LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis

LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis Luoxiang Qian, wanru Hu, Yanping Wang, YousufYousuf Abdulkarim Waheed, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4022893/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Chronic kidney disease (CKD) has been discovered to be closely associated with both long noncoding RNAs (lncRNAs) and microRNAs (miRNAs), while the precise molecular processes behind this relationship are still unclear. This study evaluated the impact of miR-542-3p and lncRNA-TUG1 on renal fibrosis, along with the regulatory mechanisms that underlie them. Through tube formation assays, in vitro research showed that TUG1 knockdown might both improve angiogenesis and heal damaged endothelial cell-cell connections. We used Western blot and q-PCR methods in the UUO model to identify tissue hypoxia and fibrotic lesions. Additionally, we employed a cutting-edge method known as fluorescence microangiography (FMA) to find damage to the peritubular capillaries (PTCs), and MATLAB software was utilized to evaluate the data. Furthermore, by looking at the coexpression of CD31 and a-SMA, we were able to identify cells in the obstructed kidney that were transitioning from endothelium tomyofibroblasts.Moreover, the reduction of tissue hypoxia brought on by lncRNA TUG1 knockdown was dramatically reversed by inhibition of miR-542-3p, which also decreased the expression levels of fibrotic indicators. To sum up, our findings offer fresh perspectives on how TUG1 and the miR-542-3p / HIF-1α / VEGF axis are regulated as renal fibrosis advances. LncRNA Taurine-upregulated gene 1 MiR-542-3p Renal fibrosis Hypoxia-inducible factor-1-alpha Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Background CKD can cause various patterns of kidney damage that ultimately result in end-stage renal failure. The final result of increasing CKD is renal fibrosis, which is characterized by tubular atrophy, extracellular matrix buildup, fibroblast proliferation and activation, and chronic inflammation[1,2]. While a number of risk factors, including smoking, diabetes, hypertension, and hyperuricemia, can be controlled with lifestyle modifications or symptom-based therapy, there hasn't been much success in developing efficient treatments to halt the course of chronic kidney disease.To create such medications, one must have a deep grasp of the cellular and molecularmechanisms underlying chronic kidney disease. A diverse family of lengthy [>200 nucleotides] transcripts lacking the ability to code for proteins are known as lncRNA[3,4].It is clear that lncRNA perform a variety of biological roles, and abnormal expression of these transcripts has been linked to a range of clinical conditions, such as cancer, metabolic, and cardiovascular disorders[5–7]. Recent research indicates that lncRNA might be important players in the aetiology of renal disorders[8,9]. LncRNA has been shown to have the ability to stimulate renal interstitial fibrosis. Imai K et al. have demonstrated that lnc-CHAF1B-3 causes renal interstitial fibrosis by controlling genes linked to epithelial-mesenchymal transition in renal proximal tubular cells[10]. Additionally, study by DuanYR et al. shows that LncRNA lnc-ISG20 causes renal fibrosis in diabetic nephropathy through miR-486-5p/NFAT5-mediated AKT phosphorylation[11]. It was recently discovered that TUG1 is linked to renal disorders. TUG1 knockdown reduces acute kidney injury in ischemia-reperfusion patients by binding to miR-29 and silencing PTEN, as shown by Xu et al[12].Uncertainty exists regarding the precise mechanism by which TUG1 alters the progression of CKD. MicroRNAs (miRNAs), small noncoding RNAs, regulate gene expression by targeting specific mRNAs. A growing body of research indicates that miR-542-3p plays a crucial role in the development and progression of renal disorders[13,36]. Jue Lia et al. found that miR-542-3p exacerbates renal tubular interstitial fibrosis[14]. Bioinformatics studies suggest a potential interaction between TUG1 and miR-542-3p, although this relationship has not been previously documented. Therefore, we hypothesize that TUG1 may regulate the onset and progression of renal fibrosis through the modulation of miR-542-3p. A large amount of clinical data shows that the number of peritubular capillaries around the renal tubules in CKD patients is significantly less compared to normal individuals. When the density of the small capillaries in the kidneys decreases, it exacerbates tissue hypoxia within the microcirculation, leading to heightened damage in renal interstitial fibrosis[15].The renal tubular epithelium's cells dedifferentiate and take on the characteristics of mesenchymal cells when exposed to hypoxia (epithelial to mesenchymal transition).Hypoxia-inducible factor-1-alpha (HIF-1α)-mediated pathway activation, which is triggered in hypoxic conditions, is another mechanism that promotes fibrosis. Excessive activation of this system leads to the production of growth factors that support vascular development to increase oxygen delivery, stimulate cell survival in hypoxic environments, and boost fibroblast proliferation[16]. According to Chen et al., when renal obstruction is present, HIF-1α expression rises noticeably, which lowers the vascular density around the renal tubules[17]. Despite the importance of the HIF-1α in vascular remodeling, the molecular mechanisms underlying vascular remodeling in RIF have not been completely understood. Here, we looked at the potential role and underlying mechanisms of lncRNA linked to the onset of renal fibrosis. Overall, we found that TUG1 knockdown might reduce renal fibrosis by sponging miR-542-3p and controlling the HIF-1α pathway, which in turn increased the level of vascular endothelial growth factor(VEGF). This finding offers a possible new target for renal fibrosis treatment. 2 Materials and methods 2.1 Ethics statement Every procedure was carried out in compliance with the applicable rules and regulations. 2.1 Cell culture HUVECs were cultivated at 37°C in a humidified environment with 5% CO2 in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. Every one to two days, the culture media was changed, and cells that were 85–90% confluent were passaged at a confluence ratio of 1:3. In every experiment, the cells were employed between passages two and five. 2.2 Cell transfection The GenePharma Company (Suzhou, China) developed a lentivirus vector plasmid system containing the sh-TUG1 gene(sh-TUG1:CCATCTCACAAGGCTTCAA), which was labeled with a green fluorescent protein (GFP). HUVECs were transfected with the lentivirus vectors using standard procedures, with an MOI=10 considered the most suitable. The expression and detection of GFP were performed on 1, 2, and 3 days after the transfection with the lentiviral vector. In order to obstruct miR-542-3p, Genepharma Company (Suzhou, China) supplied siRNA against miR-542-3p (named as si-miR-542-3p: UUUCAGUUAUCAAUCUGUCACA).The oe-TUG1 group represents a TUG1 overexpression group, while the oe-NC group was transfected with an empty plasmid. As directed by the manufacturer, cell transfection was carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). 2.3 Animal models Thirty-six male C57/C mice, weighing between 18 and 22 grammes and aged between 6 and 8 weeks, were acquired from Xuzhou Medical University's Laboratory Animal Centre in Jiangsu, China. After a week of acclimatization, the mice were split into four groups at random, each consisting of 16 mice: the sham group, the UUO group, the sh-TUG1 transfected group(sh-TUG1 group), and the equivalent negative controls (sh-NC group) that received an identical dosage of transfection.The sh-TUG1 lentivirus or empty virus injections (5 nmol/g/day) were administered via the tail vein for three consecutive days before the surgery in sh-TUG1 group and sh-NC group. To build the UUO model, a left abdominal incision was done and the mice were given a chloral hydrate anesthesia. After ligating the left ureter with a 4-0 silk suture, the incision was layer-closed. The left ureter was not clamped during the comparable left abdominal incision performed on the sham group. On the seventh day following surgery, mice from all four groups were slaughtered. The left kidneys of the mice were then extracted and rinsed with saline solution. While the remaining kidney was held at -80 °C for PCR and Western blot analysis later on, a portion was kept in 10% formaldehyde for morphological and immunofluorescence labeling. 2.4 Tube formation assay Tube formation was carried out according to the method previously explained[18]. To summarize, a 96-well plate containing 50 μl of growth factor-reduced Matrigel TM (BD, USA) was seeded with endothelial cells (1 × 104) and incubated for 24 hours at 37 °C to enable tube stability. A computer-assisted microscope (OLYMPUS, JAPAN) was used to count the total number of tube loops in five different microscopic fields at random. 2.5 Hematoxylin and Eosin Staining The kidney tissues of mice were fixed in 4% paraformaldehyde (Sigma) and subsequently embedded in paraffin. After dewaxing in xylene and rehydrating with a decreasing series of alcohol, 5-μm-thick slices were taken from the paraffin-embedded tissues. Following that, the tissue sections were stained for five minutes with hematoxylin and three minutes with eosin solution. The sections were stained, dehydrated with graded ethanol, and then cleaned in xylene. Ultimately, the tissue sections were examined under an Olympus microscope in order to do additional investigation. 2.6 Masson Staining Standard deparaffinization was performed on the kidney tissue slices, and Masson's Trichrome Stain Kit was used, adhering to the manufacturer's recommendations for staining. After that, the stained slices were examined at a 200x magnification using an optical microscope (Olympus). Blue dye was applied to the regions that showed collagen fibers. The National Institutes of Health (NIH) ImageJ program was used to examine the pictures. The total area of fibrotic lesions was computed for randomly chosen fields of view and reported as a percentage of the full picture. 2.7 FMA FMA was conducted as stated earlier [34] . The mice were sedated with chloral hydrate (10.0%, 0.003 ml/g intraperitoneally), and then placed on a surgical heating pad that was set to 37 °C. From the symphysis pubis to the jugulum, the abdomen was sliced in the middle. Using the method described by Rafael Kramann et al., all solutions were heated to 41 °C. A venous needle was used to inject one milliliter each of 3 M KCl and heparinized saline into the pounding left ventricle. The mouse was then given a right atrial cut, into which 10 ml of 41 °C prewarmed PBS and 5 ml of the agarose-microbead combination (500 ml 0.02 mm FluoSpheres + 4.5 ml 1% agarose/mouse) were perfused.The kidneys were gently removed and put in a small beaker covered by ice for 10 minutes. Afterward, the kidneys were fixed in 4% paraformaldehyde on ice for 2 hours, followed by overnight incubation in 30% sucrose in PBS at 4 °C. Following cryosectioning into 10 μm slices, the implanted kidneys were placed on Superfrost slides. The sections were treated with 49,6-diamidino-2-phenylindole, stained, and then mounted in ProLong Gold (Life Technologies) after being rinsed in PBS for a predetermined period of time. To prepare sections for immunofluorescence staining, PBS washed them for five minutes, and then they were incubated for one hour at room temperature with 5% donkey serum in PBS containing 0.3% Triton-X-100. Next, they were incubated for eight hours at 4 °C with anti-VE-cadherin antibody (1:200, ab33168, abcam), anti-alpha smooth muscle actin mouse antibody (1:200, ab7817,abcam), and rabbit anti-CD31 rabbit antibody (1:200, ab28364,abcam). The Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher) were employed on the sections in the experiment. After that, the sections were incubated for two hours at room temperature. The tissue slices were then mounted using Invitrogen's ProLong Gold Antifade reagent (18255385). Our tool of choice for viewing the images was a confocal laser microscope (FV1000; Olympus, Tokyo, Japan).In addition, VE-cadherin antibody (1:200, ab33168, abcam) was used for an 18-hour incubation period at 4 °C. We then incubated the sections at room temperature for two hours using the Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and the Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher). ProLong Gold Antifade reagent (18255385, Invitrogen) was once more used to mount the tissue slices.Lastly, each image was seen using a confocal laser microscope (Leica, Germany). 2.8 Quantitative RT-PCR The RNeasy kit (Takara，Japan) was utilized to extract RNA from entire tissue samples, followed by a ABIPRISM 7300 Sequence Detection System quantitative RT-PCR analysis. The reaction was composed of complemental DNA template, iTaq SYBR Green Supermix (with ROX, Takara, Japan), and gene-tailored primers ( Table 1). Conditions for the PCR were two minutes at 50 °C, ten minutes at 95 °C, and forty cycles of 30 seconds at 95 °C, 45 seconds at 60 °C, and 30 seconds at 72 °C. As an internal control, GADPH was employed for benchmarking. Following PCR, cycle threshold values were established for GADPH and the other particular genes. The normalized fold expression for each gene was computed using the 2-ΔΔCT technique and published. 2.9 Western blotting The kidney tissue was lysed in a 100:1 mixture of RIPA and PMSF and allowed to stand on ice for half an hour. After that, the resultant solution was spun for 15 minutes at 12,000 rpm while being maintained at 4 °C. Roughly 150 μg of total protein was loaded onto 10% or 12% SDS polyacrylamide gels and then electroblotted onto a PVDF membrane after the proteins were heated in boiling water for five minutes. After treating the membrane with 3% BSA for an hour at room temperature, it was incubated with primary antibodies targeting TGF-β1, α-SMA, VEGF, HIF1-α, and VE-cadherin for an overnight period at 4 °C. Each primary antibody was diluted at a ratio of 1:1000 or 1:200 to prevent non-specific binding. After that, another round of incubation was conducted using ECL secondary antibodies. Ultimately, the ImageQuant LAS 4000 mini was used to identify the signal, and beta actin was used to quantify it. 2.10 FISH To find out where TUG1 is in the cell, we performed a technique called fluorescence in situ hybridization (FISH). We used special probes labeled with fluorescein, made by GenePharma in Suzhou, China, to target TUG1. First, we fixed HUVECs with a solution of 4% paraformaldehyde, then we exposed them to a solution that helped make them more permeable. After blocking any unwanted interactions, we added the TUG1 probes and let them bind with the RNA overnight in the absence of light. To visualize the results, we stained the cell nuclei with DAPI and used a confocal laser microscope to scan for fluorescence signals. 3 Results 3.1 TUG1 expression was markedly elevated in renal fibrosis both in vivo and in vitro. Initially, we assessed the expression levels of TUG1 in human umbilical vein endothelial cells (HUVECs) before delving into its functional implications. When compared to the corresponding normoxic group, the data unequivocally revealed a marked increase in TUG1 levels within the hypoxic group. (Figure 1A) Subsequently, we examined the expression levels of TUG1 in renal tissue. Upon comparison with the sham-operated group, the findings indicated a noticeable overexpression of TUG1 in the unilateral ureteral obstruction (UUO) group.(Figure. 1B) 3.2 Lentivirus vector production. GenePharma, a biotechnology firm based in Suzhou, China, has engineered a lentiviral vector plasmid system that includes the sh-TUG1 gene, which is distinctively tagged with a green fluorescent protein (GFP). Human umbilical vein endothelial cells (HUVECs) were subjected to transfection with these lentiviral vectors, following standard protocols, with a multiplicity of infection (MOI) of 10 determined to be the optimal dosage. The expression and detection of GFP were monitored at intervals of 1, 2, and 3 days post-transfection. Remarkably, by the third day, approximately 80% of the HUVECs exhibited GFP expression, as evidenced by the characteristic green fluorescence.(Figure 1C) 3.3 Capillary-like development is regulated by LncRNA TUG1 in vitro. To evaluate the capacity of human umbilical vein endothelial cells (HUVECs) to form a well-organized tubular network, a tube formation assay utilizing Matrigel was conducted. (Figure.1D,E) In this segment, Figure 1E revealed that the inhibition of TUG1 facilitated the impaired tube formation following a 12-hour hypoxic exposure. These observations underscore the pivotal role of lncRNA TUG1 in the angiogenesis process. 3.4 LncRNA TUG1 regulates endothelial junctions in vitro. Specifically, vascular endothelial cadherin (VE-cadherin) is emblematic for the assembly and structural design of endothelial connections. In the normoxia group, HUVECs consistently expressed VE-cadherin during their interactions, maintaining a continuous pattern. In contrast, the hypoxia group exhibited a sawtooth distribution of VE-cadherin expression, indicative of a lack of tight junctions. Over a 12-hour hypoxic period, VE-cadherin proteins, which are typically found throughout the cell membrane, became dispersed, extending into the nucleus and cytoplasm. In comparison to endothelial cells cultured under hypoxic conditions, the sh-TUG1 group displayed an enhanced VE-cadherin expression at cell-cell contact sites and a tendency towards a more typical endothelial cell morphology. (Figure.1F) 3.5 TUG 1 knockdown prevented hypoxia-induced renal fibrosis in vitro. The aim of our research was to investigate the impact of TUG1 on renal fibrosis under hypoxic conditions. Post-transfection, RT-qPCR analysis confirmed the successful attenuation of LncRNA TUG1 levels in HUVECs following sh-TUG1 treatment. (Figure. 1G) Further analysis employing Western blotting techniques demonstrated that the suppression of TUG1 mitigated the hypoxia-induced decline in VEGF protein expression, resulting in an elevation of VEGF protein levels. (Figure. 2A,B) Moreover, the levels of α-SMA, TGF-β1, and HIF-1α, which are markers affected by hypoxic treatment, were observed to increase following the repression of TUG1. (Figure. 2A,C,D,E) Collectively, these findings offer compelling evidence that the knockdown of TUG1 inhibited fibrotic characteristics by alleviating hypoxic conditions and promoting angiogenesis. 3.6 TUG1 Could Directly Target miR-542-3p. An increasing body of research suggests that lncRNAs can act as competing endogenous RNAs (ceRNAs) to regulate the expression of specific genes. Consequently, we focused on miRNAs as potential targets of lncRNA TUG1. Employing bioinformatics software, we examined the binding sites between TUG1 and miR-542-3p. Figure 2I indicates that the lncRNA TUG1 transcript harbors a binding region for miR-542-3p, suggesting that miR-542-3p could be a plausible target for TUG1. Furthermore, we utilized the FISH technique, with DAPI for nuclear staining and CY3 to visualize the cytoplasmic positive 18S rRNA and TUG1 lncRNA. (Figure.2F) The findings demonstrated that lncRNA TUG1 was found in the HUVECs' cytoplasm (Figure.2F) This evidence suggests that TUG1 is likely to interact with cytoplasmic miRNAs, hinting at its potential role in post-transcriptional regulation within the cell. Furthermore, we observed that the expression levels of miR-542-3p significantly decreased in HUVECs under hypoxic conditions, exhibiting an inverse pattern compared to TUG1 expression. RT-qPCR results also indicated that while TUG1 overexpression suppressed miR-31 expression, the knockdown of TUG1 led to an upregulation of miR-542-3p expression. (Figure. 2G,H) Consequently, our findings proved that TUG1 specifically targeted miR-542-3p. 3.7 The inhibitory effects of TUG1 knockdown on renal fibrosis were reversed in vitro by inhibition of miR-542-3p. To gain a deeper understanding of the relationship between TUG1 and miR-542-3p in the context of renal interstitial fibrosis, hypoxia-induced HUVECs were treated with sh-TUG1. The knockdown of TUG1 led to an enhancement in miR-542-3p expression, and the silencing of miR-542-3p restored the observed effects. Furthermore, the si-miR-542-3p group exhibited increased HIF-1α expression as a result of TUG1 knockdown, which was associated with a subsequent decrease in VEGF expression. However, the knockdown of miR-542-3p reversed these inhibitory effects. (Figure.2K) The findings strongly suggested that knockdown of TUG1 alleviated renal fibrosis by relieving tissue hypoxia and repairing renal microvessels by modulating miR-542-3p expression. 3.8 Renal morphology. To validate the roles of TUG1 in renal fibrosis in vivo, we established a mouse model representing the disease conditions. The renal histopathology was assessed using Masson's trichrome and hematoxylin-eosin staining techniques. (Figure.3A,B) As depicted in Figure 3A, the sham group displayed no histological abnormalities. In contrast, unilateral ureteral obstruction led to renal tubular rupture, glomerular atrophy, and increased extracellular matrix (ECM) production. However, the administration of sh-TUG1 significantly mitigated these renal pathological alterations and the accumulation of collagen compared to the sh-NC group. 3.9 EndMT is lessened by TUG1 knockdown in UUO models. Eing immunostaining to identify cells undergoing endothelial-to-mesenchymal transition (EndMT), we observed the concurrent expression of endothelial and myofibroblast markers. In the sham-operated group, samples contained both resident α-SMA+ cells and CD31+ endothelial cells; however, no cells exhibited the coexpression of these dual markers. (Figure.3C) Conversely, the obstructed kidney exhibited a decrease in CD31+ endothelial cells and the emergence of cells coexpressing both CD31 and α-SMA, indicating active EndMT in the fibrotic kidneys post-UUO. The sh-TUG1 group displayed fewer α-SMA myofibroblasts and a greater number of CD31+ endothelial cells compared to the UUO group. Furthermore, interstitial fibrosis was linked to a reduction in the presence of CD31+α-SMA+ EndMT cells. These observations suggest that a substantial portion of the fibroblasts in UUO models may originate from EndMT, and that EndMT may be suppressed by TUG1 silencing. 3.10 TUG 1 knockdown alleviate renal interstitial fibrosis. Subsequently, the in vivo influence of TUG1 on renal fibrosis was assessed. Post-transfection, RT-qPCR analysis unequivocally confirmed the successful reduction of LncRNA TUG1 levels within the kidney following sh-TUG1 treatment (Figure 4A) Further investigation using Western blotting revealed that the suppression of TUG1 mitigated the decrease in VEGF protein expression observed in the UUO kidney (Figure 4B, F) Additionally, the examination of α-SMA, TGF-β1, and HIF-1α levels, which are markers affected in the UUO kidney, demonstrated significant increases following TUG1 suppression (Figure 4B, C, D, E) Collectively, these findings provide compelling evidence that the silencing of TUG1 effectively inhibited the fibrotic characteristics observed in the UUO model. 3.11Changes in peritubular capillaries identified using FMA. We used FMA in conjunction with MATLAB analysis to determine the total areas and density of the capillaries in order to analyze the changes in peritubular capillaries within each group (Figure.4G). Comparing the blocked kidney group to the control group, the results indicated a decrease in the overall amount of perfused area and vascular density. In contrast to the UUO group and the sh-NC group, there was a notable increase in the overall area of perfusion as well as the amount of vasculature following the suppression of TUG1 expression(Figure.4H,I) Staining and quantification demonstrated a significant increase in α-SMA protein expression as compared to the sham group for both the UUO and sh-NC groups. On the other hand, as Figure 5 illustrates, TUG1 knockdown was successful in slowing the course of fibrosis. By enhancing renal microcirculation by TUG1 inhibition, our findings provide precise evidence that renal interstitial fibrosis may be lessened. 4 Discussion In the context of CKD, renal interstitial fibrosis is a critical stage that precedes end-stage renal failure[19]. Renal fibrosis is characterized by a reduction in peritubular capillaries, tissue hypoxia, activation of the epithelial-mesenchymal transition (EMT), accumulation of extracellular matrix, oxidative stress, and inflammation[20–24]. Despite its importance, the exact mechanism underlying renal fibrosis remains unknown.In our recent study, we uncovered an interesting finding regarding the role of a long non-coding RNA called TUG1 in renal fibrosis. We observed that TUG1 levels increase in response to hypoxia treatment and in a model of obstructive uropathy (UUO). Intriguingly, we found that reducing TUG1 expression alleviates renal hypoxia and microvascular damage, thereby halting the EndMT process and reducing renal fibrosis.Furthermore, we discovered that the suppression of TUG1 exerts anti-renal fibrotic effects through a signaling pathway involving the lncRNA TUG1/miR-542-3p/HIF-1α/VEGF axis. This novel insight into the molecular mechanisms of renal fibrosis could have significant implications for the development of future CKD therapies. Numerous studies have consistently demonstrated that a decline in relative blood volume and microvascular density is an early characteristic of renal fibrosis[25]. In recent years, an increasing amount of studies have found that the reduction of PTCs is strongly related to renal interstitial fibrosis[26,27].It is believed that the main factors contributing to kidney damage progression include endothelial injury in the renal medulla's capillary system, CKD patients, and the concomitant renal vascular rarefaction. Adipose-derived mesenchymal stem cells, exosomes, and beraprost sodium have all been shown by our team to have the ability to improve renal microcirculation, which in turn helps to lessen renal interstitial fibrosis[17,28,29]. PTCs diminishes local blood supply and oxygen delivery in the kidneys, which triggers endothelial cells to undergo a transformation into fibroblasts. These fibroblasts further exacerbate PTCs loss, hastening the progression of local lesions and ultimately culminating in kidney fibrosis[30,31]. In our investigations, we observed a significant upregulation of TUG1 expression in the kidneys of UUO mice and hypoxic endothelial cells. Consequently, we sought to determine whether TUG1 knockdown could alleviate renal injury by promoting microcirculation. Our findings demonstrated that TUG1 knockdown in hypoxia-treated endothelial cells stimulated the formation of capillary-like structures, surpassing the levels observed in hypoxia-treated cells without TUG1 knocking down. Furthermore, it was shown that the sh-TUG1 group had higher levels of VEGF than both the hypoxic and the sh-NC groups. These results suggested that knocking down of TUG1 facilitated the process of blood vessel formation and remodeling. Concurrently, there was a reduction in HIF-1α, TGF-β1, and α-SMA, which are important factors in fibrosis, following TUG1 knockdown. TUG1 is linked to anti-oxidative and anti-inflammatory properties.Furthermore, cell-to-cell communication is essential for preserving blood vessel integrity and homeostasis. Disruption of junctions between endothelial cells leads to an elevation in microvascular permeability. As a result, leukocytes can penetrate the interstitial compartment through endothelial cells, causing the interstitial space to enlarge and the microvasculature to compress. Thus, oxygen transport is hampered and nutrient flow is impeded. Here, VE-cadherin is especially important because of its role in barrier architecture and endothelial adherens assembly. The increased expression of VE-cadherin in our data indicated that TUG1 knockdown distorted endothelial cell-cell connections under hypoxic settings. These results demonstrate the beneficial effects of TUG1 knockdown on enhancing microcirculation in vitro, preserving renal function and mitigating fibrosis. To further investigate whether knocking down TUG1 have any effect on renal microvascular in vivo. Three days before the surgery, we injected sh-TUG1 or sh-NC into the UUO mice through the tail vein.At the moment, genetic labeling (such as Tie 2) or CD31 antigen immunostaining—which measures the surface area of endothelial cells—are used to quantify microvascular density[32]. However, the capillary lumen itself cannot be quantified. In this study, we adopt a novel method known as Fluocular Microscopy Analysis to create a microangiogram visible under a confocal laser microscope using low-melting-point agarose augmented with FluoSpheres[33]. Furthermore, the overall perfused capillary area, the count of peritubular capillaries, and the cross-sectional area and perimeter of individual capillaries should all be analyzed using MATLAB software. MATLAB scripts can be used to automatically generate analyses of the microvasculature.PTCs-positive regions, identified in this study by CD31 immunostaining, demonstrated that the PTCs in the sh-NC and UUO groups had been destroyed. In the meantime, the blocked kidneys' perfused FMA+ capillary region revealed a lack of perfusion. The increase of HIF-1α revealed that tissue hypoxia follows the rarefaction of the PTCs. According to our research, TUG1 silencing can reduce tissue hypoxia, promote an increase in PTCs density, and repair renal blood vessels. These cells have the ability to move to the interstitium, where they can develop into myofibroblasts and stimulate the synthesis of collagen and other ECM[29]. According to these findings, TUG1 knockdown may be able to reduce the severity of renal fibrosis through processes that improve hypoxic conditions and encourage angiogenesis. An increasing amount of research points to an association between ECM deposition and renal fibrosis brought on by oxidative stress and inflammation. Our prior research has revealed that obstructive kidney conditions can result in a reduction in capillary density around the renal tubules, leading to severe hypoxia. This further aggravates oxidative stress and inflammatory reactions, which eventually quickens the development of renal fibrosis as a reaction to kidney injury[28,29]. Inflammation and oxidative stress can cause renal endothelial cells and tubular epithelial cells to undergo apoptosis[37], which can then cause EndMT and EMT and ultimately promote the deposition of extracellular matrix[1]. Moreover, during UUO-induced renal interstitial fibrosis, the overproduction of ROS causes a decrease in mitochondrial respiratory chain activity, which in turn activates EndMT and EMT[34]. Confocal imaging in chronic kidney illness demonstrated immunestaining-capable endothelial cells undergoing EndMT, implying that damaged endothelium cells may differentiate into myofibroblasts. In the renal interstitium, there was less colocalization of a-SMA+ myofibroblasts and CD31+ endothelial cells, indicating that TUG1 knockdown suppressed the EndMT process. According to our results, TUG1 knockdown may reduce tissue hypoxia-induced EndMT. LncRNA-miRNA interactions are thought to be crucial for a number of biological processes and diseases[35]. Growing data indicates that lncRNAs may compete with miRNAs as ceRNAs and contribute to the development of many disorders. We also verified that TUG1 directly regulated miR-542-3p.According to Liu et al., lncRNA TUG1 may bind miR-542-3p competitively to control the expression of TRIB2, as well as decrease the growth, migration, invasion, and proliferation of colorectal cancer cells while promoting apoptosis[14]. We concentrated on the target miRNAs of LncRNA TUG1 in renal fibrosis in order to investigate its mechanism. By online databases (starbase) prediction, miR-542-3p was chosen for further study for being a kidney diseases-related miRNA. Furthermore, bioinformatics study was used to identify binging locations between miR-542-3p and TUG1.Our research showed that knocking down TUG1 enhanced the expression of miR-542-3p in hypoxic circumstances.In order to further validate the connection between TUG1 and miR-542-3p, we established an model in vitro hypoxia. As compared to the si-NC+sh-TUG1 group, the si-miR-542-3p+sh-TUG1 group exhibited a little uptick in HIF-1α expression, while VEGF expression decreased. The outcome validates that TUG1 influences the advancement of renal fibrosis by means of the miR-542-3p/HIF-1α/VEGF axis. 5 Conclusions In summary, we demonstrated that knockdown of TUG1 could restore damaged peritubular capillaries, accompanied by alleviating renal hypoxia, ultimately relieving EndMT process(Figure.6). These findings offer fresh perspectives on the ways in which TUG1 and miR-542-3p/HIF-1α/VEGF, which may represent a potential therapeutic target for CKD, contribute to the anti-fibrotic impact. Declarations Ethical Approval and Consent to participat e The Xuzhou Medical University's Ethics Committee for Animal Research approved the protocols used for all animal research(Approval No. L20210226432). Competing Interest information All authors declare no competing interests. Founding This study was supported by funding from the National Natural Science Foundation of China (82270731, 82000703); the Jiangsu Provincial Natural Science Foundation (BK20211054); the Jiangsu Provincial Commission of Health and Family Planning (2016103003, H201628); Science and technology development fund of Affiliated Hospital of Xuzhou Medical University (XYFC2020001; XYFY2020038); Xuzhou Basic Research Program (KC22042); Xuzhou key R & D Program(Social Development) (KC20160); Xuzhou Medical leadingTalent training Project (XWRCHT20210038). References H. Fu, Y. Tian, L. Zhou, D. Zhou, R.J. Tan, D.B. Stolz, Y. Liu, Tenascin-C Is a Major Component of the Fibrogenic Niche in Kidney Fibrosis, JASN 28 (2017) 785–801. https://doi.org/10.1681/ASN.2016020165. G. Campanholle, G. Ligresti, S.A. Gharib, J.S. Duffield, Cellular Mechanisms of Tissue Fibrosis. 3. Novel mechanisms of kidney fibrosis, American Journal of Physiology-Cell Physiology 304 (2013) C591–C603. https://doi.org/10.1152/ajpcell.00414.2012. T. Ali, P. Grote, Beyond the RNA-dependent function of LncRNA genes, eLife 9 (2020) e60583. https://doi.org/10.7554/eLife.60583. J. Cable, E. Heard, T. Hirose, K.V. Prasanth, L. Chen, J.E. Henninger, S.A. Quinodoz, D.L. Spector, S.D. Diermeier, A.M. Porman, D. Kumar, M.W. Feinberg, X. Shen, J.P. Unfried, R. Johnson, C. Chen, J.E. Wilusz, A. Lempradl, S.E. McGeary, L. Wahba, A.M. Pyle, A.E. Hargrove, M.D. Simon, M. Marcia, R.K. Przanowska, H.Y. Chang, S.R. Jaffrey, L.M. Contreras, Q. Chen, J. Shi, J.T. Mendell, L. He, E. Song, J.L. Rinn, M.K. Lalwani, M.C. Kalem, E.B. Chuong, L.E. Maquat, X. Liu, Noncoding RNAs: biology and applications—a Keystone Symposia report, Annals of the New York Academy of Sciences 1506 (2021) 118–141. https://doi.org/10.1111/nyas.14713. Y.-H. Lin, Crosstalk of lncRNA and Cellular Metabolism and Their Regulatory Mechanism in Cancer, IJMS 21 (2020) 2947. https://doi.org/10.3390/ijms21082947. Y. Tan, J. Lin, T. Li, J. Li, R. Xu, H. Ju, LncRNA‐mediated posttranslational modifications and reprogramming of energy metabolism in cancer, Cancer Communications 41 (2021) 109–120. https://doi.org/10.1002/cac2.12108. S. Uchida, S. Dimmeler, Long Noncoding RNAs in Cardiovascular Diseases, (n.d.). H.J. Jung, H.-J. Kim, K.-K. Park, Potential Roles of Long Noncoding RNAs as Therapeutic Targets in Renal Fibrosis, IJMS 21 (2020) 2698. https://doi.org/10.3390/ijms21082698. Y. Pan, X. Lu, G. Shu, J. Cen, J. Lu, M. Zhou, K. Huang, J. Dong, J. Li, H. Lin, H. Song, Q. Xu, H. Han, Z. Chen, W. Chen, J. Luo, J. Wei, J. Zhang, Extracellular Vesicle-Mediated Transfer of LncRNA IGFL2-AS1 Confers Sunitinib Resistance in Renal Cell Carcinoma, Cancer Research 83 (2023) 103–116. https://doi.org/10.1158/0008-5472.CAN-21-3432. K. Imai, T. Ishimoto, T. Doke, T. Tsuboi, Y. Watanabe, K. Katsushima, M. Suzuki, H. Oishi, K. Furuhashi, Y. Ito, Y. Kondo, S. Maruyama, Long non-coding RNA lnc-CHAF1B-3 promotes renal interstitial fibrosis by regulating EMT-related genes in renal proximal tubular cells, Molecular Therapy - Nucleic Acids 31 (2023) 139–150. https://doi.org/10.1016/j.omtn.2022.12.011. Y. Duan, B. Chen, F. Chen, S. Yang, C. Zhu, Y. Ma, Y. Li, J. Shi, LncRNA lnc‐ISG20 promotes renal fibrosis in diabetic nephropathy by inducing AKT phosphorylation through miR‐486‐5p/NFAT5, J Cellular Molecular Medi 25 (2021) 4922–4937. https://doi.org/10.1111/jcmm.16280. Z. Xu, X. Huang, Q. Lin, W. Xiang, Long non-coding RNA TUG1 knockdown promotes autophagy and improves acute renal injury in ischemia-reperfusion-treated rats by binding to microRNA-29 to silence PTEN, BMC Nephrol 22 (2021) 288. https://doi.org/10.1186/s12882-021-02473-0. Q. Xiao, Y. Tang, H. Luo, S. Chen, R. Chen, Z. Yan, L. Pu, L. Wang, G. Li, Y. Li, Sclerostin is involved in osteogenic transdifferentiation of vascular smooth muscle cells in chronic kidney disease-associated vascular calcification with non-canonical Wnt signaling, Renal Failure 44 (2022) 1427–1443. https://doi.org/10.1080/0886022X.2022.2114370. Q. Liu, W. Zhang, L. Luo, K. Han, R. Liu, S. Wei, X. Guo, Long noncoding RNA TUG1 regulates the progression of colorectal cancer through miR-542-3p/TRIB2 axis and Wnt/β-catenin pathway, Diagn Pathol 16 (2021) 47. https://doi.org/10.1186/s13000-021-01101-7. Y. Shi, B. Li, X. Huang, W. Kou, M. Zhai, Y. Zeng, S. You, Q. Yu, Y. Zhao, J. Zhuang, W. Peng, W. Jian, Loss of TET2 impairs endothelial angiogenesis via downregulating STAT3 target genes, Cell Biosci 13 (2023) 12. https://doi.org/10.1186/s13578-023-00960-5. B. Nath, G. Szabo, Hypoxia and hypoxia inducible factors: Diverse roles in liver diseases, Hepatology 55 (2012) 622–633. https://doi.org/10.1002/hep.25497. L. Chen, Y. Wang, S. Li, B. Zuo, X. Zhang, F. Wang, D. Sun, Exosomes derived from GDNF-modified human adipose mesenchymal stem cells ameliorate peritubular capillary loss in tubulointerstitial fibrosis by activating the SIRT1/eNOS signaling pathway, Theranostics 10 (2020) 9425–9442. https://doi.org/10.7150/thno.43315. K. Takeshita, M. Satoh, M. Ii, M. Silver, F.P. Limbourg, Y. Mukai, Y. Rikitake, F. Radtke, T. Gridley, D.W. Losordo, J.K. Liao, Critical Role of Endothelial Notch1 Signaling in Postnatal Angiogenesis,Circulation Research 100 (2007) 70–78. https://doi.org/10.1161/01.RES.0000254788.47304.6e. B.D. Humphreys, Mechanisms of Renal Fibrosis, Annu. Rev. Physiol. 80 (2018) 309–326. https://doi.org/10.1146/annurev-physiol-022516-034227. Y. Han, S. Tang, Y. Liu, A. Li, M. Zhan, M. Yang, N. Song, W. Zhang, X. Wu, C. Peng, H. Zhang, S. Yang, AMPK agonist alleviate renal tubulointerstitial fibrosis via activating mitophagy in high fat and streptozotocin induced diabetic mice, Cell Death Dis 12 (2021) 925. https://doi.org/10.1038/s41419-021-04184-8. Y. Liu, Cellular and molecular mechanisms of renal fibrosis, Nat Rev Nephrol 7 (2011) 684–696. https://doi.org/10.1038/nrneph.2011.149. S. Lovisa, V.S. LeBleu, B. Tampe, H. Sugimoto, K. Vadnagara, J.L. Carstens, C.-C. Wu, Y. Hagos, B.C. Burckhardt, T. Pentcheva-Hoang, H. Nischal, J.P. Allison, M. Zeisberg, R. Kalluri, Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis, Nat Med 21 (2015) 998–1009. https://doi.org/10.1038/nm.3902. S. Panizo, L. Martínez-Arias, C. Alonso-Montes, P. Cannata, B. Martín-Carro, J.L. Fernández-Martín, M. Naves-Díaz, N. Carrillo-López, J.B. Cannata-Andía, Fibrosis in Chronic Kidney Disease: Pathogenesis and Consequences, IJMS 22 (2021) 408. https://doi.org/10.3390/ijms22010408. B. Yang, S. Lan, M. Dieudé, J.-P. Sabo-Vatasescu, A. Karakeussian-Rimbaud, J. Turgeon, S. Qi, L. Gunaratnam, N. Patey, M.-J. Hébert, Caspase-3 Is a Pivotal Regulator of Microvascular Rarefaction and Renal Fibrosis after Ischemia-Reperfusion Injury, JASN 29 (2018) 1900–1916. https://doi.org/10.1681/ASN.2017050581. J. Bábíčková, B.M. Klinkhammer, E.M. Buhl, S. Djudjaj, M. Hoss, F. Heymann, F. Tacke, J. Floege, J.U. Becker, P. Boor, Regardless of etiology, progressive renal disease causes ultrastructural and functional alterations of peritubular capillaries, Kidney International 91 (2017) 70–85. https://doi.org/10.1016/j.kint.2016.07.038. S. Li, F. Wang, D. Sun, The renal microcirculation in chronic kidney disease: novel diagnostic methods and therapeutic perspectives, Cell Biosci 11 (2021) 90. https://doi.org/10.1186/s13578-021-00606-4. F. Zhu, H. Li, T. Long, M. Zhou, J. Wan, J. Tian, Z. Zhou, Z. Hu, J. Nie, Tubular Numb promotes renal interstitial fibrosis via modulating HIF-1α protein stability, Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1867 (2021) 166081. https://doi.org/10.1016/j.bbadis.2021.166081. S. Li, Y. Wang, L. Chen, Z. Wang, G. Liu, B. Zuo, C. Liu, D. Sun, Beraprost sodium mitigates renal interstitial fibrosis through repairing renal microvessels, J Mol Med 97 (2019) 777–791. https://doi.org/10.1007/s00109-019-01769-x. S. Li, Y. Wang, Z. Wang, L. Chen, B. Zuo, C. Liu, D. Sun, Enhanced renoprotective effect of GDNF-modified adipose-derived mesenchymal stem cells on renal interstitial fibrosis, Stem Cell Res Ther 12 (2021) 27. https://doi.org/10.1186/s13287-020-02049-z. B.J. Ballermann, M. Obeidat, Tipping the balance from angiogenesis to fibrosis in CKD, Kidney International Supplements 4 (2014) 45–52. https://doi.org/10.1038/kisup.2014.9. Y.-A. Lu, C.-T. Liao, R. Raybould, B. Talabani, I. Grigorieva, B. Szomolay, T. Bowen, R. Andrews, P.R. Taylor, D. Fraser, Single-Nucleus RNA Sequencing Identifies New Classes of Proximal Tubular Epithelial Cells in Kidney Fibrosis, JASN 32 (2021) 2501–2516. https://doi.org/10.1681/ASN.2020081143. T. Liu, W. Ma, H. Xu, M. Huang, D. Zhang, Z. He, L. Zhang, S. Brem, D.M. O’Rourke, Y. Gong, Y. Mou, Z. Zhang, Y. Fan, PDGF-mediated mesenchymal transformation renders endothelial resistance to anti-VEGF treatment in glioblastoma, Nat Commun 9 (2018) 3439. https://doi.org/10.1038/s41467-018-05982-z. R. Kramann, M. Tanaka, B.D. Humphreys, Fluorescence Microangiography for Quantitative Assessment of Peritubular Capillary Changes after AKI in Mice, Journal of the American Society of Nephrology 25 (2014) 1924–1931. https://doi.org/10.1681/ASN.2013101121. S. Zhang, X. Tan, Y. Chen, X. Zhang, Postconditioning protects renal fibrosis by attenuating oxidative stress-induced mitochondrial injury, Nephrology Dialysis Transplantation 32 (2017) 1628–1636. https://doi.org/10.1093/ndt/gfw469. X. Zhang, W. Wang, W. Zhu, J. Dong, Y. Cheng, Z. Yin, F. Shen, Mechanisms and Functions of Long Non-Coding RNAs at Multiple Regulatory Levels, IJMS 20 (2019) 5573. https://doi.org/10.3390/ijms20225573. Marin DE, Braicu C, Dumitrescu G, et al. MicroRNA profiling in kidney in pigs fed ochratoxin A contaminated diet. Ecotoxicol Environ Saf. 2019;184:109637. doi:10.1016/j.ecoenv.2019.109637 Chen JF, Wu QS, Xie YX, et al. TRAP1 ameliorates renal tubulointerstitial fibrosis in mice with unilateral ureteral obstruction by protecting renal tubular epithelial cell mitochondria. FASEB J. 2017;31(10):4503-4514. doi:10.1096/fj.201700283R Table Table 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files table.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4022893","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":279071013,"identity":"496344a6-5946-4784-a77b-0898327dd479","order_by":0,"name":"Luoxiang Qian","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Luoxiang","middleName":"","lastName":"Qian","suffix":""},{"id":279071014,"identity":"a19ed3c7-bbee-43f4-92e0-84d68782d606","order_by":1,"name":"wanru Hu","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"wanru","middleName":"","lastName":"Hu","suffix":""},{"id":279071015,"identity":"8dafe8a2-8325-4475-a74c-01877cfb8649","order_by":2,"name":"Yanping Wang","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanping","middleName":"","lastName":"Wang","suffix":""},{"id":279071016,"identity":"b06aae62-8965-48c0-a17e-48b534ce48b4","order_by":3,"name":"YousufYousuf Abdulkarim Waheed","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"YousufYousuf","middleName":"Abdulkarim","lastName":"Waheed","suffix":""},{"id":279071017,"identity":"13f84ea3-d414-4be7-986a-cdc4dc615c72","order_by":4,"name":"Shuqun Hu","email":"","orcid":"","institution":"Laboratory of Emergency Medicine, Second Clinical Medical College of Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shuqun","middleName":"","lastName":"Hu","suffix":""},{"id":279071020,"identity":"2b2edba1-2fd4-4e97-a06a-a3b4da9d6fbd","order_by":5,"name":"Dong Sun","email":"","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Sun","suffix":""},{"id":279071023,"identity":"d34024cd-e199-4d2d-89bb-7c2fe3bdf140","order_by":6,"name":"Shulin Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYBACfmb2g49//pFgZmxvIFKLZHtPsjFjgw07c88BIrUY9Bwwk2ZsSONnn5FArBaJhDTpwh2HpXlnPt54g6HGJpqgFnOJxMPWM88cNpacnVZswXAsLbeBkBbLGQmJN3jYDicbzs4xk2BsOExYi8GNBAMJoJb6/TfPEKvlzAEjad62NGbGGTxEagEFsuGMMzbMjD1AvyQQ4xdQVD74UAGKysMbb3yosSGsBcWREgmkKIdoIVXHKBgFo2AUjAwAACg3QiKwrnBmAAAAAElFTkSuQmCC","orcid":"","institution":"Affiliated Hospital of Xuzhou Medical University, Xuzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Shulin","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-03-07 04:45:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4022893/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4022893/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52757278,"identity":"139bb7d9-b7cd-4b3b-a527-b28f60057c77","added_by":"auto","created_at":"2024-03-15 11:58:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1160029,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of TUG1 was significantly upregulated in renal fibrosis in vivo and in vitro. Lentivirus vector production.LncRNA TUG1 regulates capillary-like formation in vitro.LncRNA TUG1 regulates endothelial junctions in vitro.(A and B)Relative expression levels of TUG1 in HUVECs and kidney.（C）HUVECs were plastic-adherent, with fibroblastic morphology. Fluorescence expression of lentiviral vector in sh-TUG1-transfected HUVECs at 72 hours. Approximately 80% of HUVECs expressed the GFP gene 72 hours after transfection, as indicated by the green fluorescence. Scale bar: 100 μm. (D and E) Representative images and quantification of human umbilical vein endothelial cell (HUVEC) tube formation in different treatment groups.Scale bar: 100 μm. (F) Ariations in VE-cadherin(red) distribution and expression across distinct groups. Nuclei were stained with DAPI (blue). Scale bar: 50 μm.G Relative expression levels of TUG1 in different groups. *p\u0026lt; 0.05; **p \u0026lt; 0.01; ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/4f8981d7e14afeb5fce197db.png"},{"id":52757797,"identity":"e027f976-dcfb-40c1-8843-5cc5857eda18","added_by":"auto","created_at":"2024-03-15 12:06:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":731302,"visible":true,"origin":"","legend":"\u003cp\u003eLncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis (A) Representative Western blot image of VEGF、TGF-β、α-sma and HIF-1α protein expression in endothelial cells. GAPDH was used as the loading control. (B C D and E)Analysis of protein levels of VEGF、TGF-β、α-sma and HIF-1α. (F) FISH assay of TUG1 in HUVECs without any treatment. Scale bars: 100μm. (G and H)Relative expression levels of miR-542-3p in HUVECs..Scale bar: 100 μm.（I）The predicted binding sites between TUG1 and miR-542-3p by bioinformatics analysis; the predicted binding sites between miR-542-3p and HIF-1αby bioinformatics analysis. （J）Representative Western blot image of VEGF and HIF-1α protein expression in endothelial cells. GAPDH was used as the loading control. (K and L) Analysis of protein levels of VEGF and HIF-1α*\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/00758a6decbc2d981af10cb8.png"},{"id":52757798,"identity":"cf02fdec-d967-4ba2-9466-109020c23122","added_by":"auto","created_at":"2024-03-15 12:06:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1964735,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown TUG1 improves the morphology of renal histology and inhibits EndMT progression in the obstructed kidney. (A)Representative micrographs of hematoxylin eosin and Masson’s trichrome demonstrate histological changes in the four groups. Bar = 50 μm. (B)Quantitative analysis of tubulointerstitial fibrosis in the kidney cortex. C The coexpression of α-SMA（red）and CD31 （green) in each group.Nuclei were stained with DAPI in blue.*\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/c2cbcafc563514ce22636214.png"},{"id":52757282,"identity":"9212e1b7-9e03-4a6c-a688-e13acf37dd1a","added_by":"auto","created_at":"2024-03-15 11:58:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":990041,"visible":true,"origin":"","legend":"\u003cp\u003eTUG 1 knockdown alleviate renal interstitial fibrosis.(A) Relative expression levels of TUG1 in different groups. (B) Representative Western blot image of VEGF、TGF-β、α-sma and HIF-1α protein expression in vivo. GAPDH was used as the loading control. (C D Eand F) Analysis of protein levels of VEGF、TGF-β;α-sma and HIF-1α.(G) FMA after unilateral ureteral obstruction (UUO) surgery in mice treated with knock downTUG1(sh-TUG1), empty vector (sh-NC), or phosphate-buffered saline (PBS), together with CD31 immunostaining, demonstrated capillary rarefaction in response to the severity of the injury. Capillaries with red CD31+ endothelial cells surrounding the green FMA solution; blue: DAPI. The scale bars represent 20 μm (H and I) Quantitative analysis of the total cortical cross-sectional capillary area and capillary number per high-power field.*\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/add9799f87bc26767d07b998.png"},{"id":52757281,"identity":"90d81bba-6042-4669-a366-c876823094d0","added_by":"auto","created_at":"2024-03-15 11:58:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1312078,"visible":true,"origin":"","legend":"\u003cp\u003eα-smooth muscle actin (α-SMA) staining and quantification revealed the induction of interstitial fibrosis. Green: fluorescence microangiography, red: α-SMA, blue: DAPI. The results are expressed as the means ± SEMs of fourdifferent experiments. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/ddb56a43715d76b21670d0c5.png"},{"id":52757279,"identity":"05b89677-29b2-4a79-8bac-83099948e12d","added_by":"auto","created_at":"2024-03-15 11:58:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":739157,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic of the LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/4f023fd6d1385511376edfa4.png"},{"id":53315047,"identity":"71a515f1-c58a-493c-9268-4f6db6545709","added_by":"auto","created_at":"2024-03-23 17:38:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6529436,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/3f7f2f1c-04b2-43a8-8217-c96f25c75447.pdf"},{"id":52757280,"identity":"b7f89f12-f5fc-411b-bd13-ba393a3a7fc3","added_by":"auto","created_at":"2024-03-15 11:58:17","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":457154,"visible":true,"origin":"","legend":"","description":"","filename":"table.docx","url":"https://assets-eu.researchsquare.com/files/rs-4022893/v1/ed7798915412d20e8c90edcb.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis","fulltext":[{"header":"1 Background","content":"\u003cp\u003eCKD can cause various patterns of kidney damage that ultimately result in end-stage renal failure. The final result of increasing CKD is renal fibrosis, which is characterized by tubular atrophy, extracellular matrix buildup, fibroblast proliferation and activation, and chronic inflammation[1,2]. While a number of risk factors, including smoking, diabetes, hypertension, and hyperuricemia, can be controlled with lifestyle modifications or symptom-based therapy, there hasn\u0026apos;t been much success in developing efficient treatments to halt the course of chronic kidney disease.To create such medications, one must have a deep grasp of the cellular and molecularmechanisms underlying chronic kidney disease.\u003c/p\u003e\n\u003cp\u003eA diverse family of lengthy [\u0026gt;200 nucleotides] transcripts lacking the ability to code for proteins are known as lncRNA[3,4].It is clear that lncRNA perform a variety of biological roles, and abnormal expression of these transcripts has been linked to a range of clinical conditions, such as cancer, metabolic, and cardiovascular disorders[5\u0026ndash;7]. Recent research indicates that lncRNA might be important players in the aetiology of renal disorders[8,9]. LncRNA has been shown to have the ability to stimulate renal interstitial fibrosis. Imai K et al. have demonstrated that lnc-CHAF1B-3 causes renal interstitial fibrosis by controlling genes linked to epithelial-mesenchymal transition in renal proximal tubular cells[10]. Additionally, study by DuanYR et al. shows that LncRNA lnc-ISG20 causes renal fibrosis in diabetic nephropathy through miR-486-5p/NFAT5-mediated AKT phosphorylation[11]. It was recently discovered that TUG1 is linked to renal disorders. TUG1 knockdown reduces acute kidney injury in ischemia-reperfusion patients by binding to miR-29 and silencing PTEN, as shown by Xu et al[12].Uncertainty exists regarding the precise mechanism by which TUG1 alters the progression of CKD.\u003c/p\u003e\n\u003cp\u003eMicroRNAs (miRNAs), small noncoding RNAs, regulate gene expression by targeting specific mRNAs. A growing body of research indicates that miR-542-3p plays a crucial role in the development and progression of renal disorders[13,36]. Jue Lia et al. found that miR-542-3p exacerbates renal tubular interstitial fibrosis[14]. Bioinformatics studies suggest a potential interaction between TUG1 and miR-542-3p, although this relationship has not been previously documented. Therefore, we hypothesize that TUG1 may regulate the onset and progression of renal fibrosis through the modulation of miR-542-3p.\u003c/p\u003e\n\u003cp\u003eA large amount of clinical data shows that the number of peritubular capillaries around the renal tubules in CKD patients is significantly less compared to normal individuals. When the density of the small capillaries in the kidneys decreases, it exacerbates tissue hypoxia within the microcirculation, leading to heightened damage in renal interstitial fibrosis[15].The renal tubular epithelium\u0026apos;s cells dedifferentiate and take on the characteristics of mesenchymal cells when exposed to hypoxia (epithelial to mesenchymal transition).Hypoxia-inducible factor-1-alpha (HIF-1\u0026alpha;)-mediated pathway activation, which is triggered in hypoxic conditions, is another mechanism that promotes fibrosis. Excessive activation of this system leads to the production of growth factors that support vascular development to increase oxygen delivery, stimulate cell survival in hypoxic environments, and boost fibroblast proliferation[16]. According to Chen et al., when renal obstruction is present, HIF-1\u0026alpha; expression rises noticeably, which lowers the vascular density around the renal tubules[17]. Despite the importance of the HIF-1\u0026alpha; in vascular remodeling, the molecular mechanisms underlying vascular remodeling in RIF have not been completely understood.\u003c/p\u003e\n\u003cp\u003eHere, we looked at the potential role and underlying mechanisms of lncRNA linked to the onset of renal fibrosis. Overall, we found that TUG1 knockdown might reduce renal fibrosis by sponging miR-542-3p and controlling the HIF-1\u0026alpha; pathway, which in turn increased the level of vascular endothelial growth factor(VEGF). This finding offers a possible new target for renal fibrosis treatment.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Ethics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEvery procedure was carried out in compliance with the applicable rules and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1 Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHUVECs were cultivated at 37\u0026deg;C in a humidified environment with 5% CO2 in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. Every one to two days, the culture media was changed, and cells that were 85\u0026ndash;90% confluent were passaged at a confluence ratio of 1:3. In every experiment, the cells were employed between passages two and five.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Cell transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe GenePharma Company (Suzhou, China) developed a lentivirus vector plasmid system containing the sh-TUG1 gene(sh-TUG1:CCATCTCACAAGGCTTCAA), which was labeled with a green fluorescent protein (GFP). HUVECs were transfected with the lentivirus vectors using standard procedures, with an MOI=10 considered the most suitable. The expression and detection of GFP were performed on 1, 2, and 3 days after the transfection with the lentiviral vector.\u003c/p\u003e\n\u003cp\u003eIn order to obstruct miR-542-3p, Genepharma Company (Suzhou, China) supplied siRNA against miR-542-3p (named as si-miR-542-3p: UUUCAGUUAUCAAUCUGUCACA).The oe-TUG1 group represents a TUG1 overexpression group, while the oe-NC group was transfected with an empty plasmid. As directed by the manufacturer, cell transfection was carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Animal models\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThirty-six male C57/C mice, weighing between 18 and 22 grammes and aged between 6 and 8 weeks, were acquired from Xuzhou Medical University\u0026apos;s Laboratory Animal Centre in Jiangsu, China. After a week of acclimatization, the mice were split into four groups at random, each consisting of 16 mice: the sham group, the UUO group, the sh-TUG1 transfected group(sh-TUG1 group), and the equivalent negative controls (sh-NC group) that received an identical dosage of transfection.The sh-TUG1 lentivirus or empty virus injections (5 nmol/g/day) were administered via the tail vein for three consecutive days before the surgery in sh-TUG1 group and sh-NC group. To build the UUO model, a left abdominal incision was done and the mice were given a chloral hydrate anesthesia. After ligating the left ureter with a 4-0 silk suture, the incision was layer-closed. The left ureter was not clamped during the comparable left abdominal incision performed on the sham group.\u003c/p\u003e\n\u003cp\u003eOn the seventh day following surgery, mice from all four groups were slaughtered. The left kidneys of the mice were then extracted and rinsed with saline solution. While the remaining kidney was held at -80 \u0026deg;C for PCR and Western blot analysis later on, a portion was kept in 10% formaldehyde for morphological and immunofluorescence labeling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Tube formation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTube formation was carried out according to the method previously explained[18]. To summarize, a 96-well plate containing 50 \u0026mu;l of growth factor-reduced Matrigel TM (BD, USA) was seeded with endothelial cells (1 \u0026times; 104) and incubated for 24 hours at 37 \u0026deg;C to enable tube stability. A computer-assisted microscope (OLYMPUS, JAPAN) was used to count the total number of tube loops in five different microscopic fields at random.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Hematoxylin and Eosin Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe kidney tissues of mice were fixed in 4% paraformaldehyde (Sigma) and subsequently embedded in paraffin. After dewaxing in xylene and rehydrating with a decreasing series of alcohol, 5-\u0026mu;m-thick slices were taken from the paraffin-embedded tissues. Following that, the tissue sections were stained for five minutes with hematoxylin and three minutes with eosin solution. The sections were stained, dehydrated with graded ethanol, and then cleaned in xylene. Ultimately, the tissue sections were examined under an Olympus microscope in order to do additional investigation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Masson Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStandard deparaffinization was performed on the kidney tissue slices, and Masson\u0026apos;s Trichrome Stain Kit was used, adhering to the manufacturer\u0026apos;s recommendations for staining. After that, the stained slices were examined at a 200x magnification using an optical microscope (Olympus). Blue dye was applied to the regions that showed collagen fibers. The National Institutes of Health (NIH) ImageJ program was used to examine the pictures. The total area of fibrotic lesions was computed for randomly chosen fields of view and reported as a percentage of the full picture.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 FMA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFMA was conducted as stated earlier\u003csup\u003e\u0026nbsp;[34]\u003c/sup\u003e. The mice were sedated with chloral hydrate (10.0%, 0.003 ml/g intraperitoneally), and then placed on a surgical heating pad that was set to 37 \u0026deg;C. From the symphysis pubis to the jugulum, the abdomen was sliced in the middle. Using the method described by Rafael Kramann et al., all solutions were heated to 41 \u0026deg;C. A venous needle was used to inject one milliliter each of 3 M KCl and heparinized saline into the pounding left ventricle. The mouse was then given a right atrial cut, into which 10 ml of 41 \u0026deg;C prewarmed PBS and 5 ml of the agarose-microbead combination (500 ml 0.02 mm FluoSpheres + 4.5 ml 1% agarose/mouse) were perfused.The kidneys were gently removed and put in a small beaker covered by ice for 10 minutes. Afterward, the kidneys were fixed in 4% paraformaldehyde on ice for 2 hours, followed by overnight incubation in 30% sucrose in PBS at 4 \u0026deg;C. Following cryosectioning into 10 \u0026mu;m slices, the implanted kidneys were placed on Superfrost slides. The sections were treated with 49,6-diamidino-2-phenylindole, stained, and then mounted in ProLong Gold (Life Technologies) after being rinsed in PBS for a predetermined period of time. To prepare sections for immunofluorescence staining, PBS washed them for five minutes, and then they were incubated for one hour at room temperature with 5% donkey serum in PBS containing 0.3% Triton-X-100. Next, they were incubated for eight hours at 4 \u0026deg;C with anti-VE-cadherin antibody (1:200, ab33168, abcam), anti-alpha smooth muscle actin mouse antibody (1:200, ab7817,abcam), and rabbit anti-CD31 rabbit antibody (1:200, ab28364,abcam). The Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher) were employed on the sections in the experiment. After that, the sections were incubated for two hours at room temperature. The tissue slices were then mounted using Invitrogen\u0026apos;s ProLong Gold Antifade reagent (18255385). Our tool of choice for viewing the images was a confocal laser microscope (FV1000; Olympus, Tokyo, Japan).In addition, VE-cadherin antibody (1:200, ab33168, abcam) was used for an 18-hour incubation period at 4 \u0026deg;C. We then incubated the sections at room temperature for two hours using the Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and the Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher). ProLong Gold Antifade reagent (18255385, Invitrogen) was once more used to mount the tissue slices.Lastly, each image was seen using a confocal laser microscope (Leica, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 Quantitative RT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNeasy kit (Takara，Japan) was utilized to extract RNA from entire tissue samples, followed by a ABIPRISM 7300 Sequence Detection System quantitative RT-PCR analysis. The reaction was composed of complemental DNA template, iTaq SYBR Green Supermix (with ROX, Takara, Japan), and gene-tailored primers ( Table 1). Conditions for the PCR were two minutes at 50 \u0026deg;C, ten minutes at 95 \u0026deg;C, and forty cycles of 30 seconds at 95 \u0026deg;C, 45 seconds at 60 \u0026deg;C, and 30 seconds at 72 \u0026deg;C. As an internal control, GADPH was employed for benchmarking. Following PCR, cycle threshold values were established for GADPH and the other particular genes. The normalized fold expression for each gene was computed using the 2-\u0026Delta;\u0026Delta;CT technique and published.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Western blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe kidney tissue was lysed in a 100:1 mixture of RIPA and PMSF and allowed to stand on ice for half an hour. After that, the resultant solution was spun for 15 minutes at 12,000 rpm while being maintained at 4 \u0026deg;C. Roughly 150 \u0026mu;g of total protein was loaded onto 10% or 12% SDS polyacrylamide gels and then electroblotted onto a PVDF membrane after the proteins were heated in boiling water for five minutes. After treating the membrane with 3% BSA for an hour at room temperature, it was incubated with primary antibodies targeting TGF-\u0026beta;1, \u0026alpha;-SMA, VEGF, HIF1-\u0026alpha;, and VE-cadherin for an overnight period at 4 \u0026deg;C. Each primary antibody was diluted at a ratio of 1:1000 or 1:200 to prevent non-specific binding. After that, another round of incubation was conducted using ECL secondary antibodies. Ultimately, the ImageQuant LAS 4000 mini was used to identify the signal, and beta actin was used to quantify it.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 FISH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo find out where TUG1 is in the cell, we performed a technique called fluorescence in situ hybridization (FISH). We used special probes labeled with fluorescein, made by GenePharma in Suzhou, China, to target TUG1. First, we fixed HUVECs with a solution of 4% paraformaldehyde, then we exposed them to a solution that helped make them more permeable. After blocking any unwanted interactions, we added the TUG1 probes and let them bind with the RNA overnight in the absence of light. To visualize the results, we stained the cell nuclei with DAPI and used a confocal laser microscope to scan for fluorescence signals.\u003c/p\u003e"},{"header":"3 Results","content":"\u003cp\u003e\u003cstrong\u003e3.1\u003c/strong\u003e \u003cstrong\u003eTUG1 expression was markedly elevated in renal fibrosis both in vivo and in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInitially, we assessed the expression levels of TUG1 in human umbilical vein endothelial cells (HUVECs) before delving into its functional implications. When compared to the corresponding normoxic group, the data unequivocally revealed a marked increase in TUG1 levels within the hypoxic group. (Figure 1A) Subsequently, we examined the expression levels of TUG1 in renal tissue. Upon comparison with the sham-operated group, the findings indicated a noticeable overexpression of TUG1 in the unilateral ureteral obstruction (UUO) group.(Figure. 1B)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Lentivirus vector production.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenePharma, a biotechnology firm based in Suzhou, China, has engineered a lentiviral vector plasmid system that includes the sh-TUG1 gene, which is distinctively tagged with a green fluorescent protein (GFP). Human umbilical vein endothelial cells (HUVECs) were subjected to transfection with these lentiviral vectors, following standard protocols, with a multiplicity of infection (MOI) of 10 determined to be the optimal dosage. The expression and detection of GFP were monitored at intervals of 1, 2, and 3 days post-transfection. Remarkably, by the third day, approximately 80% of the HUVECs exhibited GFP expression, as evidenced by the characteristic green fluorescence.(Figure 1C)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Capillary-like development is regulated by LncRNA TUG1 in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the capacity of human umbilical vein endothelial cells (HUVECs) to form a well-organized tubular network, a tube formation assay utilizing Matrigel was conducted. (Figure.1D,E) In this segment, Figure 1E revealed that the inhibition of TUG1 facilitated the impaired tube formation following a 12-hour hypoxic exposure. These observations underscore the pivotal role of lncRNA TUG1 in the angiogenesis process.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 LncRNA TUG1 regulates endothelial junctions in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecifically, vascular endothelial cadherin (VE-cadherin) is emblematic for the assembly and structural design of endothelial connections. In the normoxia group, HUVECs consistently expressed VE-cadherin during their interactions, maintaining a continuous pattern. In contrast, the hypoxia group exhibited a sawtooth distribution of VE-cadherin expression, indicative of a lack of tight junctions. Over a 12-hour hypoxic period, VE-cadherin proteins, which are typically found throughout the cell membrane, became dispersed, extending into the nucleus and cytoplasm. In comparison to endothelial cells cultured under hypoxic conditions, the sh-TUG1 group displayed an enhanced VE-cadherin expression at cell-cell contact sites and a tendency towards a more typical endothelial cell morphology. (Figure.1F)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5\u003c/strong\u003e \u003cstrong\u003eTUG 1 knockdown prevented hypoxia-induced renal fibrosis in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe aim of our research was to investigate the impact of TUG1 on renal fibrosis under hypoxic conditions. Post-transfection, RT-qPCR analysis confirmed the successful attenuation of LncRNA TUG1 levels in HUVECs following sh-TUG1 treatment. (Figure. 1G) Further analysis employing Western blotting techniques demonstrated that the suppression of TUG1 mitigated the hypoxia-induced decline in VEGF protein expression, resulting in an elevation of VEGF protein levels. (Figure. 2A,B) Moreover, the levels of \u0026alpha;-SMA, TGF-\u0026beta;1, and HIF-1\u0026alpha;, which are markers affected by hypoxic treatment, were observed to increase following the repression of TUG1. (Figure. 2A,C,D,E) Collectively, these findings offer compelling evidence that the knockdown of TUG1 inhibited fibrotic characteristics by alleviating hypoxic conditions and promoting angiogenesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 TUG1 Could Directly Target miR-542-3p.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn increasing body of research suggests that lncRNAs can act as competing endogenous RNAs (ceRNAs) to regulate the expression of specific genes. Consequently, we focused on miRNAs as potential targets of lncRNA TUG1. Employing bioinformatics software, we examined the binding sites between TUG1 and miR-542-3p. Figure 2I indicates that the lncRNA TUG1 transcript harbors a binding region for miR-542-3p, suggesting that miR-542-3p could be a plausible target for TUG1. Furthermore, we utilized the FISH technique, with DAPI for nuclear staining and CY3 to visualize the cytoplasmic positive 18S rRNA and TUG1 lncRNA. (Figure.2F) The findings demonstrated that lncRNA TUG1 was found in the HUVECs\u0026apos; cytoplasm (Figure.2F) This evidence suggests that TUG1 is likely to interact with cytoplasmic miRNAs, hinting at its potential role in post-transcriptional regulation within the cell. Furthermore, we observed that the expression levels of miR-542-3p significantly decreased in HUVECs under hypoxic conditions, exhibiting an inverse pattern compared to TUG1 expression. RT-qPCR results also indicated that while TUG1 overexpression suppressed miR-31 expression, the knockdown of TUG1 led to an upregulation of miR-542-3p expression. (Figure. 2G,H) Consequently, our findings proved that TUG1 specifically targeted miR-542-3p.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7\u003c/strong\u003e \u003cstrong\u003eThe inhibitory effects of TUG1 knockdown on renal fibrosis were reversed in vitro by inhibition of miR-542-3p.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain a deeper understanding of the relationship between TUG1 and miR-542-3p in the context of renal interstitial fibrosis, hypoxia-induced HUVECs were treated with sh-TUG1. The knockdown of TUG1 led to an enhancement in miR-542-3p expression, and the silencing of miR-542-3p restored the observed effects. Furthermore, the si-miR-542-3p group exhibited increased HIF-1\u0026alpha; expression as a result of TUG1 knockdown, which was associated with a subsequent decrease in VEGF expression. However, the knockdown of miR-542-3p reversed these inhibitory effects. (Figure.2K) The findings strongly suggested that knockdown of TUG1 alleviated renal fibrosis by relieving tissue hypoxia and repairing renal microvessels by modulating miR-542-3p expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.8 Renal morphology.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo validate the roles of TUG1 in renal fibrosis in vivo, we established a mouse model representing the disease conditions. The renal histopathology was assessed using Masson\u0026apos;s trichrome and hematoxylin-eosin staining techniques. (Figure.3A,B) As depicted in Figure 3A, the sham group displayed no histological abnormalities. In contrast, unilateral ureteral obstruction led to renal tubular rupture, glomerular atrophy, and increased extracellular matrix (ECM) production. However, the administration of sh-TUG1 significantly mitigated these renal pathological alterations and the accumulation of collagen compared to the sh-NC group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.9 EndMT is lessened by TUG1 knockdown in UUO models.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEing immunostaining to identify cells undergoing endothelial-to-mesenchymal transition (EndMT), we observed the concurrent expression of endothelial and myofibroblast markers. In the sham-operated group, samples contained both resident \u0026alpha;-SMA+ cells and CD31+ endothelial cells; however, no cells exhibited the coexpression of these dual markers. (Figure.3C) Conversely, the obstructed kidney exhibited a decrease in CD31+ endothelial cells and the emergence of cells coexpressing both CD31 and \u0026alpha;-SMA, indicating active EndMT in the fibrotic kidneys post-UUO. The sh-TUG1 group displayed fewer \u0026alpha;-SMA myofibroblasts and a greater number of CD31+ endothelial cells compared to the UUO group. Furthermore, interstitial fibrosis was linked to a reduction in the presence of CD31+\u0026alpha;-SMA+ EndMT cells. These observations suggest that a substantial portion of the fibroblasts in UUO models may originate from EndMT, and that EndMT may be suppressed by TUG1 silencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.10 TUG 1 knockdown\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;alleviate renal interstitial fibrosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubsequently, the in vivo influence of TUG1 on renal fibrosis was assessed. Post-transfection, RT-qPCR analysis unequivocally confirmed the successful reduction of LncRNA TUG1 levels within the kidney following sh-TUG1 treatment (Figure 4A) Further investigation using Western blotting revealed that the suppression of TUG1 mitigated the decrease in VEGF protein expression observed in the UUO kidney (Figure 4B, F) Additionally, the examination of \u0026alpha;-SMA, TGF-\u0026beta;1, and HIF-1\u0026alpha; levels, which are markers affected in the UUO kidney, demonstrated significant increases following TUG1 suppression (Figure 4B, C, D, E) Collectively, these findings provide compelling evidence that the silencing of TUG1 effectively inhibited the fibrotic characteristics observed in the UUO model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.11Changes in peritubular capillaries identified using FMA.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used FMA in conjunction with MATLAB analysis to determine the total areas and density of the capillaries in order to analyze the changes in peritubular capillaries within each group (Figure.4G). Comparing the blocked kidney group to the control group, the results indicated a decrease in the overall amount of perfused area and vascular density. In contrast to the UUO group and the sh-NC group, there was a notable increase in the overall area of perfusion as well as the amount of vasculature following the suppression of TUG1 expression(Figure.4H,I) Staining and quantification demonstrated a significant increase in \u0026alpha;-SMA protein expression as compared to the sham group for both the UUO and sh-NC groups. On the other hand, as Figure 5 illustrates, TUG1 knockdown was successful in slowing the course of fibrosis. By enhancing renal microcirculation by TUG1 inhibition, our findings provide precise evidence that renal interstitial fibrosis may be lessened.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIn the context of CKD, renal interstitial fibrosis is a critical stage that precedes end-stage renal failure[19]. Renal fibrosis is characterized by a reduction in peritubular capillaries, tissue hypoxia, activation of the epithelial-mesenchymal transition (EMT), accumulation of extracellular matrix, oxidative stress, and inflammation[20\u0026ndash;24]. Despite its importance, the exact mechanism underlying renal fibrosis remains unknown.In our recent study, we uncovered an interesting finding regarding the role of a long non-coding RNA called TUG1 in renal fibrosis. We observed that TUG1 levels increase in response to hypoxia treatment and in a model of obstructive uropathy (UUO). Intriguingly, we found that reducing TUG1 expression alleviates renal hypoxia and microvascular damage, thereby halting the EndMT process and reducing renal fibrosis.Furthermore, we discovered that the suppression of TUG1 exerts anti-renal fibrotic effects through a signaling pathway involving the lncRNA TUG1/miR-542-3p/HIF-1\u0026alpha;/VEGF axis. This novel insight into the molecular mechanisms of renal fibrosis could have significant implications for the development of future CKD therapies.\u003c/p\u003e\n\u003cp\u003eNumerous studies have consistently demonstrated that a decline in relative blood volume and microvascular density is an early characteristic of renal fibrosis[25]. In recent years, an increasing amount of studies have found that the reduction of PTCs is strongly related to renal interstitial fibrosis[26,27].It is believed that the main factors contributing to kidney damage progression include endothelial injury in the renal medulla\u0026apos;s capillary system, CKD patients, and the concomitant renal vascular rarefaction. Adipose-derived mesenchymal stem cells, exosomes, and beraprost sodium have all been shown by our team to have the ability to improve renal microcirculation, which in turn helps to lessen renal interstitial fibrosis[17,28,29]. PTCs diminishes local blood supply and oxygen delivery in the kidneys, which triggers endothelial cells to undergo a transformation into fibroblasts. These fibroblasts further exacerbate PTCs loss, hastening the progression of local lesions and ultimately culminating in kidney fibrosis[30,31]. In our investigations, we observed a significant upregulation of TUG1 expression in the kidneys of UUO mice and hypoxic endothelial cells. Consequently, we sought to determine whether TUG1 knockdown could alleviate renal injury by promoting microcirculation. Our findings demonstrated that TUG1 knockdown in hypoxia-treated endothelial cells stimulated the formation of capillary-like structures, surpassing the levels observed in hypoxia-treated cells without TUG1 knocking down. Furthermore, it was shown that the sh-TUG1 group had higher levels of VEGF than both the hypoxic and the sh-NC groups. These results suggested that knocking down of TUG1 facilitated the process of blood vessel formation and remodeling. Concurrently, there was a reduction in HIF-1\u0026alpha;, TGF-\u0026beta;1, and \u0026alpha;-SMA, which are important factors in fibrosis, following TUG1 knockdown. TUG1 is linked to anti-oxidative and anti-inflammatory properties.Furthermore, cell-to-cell communication is essential for preserving blood vessel integrity and homeostasis. Disruption of junctions between endothelial cells leads to an elevation in microvascular permeability. As a result, leukocytes can penetrate the interstitial compartment through endothelial cells, causing the interstitial space to enlarge and the microvasculature to compress. Thus, oxygen transport is hampered and nutrient flow is impeded. Here, VE-cadherin is especially important because of its role in barrier architecture and endothelial adherens assembly. The increased expression of VE-cadherin in our data indicated that TUG1 knockdown distorted endothelial cell-cell connections under hypoxic settings. These results demonstrate the beneficial effects of TUG1 knockdown on enhancing microcirculation in vitro, preserving renal function and mitigating fibrosis.\u003c/p\u003e\n\u003cp\u003eTo further investigate whether knocking down TUG1 have any effect on renal microvascular in vivo. Three days before the surgery, we injected sh-TUG1 or sh-NC into the UUO mice through the tail vein.At the moment, genetic labeling (such as Tie 2) or CD31 antigen immunostaining\u0026mdash;which measures the surface area of endothelial cells\u0026mdash;are used to quantify microvascular density[32]. However, the capillary lumen itself cannot be quantified. In this study, we adopt a novel method known as Fluocular Microscopy Analysis \u0026nbsp; to create a microangiogram visible under a confocal laser microscope using low-melting-point agarose augmented with FluoSpheres[33]. Furthermore, the overall perfused capillary area, the count of peritubular capillaries, and the cross-sectional area and perimeter of individual capillaries should all be analyzed using MATLAB software. MATLAB scripts can be used to automatically generate analyses of the microvasculature.PTCs-positive regions, identified in this study by CD31 immunostaining, demonstrated that the PTCs in the sh-NC and UUO groups had been destroyed. In the meantime, the blocked kidneys\u0026apos; perfused FMA+ capillary region revealed a lack of perfusion. The increase of HIF-1\u0026alpha; revealed that tissue hypoxia follows the rarefaction of the PTCs. According to our research, TUG1 silencing can reduce tissue hypoxia, promote an increase in PTCs density, and repair renal blood vessels. These cells have the ability to move to the interstitium, where they can develop into myofibroblasts and stimulate the synthesis of collagen and other ECM[29]. According to these findings, TUG1 knockdown may be able to reduce the severity of renal fibrosis through processes that improve hypoxic conditions and encourage angiogenesis.\u003c/p\u003e\n\u003cp\u003eAn increasing amount of research points to an association between ECM deposition and renal fibrosis brought on by oxidative stress and inflammation. Our prior research has revealed that obstructive kidney conditions can result in a reduction in capillary density around the renal tubules, leading to severe hypoxia. This further aggravates oxidative stress and inflammatory reactions, which eventually quickens the development of renal fibrosis as a reaction to kidney injury[28,29]. Inflammation and oxidative stress can cause renal endothelial cells and tubular epithelial cells to undergo apoptosis[37], which can then cause EndMT and EMT and ultimately promote the deposition of extracellular matrix[1]. Moreover, during UUO-induced renal interstitial fibrosis, the overproduction of ROS causes a decrease in mitochondrial respiratory chain activity, which in turn activates EndMT and EMT[34]. Confocal imaging in chronic kidney illness demonstrated immunestaining-capable endothelial cells undergoing EndMT, implying that damaged endothelium cells may differentiate into myofibroblasts. In the renal interstitium, there was less colocalization of a-SMA+ myofibroblasts and CD31+ endothelial cells, indicating that TUG1 knockdown suppressed the EndMT process. According to our results, TUG1 knockdown may reduce tissue hypoxia-induced EndMT.\u003c/p\u003e\n\u003cp\u003eLncRNA-miRNA interactions are thought to be crucial for a number of biological processes and diseases[35]. Growing data indicates that lncRNAs may compete with miRNAs as ceRNAs and contribute to the development of many disorders. We also verified that TUG1 directly regulated miR-542-3p.According to Liu et al., lncRNA TUG1 may bind miR-542-3p competitively to control the expression of TRIB2, as well as decrease the growth, migration, invasion, and proliferation of colorectal cancer cells while promoting apoptosis[14]. We concentrated on the target miRNAs of LncRNA TUG1 in renal fibrosis in order to investigate its mechanism. By online databases (starbase) prediction, miR-542-3p was chosen for further study for being a kidney diseases-related miRNA. Furthermore, bioinformatics study was used to identify binging locations between miR-542-3p and TUG1.Our research showed that knocking down TUG1 enhanced the expression of miR-542-3p in hypoxic circumstances.In order to further validate the connection between TUG1 and miR-542-3p, we established an model in vitro hypoxia. As compared to the si-NC+sh-TUG1 group, the si-miR-542-3p+sh-TUG1 group exhibited a little uptick in HIF-1\u0026alpha; expression, while VEGF expression decreased. The outcome validates that TUG1 influences the advancement of renal fibrosis by means of the miR-542-3p/HIF-1\u0026alpha;/VEGF axis.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eIn summary, we demonstrated that knockdown of TUG1 could restore damaged peritubular capillaries, accompanied by alleviating renal hypoxia, ultimately relieving EndMT process(Figure.6). These findings offer fresh perspectives on the ways in which TUG1 and miR-542-3p/HIF-1\u0026alpha;/VEGF, which may represent a potential therapeutic target for CKD, contribute to the anti-fibrotic impact.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthical Approval and Consent to participat\u003c/em\u003e\u003c/strong\u003e\u003cem\u003ee\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe Xuzhou Medical University\u0026apos;s Ethics Committee for Animal Research approved the protocols used for all animal research(Approval No. L20210226432).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting Interest information\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFounding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by funding from the National Natural Science Foundation of China (82270731, 82000703); the Jiangsu Provincial Natural Science Foundation (BK20211054); the Jiangsu Provincial Commission of Health and Family Planning (2016103003, H201628); Science and technology development fund of Affiliated Hospital of Xuzhou Medical University (XYFC2020001; XYFY2020038); Xuzhou Basic Research Program (KC22042); Xuzhou key R \u0026amp; D Program(Social Development) (KC20160); Xuzhou Medical leadingTalent training Project (XWRCHT20210038).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eH. Fu, Y. Tian, L. Zhou, D. Zhou, R.J. Tan, D.B. Stolz, Y. Liu, Tenascin-C Is a Major Component of the Fibrogenic Niche in Kidney Fibrosis, JASN 28 (2017) 785\u0026ndash;801. https://doi.org/10.1681/ASN.2016020165.\u003c/li\u003e\n \u003cli\u003eG. Campanholle, G. Ligresti, S.A. Gharib, J.S. Duffield, Cellular Mechanisms of Tissue Fibrosis. 3. Novel mechanisms of kidney fibrosis, American Journal of Physiology-Cell Physiology 304 (2013) C591\u0026ndash;C603. https://doi.org/10.1152/ajpcell.00414.2012.\u003c/li\u003e\n \u003cli\u003eT. Ali, P. Grote, Beyond the RNA-dependent function of LncRNA genes, eLife 9 (2020) e60583. https://doi.org/10.7554/eLife.60583.\u003c/li\u003e\n \u003cli\u003eJ. Cable, E. Heard, T. Hirose, K.V. Prasanth, L. Chen, J.E. Henninger, S.A. Quinodoz, D.L. Spector, S.D. Diermeier, A.M. Porman, D. Kumar, M.W. Feinberg, X. Shen, J.P. Unfried, R. Johnson, C. Chen, J.E. Wilusz, A. Lempradl, S.E. McGeary, L. Wahba, A.M. Pyle, A.E. Hargrove, M.D. Simon, M. Marcia, R.K. Przanowska, H.Y. Chang, S.R. Jaffrey, L.M. Contreras, Q. Chen, J. Shi, J.T. Mendell, L. He, E. Song, J.L. Rinn, M.K. Lalwani, M.C. Kalem, E.B. Chuong, L.E. Maquat, X. Liu, Noncoding RNAs: biology and applications\u0026mdash;a Keystone Symposia report, Annals of the New York Academy of Sciences 1506 (2021) 118\u0026ndash;141. https://doi.org/10.1111/nyas.14713.\u003c/li\u003e\n \u003cli\u003eY.-H. Lin, Crosstalk of lncRNA and Cellular Metabolism and Their Regulatory Mechanism in Cancer, IJMS 21 (2020) 2947. https://doi.org/10.3390/ijms21082947.\u003c/li\u003e\n \u003cli\u003eY. Tan, J. Lin, T. Li, J. Li, R. Xu, H. Ju, LncRNA‐mediated posttranslational modifications and reprogramming of energy metabolism in cancer, Cancer Communications 41 (2021) 109\u0026ndash;120. https://doi.org/10.1002/cac2.12108.\u003c/li\u003e\n \u003cli\u003eS. Uchida, S. Dimmeler, Long Noncoding RNAs in Cardiovascular Diseases, (n.d.).\u003c/li\u003e\n \u003cli\u003eH.J. Jung, H.-J. Kim, K.-K. Park, Potential Roles of Long Noncoding RNAs as Therapeutic Targets in Renal Fibrosis, IJMS 21 (2020) 2698. https://doi.org/10.3390/ijms21082698.\u003c/li\u003e\n \u003cli\u003eY. Pan, X. Lu, G. Shu, J. Cen, J. Lu, M. Zhou, K. Huang, J. Dong, J. Li, H. Lin, H. Song, Q. Xu, H. Han, Z. Chen, W. Chen, J. Luo, J. Wei, J. Zhang, Extracellular Vesicle-Mediated Transfer of LncRNA \u003cem\u003eIGFL2-AS1\u003c/em\u003e Confers Sunitinib Resistance in Renal Cell Carcinoma, Cancer Research 83 (2023) 103\u0026ndash;116. https://doi.org/10.1158/0008-5472.CAN-21-3432.\u003c/li\u003e\n \u003cli\u003eK. Imai, T. Ishimoto, T. Doke, T. Tsuboi, Y. Watanabe, K. Katsushima, M. Suzuki, H. Oishi, K. Furuhashi, Y. Ito, Y. Kondo, S. Maruyama, Long non-coding RNA lnc-CHAF1B-3 promotes renal interstitial fibrosis by regulating EMT-related genes in renal proximal tubular cells, Molecular Therapy - Nucleic Acids 31 (2023) 139\u0026ndash;150. https://doi.org/10.1016/j.omtn.2022.12.011.\u003c/li\u003e\n \u003cli\u003eY. Duan, B. Chen, F. Chen, S. Yang, C. Zhu, Y. Ma, Y. Li, J. Shi, LncRNA lnc‐ISG20 promotes renal fibrosis in diabetic nephropathy by inducing AKT phosphorylation through miR‐486‐5p/NFAT5, J Cellular Molecular Medi 25 (2021) 4922\u0026ndash;4937. https://doi.org/10.1111/jcmm.16280.\u003c/li\u003e\n \u003cli\u003eZ. Xu, X. Huang, Q. Lin, W. Xiang, Long non-coding RNA TUG1 knockdown promotes autophagy and improves acute renal injury in ischemia-reperfusion-treated rats by binding to microRNA-29 to silence PTEN, BMC Nephrol 22 (2021) 288. https://doi.org/10.1186/s12882-021-02473-0.\u003c/li\u003e\n \u003cli\u003eQ. Xiao, Y. Tang, H. Luo, S. Chen, R. Chen, Z. Yan, L. Pu, L. Wang, G. Li, Y. Li, Sclerostin is involved in osteogenic transdifferentiation of vascular smooth muscle cells in chronic kidney disease-associated vascular calcification with non-canonical Wnt signaling, Renal Failure 44 (2022) 1427\u0026ndash;1443. https://doi.org/10.1080/0886022X.2022.2114370.\u003c/li\u003e\n \u003cli\u003eQ. Liu, W. Zhang, L. Luo, K. Han, R. Liu, S. Wei, X. Guo, Long noncoding RNA TUG1 regulates the progression of colorectal cancer through miR-542-3p/TRIB2 axis and Wnt/\u0026beta;-catenin pathway, Diagn Pathol 16 (2021) 47. https://doi.org/10.1186/s13000-021-01101-7.\u003c/li\u003e\n \u003cli\u003eY. Shi, B. Li, X. Huang, W. Kou, M. Zhai, Y. Zeng, S. You, Q. Yu, Y. Zhao, J. Zhuang, W. Peng, W. Jian, Loss of TET2 impairs endothelial angiogenesis via downregulating STAT3 target genes, Cell Biosci 13 (2023) 12. https://doi.org/10.1186/s13578-023-00960-5.\u003c/li\u003e\n \u003cli\u003eB. Nath, G. Szabo, Hypoxia and hypoxia inducible factors: Diverse roles in liver diseases, Hepatology 55 (2012) 622\u0026ndash;633. https://doi.org/10.1002/hep.25497.\u003c/li\u003e\n \u003cli\u003eL. Chen, Y. Wang, S. Li, B. Zuo, X. Zhang, F. Wang, D. Sun, Exosomes derived from GDNF-modified human adipose mesenchymal stem cells ameliorate peritubular capillary loss in tubulointerstitial fibrosis by activating the SIRT1/eNOS signaling pathway, Theranostics 10 (2020) 9425\u0026ndash;9442. https://doi.org/10.7150/thno.43315.\u003c/li\u003e\n \u003cli\u003eK. Takeshita, M. Satoh, M. Ii, M. Silver, F.P. Limbourg, Y. Mukai, Y. Rikitake, F. Radtke, T. Gridley, D.W. Losordo, J.K. Liao, Critical Role of Endothelial Notch1 Signaling in Postnatal Angiogenesis,Circulation Research 100 (2007) 70\u0026ndash;78. https://doi.org/10.1161/01.RES.0000254788.47304.6e.\u003c/li\u003e\n \u003cli\u003eB.D. Humphreys, Mechanisms of Renal Fibrosis, Annu. Rev. Physiol. 80 (2018) 309\u0026ndash;326. https://doi.org/10.1146/annurev-physiol-022516-034227.\u003c/li\u003e\n \u003cli\u003eY. Han, S. Tang, Y. Liu, A. Li, M. Zhan, M. Yang, N. Song, W. Zhang, X. Wu, C. Peng, H. Zhang, S. Yang, AMPK agonist alleviate renal tubulointerstitial fibrosis via activating mitophagy in high fat and streptozotocin induced diabetic mice, Cell Death Dis 12 (2021) 925. https://doi.org/10.1038/s41419-021-04184-8.\u003c/li\u003e\n \u003cli\u003eY. Liu, Cellular and molecular mechanisms of renal fibrosis, Nat Rev Nephrol 7 (2011) 684\u0026ndash;696. https://doi.org/10.1038/nrneph.2011.149.\u003c/li\u003e\n \u003cli\u003eS. Lovisa, V.S. LeBleu, B. Tampe, H. Sugimoto, K. Vadnagara, J.L. Carstens, C.-C. Wu, Y. Hagos, B.C. Burckhardt, T. Pentcheva-Hoang, H. Nischal, J.P. Allison, M. Zeisberg, R. Kalluri, Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis, Nat Med 21 (2015) 998\u0026ndash;1009. https://doi.org/10.1038/nm.3902.\u003c/li\u003e\n \u003cli\u003eS. Panizo, L. Mart\u0026iacute;nez-Arias, C. Alonso-Montes, P. Cannata, B. Mart\u0026iacute;n-Carro, J.L. Fern\u0026aacute;ndez-Mart\u0026iacute;n, M. Naves-D\u0026iacute;az, N. Carrillo-L\u0026oacute;pez, J.B. Cannata-And\u0026iacute;a, Fibrosis in Chronic Kidney Disease: Pathogenesis and Consequences, IJMS 22 (2021) 408. https://doi.org/10.3390/ijms22010408.\u003c/li\u003e\n \u003cli\u003eB. Yang, S. Lan, M. Dieud\u0026eacute;, J.-P. Sabo-Vatasescu, A. Karakeussian-Rimbaud, J. Turgeon, S. Qi, L. Gunaratnam, N. Patey, M.-J. H\u0026eacute;bert, Caspase-3 Is a Pivotal Regulator of Microvascular Rarefaction and Renal Fibrosis after Ischemia-Reperfusion Injury, JASN 29 (2018) 1900\u0026ndash;1916. https://doi.org/10.1681/ASN.2017050581.\u003c/li\u003e\n \u003cli\u003eJ. B\u0026aacute;b\u0026iacute;čkov\u0026aacute;, B.M. Klinkhammer, E.M. Buhl, S. Djudjaj, M. Hoss, F. Heymann, F. Tacke, J. Floege, J.U. Becker, P. Boor, Regardless of etiology, progressive renal disease causes ultrastructural and functional alterations of peritubular capillaries, Kidney International 91 (2017) 70\u0026ndash;85. https://doi.org/10.1016/j.kint.2016.07.038.\u003c/li\u003e\n \u003cli\u003eS. Li, F. Wang, D. Sun, The renal microcirculation in chronic kidney disease: novel diagnostic methods and therapeutic perspectives, Cell Biosci 11 (2021) 90. https://doi.org/10.1186/s13578-021-00606-4.\u003c/li\u003e\n \u003cli\u003eF. Zhu, H. Li, T. Long, M. Zhou, J. Wan, J. Tian, Z. Zhou, Z. Hu, J. Nie, Tubular Numb promotes renal interstitial fibrosis via modulating HIF-1\u0026alpha; protein stability, Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1867 (2021) 166081. https://doi.org/10.1016/j.bbadis.2021.166081.\u003c/li\u003e\n \u003cli\u003eS. Li, Y. Wang, L. Chen, Z. Wang, G. Liu, B. Zuo, C. Liu, D. Sun, Beraprost sodium mitigates renal interstitial fibrosis through repairing renal microvessels, J Mol Med 97 (2019) 777\u0026ndash;791. https://doi.org/10.1007/s00109-019-01769-x.\u003c/li\u003e\n \u003cli\u003eS. Li, Y. Wang, Z. Wang, L. Chen, B. Zuo, C. Liu, D. Sun, Enhanced renoprotective effect of GDNF-modified adipose-derived mesenchymal stem cells on renal interstitial fibrosis, Stem Cell Res Ther 12 (2021) 27. https://doi.org/10.1186/s13287-020-02049-z.\u003c/li\u003e\n \u003cli\u003eB.J. Ballermann, M. Obeidat, Tipping the balance from angiogenesis to fibrosis in CKD, Kidney International Supplements 4 (2014) 45\u0026ndash;52. https://doi.org/10.1038/kisup.2014.9.\u003c/li\u003e\n \u003cli\u003eY.-A. Lu, C.-T. Liao, R. Raybould, B. Talabani, I. Grigorieva, B. Szomolay, T. Bowen, R. Andrews, P.R. Taylor, D. Fraser, Single-Nucleus RNA Sequencing Identifies New Classes of Proximal Tubular Epithelial Cells in Kidney Fibrosis, JASN 32 (2021) 2501\u0026ndash;2516. https://doi.org/10.1681/ASN.2020081143.\u003c/li\u003e\n \u003cli\u003eT. Liu, W. Ma, H. Xu, M. Huang, D. Zhang, Z. He, L. Zhang, S. Brem, D.M. O\u0026rsquo;Rourke, Y. Gong, Y. Mou, Z. Zhang, Y. Fan, PDGF-mediated mesenchymal transformation renders endothelial resistance to anti-VEGF treatment in glioblastoma, Nat Commun 9 (2018) 3439. https://doi.org/10.1038/s41467-018-05982-z.\u003c/li\u003e\n \u003cli\u003eR. Kramann, M. Tanaka, B.D. Humphreys, Fluorescence Microangiography for Quantitative Assessment of Peritubular Capillary Changes after AKI in Mice, Journal of the American Society of Nephrology 25 (2014) 1924\u0026ndash;1931. https://doi.org/10.1681/ASN.2013101121.\u003c/li\u003e\n \u003cli\u003eS. Zhang, X. Tan, Y. Chen, X. Zhang, Postconditioning protects renal fibrosis by attenuating oxidative stress-induced mitochondrial injury, Nephrology Dialysis Transplantation 32 (2017) 1628\u0026ndash;1636. https://doi.org/10.1093/ndt/gfw469.\u003c/li\u003e\n \u003cli\u003eX. Zhang, W. Wang, W. Zhu, J. Dong, Y. Cheng, Z. Yin, F. Shen, Mechanisms and Functions of Long Non-Coding RNAs at Multiple Regulatory Levels, IJMS 20 (2019) 5573. https://doi.org/10.3390/ijms20225573.\u003c/li\u003e\n \u003cli\u003eMarin DE, Braicu C, Dumitrescu G, et al. MicroRNA profiling in kidney in pigs fed ochratoxin A contaminated diet. Ecotoxicol Environ Saf. 2019;184:109637. doi:10.1016/j.ecoenv.2019.109637\u003c/li\u003e\n \u003cli\u003eChen JF, Wu QS, Xie YX, et al. TRAP1 ameliorates renal tubulointerstitial fibrosis in mice with unilateral ureteral obstruction by protecting renal tubular epithelial cell mitochondria. FASEB J. 2017;31(10):4503-4514. doi:10.1096/fj.201700283R\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section.\u003c/p\u003e "}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"LncRNA Taurine-upregulated gene 1, MiR-542-3p, Renal fibrosis, Hypoxia-inducible factor-1-alpha","lastPublishedDoi":"10.21203/rs.3.rs-4022893/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4022893/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Chronic kidney disease (CKD) has been discovered to be closely associated with both long noncoding RNAs (lncRNAs) and microRNAs (miRNAs), while the precise molecular processes behind this relationship are still unclear. This study evaluated the impact of miR-542-3p and lncRNA-TUG1 on renal fibrosis, along with the regulatory mechanisms that underlie them. Through tube formation assays, in vitro research showed that TUG1 knockdown might both improve angiogenesis and heal damaged endothelial cell-cell connections. We used Western blot and q-PCR methods in the UUO model to identify tissue hypoxia and fibrotic lesions. Additionally, we employed a cutting-edge method known as fluorescence microangiography (FMA) to find damage to the peritubular capillaries (PTCs), and MATLAB software was utilized to evaluate the data. Furthermore, by looking at the coexpression of CD31 and a-SMA, we were able to identify cells in the obstructed kidney that were transitioning from endothelium tomyofibroblasts.Moreover, the reduction of tissue hypoxia brought on by lncRNA TUG1 knockdown was dramatically reversed by inhibition of miR-542-3p, which also decreased the expression levels of fibrotic indicators. To sum up, our findings offer fresh perspectives on how TUG1 and the miR-542-3p / HIF-1α / VEGF axis are regulated as renal fibrosis advances.","manuscriptTitle":"LncRNA TUG1 mitigates renal interstitial fibrosis through miR-542-3p / HIF-1α/VEGF axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-15 11:58:13","doi":"10.21203/rs.3.rs-4022893/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"02f4092e-8c09-4068-86cc-cbaa018d8803","owner":[],"postedDate":"March 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-01T09:38:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-15 11:58:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4022893","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4022893","identity":"rs-4022893","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}