Pangenome-based design of strain-specific primers enables precise monitoring of bacteria in human microbiome intervention trials

Pangenome-based design of strain-specific primers enables precise monitoring of bacteria in human microbiome intervention trials | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Pangenome-based design of strain-specific primers enables precise monitoring of bacteria in human microbiome intervention trials Tom Eilers, Lize Delanghe, Ilke De Boeck, Tim Van Rillaer, Joke Van Malderen, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8210879/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Feb, 2026 Read the published version in Scientific Reports → Version 1 posted 14 You are reading this latest preprint version Abstract Lactic acid bacteria (LAB), including many well-known beneficial bacteria, are increasingly used in diverse applications, including probiotics. Among these, strains of Lactobacillaceae are extensively researched. Monitoring the survival and persistence of specific strains in across niches remains a challenge, as selective techniques at strain level are often lacking. Here, we present a robust pangenome-based approach for detecting unique target genes to develop strain-specific primers. We designed selective and specific primers for six strains across different LAB species. Primers for the widely used probiotic strains Lacticaseibacillus rhamnosus GG and Lactiplantibacillus plantarum WCFS1 were validated using in-house samples from three placebo-controlled human intervention studies. These strains were specifically tracked from body sites such as the skin and the upper respiratory tract, with clear differences between treatment and control samples. This gene-based qPCR method enables sensitive strain detection and can be readily extended to other bacterial strains for diverse research and industrial applications. Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Microbiology Figures Figure 1 Figure 2 Figure 3 Introduction Microbial applications are increasingly explored and implemented in different domains, such as probiotics 1 , medicine (live biotherapeutic products or LBPs 2 ), food (fermentation starter cultures 3 ), and agriculture (biocontrol 4 and biostimulant 5 ) applications. A key challenge in all these applications with live micro-organisms is obtaining sufficient survival of the specific strains so that they can optimally exert their activity and efficacy 6 . Therefore, effective and selective monitoring of applied strains is crucial. Probiotics are defined as “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host” 7 , with well-known examples belonging to the family of the Lactobacillaceae , such as Lacticaseibacillus rhamnosus GG 8 , and Lactiplantibacillus plantarum WCFS1 9 . This is a broad scientific definition, and probiotics can enter the market under different regulatory statuses 10 . The term live biotherapeutic product (LBP) is dedicated to live micro-organisms for which the intended use is prevention, treatment, or cure of a disease or condition in human beings 11 . The market for probiotics and LBPs is exponentially growing worldwide, with also the type of formulations and applications expanding beyond the gastrointestinal tract with only oral supplements or fermented dairy products 2 , 12 , 13 . Furthermore, the bacterial strains used as probiotics and LBPs are rapidly diversifying, indicating the need for specific detection of bacterial strains in the target niches such as gut 14 , 15 , skin 16 , vagina 17 , oral cavity 18 , URT 19 , and beyond). With a growing focus on (regulatory) awareness and research and development, monitoring strain survival, persistence and engraftment has become essential for quality and safety 20 , 21 . While selective culture conditions used to be sufficient for these monitoring objectives, they can only detect taxa in general levels such as ‘total number of lactic acid bacteria’ after plating on selective growth media. In addition, when absolute numbers of the bacteria in a certain niche are low, they will not be picked up with cultivation methods, because they are rapidly overgrown by fast-growing microorganisms 22 . Thus, strain-specific approaches that can better discriminate the supplemented strains from the native and naturally present bacteria in the target microbiomes is essential. Various tools exist for strain monitoring and tracking, which have evolved significantly in the genomic and genetic engineering era. Sensitive tools are often based on fluorescence 23 , bioluminescence 24 and DNA barcoding 25 . However, these methods all have the major drawback of requiring modifications and the introduction of exogenous DNA, resulting in genetically modified organisms (GMO). These strategies are thus not widely applicable from a regulatory point of view for probiotics or LBPs. Since the sequencing of the first genome in 1995 26 , over 36.000 genomes have been sequenced and made available online (based on version 214 of the Genome Taxonomy Database 27 ). This vast pool of genomic information has revolutionized science, allowing for innovative ways to study bacteria. These advancements include comparative genomics, refining the definition of a strain, and enabling the monitoring of specific strains. An important part of comparative genomics is pangenome inference, which involves clustering all genes of a set of genomes (in this paper, for each species) into gene families, or orthogroups. Genes within the same gene family are assumed to share a common function. Furthermore, the definition of a strain has been and remains the subject of debate 28 – 31 with no uniform definition established yet. In this study, we define strains as distinct when their average nucleotide identity (ANI) is below 99.99%. Non-GMO methods are thus a preferred alternative approach for probiotics and LBP and related strain monitoring in industry and real-life applications. Strain-level metagenome approaches are being developed 32 , but these approaches are still expensive as they require very deep sequencing to obtain sufficient genome coverage. We propose that the development of strain-specific primers combined with qPCR can be used as a cost-effective, quantitative and rapid method for strain monitoring 17 , 33 . While many studies have developed and implemented such primers, their development has not been adequately validated across a wide diversity of closely related strains, resulting in concerns about their specificity. For example, in the placebo-controlled Lactin-V study where application of Lactobacillus crispatus CTV-05 was investigated in 228 patients (152 verum, 76 placebo), the strain was also detected in 2–6% of the placebo group versus 48–84% of the treated group, while the placebo group should have never come into contact with the strain, hypothesizing that the DNA of other strains of L. crispatus (which are commonly present in women at high microbial loads) could also amplified with the primers 17 . In one of our own human studies with applied probiotic strains, cross-reactivity was also shown for primers that were designed on the srr gene (encoding fimbriae) in Lacticaseibacillus casei AMBR-0002, an accessory but non-unique gene for this species 33 . While this might not be a problem for habitats where lactobacilli are not dominant members, such as the skin 16 or respiratory tract 34 , other habitats such as the human vagina 35 and fermented foods 36 have a high prevalence of various closely related lactobacilli, making it crucial to find more unique gene primers. 17 . Hereto, the wealth of LAB genome information that is now publicly available can be leveraged. In this study we developed a pipeline that is widely applicable for LAB in different habitats and that depends on unique target genes of the strains of interest and qPCR. We first designed an in silico method to find unique accessory/target genes in a species’ pangenome in order to develop strain-specific primers. We then validated this method for six LAB strains: two widely used probiotic strains, i.e. Lacticaseibacillus rhamnosus GG and Lactiplantibacillus plantarum WCFS1 and four newly isolated strains of interest as novel probiotics or LBPs, i.e. Limosilactobacillus reuteri AMBV-0038, Limosilactobacillus reuteri AMBF-0471, Streptococcus salivarius AMBR-0024, and Streptococcus salivarius AMBR-0158. Cross-reactivity and qPCR efficiency were experimentally validated. Additionally, the applicability to monitor the persistence and establishment of strains of interest in different habitats and environments were validated for L. rhamnosus GG and L. plantarum WCFS1, two strains that were used in three placebo-controlled human intervention studies. Material and methods Strain selection Strains to validate the method were selected based on probiotic potential for different applications. We aimed for genus and species variability in our selection to test the broader application of our approach (Table 1 ). In addition, we selected strains with high genome accessibility and high safety profiles to make it possible to directly evaluate our approach in vivo . To validate the specificity and selectivity of this approach, additional strains were selected from the same species to test cross-reactivity (Table 1 ). Table 1 Strains used for in vitro validation in this paper. T = Selection of the different target strains used in this study. C = Strains used to test for cross-reactivity in this study Species Strain Genome accession number Isolation source and reference T Lacticaseibacillus rhamnosus GG GCF_000026505.1 Human gastrointestinal tract 37 , model probiotic strain C GR-1 GCF_900604925.1 Female urethra 38 , model probiotic strain C AMBR-0003 GCA_901830385.1 Human respiratory tract 34 C AMBR-0004 GCA_901830395.1 Human respiratory tract 34 T Lactiplantibacillus plantarum WCFS1 GCF_000203855.3 Human saliva 39 C CMPG5300 GCF_000762955.1 Human vagina 40 C 5057 Human ileostomy effluent 41 C ATCC8014 GCF_002370965.1 Corn silage 42 T Limosilactobacillus reuteri AMBV-0038 This paper Human vagina 43 T AMBF-0471 GCA_012275185.1 Chicken feces C RC-14 GCF_002762415.1 Female urogenital tract 44 C DSM 20016 GCF_000016825.1 Human feces 45 T Streptococcus salivarius AMBR-0024 GCF_905071825.1 Human respiratory tract 46 , T AMBR-0158 GCF_905071905.1 Human respiratory tract 46 C HSISS4 GCF_000448685.2 Human gastrointestinal tract 47 C ATCC25975 GCF_002094975.1 Saliva 48 Pangenome construction and selection of unique genes All genomes per species were selected using the genome taxonomy database v214 49 and downloaded from NCBI GenBank. Proteins were predicted with Prodigal version 2.6.3 (github.com/hyattpd/Prodigal) and pangenomes were inferred using SCARAP (github.com/swittouck/SCARAP). Genome content similarity was checked using fastANI 50 . Based on the pangenome, unique target genes were selected for the strains of interest, while excluding genomes that were virtually identical to those of the strains of interest. As an extra validation, unique genes were scanned with blast to ensure no off-targets were present with other species. The tool is made accessible on GitHub (github.com/TomEile/uniortho). Microbial RNA and DNA extraction For the primer efficiency and validation, DNA from overnight cultures of all selected bacterial strains was extracted. Strains were grown in deMAN, Rogosa and Sharpe (MRS) broth (Difco) or Brain Hearth Infusion (BHI) broth (Neogen Culture Media, USA). Subsequently, 10 8 CFU/mL of the overnight cultures was centrifuged and dissolved in phosphate-buffered saline (PBS), 500µl was then used for DNA extraction. For the application of the primers on clinical samples, 500µL of eNAT swab buffer was used for DNA extraction. Bacterial DNA was extracted using the PowerSoil Pro DNA Isolation Kit (Qiagen, Hilden, Germany), according to the instructions of the manufacturer and eluted in 50 µL. Next, DNA concentrations were measured using the Qubit 3.0 Fluorometer (Life Technologies, Ledeberg, Belgium). Primer design, optimization, and in vitro validation Primer sequences were designed to amplify the unique sequences and tested for cross-reactivity with other strains of the same species. We started with colony PCR for a first evaluation of possible cross-reactivity. PCR primers were designed in Geneious and synthesized by Integrated DNA Technologies (IDT, Leuven, Belgium). Of the different primer sequences designed by Geneious, the best primer pairs were selected based on the lowest hairpin, self-dimer, cross-dimer and melt temperature mismatching. 10 µl DNA sample was added to 15 µl mastermix (2.5 µl 10x VWR buffer, 2.5 µl 10 µM primers, 0.5 µl dNTPS 10mM, 0.2 µl Taq polymerase, 6.8 µl molecular grade water per sample), primers as indicated in Table 3. The following PCR conditions were used: denaturation at 95°C for 2 min., followed by 30 cycles at 95°C for 30 sec., 55°C for 30 sec. and 72°C for 1 min./kb, with the final extension at 72°C for 5 min. PCR products were visualized on a 1% agarose gel. Table 2 PCR primer sequences for the different target strains used in this paper Species Strain ID Primer sequence Lacticaseibacillus rhamnosus GG SL983 CGGCTTGACAGAGAATGCTA F PCR SL984 CCAAAGGCTCCGAAGTTGAA R PCR SL991 TGTCTCTGTCAAGCCGATTT F qPCR SL992 CGAGTGAAGTTGCATGTGAAG R qPCR Lactiplantibacillus plantarum WCFS1 SL975 CAGAGCTGTACCGCTTGTTA F PCR SL976 CTACGGCAATGCATTGTCCT R PCR SL604 GCCACAACACTTCAGCAATAC F qPCR SL605 GTGCCATACACCCTGGTAAG R qPCR Limosilactobacillus reuteri AMBV-0038 SL998 CAGGTCAGTAACTTATCAGC F PCR SL997 CTTGCTGAACTTGCGCTAGT R PCR SL988 TGGTCAAGACTGGCAAATGA F qPCR SL987 CTGTGCTGAGGTGTTCCATAA R qPCR Limosilactobacillus reuteri AMBF-0471 SL965 CGTGAGATTCTTGACGCCAT F PCR SL966 TTAGTCGTTGTCAGTGTCCG R PCR SL589 CGTGAGATTCTTGACGCCATAA F qPCR SL590 CCGCTGAATATCTTGGACAACT R qPCR Streptococcus salivarius AMBR-0024 SL967 GCGATTCCTGCTCTACATAC F PCR SL968 CTAGCTCTTGAAGCACCAAC R PCR SL591 ATGCGATTCCTGCTCTACATAC F qPCR SL592 TCCCTGCTCCTCCTTGAATA R qPCR Streptococcus salivarius AMBR-0158 SL981 ACGAAGAATAGTCGAGCGGA F PCR SL982 GGTAAATGTGTCTTACACCC R PCR SL637 TCGAGGAAGTACAGAGTTTGATG F qPCR SL638 GAACTCTTGCAAATCCAACACA R qPCR After evaluation of the absence of cross-reactivity for the selected unique sequences with colony PCR, qPCR primers were designed based on the selected unique sequences and primer design for intercalating dyes was performed in PrimerQuest™ Tool (IDT), using the default option for qPCR primers with intercalating dyes. Of the different primer sequences designed by PrimerQuest™ Tool the best primer pairs were selected based on the lowest hairpin, self-dimer, cross-dimer and melt temperature mismatching. These primer pairs were then first tested on primer efficiency whereafter the best primer pairs were selected to test on cross-reactivity. Primers were chemically synthesized by Integrated DNA Technologies (IDT, Leuven, Belgium), primer sequences in Table 4. To calculate the primer efficiency of the developed qPCR primers, standard curves were derived from serially diluted bacterial DNA (Figure S1 ). All primer efficiencies were between the required numbers of 90 and 110%, meaning that for each round of replication, the number of fragments was approximately doubled. The following qPCR conditions were used: pre-incubation at 50°C for 10 min., denaturation at 95°C for 20 sec., followed by 40 cycles at 95°C for 15 sec., and 60°C for 30 sec., with the melting curve at 95°C for 15 sec., 60°C for 1 min., 95°C for 15 sec. Primer efficiency was calculated using the formula by Bustin et al. 51 . All primer efficiencies were between the required numbers of 90 and 110%, meaning that for each round of replication, the number of fragments was approximately doubled. The specificity of the unique genes was validated by testing cross-reactivity of the primers for different strains from the respective species with qPCR. In situ v alidation of the primers To evaluate the application potential of strain-specific qPCR primers for L. rhamnosus GG and L. plantarum WCFS1, their presence was evaluated in two different habitats of the human body mainly from the skin and the upper respiratory tract (URT). For the skin, 40 facial skin samples were collected from a placebo-controlled clinical trial with a topical probiotic cream containing 10 9 -10 10 CFU/gram L. rhamnosus GG and L. plantarum WCFS1 52 . For the URT, L. plantarum WCFS1 was monitored in 24 throat samples from a placebo-controlled trial using a probiotic throat spray, containing 9.5x10 8 CFU/mL L. plantarum WCFS1 33 . To validate L. rhamnosus GG primers, nasopharyngeal samples from a separate placebo-controlled trial were analyzed, where participants consumed a chewable probiotic tablet containing 10 10 CFUs L. rhamnosus GG. qPCR was performed as described above, using a Ct-cutoff of 35. Samples with lower DNA concentrations, resulting in Ct values above this threshold, were excluded from further analysis to ensure reliable detection of the target strains. All studies complied with the Declaration of Helsinki and all studies were registered on clinicaltrials.gov (NCT04216160, NCT04793997, and NCT04898686). An informed consent was obtained from all participants prior to inclusion. The skin trial was approved by the Local Ethics Committee (LEC) of Investigation – Instituto de Pesquisas, registered by the National Research Ethics Commission (CONEP) of Brazil. The respiratory studies were approved by the ethical committee of the Antwerp University Hospital/University of Antwerp (Belgium, B3002021000018 and B3002020000086). The specifics about skin and both URT human intervention studies, including methods for study design, human subjects, sample collection, bacterial DNA extraction, and product formulation are more accurately described by Lebeer et al. (2022) 16 and De Boeck et al. (2022, 2025) 19 , 33 . Results Pangenome analyses can reveal strain-unique orthogroups A pipeline for the selection of unique accessory genes was designed to process the genomes of strains of interest and compile a list of all genes that are exclusive/unique to each strain within its respective species, along with their corresponding gene families (Fig. 1 A). This pangenome analysis revealed a substantial number of putative unique orthogroups for each species, indicating the presence of additional species for which unique target genes exist, suitable for strain monitoring (Fig. 1 B). We then focused on specific strains of interest and investigated whether they had unique genes. We performed this analysis for 6 strains from 4 species of interest for ongoing probiotic trials, with L. plantarum WCFS1 and L. rhamnosus GG as our model strains (Table 1 ). Among these analyzed strains, only the newly isolated strains L. reuteri AMBV-0038, L. reuteri AMBF-0471, S. salivarius AMBR-0024, and S. salivarius AMBR-0158, showed 3, 14, 19 and 7, unique orthogroups, respectively. For L. plantarum WCFS1 and L. rhamnosus GG, we did not find unique orthogroups, indicating that the publicly available genomes submitted for these strains were not unique or too similar, which we confirmed using fastANI (Fig. 1 C). L. plantarum WCFS1 had 2 genomes with an ANI larger than 99.99 and L. rhamnosus GG had 5 such submissions of potential clones sequenced several times (Supplementary table S1 ) Clones with an ANI above 99.99% from the analysis to determine unique orthogroups were excluded. As an additional verification step, BLAST analysis was performed to confirm the uniqueness of the identified orthogroups. This analysis showed that most orthogroups were indeed unique. However, for L. rhamnosus GG, the initially selected target gene was found to be non-unique. This was due to partial biological duplication of a this target gene, which, because of the pangenome construction method, was assigned to two separate orthogroups. Consequently, a different unique target gene was selected and validated to ensure specific detection. In vitro validation of unique orthogroups To validate the strategy of the unique orthogroups as targets for strain-specific primers, one of the unique orthogroups was selected for each strain based on size, GC content, and absence of long repeats. PCR primers were developed to experimentally check selectivity and sensitivity. For each target strain, this was tested against three other control strains per species (Table 1 ). A first evaluation of cross-reactivity was evaluated using the strain-specific PCR primers. For all unique accessory genes, the designed PCR primers (Table 2 ) tested negative for cross-reactivity against three other strains of the same species (Fig. 2 A), indicating the selectivity of the unique accessory genes. Next, qPCR primers were designed on the same unique accessory genes, which were generally smaller, ranging from 80–200 base pairs (Table 2 ). The specificity and primer efficiency of the qPCR primers was evaluated on three other strains within the same species (Fig. 2 B, Figure S1 ). Strain specificity of the qPCR primers was confirmed when the difference in Ct value between the target and other strains was 10 or higher and the strain specificity for all primer pairs could be confirmed by these results. Additionally, melt curves did not show any aspecific binding. Unique orthogroups approach can viably monitor the presence in different ecological niches To validate the application potential of strain-specific qPCR primers for tracking topically applied strains, we tested primers targeting L. rhamnosus GG and L. plantarum WCFS1 different samples from the human skin and URT. Skin samples were collected during a placebo-controlled intervention study, where a topical probiotic cream containing L. rhamnosus GG and L. plantarum WCFS1 was applied daily for 8 weeks 16 . After excluding samples with Ct > 35, L. rhamnosus GG was detected in 23/24 samples taken at 2, 4, and 8 weeks (mean Ct: 28.18). L. plantarum WCFS1 was detected in all 32 samples analyzed across timepoints 2, 4, 8, and 12 weeks (mean Ct: 26.53). In contrast, the control samples, i.e., baseline samples (timepoint 0) from the intervention group and samples from the placebo group, showed high or undetectable Ct values of both strains. L. rhamnosus GG was not detected in any of the 40 control samples analyzed, while L. plantarum WCFS1 was still detected in some control samples (10/48) using these primer combinations, however with a rather high mean Ct of 33.85. URT samples from two different placebo-controlled trials, one using a chewable probiotic with L. rhamnosus GG 19 and the other a throat spray containing L. rhamnosus GG and L. plantarum WCFS1 33 , also demonstrated high specificity and efficiency of the qPCR primers. L. rhamnosus GG was detected in 34/43 samples intervention samples (mean Ct value: 30.01) and only once in 45 control samples (Ct value: 33.63). L. plantarum WCFS1 was detected in 7/12 samples analyzed (mean Ct: 26.66) and was not detected in any of the 12 control samples. Discussion Although strain-specific qPCR is a well-established technique and has been applied in many papers, we noticed that the details around primer design are often not fully described in the literature. To address this, we developed a comparative genomics approach supported by an accessible and reproducible workflow for designing strain-specific primers (github.com/tomeile/uniortho). Advancements in whole genome sequencing technologies, as well as decreasing sequencing costs, have significantly expanded the number of available high-quality sequenced genomes. This increase enables more in-depth analysis of intraspecies variation through pangenome analysis. The pangenome represents the entire set of genes of a species or genus, and consists of a core genome, shared among all individuals, and an accessory genome, which varies between strains. In this study, we used pangenome analysis to reveal vast intraspecies diversity in different LAB of interest for probiotic applications. Based on this diversity, we developed a novel approach to track individual strains using unique accessory genes identified through comparative genomics. Our results demonstrated that, with a well-designed primer set, PCR and qPCR can be effectively used to monitor bacterial presence at the strain level, provided that there are enough genomes available. However, the minimum threshold of available genomes should still be evaluated in follow-up research. Additionally, the use of closely related species may be considered when there are not enough genomes available, which can be a limitation for rather rare species. Related to the availability of sufficient genomes, it should also be highlighted that an important measure we implemented is to dereplicate genomes, because some strains are sequenced multiple times and added multiple times in GTDB. For instance, L. rhamnosus GG is a widely used probiotic strain 30 , and likely sequenced multiple times, as also mentioned in Wuyts et al (2017) 53 . Similarly, for L. plantarum , one genome with an ANI above 99.99% compared to L. plantarum WCFS1 is available. These near-identical genomes makes the separation of strains less clear and must be excluded to ensure specificity. A significant challenge in developing strain-specific primers is the debate on the criteria that differentiate two strains from one another 28 – 31 . We used a pragmatic strain definition similar to Dijkshoorn et al. (2000) 29 . Nevertheless, a clear definition and a general consensus of strain-level classification can help to expand the use of the approach proposed in this paper. It is also important to note that certain applications, such as outbreak tracking, may not be feasible with this method due to the extremely short evolutionary timescales involved. During such events, strains may still exhibit ANI values above 99.99% because they are only recently diverged, making it difficult to distinguish them based on gene content. In these cases, intergenic regions, particularly recombination hotspots, could be explored as alternative targets. However, recombination itself can also introduce complications. For example, in the case of L. rhamnosus GG we encountered an issue where genomic duplication led to the identification of a falsely unique orthogroup. While the orthogroup was technically unique, the duplication prevented the design of a primer that could uniquely amplify this region. This highlights the importance of careful curation and validation of genomic data when designing strain-specific primers. After the detection of unique orthogroups and strain-specific primer development, the application potential of these strain-specific qPCR primers was validated on human microbiome samples from different niches after intervention with probiotic strains. The newly obtained results confirmed that the primers were selective to measure the concentration of the target strains on skin and URT swabs after topical application of these strains. In addition, the data confirmed that the two probiotic strains, L. rhamnosus GG and L. plantarum WCFS1 could at least temporarily establish on the skin and in the URT when applied. However, there was also a low detection in the control skin samples, which could be explained because of the natural presence of these strains on the skin 52 and/or because of cross-contamination during laboratory practices, which is even more important for low bacterial biomass niches such as the skin and respiratory tract. Overall, the results indicate the strain-specific primers were also efficient and selective for mixed microbial DNA samples. Our approach can also be applied more broadly. The high interest in studying LAB allowed us to immediately include the developed primers for in vitro and in vivo testing in various research projects 16 , 18 , 19 , 33 , 54 . For instance, the primers targeting L. reuteri AMBV-0038, L. reuteri AMBF-0471, S. salivarius AMBR-0024 and S. salivarius AMBR-0158 were used to evaluate the effect of these strains on in vitro periodontal biofilms, allowing us to real-time track the colonization potential of probiotic candidate strains within the biofilms, which is an important selection criterion 18 . Primers were designed to track absolute abundance of L. reuteri, L. jensenii and L. crispatus strains in a bottom-up synthetic community to study host independent community assembly in the human vagina 54 . Moreover, our method was previously used to design primers targeting L. rhamnosus GG to measure its colonization in vivo in the URT during and after probiotic intervention 33 , 55 . These results indicate the potential of this approach for different microbiome studies, e.g. human microbiome, food microbiology and environmental microbiomes. qPCR is a valuable technique to investigate absolute abundances of certain strains or species in microbiological DNA samples in these niches. The integration of qPCR data with amplicon and metagenomic sequencing data can overcome sequencing limitations, by providing absolute abundance data and give crucial insights into the community dynamics and interactions. Finally, the selection of unique genes based on the pangenome, combined with qPCR, provides a simple, fast and relatively inexpensive method for strain monitoring compared to currently used techniques such as fluorescence 23 , bioluminescence 24 and DNA barcoding 25 . In future research, it might even be possible to employ this technique of unique orthogroups for the creation of a curated database for metagenomics and metatranscriptomics. Conclusion In summary, this study provides a versatile and easy-to-use pipeline for developing strain-specific primers, enabling the tracking absolute abundances at strain-level (ANI below 99.99%) in samples of many different applications. The primers were subsequently validated with PCR and qPCR on non strain-specific cross-reactivity and application potential on human microbiome and vegetable fermentation samples. This tool is of interest to study efficacy and potency of strains, e.g. survival and performance as probiotics and LBPs, and could potentially be expanded to different families and even phyla for use in other applications. Declarations Competing Interests S.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare. Funding ERC starting grant Lacto-Be 852600 of SL supporting TE. TE is partially funded by VLAIO (HBC.2022.1000). LD was funded by Baekeland from VLAIO (HBC.2020.2873). IDB, SW, WVB, JVM were funded by grants from Research Foundation – Flanders (FWO, respectively grants 12S4222N, 12AZ624N, 1224923N, and 1S08523N). Competing interests S.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare. Data Availability Pipeline is publicly available on github (github.com/tomeile/uniortho). All genomes used were publicly available, the in-house genome of AMBV-0039 is published on ENA via project PRJEB74196. Author Contribution Conceived and designed the experiments: TE, LD, IDB, SL. Performed the experiments: LD, SB, JVM. Analyzed the data: TE, TVR. Contributed materials/analysis tools: TE, TVR, SW. Wrote the paper: TE, LD. Revised the paper: TE, LD, IDB, TVR, JVM, WVB, SL. Funding acquisition and project management: SL. All authors contributed, read and approved the final manuscript. Acknowledgement MK, CRD for the extra experiments. WVH for using the primers in his research. EO and IC for supplying skin samples of the acne intervention study. Kingsley C. Anukam and Chidozi N.E. Ibezim for supplying the chicken feces samples in the framework of the 2 months research stay of Chido Ibezem in our lab. Data Availability Pipeline is publicly available on github (github.com/tomeile/uniortho). All genomes used were publicly available, the in-house genome of AMBV-0039 is published on ENA via project PRJEB74196. References Larsen, I. S. et al. Experimental diets dictate the metabolic benefits of probiotics in obesity. Gut Microbes 15 , (2023). Nicola, T. et al. A lactobacilli-based inhaled live biotherapeutic product attenuates pulmonary neutrophilic inflammation. Nat Commun 15 , (2024). Leroy, F. & De Vuyst, L. Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci. Technol. 15 , 67–78 (2004). Legein, M. et al. Modes of Action of Microbial Biocontrol in the Phyllosphere. Front. Microbiol. 11 , 544057 (2020). Backer, R. et al. Plant Growth-Promoting Rhizobacteria: Context, Mechanisms of Action, and Roadmap to Commercialization of Biostimulants for Sustainable Agriculture. Front. Plant. Sci. 9 , 402666 (2018). Wendel, U. Assessing Viability and Stress Tolerance of Probiotics—A Review. Front. Microbiol. 12 , 818468 (2022). Hill, C. et al. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 11 , 506–514 (2014). Lebeer, S. et al. Functional analysis of lactobacillus rhamnosus GG pili in relation to adhesion and immunomodulatory interactions with intestinal epithelial cells. Appl. Environ. Microbiol. 78 , 185–193 (2012). de Vries, M. C., Vaughan, E. E., Kleerebezem, M. & de Vos, W. M. Lactobacillus plantarum—survival, functional and potential probiotic properties in the human intestinal tract. Int. Dairy. J. 16 , 1018–1028 (2006). Hill, C. et al. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014 118 (11), 506–514 (2014). FDA. Early Clinical Trials with Live Biotherapeutic Products: Chemistry, Manufacturing, and Control Information; Guidance for Industry. (2016). Vargason, A. M. & Anselmo, A. C. Live Biotherapeutic Products and Probiotics for the Skin. Adv. NanoBiomed Res. 1 , 1–6 (2021). Hemmerling, A. et al. Effect of the vaginal live biotherapeutic LACTIN-V (Lactobacillus crispatus CTV-05) on vaginal microbiota and genital tract inflammation among women at high risk of HIV acquisition in South Africa: a phase 2, randomised, placebo-controlled trial. Lancet Microbe . 6 , 1–12 (2025). Smillie, C. S. et al. Strain Tracking Reveals the Determinants of Bacterial Engraftment in the Human Gut Following Fecal Microbiota Transplantation. Cell. Host Microbe . 23 , 229–240e5 (2018). Kumar, R. et al. Identification of donor microbe species that colonize and persist long term in the recipient after fecal transplant for recurrent Clostridium difficile. NPJ Biofilms Microbiomes 3 , (2017). Lebeer, S. et al. Selective targeting of skin pathobionts and inflammation with topically applied lactobacilli. Cell. Rep. Med. 3 , 100521 (2022). Cohen, C. R. et al. Randomized Trial of Lactin-V to Prevent Recurrence of Bacterial Vaginosis. N Engl. J. Med. 382 , 1906–1915 (2020). Van Holm, W. et al. Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms. npj Biofilms Microbiomes . 9 , 1–12 (2023). De Boeck, I. et al. Lacticaseibacillus rhamnosus GG in a chewable colonizes the nose and facilitates local immune benefits in allergic rhinoconjunctivitis patients. Microbiol Spectr 0 , (2025). Capozzi, V., Fragasso, M. & Russo, P. Microbiological Safety and the Management of Microbial Resources in Artisanal Foods and Beverages: The Need for a Transdisciplinary Assessment to Conciliate Actual Trends and Risks Avoidance. Microorganisms 8, (2020). Ashaolu, T. J. Safety and quality of bacterially fermented functional foods and beverages: a mini review. Food Qual. Saf. 4 , 123–127 (2020). Bron, P. A., Grangette, C., Mercenier, A., De Vos, W. M. & Kleerebezem, M. Identification of Lactobacillus plantarum Genes That Are Induced in the Gastrointestinal Tract of Mice. J. Bacteriol. 186 , 5721 (2004). Spacova, I. et al. Expression of fluorescent proteins in Lactobacillus rhamnosus to study host–microbe and microbe–microbe interactions. Microb. Biotechnol. 11 , 317–331 (2018). Turpin, P. E., Maycroft, K. A., Bedford, J., Rowlands, C. L. & Wellington, E. M. H. A rapid luminescent-phage based MPN method for the enumeration of Salmonella typhimurium in environmental samples. Lett. Appl. Microbiol. 16 , 24–27 (1993). Fasanello, V. J., Liu, P., Botero, C. A. & Fay, J. C. High-throughput analysis of adaptation using barcoded strains of Saccharomyces cerevisiae. PeerJ 8 , e10118 (2020). Fleischmann, R. D. et al. Whole-Genome Random Sequencing and Assembly of Haemophilus influenzae Rd. Sci. (80-) . 269 , 496–512 (1995). Parks, D. H. et al. An ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic Acids Res. 50 , D785–D794 (2022). Anderson, B. D. & Bisanz, J. E. Challenges and opportunities of strain diversity in gut microbiome research. Front. Microbiol. 14 , 1–8 (2023). Dijkshoorn, L., Ursing, B. M. & Ursing, J. B. Strain, clone and species: Comments on three basic concepts of bacteriology. J. Med. Microbiol. 49 , 397–401 (2000). Hill, C. & International Scientific Association for Probiotics and Prebiotics (ISAPP). What is a strain in microbiology and why does it matter? ISAPP Sci. Blog (2022). Van Rossum, T., Ferretti, P., Maistrenko, O. M. & Bork, P. Diversity within species: interpreting strains in microbiomes. Nat. Rev. Microbiol. 18 , 491–506 (2020). Pasolli, E. et al. Large-scale genome-wide analysis links lactic acid bacteria from food with the gut microbiome. Nat. Commun. 11 , 1–12 (2020). De Boeck, I. et al. Randomized, Double-Blind, Placebo-Controlled Trial of a Throat Spray with Selected Lactobacilli in COVID-19 Outpatients. Microbiol Spectr 10 , (2022). De Boeck, I. et al. Lactobacilli Have a Niche in the Human Nose. Cell. Rep. 31 , 107674 (2020). Lebeer, S. et al. A citizen-science-enabled catalogue of the vaginal microbiome and associated factors. Nat. Microbiol. 8 , 2183–2195 (2022). Wuyts, S. et al. Carrot juice fermentations as man-made microbial ecosystems dominated by lactic acid bacteria. Appl. Environ. Microbiol. 84 , e00134–e00118 (2018). Kankainen, M. et al. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human- mucus binding protein. Proc. Natl. Acad. Sci. 106, 17193–17198 (2009). Petrova, M. I. et al. Comparative genomic and phenotypic analysis of the vaginal probiotic lactobacillus rhamnosus GR-1. Front Microbiol 9 , (2018). Kleerebezem, M. et al. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. 100, 1990–1995 (2003). Malik, S. et al. High mannose-specific lectin Msl mediates key interactions of the vaginal Lactobacillus plantarum isolate CMPG5300. Sci. Rep. 2016 61 (6), 1–16 (2016). Danielsen, M. Characterization of the tetracycline resistance plasmid pMD5057 from Lactobacillus plantarum 5057 reveals a composite structure. Plasmid 48 , 98–103 (2002). Leer, R. J., van Luijk, N., Posno, M. & Pouwels, P. H. Structural and functional analysis of two cryptic plasmids from Lactobacillus pentosus MD353 and Lactobacillus plantarum ATCC 8014. MGG Mol. Gen. Genet. 234 , 265–274 (1992). Allonsius, C. N. et al. Inhibition of Candida albicans morphogenesis by chitinase from Lactobacillus rhamnosus GG. Sci. Rep. 9 , 2900 (2019). Reid, G., Cook, R. L. & Bruce, A. W. Examination of strains of lactobacilli for properties that may influence bacterial interference in the urinary tract. J. Urol. 138 , 330–335 (1987). Sriramulu, D. D. et al. Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1,2-propanediol by disproportionation. J. Bacteriol. 190 , 4559–4567 (2008). Jörissen, J. et al. Case-Control Microbiome Study of Chronic Otitis Media with Effusion in Children Points at Streptococcus salivarius as a Pathobiont-Inhibiting Species. mSystems 6, (2021). Mignolet, J., Fontaine, L., Kleerebezem, M. & Hols, P. Complete genome sequence of Streptococcus salivarius HSISS4, a human commensal bacterium highly prevalent in the digestive tract. Genome Announc 4 , (2016). Butler, R. R., Soomer-James, J. T. A., Frenette, M. & Pombert, J. F. Complete genome sequences of two human oral microbiome commensals, Streptococcus salivarius ATCC 25975 and S. salivarius ATCC 27945. Genome Announc 5 , (2017). Parks, D. H. et al. GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic Acids Res. 50 , D785–D794 (2022). Jain, C., Rodriguez-R, L. M., Phillippy, A. M., Konstantinidis, K. T. & Aluru, S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat. Commun. 2018 . 91 9 , 1–8 (2018). Bustin, S. A. et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55 , 611–622 (2009). Lebeer, S. et al. Selective targeting of skin pathobionts and inflammation with topically applied lactobacilli. Cell Rep. Med 3 , (2022). Wuyts, S. et al. Large-Scale Phylogenomics of the Lactobacillus casei Group Highlights Taxonomic Inconsistencies and Reveals Novel Clade-Associated Features. mSystems 2, (2017). Vander Donck, L. et al. Host-independent synergism between Lactobacillus crispatus and other vaginal lactobacilli. Cell Rep 44 , (2025). De Boeck, I. et al. Lacticaseibacillus rhamnosus GG in a chewable colonizes the nose and facilitates local immune benefits in allergic rhinoconjunctivitis patients. (2024). 10.1101/2024.10.29.620974 Additional Declarations Competing interest reported. S.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare. Supplementary Files Supplementaryinformation.docx Cite Share Download PDF Status: Published Journal Publication published 27 Feb, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 25 Dec, 2025 Reviews received at journal 24 Dec, 2025 Reviews received at journal 22 Dec, 2025 Reviewers agreed at journal 19 Dec, 2025 Reviewers agreed at journal 18 Dec, 2025 Reviewers agreed at journal 18 Dec, 2025 Reviewers agreed at journal 17 Dec, 2025 Reviewers agreed at journal 17 Dec, 2025 Reviewers agreed at journal 17 Dec, 2025 Reviewers invited by journal 16 Dec, 2025 Editor assigned by journal 08 Dec, 2025 Editor invited by journal 02 Dec, 2025 Submission checks completed at journal 02 Dec, 2025 First submitted to journal 02 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8210879","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":562330104,"identity":"31e93053-bd41-4322-8bd0-ccf107516afa","order_by":0,"name":"Tom Eilers","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Tom","middleName":"","lastName":"Eilers","suffix":""},{"id":562330105,"identity":"95664cb1-6f6f-42b9-a3f8-5a46d749bb50","order_by":1,"name":"Lize Delanghe","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Lize","middleName":"","lastName":"Delanghe","suffix":""},{"id":562330106,"identity":"8ee94887-8155-4561-89b2-7b465f27a7d0","order_by":2,"name":"Ilke De Boeck","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Ilke","middleName":"","lastName":"De Boeck","suffix":""},{"id":562330107,"identity":"fef6995a-0fff-450c-a0b1-f71f2253fb88","order_by":3,"name":"Tim Van Rillaer","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Tim","middleName":"Van","lastName":"Rillaer","suffix":""},{"id":562330108,"identity":"457d2113-e858-4765-a324-70af4e4f318d","order_by":4,"name":"Joke Van Malderen","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Joke","middleName":"Van","lastName":"Malderen","suffix":""},{"id":562330110,"identity":"e564c250-5660-41be-964d-ede46014132b","order_by":5,"name":"Sam Bakelants","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Sam","middleName":"","lastName":"Bakelants","suffix":""},{"id":562330111,"identity":"ad798999-c2b4-4448-bcf4-d1c318c8102b","order_by":6,"name":"Wannes Van Beeck","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Wannes","middleName":"Van","lastName":"Beeck","suffix":""},{"id":562330116,"identity":"a1df92f3-af2e-44ad-aabc-b4b87f87805c","order_by":7,"name":"Stijn Wittouck","email":"","orcid":"","institution":"University of Antwerp","correspondingAuthor":false,"prefix":"","firstName":"Stijn","middleName":"","lastName":"Wittouck","suffix":""},{"id":562330117,"identity":"6120064d-d738-4bbf-804f-ab3f10e240ee","order_by":8,"name":"Sarah Lebeer","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGUlEQVRIiWNgGAWjYJACZgYGCwYDEOsDsrABfi0SYAWMM4AED0lamHmI0SLffvbh5wIGCTlz9uZjn23b7PLsJZKPfS6ouMNgzt6AVYvBmXRj6RkMEsaWPceSZ+e2JRfzSKQlz55x5hmDZc8B7FoY0hikeRgkEjfcyDFmzm1jTuyRBjJ42w4zGNxIwO6w/mfMv4Fa6jfcf/+Z2bKtHqgl/zMz7z+glvsPsHvmRhobyJYEgxs8zMyMbYdBtjAz8zaAbMGuw+DGMzZrHgMJw509acaMPeeOJ/bcf2bMPOPYYR7LHlwOS2O+zVNhI2/Ofvgxw4+y6sT2nsOPmQtqDgPDELv3YYGACoAxhYgf4gAzacpHwSgYBaNgmAMAAepU6DZgr0IAAAAASUVORK5CYII=","orcid":"","institution":"University of Antwerp","correspondingAuthor":true,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Lebeer","suffix":""}],"badges":[],"createdAt":"2025-11-26 09:08:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8210879/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8210879/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-41449-8","type":"published","date":"2026-02-27T15:59:21+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":98635986,"identity":"fa6d7735-27af-48ea-b9f2-6ba96609e6ae","added_by":"auto","created_at":"2025-12-19 17:26:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2080322,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptDevelopmentofstrainspecificprimersforlactobacillirevisionsV2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/d0811c9d4814c3cc529dd931.docx"},{"id":98636011,"identity":"413b8728-b8f3-4651-9a2b-ead554e9765e","added_by":"auto","created_at":"2025-12-19 17:26:58","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10042,"visible":true,"origin":"","legend":"","description":"","filename":"bae25f2fd25a4c19a102af3ea5796ff3.json","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/9a68fcc61113372340e450c5.json"},{"id":98635984,"identity":"34fb3eea-90b1-4502-bc89-1ce6a20261a8","added_by":"auto","created_at":"2025-12-19 17:26:50","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":218836,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/de1c373679a540dfbcd932e9.docx"},{"id":98635962,"identity":"6bc7b3c2-1e9f-42b4-a285-0f23ca89a09a","added_by":"auto","created_at":"2025-12-19 17:26:44","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128276,"visible":true,"origin":"","legend":"","description":"","filename":"bae25f2fd25a4c19a102af3ea5796ff31enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/b9fcbf05cddcc7dfbbef7bad.xml"},{"id":98636014,"identity":"351edf0b-d4a7-4c56-956d-9d1940d77eda","added_by":"auto","created_at":"2025-12-19 17:26:58","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":279407,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/49e3fde5a397a691b239e209.png"},{"id":98636009,"identity":"a678e998-af1b-4717-88a5-0835eef65983","added_by":"auto","created_at":"2025-12-19 17:26:57","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1061960,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/3fb84e26a48695f7dccb1a61.png"},{"id":98636008,"identity":"a494d70d-4e8b-44bb-ae0b-1633c2454473","added_by":"auto","created_at":"2025-12-19 17:26:57","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65446,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/bfcefea9a2ffe527e507690b.png"},{"id":98635867,"identity":"2b5f4b1c-90a4-44b1-9cdc-45153158a166","added_by":"auto","created_at":"2025-12-19 17:26:37","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92560,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/e08ab7fefcde770bd7b35ea7.png"},{"id":98636010,"identity":"1f3d06ba-8adf-4f19-aa18-a0ccdb06dd4f","added_by":"auto","created_at":"2025-12-19 17:26:57","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163496,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/19dae350e2e50205b2dc1096.png"},{"id":98635823,"identity":"5b6e753e-aedd-4465-8aff-d25a4bf5bfda","added_by":"auto","created_at":"2025-12-19 17:26:36","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24730,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/d90a2b5607be921f8753944f.png"},{"id":98636007,"identity":"7524c2f5-2cec-4cd1-928e-f702ad68a730","added_by":"auto","created_at":"2025-12-19 17:26:57","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125832,"visible":true,"origin":"","legend":"","description":"","filename":"bae25f2fd25a4c19a102af3ea5796ff31structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/384a94272cfde9523ba32966.xml"},{"id":98636004,"identity":"400d784a-c7aa-42fb-bf9a-e2bd5d287329","added_by":"auto","created_at":"2025-12-19 17:26:53","extension":"html","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140369,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/2eabfb7a3da5018dc8a97204.html"},{"id":98636005,"identity":"bb52fc6f-9f74-4042-876f-8a50c3af6d4e","added_by":"auto","created_at":"2025-12-19 17:26:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":312609,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatic identification of potential qPCR primer targets. A: Overview of the pipeline used to develop strain-specific primers B: Summary of core genes, accessory genes and singletons (unique target genes) across four species of interest. C: Average nucleotide identity (ANI) comparison to Lacticaseibacillus rhamnosus GG and L. plantarum WCFS1, with a cutoff of 99.99%.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/2eff0d76f040ebdfac8dbe34.png"},{"id":98636012,"identity":"2ee4cc40-64fe-4aaf-97ad-2690bf7687c5","added_by":"auto","created_at":"2025-12-19 17:26:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1088259,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of the primer specificity. (A) PCR results with the developed primers on the target strain and three non-target strains within the same species. (B) qPCR results using the developed primers on the target strain and three other strains within the same species. Cycle threshold (Ct)-values are plotted on the y-axis. Ct-values above a Ct of 35 or undetermined are shown in grey. A horizontal grey line indicates the Ct threshold of 35.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/d1a337186da3a823e77db20d.png"},{"id":98635987,"identity":"aa6b1943-7901-4a8a-9c2b-3956aee7f9e6","added_by":"auto","created_at":"2025-12-19 17:26:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":65446,"visible":true,"origin":"","legend":"\u003cp\u003eStrain monitoring of LGG and WCFS1 in two distinct niches using strain-specific primers. Sampling points were collapsed for visualization. Ct-values above 35 or undetermined are shown in grey. A horizontal grey line indicates the Ct threshold of 35. Numbers indicate how many samples were above this threshold or undetectable.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/b0a4f693940f047a38b1abd4.png"},{"id":103765631,"identity":"d6d7a154-94d2-4406-a531-a4c5e3365878","added_by":"auto","created_at":"2026-03-02 16:06:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2025098,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/64f33a76-1f9e-4cc1-a16c-4e1bff5091c0.pdf"},{"id":98635983,"identity":"6950bc63-5f3b-4190-991b-46cb1ba5fe64","added_by":"auto","created_at":"2025-12-19 17:26:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":218836,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8210879/v1/8f153493d919c76449f0e074.docx"}],"financialInterests":"Competing interest reported. S.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare.","formattedTitle":"Pangenome-based design of strain-specific primers enables precise monitoring of bacteria in human microbiome intervention trials","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMicrobial applications are increasingly explored and implemented in different domains, such as probiotics\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, medicine (live biotherapeutic products or LBPs\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e), food (fermentation starter cultures\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e), and agriculture (biocontrol\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e and biostimulant\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e) applications. A key challenge in all these applications with live micro-organisms is obtaining sufficient survival of the specific strains so that they can optimally exert their activity and efficacy\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Therefore, effective and selective monitoring of applied strains is crucial. Probiotics are defined as \u0026ldquo;live microorganisms that, when administered in adequate amounts, confer a health benefit on the host\u0026rdquo;\u003csup\u003e7\u003c/sup\u003e, with well-known examples belonging to the family of the \u003cem\u003eLactobacillaceae\u003c/em\u003e, such as \u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e GG\u003csup\u003e8\u003c/sup\u003e, and \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e WCFS1\u003csup\u003e9\u003c/sup\u003e. This is a broad scientific definition, and probiotics can enter the market under different regulatory statuses\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The term live biotherapeutic product (LBP) is dedicated to live micro-organisms for which the intended use is prevention, treatment, or cure of a disease or condition in human beings\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. The market for probiotics and LBPs is exponentially growing worldwide, with also the type of formulations and applications expanding beyond the gastrointestinal tract with only oral supplements or fermented dairy products\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Furthermore, the bacterial strains used as probiotics and LBPs are rapidly diversifying, indicating the need for specific detection of bacterial strains in the target niches such as gut \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, skin\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, vagina\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, oral cavity\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, URT\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, and beyond). With a growing focus on (regulatory) awareness and research and development, monitoring strain survival, persistence and engraftment has become essential for quality and safety\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWhile selective culture conditions used to be sufficient for these monitoring objectives, they can only detect taxa in general levels such as \u0026lsquo;total number of lactic acid bacteria\u0026rsquo; after plating on selective growth media. In addition, when absolute numbers of the bacteria in a certain niche are low, they will not be picked up with cultivation methods, because they are rapidly overgrown by fast-growing microorganisms\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Thus, strain-specific approaches that can better discriminate the supplemented strains from the native and naturally present bacteria in the target microbiomes is essential. Various tools exist for strain monitoring and tracking, which have evolved significantly in the genomic and genetic engineering era. Sensitive tools are often based on fluorescence\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, bioluminescence\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e and DNA barcoding\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. However, these methods all have the major drawback of requiring modifications and the introduction of exogenous DNA, resulting in genetically modified organisms (GMO). These strategies are thus not widely applicable from a regulatory point of view for probiotics or LBPs.\u003c/p\u003e \u003cp\u003eSince the sequencing of the first genome in 1995\u003csup\u003e26\u003c/sup\u003e, over 36.000 genomes have been sequenced and made available online (based on version 214 of the Genome Taxonomy Database\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e). This vast pool of genomic information has revolutionized science, allowing for innovative ways to study bacteria. These advancements include comparative genomics, refining the definition of a strain, and enabling the monitoring of specific strains. An important part of comparative genomics is pangenome inference, which involves clustering all genes of a set of genomes (in this paper, for each species) into gene families, or orthogroups. Genes within the same gene family are assumed to share a common function. Furthermore, the definition of a strain has been and remains the subject of debate\u003csup\u003e\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e with no uniform definition established yet. In this study, we define strains as distinct when their average nucleotide identity (ANI) is below 99.99%.\u003c/p\u003e \u003cp\u003eNon-GMO methods are thus a preferred alternative approach for probiotics and LBP and related strain monitoring in industry and real-life applications. Strain-level metagenome approaches are being developed\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, but these approaches are still expensive as they require very deep sequencing to obtain sufficient genome coverage. We propose that the development of strain-specific primers combined with qPCR can be used as a cost-effective, quantitative and rapid method for strain monitoring\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. While many studies have developed and implemented such primers, their development has not been adequately validated across a wide diversity of closely related strains, resulting in concerns about their specificity. For example, in the placebo-controlled Lactin-V study where application of \u003cem\u003eLactobacillus crispatus\u003c/em\u003e CTV-05 was investigated in 228 patients (152 verum, 76 placebo), the strain was also detected in 2\u0026ndash;6% of the placebo group versus 48\u0026ndash;84% of the treated group, while the placebo group should have never come into contact with the strain, hypothesizing that the DNA of other strains of \u003cem\u003eL. crispatus\u003c/em\u003e (which are commonly present in women at high microbial loads) could also amplified with the primers\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In one of our own human studies with applied probiotic strains, cross-reactivity was also shown for primers that were designed on the \u003cem\u003esrr\u003c/em\u003e gene (encoding fimbriae) in \u003cem\u003eLacticaseibacillus casei\u003c/em\u003e AMBR-0002, an accessory but non-unique gene for this species\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. While this might not be a problem for habitats where lactobacilli are not dominant members, such as the skin\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e or respiratory tract\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e, other habitats such as the human vagina\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e and fermented foods\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e have a high prevalence of various closely related lactobacilli, making it crucial to find more unique gene primers. \u003csup\u003e17\u003c/sup\u003e. Hereto, the wealth of LAB genome information that is now publicly available can be leveraged.\u003c/p\u003e \u003cp\u003eIn this study we developed a pipeline that is widely applicable for LAB in different habitats and that depends on unique target genes of the strains of interest and qPCR. We first designed an \u003cem\u003ein silico\u003c/em\u003e method to find unique accessory/target genes in a species\u0026rsquo; pangenome in order to develop strain-specific primers. We then validated this method for six LAB strains: two widely used probiotic strains, i.e. \u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e GG and \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e WCFS1 and four newly isolated strains of interest as novel probiotics or LBPs, i.e. \u003cem\u003eLimosilactobacillus reuteri\u003c/em\u003e AMBV-0038, \u003cem\u003eLimosilactobacillus reuteri\u003c/em\u003e AMBF-0471, \u003cem\u003eStreptococcus salivarius\u003c/em\u003e AMBR-0024, and \u003cem\u003eStreptococcus salivarius\u003c/em\u003e AMBR-0158. Cross-reactivity and qPCR efficiency were experimentally validated. Additionally, the applicability to monitor the persistence and establishment of strains of interest in different habitats and environments were validated for \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1, two strains that were used in three placebo-controlled human intervention studies.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003eStrain selection\u003c/p\u003e \u003cp\u003eStrains to validate the method were selected based on probiotic potential for different applications. We aimed for genus and species variability in our selection to test the broader application of our approach (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In addition, we selected strains with high genome accessibility and high safety profiles to make it possible to directly evaluate our approach \u003cem\u003ein vivo\u003c/em\u003e. To validate the specificity and selectivity of this approach, additional strains were selected from the same species to test cross-reactivity (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStrains used for in vitro validation in this paper. T\u0026thinsp;=\u0026thinsp;Selection of the different target strains used in this study. C\u0026thinsp;=\u0026thinsp;Strains used to test for cross-reactivity in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGenome accession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIsolation source and reference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLacticaseibacillus\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003erhamnosus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_000026505.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman gastrointestinal tract \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, model probiotic strain\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGR-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_900604925.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale urethra \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, model probiotic strain\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBR-0003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCA_901830385.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman respiratory tract \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBR-0004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCA_901830395.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman respiratory tract \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLactiplantibacillus\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003eplantarum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWCFS1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_000203855.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman saliva \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCMPG5300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_000762955.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman vagina \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5057\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman ileostomy effluent\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCC8014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_002370965.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCorn silage \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLimosilactobacillus reuteri\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBV-0038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis paper\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman vagina \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBF-0471\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCA_012275185.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChicken feces\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRC-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_002762415.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale urogenital tract \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDSM 20016\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_000016825.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman feces \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eStreptococcus salivarius\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBR-0024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_905071825.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman respiratory tract \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e,\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAMBR-0158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_905071905.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman respiratory tract \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHSISS4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_000448685.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHuman gastrointestinal tract \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCC25975\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCF_002094975.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSaliva \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ePangenome construction and selection of unique genes\u003c/p\u003e \u003cp\u003eAll genomes per species were selected using the genome taxonomy database v214\u003csup\u003e49\u003c/sup\u003e and downloaded from NCBI GenBank. Proteins were predicted with Prodigal version 2.6.3 (github.com/hyattpd/Prodigal) and pangenomes were inferred using SCARAP (github.com/swittouck/SCARAP). Genome content similarity was checked using fastANI\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Based on the pangenome, unique target genes were selected for the strains of interest, while excluding genomes that were virtually identical to those of the strains of interest. As an extra validation, unique genes were scanned with blast to ensure no off-targets were present with other species. The tool is made accessible on GitHub (github.com/TomEile/uniortho).\u003c/p\u003e \u003cp\u003eMicrobial RNA and DNA extraction\u003c/p\u003e \u003cp\u003eFor the primer efficiency and validation, DNA from overnight cultures of all selected bacterial strains was extracted. Strains were grown in deMAN, Rogosa and Sharpe (MRS) broth (Difco) or Brain Hearth Infusion (BHI) broth (Neogen Culture Media, USA). Subsequently, 10\u003csup\u003e8\u003c/sup\u003e CFU/mL of the overnight cultures was centrifuged and dissolved in phosphate-buffered saline (PBS), 500\u0026micro;l was then used for DNA extraction. For the application of the primers on clinical samples, 500\u0026micro;L of eNAT swab buffer was used for DNA extraction. Bacterial DNA was extracted using the PowerSoil Pro DNA Isolation Kit (Qiagen, Hilden, Germany), according to the instructions of the manufacturer and eluted in 50 \u0026micro;L. Next, DNA concentrations were measured using the Qubit 3.0 Fluorometer (Life Technologies, Ledeberg, Belgium).\u003c/p\u003e \u003cp\u003ePrimer design, optimization, and \u003cem\u003ein vitro\u003c/em\u003e validation\u003c/p\u003e \u003cp\u003ePrimer sequences were designed to amplify the unique sequences and tested for cross-reactivity with other strains of the same species. We started with colony PCR for a first evaluation of possible cross-reactivity. PCR primers were designed in Geneious and synthesized by Integrated DNA Technologies (IDT, Leuven, Belgium). Of the different primer sequences designed by Geneious, the best primer pairs were selected based on the lowest hairpin, self-dimer, cross-dimer and melt temperature mismatching. 10 \u0026micro;l DNA sample was added to 15 \u0026micro;l mastermix (2.5 \u0026micro;l 10x VWR buffer, 2.5 \u0026micro;l 10 \u0026micro;M primers, 0.5 \u0026micro;l dNTPS 10mM, 0.2 \u0026micro;l Taq polymerase, 6.8 \u0026micro;l molecular grade water per sample), primers as indicated in Table\u0026nbsp;3. The following PCR conditions were used: denaturation at 95\u0026deg;C for 2 min., followed by 30 cycles at 95\u0026deg;C for 30 sec., 55\u0026deg;C for 30 sec. and 72\u0026deg;C for 1 min./kb, with the final extension at 72\u0026deg;C for 5 min. PCR products were visualized on a 1% agarose gel.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR primer sequences for the different target strains used in this paper\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL983\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGCTTGACAGAGAATGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL984\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCAAAGGCTCCGAAGTTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL991\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTCTCTGTCAAGCCGATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL992\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGAGTGAAGTTGCATGTGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eWCFS1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL975\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGAGCTGTACCGCTTGTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL976\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTACGGCAATGCATTGTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL604\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCACAACACTTCAGCAATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL605\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGCCATACACCCTGGTAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLimosilactobacillus reuteri\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAMBV-0038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL998\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGGTCAGTAACTTATCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL997\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTGCTGAACTTGCGCTAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL988\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGGTCAAGACTGGCAAATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL987\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGTGCTGAGGTGTTCCATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eLimosilactobacillus reuteri\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAMBF-0471\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL965\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTGAGATTCTTGACGCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL966\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTAGTCGTTGTCAGTGTCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL589\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTGAGATTCTTGACGCCATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL590\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGCTGAATATCTTGGACAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eStreptococcus salivarius\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAMBR-0024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL967\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCGATTCCTGCTCTACATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL968\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTAGCTCTTGAAGCACCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL591\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATGCGATTCCTGCTCTACATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL592\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCCCTGCTCCTCCTTGAATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cem\u003eStreptococcus salivarius\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAMBR-0158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL981\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACGAAGAATAGTCGAGCGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL982\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTAAATGTGTCTTACACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL637\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCGAGGAAGTACAGAGTTTGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSL638\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAACTCTTGCAAATCCAACACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAfter evaluation of the absence of cross-reactivity for the selected unique sequences with colony PCR, qPCR primers were designed based on the selected unique sequences and primer design for intercalating dyes was performed in PrimerQuest\u0026trade; Tool (IDT), using the default option for qPCR primers with intercalating dyes. Of the different primer sequences designed by PrimerQuest\u0026trade; Tool the best primer pairs were selected based on the lowest hairpin, self-dimer, cross-dimer and melt temperature mismatching. These primer pairs were then first tested on primer efficiency whereafter the best primer pairs were selected to test on cross-reactivity. Primers were chemically synthesized by Integrated DNA Technologies (IDT, Leuven, Belgium), primer sequences in Table\u0026nbsp;4.\u003c/p\u003e \u003cp\u003eTo calculate the primer efficiency of the developed qPCR primers, standard curves were derived from serially diluted bacterial DNA (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). All primer efficiencies were between the required numbers of 90 and 110%, meaning that for each round of replication, the number of fragments was approximately doubled. The following qPCR conditions were used: pre-incubation at 50\u0026deg;C for 10 min., denaturation at 95\u0026deg;C for 20 sec., followed by 40 cycles at 95\u0026deg;C for 15 sec., and 60\u0026deg;C for 30 sec., with the melting curve at 95\u0026deg;C for 15 sec., 60\u0026deg;C for 1 min., 95\u0026deg;C for 15 sec. Primer efficiency was calculated using the formula by Bustin et al.\u003csup\u003e51\u003c/sup\u003e. All primer efficiencies were between the required numbers of 90 and 110%, meaning that for each round of replication, the number of fragments was approximately doubled.\u003c/p\u003e \u003cp\u003eThe specificity of the unique genes was validated by testing cross-reactivity of the primers for different strains from the respective species with qPCR.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn situ v\u003c/em\u003ealidation of the primers\u003c/p\u003e \u003cp\u003eTo evaluate the application potential of strain-specific qPCR primers for \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1, their presence was evaluated in two different habitats of the human body mainly from the skin and the upper respiratory tract (URT). For the skin, 40 facial skin samples were collected from a placebo-controlled clinical trial with a topical probiotic cream containing 10\u003csup\u003e9\u003c/sup\u003e-10\u003csup\u003e10\u003c/sup\u003e CFU/gram \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1\u003csup\u003e52\u003c/sup\u003e. For the URT, \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 was monitored in 24 throat samples from a placebo-controlled trial using a probiotic throat spray, containing 9.5x10\u003csup\u003e8\u003c/sup\u003e CFU/mL \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1\u003csup\u003e33\u003c/sup\u003e. To validate \u003cem\u003eL. rhamnosus\u003c/em\u003e GG primers, nasopharyngeal samples from a separate placebo-controlled trial were analyzed, where participants consumed a chewable probiotic tablet containing 10\u003csup\u003e10\u003c/sup\u003e CFUs \u003cem\u003eL. rhamnosus\u003c/em\u003e GG. qPCR was performed as described above, using a Ct-cutoff of 35. Samples with lower DNA concentrations, resulting in Ct values above this threshold, were excluded from further analysis to ensure reliable detection of the target strains.\u003c/p\u003e \u003cp\u003eAll studies complied with the Declaration of Helsinki and all studies were registered on clinicaltrials.gov (NCT04216160, NCT04793997, and NCT04898686). An informed consent was obtained from all participants prior to inclusion. The skin trial was approved by the Local Ethics Committee (LEC) of Investigation \u0026ndash; Instituto de Pesquisas, registered by the National Research Ethics Commission (CONEP) of Brazil. The respiratory studies were approved by the ethical committee of the Antwerp University Hospital/University of Antwerp (Belgium, B3002021000018 and B3002020000086). The specifics about skin and both URT human intervention studies, including methods for study design, human subjects, sample collection, bacterial DNA extraction, and product formulation are more accurately described by Lebeer et al. (2022)\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e and De Boeck et al. (2022, 2025)\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003ePangenome analyses can reveal strain-unique orthogroups\u003c/p\u003e \u003cp\u003eA pipeline for the selection of unique accessory genes was designed to process the genomes of strains of interest and compile a list of all genes that are exclusive/unique to each strain within its respective species, along with their corresponding gene families (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This pangenome analysis revealed a substantial number of putative unique orthogroups for each species, indicating the presence of additional species for which unique target genes exist, suitable for strain monitoring (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe then focused on specific strains of interest and investigated whether they had unique genes. We performed this analysis for 6 strains from 4 species of interest for ongoing probiotic trials, with \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 and \u003cem\u003eL. rhamnosus\u003c/em\u003e GG as our model strains (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Among these analyzed strains, only the newly isolated strains \u003cem\u003eL. reuteri\u003c/em\u003e AMBV-0038, \u003cem\u003eL. reuteri\u003c/em\u003e AMBF-0471, \u003cem\u003eS. salivarius\u003c/em\u003e AMBR-0024, \u003cem\u003eand S. salivarius\u003c/em\u003e AMBR-0158, showed 3, 14, 19 and 7, unique orthogroups, respectively. For \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 and \u003cem\u003eL. rhamnosus\u003c/em\u003e GG, we did not find unique orthogroups, indicating that the publicly available genomes submitted for these strains were not unique or too similar, which we confirmed using fastANI (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 had 2 genomes with an ANI larger than 99.99 and \u003cem\u003eL. rhamnosus\u003c/em\u003e GG had 5 such submissions of potential clones sequenced several times (Supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) Clones with an ANI above 99.99% from the analysis to determine unique orthogroups were excluded. As an additional verification step, BLAST analysis was performed to confirm the uniqueness of the identified orthogroups. This analysis showed that most orthogroups were indeed unique. However, for \u003cem\u003eL. rhamnosus\u003c/em\u003e GG, the initially selected target gene was found to be non-unique. This was due to partial biological duplication of a this target gene, which, because of the pangenome construction method, was assigned to two separate orthogroups. Consequently, a different unique target gene was selected and validated to ensure specific detection.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e validation of unique orthogroups\u003c/p\u003e \u003cp\u003eTo validate the strategy of the unique orthogroups as targets for strain-specific primers, one of the unique orthogroups was selected for each strain based on size, GC content, and absence of long repeats. PCR primers were developed to experimentally check selectivity and sensitivity. For each target strain, this was tested against three other control strains per species (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A first evaluation of cross-reactivity was evaluated using the strain-specific PCR primers. For all unique accessory genes, the designed PCR primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) tested negative for cross-reactivity against three other strains of the same species (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), indicating the selectivity of the unique accessory genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, qPCR primers were designed on the same unique accessory genes, which were generally smaller, ranging from 80\u0026ndash;200 base pairs (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The specificity and primer efficiency of the qPCR primers was evaluated on three other strains within the same species (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Strain specificity of the qPCR primers was confirmed when the difference in Ct value between the target and other strains was 10 or higher and the strain specificity for all primer pairs could be confirmed by these results. Additionally, melt curves did not show any aspecific binding.\u003c/p\u003e \u003cp\u003eUnique orthogroups approach can viably monitor the presence in different ecological niches\u003c/p\u003e \u003cp\u003eTo validate the application potential of strain-specific qPCR primers for tracking topically applied strains, we tested primers targeting \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 different samples from the human skin and URT.\u003c/p\u003e \u003cp\u003eSkin samples were collected during a placebo-controlled intervention study, where a topical probiotic cream containing \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 was applied daily for 8 weeks \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. After excluding samples with Ct\u0026thinsp;\u0026gt;\u0026thinsp;35, \u003cem\u003eL. rhamnosus\u003c/em\u003e GG was detected in 23/24 samples taken at 2, 4, and 8 weeks (mean Ct: 28.18). \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 was detected in all 32 samples analyzed across timepoints 2, 4, 8, and 12 weeks (mean Ct: 26.53). In contrast, the control samples, i.e., baseline samples (timepoint 0) from the intervention group and samples from the placebo group, showed high or undetectable Ct values of both strains. \u003cem\u003eL. rhamnosus\u003c/em\u003e GG was not detected in any of the 40 control samples analyzed, while \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 was still detected in some control samples (10/48) using these primer combinations, however with a rather high mean Ct of 33.85.\u003c/p\u003e \u003cp\u003eURT samples from two different placebo-controlled trials, one using a chewable probiotic with \u003cem\u003eL. rhamnosus\u003c/em\u003e GG \u003csup\u003e19\u003c/sup\u003e and the other a throat spray containing \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 \u003csup\u003e33\u003c/sup\u003e, also demonstrated high specificity and efficiency of the qPCR primers. \u003cem\u003eL. rhamnosus\u003c/em\u003e GG was detected in 34/43 samples intervention samples (mean Ct value: 30.01) and only once in 45 control samples (Ct value: 33.63). \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 was detected in 7/12 samples analyzed (mean Ct: 26.66) and was not detected in any of the 12 control samples.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough strain-specific qPCR is a well-established technique and has been applied in many papers, we noticed that the details around primer design are often not fully described in the literature. To address this, we developed a comparative genomics approach supported by an accessible and reproducible workflow for designing strain-specific primers (github.com/tomeile/uniortho).\u003c/p\u003e \u003cp\u003eAdvancements in whole genome sequencing technologies, as well as decreasing sequencing costs, have significantly expanded the number of available high-quality sequenced genomes. This increase enables more in-depth analysis of intraspecies variation through pangenome analysis. The pangenome represents the entire set of genes of a species or genus, and consists of a core genome, shared among all individuals, and an accessory genome, which varies between strains. In this study, we used pangenome analysis to reveal vast intraspecies diversity in different LAB of interest for probiotic applications. Based on this diversity, we developed a novel approach to track individual strains using unique accessory genes identified through comparative genomics.\u003c/p\u003e \u003cp\u003eOur results demonstrated that, with a well-designed primer set, PCR and qPCR can be effectively used to monitor bacterial presence at the strain level, provided that there are enough genomes available. However, the minimum threshold of available genomes should still be evaluated in follow-up research. Additionally, the use of closely related species may be considered when there are not enough genomes available, which can be a limitation for rather rare species. Related to the availability of sufficient genomes, it should also be highlighted that an important measure we implemented is to dereplicate genomes, because some strains are sequenced multiple times and added multiple times in GTDB. For instance, \u003cem\u003eL. rhamnosus\u003c/em\u003e GG is a widely used probiotic strain \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003c/sup\u003e and likely sequenced multiple times, as also mentioned in Wuyts et al (2017)\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Similarly, for \u003cem\u003eL. plantarum\u003c/em\u003e, one genome with an ANI above 99.99% compared to \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 is available. These near-identical genomes makes the separation of strains less clear and must be excluded to ensure specificity. A significant challenge in developing strain-specific primers is the debate on the criteria that differentiate two strains from one another\u003csup\u003e\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. We used a pragmatic strain definition similar to Dijkshoorn et al. (2000)\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Nevertheless, a clear definition and a general consensus of strain-level classification can help to expand the use of the approach proposed in this paper.\u003c/p\u003e \u003cp\u003eIt is also important to note that certain applications, such as outbreak tracking, may not be feasible with this method due to the extremely short evolutionary timescales involved. During such events, strains may still exhibit ANI values above 99.99% because they are only recently diverged, making it difficult to distinguish them based on gene content. In these cases, intergenic regions, particularly recombination hotspots, could be explored as alternative targets. However, recombination itself can also introduce complications. For example, in the case of \u003cem\u003eL. rhamnosus\u003c/em\u003e GG we encountered an issue where genomic duplication led to the identification of a falsely unique orthogroup. While the orthogroup was technically unique, the duplication prevented the design of a primer that could uniquely amplify this region. This highlights the importance of careful curation and validation of genomic data when designing strain-specific primers. After the detection of unique orthogroups and strain-specific primer development, the application potential of these strain-specific qPCR primers was validated on human microbiome samples from different niches after intervention with probiotic strains. The newly obtained results confirmed that the primers were selective to measure the concentration of the target strains on skin and URT swabs after topical application of these strains. In addition, the data confirmed that the two probiotic strains, \u003cem\u003eL. rhamnosus\u003c/em\u003e GG and \u003cem\u003eL. plantarum\u003c/em\u003e WCFS1 could at least temporarily establish on the skin and in the URT when applied. However, there was also a low detection in the control skin samples, which could be explained because of the natural presence of these strains on the skin\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e and/or because of cross-contamination during laboratory practices, which is even more important for low bacterial biomass niches such as the skin and respiratory tract. Overall, the results indicate the strain-specific primers were also efficient and selective for mixed microbial DNA samples.\u003c/p\u003e \u003cp\u003eOur approach can also be applied more broadly. The high interest in studying LAB allowed us to immediately include the developed primers for \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e testing in various research projects\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. For instance, the primers targeting \u003cem\u003eL. reuteri\u003c/em\u003e AMBV-0038, \u003cem\u003eL. reuteri\u003c/em\u003e AMBF-0471, \u003cem\u003eS. salivarius\u003c/em\u003e AMBR-0024 and \u003cem\u003eS. salivarius\u003c/em\u003e AMBR-0158 were used to evaluate the effect of these strains on \u003cem\u003ein vitro\u003c/em\u003e periodontal biofilms, allowing us to real-time track the colonization potential of probiotic candidate strains within the biofilms, which is an important selection criterion\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Primers were designed to track absolute abundance of \u003cem\u003eL. reuteri, L. jensenii\u003c/em\u003e and \u003cem\u003eL. crispatus\u003c/em\u003e strains in a bottom-up synthetic community to study host independent community assembly in the human vagina\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Moreover, our method was previously used to design primers targeting \u003cem\u003eL. rhamnosus\u003c/em\u003e GG to measure its colonization \u003cem\u003ein vivo\u003c/em\u003e in the URT during and after probiotic intervention\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. These results indicate the potential of this approach for different microbiome studies, e.g. human microbiome, food microbiology and environmental microbiomes. qPCR is a valuable technique to investigate absolute abundances of certain strains or species in microbiological DNA samples in these niches. The integration of qPCR data with amplicon and metagenomic sequencing data can overcome sequencing limitations, by providing absolute abundance data and give crucial insights into the community dynamics and interactions. Finally, the selection of unique genes based on the pangenome, combined with qPCR, provides a simple, fast and relatively inexpensive method for strain monitoring compared to currently used techniques such as fluorescence\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, bioluminescence\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e and DNA barcoding\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. In future research, it might even be possible to employ this technique of unique orthogroups for the creation of a curated database for metagenomics and metatranscriptomics.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study provides a versatile and easy-to-use pipeline for developing strain-specific primers, enabling the tracking absolute abundances at strain-level (ANI below 99.99%) in samples of many different applications. The primers were subsequently validated with PCR and qPCR on non strain-specific cross-reactivity and application potential on human microbiome and vegetable fermentation samples. This tool is of interest to study efficacy and potency of strains, e.g. survival and performance as probiotics and LBPs, and could potentially be expanded to different families and even phyla for use in other applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003cp\u003eS.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eERC starting grant Lacto-Be 852600 of SL supporting TE. TE is partially funded by VLAIO (HBC.2022.1000). LD was funded by Baekeland from VLAIO (HBC.2020.2873). IDB, SW, WVB, JVM were funded by grants from Research Foundation \u0026ndash; Flanders (FWO, respectively grants 12S4222N, 12AZ624N, 1224923N, and 1S08523N).\u003c/p\u003e \u003cp\u003eCompeting interests\u003c/p\u003e \u003cp\u003eS.L. received funding from different probiotic companies that were not involved in this research. L.D. was funded by VLAIO through a Baekeland mandate in collaboration with YUN NV. T.E. is partially funded through an industrial research VLAIO grant not related to this work. The remaining authors have no conflicts of interest to declare.\u003c/p\u003e \u003cp\u003eData Availability\u003c/p\u003e \u003cp\u003ePipeline is publicly available on github (github.com/tomeile/uniortho). All genomes used were publicly available, the in-house genome of AMBV-0039 is published on ENA via project PRJEB74196.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceived and designed the experiments: TE, LD, IDB, SL. Performed the experiments: LD, SB, JVM. Analyzed the data: TE, TVR. Contributed materials/analysis tools: TE, TVR, SW. Wrote the paper: TE, LD. Revised the paper: TE, LD, IDB, TVR, JVM, WVB, SL. Funding acquisition and project management: SL. All authors contributed, read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eMK, CRD for the extra experiments. WVH for using the primers in his research. EO and IC for supplying skin samples of the acne intervention study. Kingsley C. Anukam and Chidozi N.E. Ibezim for supplying the chicken feces samples in the framework of the 2 months research stay of Chido Ibezem in our lab.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003ePipeline is publicly available on github (github.com/tomeile/uniortho). All genomes used were publicly available, the in-house genome of AMBV-0039 is published on ENA via project PRJEB74196.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLarsen, I. S. et al. Experimental diets dictate the metabolic benefits of probiotics in obesity. \u003cem\u003eGut Microbes\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNicola, T. et al. A lactobacilli-based inhaled live biotherapeutic product attenuates pulmonary neutrophilic inflammation. \u003cem\u003eNat Commun\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeroy, F. \u0026amp; De Vuyst, L. Lactic acid bacteria as functional starter cultures for the food fermentation industry. \u003cem\u003eTrends Food Sci. Technol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 67\u0026ndash;78 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegein, M. et al. Modes of Action of Microbial Biocontrol in the Phyllosphere. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 544057 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBacker, R. et al. Plant Growth-Promoting Rhizobacteria: Context, Mechanisms of Action, and Roadmap to Commercialization of Biostimulants for Sustainable Agriculture. \u003cem\u003eFront. Plant. Sci.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 402666 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWendel, U. Assessing Viability and Stress Tolerance of Probiotics\u0026mdash;A Review. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 818468 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill, C. et al. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. \u003cem\u003eNat. Rev. Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 506\u0026ndash;514 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebeer, S. et al. Functional analysis of lactobacillus rhamnosus GG pili in relation to adhesion and immunomodulatory interactions with intestinal epithelial cells. \u003cem\u003eAppl. Environ. Microbiol.\u003c/em\u003e \u003cb\u003e78\u003c/b\u003e, 185\u0026ndash;193 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Vries, M. C., Vaughan, E. E., Kleerebezem, M. \u0026amp; de Vos, W. M. Lactobacillus plantarum\u0026mdash;survival, functional and potential probiotic properties in the human intestinal tract. \u003cem\u003eInt. Dairy. J.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1018\u0026ndash;1028 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill, C. et al. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. \u003cem\u003eNat. Rev. Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e2014 118\u003c/b\u003e (11), 506\u0026ndash;514 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFDA. Early Clinical Trials with Live Biotherapeutic Products: Chemistry, Manufacturing, and Control Information; Guidance for Industry. (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargason, A. M. \u0026amp; Anselmo, A. C. Live Biotherapeutic Products and Probiotics for the Skin. \u003cem\u003eAdv. NanoBiomed Res.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e, 1\u0026ndash;6 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHemmerling, A. et al. Effect of the vaginal live biotherapeutic LACTIN-V (Lactobacillus crispatus CTV-05) on vaginal microbiota and genital tract inflammation among women at high risk of HIV acquisition in South Africa: a phase 2, randomised, placebo-controlled trial. \u003cem\u003eLancet Microbe\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, 1\u0026ndash;12 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmillie, C. S. et al. Strain Tracking Reveals the Determinants of Bacterial Engraftment in the Human Gut Following Fecal Microbiota Transplantation. \u003cem\u003eCell. Host Microbe\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e, 229\u0026ndash;240e5 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, R. et al. Identification of donor microbe species that colonize and persist long term in the recipient after fecal transplant for recurrent Clostridium difficile. \u003cem\u003eNPJ Biofilms Microbiomes\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebeer, S. et al. Selective targeting of skin pathobionts and inflammation with topically applied lactobacilli. \u003cem\u003eCell. Rep. Med.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, 100521 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen, C. R. et al. Randomized Trial of Lactin-V to Prevent Recurrence of Bacterial Vaginosis. \u003cem\u003eN Engl. J. Med.\u003c/em\u003e \u003cb\u003e382\u003c/b\u003e, 1906\u0026ndash;1915 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Holm, W. et al. Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms. \u003cem\u003enpj Biofilms Microbiomes\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 1\u0026ndash;12 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Boeck, I. et al. Lacticaseibacillus rhamnosus GG in a chewable colonizes the nose and facilitates local immune benefits in allergic rhinoconjunctivitis patients. \u003cem\u003eMicrobiol Spectr\u003c/em\u003e \u003cb\u003e0\u003c/b\u003e, (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCapozzi, V., Fragasso, M. \u0026amp; Russo, P. Microbiological Safety and the Management of Microbial Resources in Artisanal Foods and Beverages: The Need for a Transdisciplinary Assessment to Conciliate Actual Trends and Risks Avoidance. \u003cem\u003eMicroorganisms\u003c/em\u003e 8, (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshaolu, T. J. Safety and quality of bacterially fermented functional foods and beverages: a mini review. \u003cem\u003eFood Qual. Saf.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 123\u0026ndash;127 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBron, P. A., Grangette, C., Mercenier, A., De Vos, W. M. \u0026amp; Kleerebezem, M. Identification of Lactobacillus plantarum Genes That Are Induced in the Gastrointestinal Tract of Mice. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cb\u003e186\u003c/b\u003e, 5721 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpacova, I. et al. Expression of fluorescent proteins in Lactobacillus rhamnosus to study host\u0026ndash;microbe and microbe\u0026ndash;microbe interactions. \u003cem\u003eMicrob. Biotechnol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 317\u0026ndash;331 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurpin, P. E., Maycroft, K. A., Bedford, J., Rowlands, C. L. \u0026amp; Wellington, E. M. H. A rapid luminescent-phage based MPN method for the enumeration of Salmonella typhimurium in environmental samples. \u003cem\u003eLett. Appl. Microbiol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 24\u0026ndash;27 (1993).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFasanello, V. J., Liu, P., Botero, C. A. \u0026amp; Fay, J. C. High-throughput analysis of adaptation using barcoded strains of Saccharomyces cerevisiae. \u003cem\u003ePeerJ\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, e10118 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFleischmann, R. D. et al. Whole-Genome Random Sequencing and Assembly of Haemophilus influenzae Rd. \u003cem\u003eSci. (80-)\u003c/em\u003e. \u003cb\u003e269\u003c/b\u003e, 496\u0026ndash;512 (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParks, D. H. et al. An ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, D785\u0026ndash;D794 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson, B. D. \u0026amp; Bisanz, J. E. Challenges and opportunities of strain diversity in gut microbiome research. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 1\u0026ndash;8 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDijkshoorn, L., Ursing, B. M. \u0026amp; Ursing, J. B. Strain, clone and species: Comments on three basic concepts of bacteriology. \u003cem\u003eJ. Med. Microbiol.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, 397\u0026ndash;401 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill, C. \u0026amp; International Scientific Association for Probiotics and Prebiotics (ISAPP). What is a strain in microbiology and why does it matter? \u003cem\u003eISAPP Sci. Blog\u003c/em\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Rossum, T., Ferretti, P., Maistrenko, O. M. \u0026amp; Bork, P. Diversity within species: interpreting strains in microbiomes. \u003cem\u003eNat. Rev. Microbiol.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 491\u0026ndash;506 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePasolli, E. et al. Large-scale genome-wide analysis links lactic acid bacteria from food with the gut microbiome. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1\u0026ndash;12 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Boeck, I. et al. Randomized, Double-Blind, Placebo-Controlled Trial of a Throat Spray with Selected Lactobacilli in COVID-19 Outpatients. \u003cem\u003eMicrobiol Spectr\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Boeck, I. et al. Lactobacilli Have a Niche in the Human Nose. \u003cem\u003eCell. Rep.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 107674 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebeer, S. et al. A citizen-science-enabled catalogue of the vaginal microbiome and associated factors. \u003cem\u003eNat. Microbiol.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 2183\u0026ndash;2195 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWuyts, S. et al. Carrot juice fermentations as man-made microbial ecosystems dominated by lactic acid bacteria. \u003cem\u003eAppl. Environ. Microbiol.\u003c/em\u003e \u003cb\u003e84\u003c/b\u003e, e00134\u0026ndash;e00118 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKankainen, M. et al. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human- mucus binding protein. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 106, 17193\u0026ndash;17198 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetrova, M. I. et al. Comparative genomic and phenotypic analysis of the vaginal probiotic lactobacillus rhamnosus GR-1. \u003cem\u003eFront Microbiol\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKleerebezem, M. et al. Complete genome sequence of Lactobacillus plantarum WCFS1. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 100, 1990\u0026ndash;1995 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalik, S. et al. High mannose-specific lectin Msl mediates key interactions of the vaginal Lactobacillus plantarum isolate CMPG5300. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e2016 61\u003c/b\u003e (6), 1\u0026ndash;16 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanielsen, M. Characterization of the tetracycline resistance plasmid pMD5057 from Lactobacillus plantarum 5057 reveals a composite structure. \u003cem\u003ePlasmid\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 98\u0026ndash;103 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeer, R. J., van Luijk, N., Posno, M. \u0026amp; Pouwels, P. H. Structural and functional analysis of two cryptic plasmids from Lactobacillus pentosus MD353 and Lactobacillus plantarum ATCC 8014. \u003cem\u003eMGG Mol. Gen. Genet.\u003c/em\u003e \u003cb\u003e234\u003c/b\u003e, 265\u0026ndash;274 (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllonsius, C. N. et al. Inhibition of Candida albicans morphogenesis by chitinase from Lactobacillus rhamnosus GG. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 2900 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReid, G., Cook, R. L. \u0026amp; Bruce, A. W. Examination of strains of lactobacilli for properties that may influence bacterial interference in the urinary tract. \u003cem\u003eJ. Urol.\u003c/em\u003e \u003cb\u003e138\u003c/b\u003e, 330\u0026ndash;335 (1987).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSriramulu, D. D. et al. Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1,2-propanediol by disproportionation. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cb\u003e190\u003c/b\u003e, 4559\u0026ndash;4567 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ\u0026ouml;rissen, J. et al. Case-Control Microbiome Study of Chronic Otitis Media with Effusion in Children Points at Streptococcus salivarius as a Pathobiont-Inhibiting Species. \u003cem\u003emSystems\u003c/em\u003e 6, (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMignolet, J., Fontaine, L., Kleerebezem, M. \u0026amp; Hols, P. Complete genome sequence of Streptococcus salivarius HSISS4, a human commensal bacterium highly prevalent in the digestive tract. \u003cem\u003eGenome Announc\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eButler, R. R., Soomer-James, J. T. A., Frenette, M. \u0026amp; Pombert, J. F. Complete genome sequences of two human oral microbiome commensals, Streptococcus salivarius ATCC 25975 and S. salivarius ATCC 27945. \u003cem\u003eGenome Announc\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParks, D. H. et al. GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, D785\u0026ndash;D794 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain, C., Rodriguez-R, L. M., Phillippy, A. M., Konstantinidis, K. T. \u0026amp; Aluru, S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. \u003cem\u003eNat. Commun. 2018\u003c/em\u003e. \u003cb\u003e91 9\u003c/b\u003e, 1\u0026ndash;8 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBustin, S. A. et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. \u003cem\u003eClin. Chem.\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, 611\u0026ndash;622 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebeer, S. et al. Selective targeting of skin pathobionts and inflammation with topically applied lactobacilli. \u003cem\u003eCell Rep. Med\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWuyts, S. et al. Large-Scale Phylogenomics of the Lactobacillus casei Group Highlights Taxonomic Inconsistencies and Reveals Novel Clade-Associated Features. \u003cem\u003emSystems\u003c/em\u003e 2, (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVander Donck, L. et al. Host-independent synergism between Lactobacillus crispatus and other vaginal lactobacilli. \u003cem\u003eCell Rep\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e, (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Boeck, I. et al. Lacticaseibacillus rhamnosus GG in a chewable colonizes the nose and facilitates local immune benefits in allergic rhinoconjunctivitis patients. (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2024.10.29.620974\u003c/span\u003e\u003cspan address=\"10.1101/2024.10.29.620974\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8210879/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8210879/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLactic acid bacteria (LAB), including many well-known beneficial bacteria, are increasingly used in diverse applications, including probiotics. Among these, strains of Lactobacillaceae are extensively researched. Monitoring the survival and persistence of specific strains in across niches remains a challenge, as selective techniques at strain level are often lacking.\u003c/p\u003e \u003cp\u003eHere, we present a robust pangenome-based approach for detecting unique target genes to develop strain-specific primers. We designed selective and specific primers for six strains across different LAB species. Primers for the widely used probiotic strains \u003cem\u003eLacticaseibacillus rhamnosus\u003c/em\u003e GG and \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e WCFS1 were validated using in-house samples from three placebo-controlled human intervention studies. These strains were specifically tracked from body sites such as the skin and the upper respiratory tract, with clear differences between treatment and control samples. This gene-based qPCR method enables sensitive strain detection and can be readily extended to other bacterial strains for diverse research and industrial applications.\u003c/p\u003e","manuscriptTitle":"Pangenome-based design of strain-specific primers enables precise monitoring of bacteria in human microbiome intervention trials","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-19 17:17:41","doi":"10.21203/rs.3.rs-8210879/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-25T09:18:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-25T03:13:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-22T19:32:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"211126819205906810094928783546334565675","date":"2025-12-19T19:32:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"73287985153192059320891125743836404070","date":"2025-12-18T10:48:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"24269076076242309564637557185822769945","date":"2025-12-18T05:21:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"10856942112744776562596569503158519216","date":"2025-12-18T03:38:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"206883044907358909079707693314577765933","date":"2025-12-17T14:01:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"240140009504559041019871029583145921891","date":"2025-12-17T10:57:17+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-17T04:59:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-08T17:26:35+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-12-02T18:14:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-02T10:10:56+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-12-02T09:21:09+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bc9a5a39-27cf-46a6-95b2-49c4ed2ed735","owner":[],"postedDate":"December 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":59880171,"name":"Biological sciences/Biological techniques"},{"id":59880172,"name":"Biological sciences/Biotechnology"},{"id":59880173,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2026-03-02T16:02:47+00:00","versionOfRecord":{"articleIdentity":"rs-8210879","link":"https://doi.org/10.1038/s41598-026-41449-8","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-02-27 15:59:21","publishedOnDateReadable":"February 27th, 2026"},"versionCreatedAt":"2025-12-19 17:17:41","video":"","vorDoi":"10.1038/s41598-026-41449-8","vorDoiUrl":"https://doi.org/10.1038/s41598-026-41449-8","workflowStages":[]},"version":"v1","identity":"rs-8210879","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8210879","identity":"rs-8210879","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}