Identification of A Novel Hybrid Sterility Locus S67 between temperate japonica subgroup and basmati subgroup in Oryza sativa L

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Asian cultivated rice (Oryza sativa) is the most important cultivated species in the AA genome species of the genus Oryza. basmati is a special and famous subgroup in Asian cultivated rice, and temperate japonica is one of the most important cultivated subgroup, too. However, hybrid sterility hinders the introgression of favorable traits and the utilization of hybrid vigour between them. The genetic basis of intraspecific hybrid sterility between temperate japonica and basmati remained elusive. In this study, a novel hybrid sterility locus S67 was identified, which caused hybrid male sterility in hybrids between the temperate japonica rice variety Dianjingyou 1(DJY1) and the basmati rice variety Dom-sufid. Initial mapping with BC1F1, BC4F1, BC4F2 populations and DNA markers located S67 between RM5362(41087022) and K1-40.6(41824986) on the long arm of chromosome 1. Genetic analysis confirmed that S67 caused a transmission advantage for the temperate japonica rice S67-te allele in the hybrid offsprings. This result not only fills the gap in the research on hybrid sterility between basmati and temperate japonica, but also lays a good foundation for the systematic study of the genetic rules of hybrid sterility between basmati and other subgroups, as well as the full exploration and utilization of this subgroup through the creation of wide or specific compatibility lines to overcome hybrid sterility. In addition, this result can also help us broaden our understanding of genetic differentiation within Asian cultivated rice and hybrid sterility between inter-subgroups.
Full text 139,002 characters · extracted from preprint-html · click to expand
Identification of A Novel Hybrid Sterility Locus S67 between temperate japonica subgroup and basmati subgroup in Oryza sativa L | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Identification of A Novel Hybrid Sterility Locus S67 between temperate japonica subgroup and basmati subgroup in Oryza sativa L Yonggang Lv, Jing Li, Ying Yang, Qiuhong Pu, Jiawu Zhou, Xianneng Deng, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4434612/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Nov, 2024 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Asian cultivated rice ( Oryza sativa ) is the most important cultivated species in the AA genome species of the genus Oryza . basmati is a special and famous subgroup in Asian cultivated rice, and temperate japonica is one of the most important cultivated subgroup, too. However, hybrid sterility hinders the introgression of favorable traits and the utilization of hybrid vigour between them. The genetic basis of intraspecific hybrid sterility between temperate japonica and basmati remained elusive. In this study, a novel hybrid sterility locus S67 was identified, which caused hybrid male sterility in hybrids between the temperate japonica rice variety Dianjingyou 1(DJY1) and the basmati rice variety Dom-sufid. Initial mapping with BC 1 F 1 , BC 4 F 1 , BC 4 F 2 populations and DNA markers located S67 between RM5362(41087022) and K1-40.6(41824986) on the long arm of chromosome 1. Genetic analysis confirmed that S67 caused a transmission advantage for the temperate japonica rice S67-te allele in the hybrid offsprings. This result not only fills the gap in the research on hybrid sterility between basmati and temperate japonica , but also lays a good foundation for the systematic study of the genetic rules of hybrid sterility between basmati and other subgroups, as well as the full exploration and utilization of this subgroup through the creation of wide or specific compatibility lines to overcome hybrid sterility. In addition, this result can also help us broaden our understanding of genetic differentiation within Asian cultivated rice and hybrid sterility between inter-subgroups. Biological sciences/Genetics Biological sciences/Genetics/Genetic hybridization Biological sciences/Genetics/Plant breeding Biological sciences/Genetics/Plant genetics Biological sciences/Plant sciences Biological sciences/Plant sciences/Plant breeding Biological sciences/Plant sciences/Plant genetics hybrid sterility Oryza sativa basmati temperate japonica S67 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Rice is one of the most important food crops in the world, feeding more than half of the global population (Fukagawa et al. 2019 ). The utilization of heterosis played a significant role in improving rice yield per unit area (Yu et al. 2016 ). However, the growth of rice yield entered a bottleneck period, the fundamental reason is that the genetic diversity of hybrid rice parents is narrow (Tang et al. 2017 ). Asian cultivated rice, the most important cultivated species in the AA genome rice species of the genus Oryza , mainly comprises two subspecies, indica and japonica (Kato 1930 ; Hikoichi 1952 ), and some relatively small ecological subgroups. Currently, most studies classified Asian cultivated rice into five subgroups based on molecular biology, genomics, and other characteristics: temperate japonica , tropical japonica , indica , aus and basmati (Glaszmann 1987 ; Garris et al. 2005 ; McNally et al. 2009 ; Civáň et al. 2015 ; Wang et al. 2018 ; Kishor et al. 2020 ; Zhang et al. 2022 ). Numerous studies and breeding practices shown that the hybridization-introgression of subgroups within Asian cultivated rice played a very important role and had great potential for the utilization of heterosis and the improvement of rice yield, quality, and resistance (Brar et al . 2018; McNally et al. 2009 ; Bai et al. 2018 ; Wang et al. 2018 ; Kiran et al. 2020 ). Thus, fully mining and introgression of favorable alleles from minor subgroups of Asian cultivated rice is an important way to enrich the genetic diversity of existing breeding populations. Basmati is a unique subgroup of Asian cultivated rice, mainly distributed in countries in South Asia, Southeast Asia, Central Asia, and West Asia such as Pakistan, India, Bangladesh, Myanmar, Iran, etc (Glaszmann 1987 ; Khush 2000 ; Khin et al. 2012 ; Civáň et al . 2019; Choi et al. 2020 ). It is one of the important agricultural trade commodities in these regions (Ashfaq et al. 2015 ; Satishkumar et al. 2016 ;). The main feature of basmati rice exhibits its excellent longitudinal elongation of rice grains during cooking (about twice as much as before), and the soft and fluffy texture of cooked rice, with a unique nutty aroma, known as the "king of rice". basmati rice is rich in trace elements such as zinc and iron, and has a low blood sugar index (Khush 2000 ). In addition, basmati rice also contains rich WA-CMS restorer resources and significant potential for nitrogen efficient utilization and storage tolerance (Foster-Powell et al. 2002 ; Ashok et al. 2015 ; Wang et al. 2016 ; Liu et al. 2021 ). Therefore, basmati rice not only has very high economic value and international trade status, but also has a very important position and significance in the classification, genetic research, and breeding application in Asian cultivated rice. Temperate japonica is one of the main subgroup of Asian cultivated rice, mainly distributed in a few countries and regions such as East Asia, the Mediterranean, Europe, and North America, including China, Japan, South Korea, Egypt, North Korea, the United States, etc. The annual planting area of temperate japonica accounts for about 9% of the world's total rice area, and the total yield accounts for about 14% of the world's total rice production. Given the excellent quality, its market demand continues to increase. However, the breeding and production of temperate japonica rice also faces serious problems, such as insufficient genetic diversity of germplasm resources. Basmati is a very excellent germplasm resource, which can be used for genetic improvement by hybridizing with temperate japonica varieties, which helps breed rice varieties with better yield, quality, and adaptability. Unfortunately, the severe hybrid sterility between these two subgroups limits the utilization of heterosis and introgression breeding between them (Wang et al. 2023 ). Identifying and analyzing the hybrid sterility genes between them can help overcome hybrid sterility and better understand the nature of this reproductive barrier, and promote the application of distant parents in hybrid breeding. Hybrid sterility is the most common form of postzygotic reproductive isolation in plant species. The hybrid sterility between Asian cultivated rice indica and japonica subgroups is the most classic case of postzygotic reproductive isolation and has always been a focus of genetic research. So far, more than 30 genes/QTLs conferring sterility in inter-subspecific hybrids in Asian cultivated rice were reported (Ouyang 2019 ; Xie et al. 2019 ; Zhang 2020 ; Zhang et al. 2022 ), of which seven hybrid sterility loci ( S5 , Sa , hsa1 , S7 , Sc , RHS12/Pf12/Se, DPL1/DPL2 ) were cloned (Chen et al. 2008 ; Long et al. 2008 ; Mizuta et al. 2010 ; Yang et al. 2012; Kubo et al. 2016 ; Yu et al. 2016 ; Shen et al. 2017 ; Wang et al. 2023 ; Zhou et al. 2023 ). Twenty-two hybrid sterility loci were described between indica and temperate japonica cultivars, including major genes such as S5 , Sa , Sc , RHS12/Pf12/Se (Zhang et al. 2022 ). In addition to indica and temperate japonica , some hybrid sterility loci were also found in other subgroups of Asian cultivated rice. DPL1 / DPL2 resulted in male gametes abortion and qSIG3.1 , qSIG3.2 , qSIG6.1 and qSIG12.1 resulted in female gametes abortion in the crosses between temperate japonica and aus (Mizuta et al. 2010 , Rao et al. 2021 ); S7 and S15 were responsible for female gamete sterility in the hybrid between indica and aus (Wan et al. 1996 ; Yu et al. 2016 ); S8 , S9 , S16 , S17 , S29 , S31 , S32 , qSS-2 , and qSS-8b gave rise to female gametes abortion in the hybrid between tropical japonica and temperate japonica (Wan et al . 1995; Wan et al. 1998 ; Li et al. 2005 , 2007 ; Wang et al. 2005 ; Zhu et al. 2005 ; Zhao et al. 2007 ); S7 , S8 , S9 , and S35 (t) led to the female sterility in the cross between tropical japonica and indica (Wan et al., 1993 , 1996 ; Chen et al., 2012 ); S7 and S9 controlled the hybrid female sterility between tropical japonica and aus (Wan et al., 1996 ; Yanagihara et al., 1992 ). These hybrid sterility genes or QTLs identified in the different subgroups will lay the foundation for elucidating the genetic and molecular mechanisms of hybrid sterility in Asian cultivated rice, and for breeding utilization. But, so far, due to the severe hybrid sterility between basmati and other subgroups, the hybrid introgression and utilization of favorable agronomic traits are very limited. A few of research was also limited to describing the phenomenon of hybrid sterility between basmati and other subgroups or the coincidental utilization of single hybrid sterility gene (Cheng et al. 1990 ; Dolores et al. 1975 ; Xu et al., 2022 ). At present, there are no systematic studies on hybrid sterility between basmati and other subgroups, and no hybrid sterility genes or QTLs were identified in the cross between them. In the present study, a major inter-subgroup hybrid male sterility locus S67 in the hybrids between basmati and temperate japonica in Asian cultivated rice that conferred selective abortion of male gametes carrying the basmati allele, giving a transmission advantage to the temperate japonica allele, was identified. S67 was delimited between RM5362(41087022) and K1-40.6(41824986) on the long arm of chromosome 1 by linkage analysis. In addition, the degree of segregation distortion and the mode of gamete transmission were analysed by developing reciprocal test crosses between the plants with the NIL- S67 (H) genotype in BC 4 F 2 and recurrent parent DJY1. Judging from the locus location and action mode, this locus was confirmed as a new finding of hybrid sterility between basmati and temperate japonica . Results The confirmation of hybrid sterility between basmati and temperate japonica rice Severe pollen and spikelet sterility was observed in the F 1 obtained between basmati accession Dom-sufid and temperate japonica cultivar DJY1 (Fig. 1 ). This phenomenon was also found when studying the cross compatibility between the five different subgroups of Asian cultivated rice with indica and japonica (Wang et al. 2023 ). The pollen and spikelet fertility distribution of BC 1 F 1 to BC 3 F 1 was continuous, fertile, semi-sterility, and sterility plants could still be found, and gradually showing a bimodal distribution with the increase of backcross generations (Fig. 2 a-c), while BC 4 F 1 only had fertile and semi sterility plants (Fig. 2 d). The results showed that inter-subgroup hybrid sterility between temperate japonica and basmati in Asian cultivated rice controlled by multiple genes in the preliminary populations was gradually decomposed into a simple inheritance mode, and a significant amount of genetic noise was removed after four generations phenotypic selection and continuous backcrossing, which facilitated the detection and confirmation of loci in the advanced backcrossing population. Detection of QTL for hybrid sterility in BC 1 F 1 The linkage map comprised of 663 polymorphic SNP markers and spans 2311.93 cM. The mean interval between markers was about 3.49 cM. QTL for pollen and spikelet fertility analyzed by composite interval mapping was presented in Table 1 . Two QTL ( qSS3 , qSS6 ) for spikelet fertility were detected on chromosomes 3 and 6, explained 8.48% and 20.35% of the total spikelet fertility variation, respectively, and accounted for 28.83% of the total variation. Three QTL ( qPS1.1 , qPS1.2 and qPS2 ) for pollen fertility were detected on chromosomes 1, and 2. These QTL individually explained 5.52–53.80% of the total phenotypic variation, and accounted for 66.14% of the total variation. Among these QTL, qPS1.2 was the most effective QTL, which explained 53.80% of the total pollen fertility variation, and was selected for in-depth mapping and genetic analysis in this study. Then, based on the molecular marker RM5362 genotypes (Table 2 ), tightly linked to qPS1.2 locus, and the phenotypes in each generation, continuous backcross to obtain BC 4 F 1 was made. Table 1 QTL detected for pollen and spikelet fertility based on interval mapping and composite interval mapping in the BC 1 F 1 population Trait Chromosome Position (cM) Left Marker Right Marker LOD PVE (%) QTL Pollen fertility 1 114.71 OsGRb01924 OsGRg01176 4.81 6.82 qPS1.1 Pollen fertility 1 165.70 OsGRb02912 OsGRb02939 26.03 53.80 qPS1.2 Pollen fertility 2 89.04 OsGRg03023 OsGRb04514 4.03 5.52 qPS2 Spikelet fertility 3 49.01 OsGRg04981 OsGRg04861 6.44 8.48 qSS3 Spikelet fertility 6 80.58 OsGRb30999 OsGRg09935 3.71 20.35 qSS6 Table 2 Primer sequences of molecular markers for mapping the S67 locus on rice chromosome 1 Marker Name Primer Sequence Position Marker Type K1-40.7 GACGAACAATCGGTTGGGTTTCAGAGTTAGCTTCAGAGTAGACAGAACGC[A/G]ACCAAAATCAAATATGAATATGTATTTTTATACCTGCAAGTTGCAGCAAC 40448552 SNP K1-40.9 TTGAAGTCCTGGCAGACGTGCGCCACCGCTGGCTTCTCCGGTGGGCTGCT[A/C]CGTGCCATCTGCGCGATGATGGCGTTGTTGCTCTCCCAGAATCCCATTTC 41067447 SNP RM5362 F-GCGCTAGGGCTTTGGATC R-TACCTTCCTTACTCTGCCCG 41087022 SSR K1-40.6 TGGTCCGGAGTCGGGTCTCCTCCAGCGCGAAGCTGACGAACTTGTGGTAC[A/G]GCAAGCCGGCGCCCAAGCTCCCGCCGCCGACGCCGCCGCTGCTCATGCTC 41824986 SNP K1-40.11 CTGCCATTTACTAGTAGTAGGGGAGCGTGAAGGTTGCTCGATGCATTTAT[T/C]CCGGACGACGGGATAACTCGATGGATCGCTGCACCGTGTACACAAGCAAA 42050647 SNP RM1067 F- CGATGGAGAGAGAATGTCTAGC R- TAATACGCAAGGCAGAAGGG 42923261 SSR Genetic linkage analysis and mapping of the S67 locus In BC 4 F 1 , only two type plants: fertile and semi-sterility could be found, and they were used to detect for genetic background and target fragments introgression using Rice 6k Chips. The results showed that about 97% of the genetic background of BC 4 F 1 plants was the same as that of their recurrent parent (Fig. 3 ), and introgression fragments of the qPS1.2 locus were also detected in 5 semi-sterility pollen grain plants, 136-1-1, 136-1-5, 136-1-6, 136-1-7, 136-1-10. To map qPS1.2 , one of the semi-sterility individual 136-1-1, which had a clean background and carried the qPS1.2 locus in BC 4 F 1, was selected to selfing and form BC 4 F 2 mapping population. Among 390 plants in the BC 4 F 2 population, pollen fertility showed bimodal distribution, divided into semi-sterility and fertile and spikelet fertility of all plant were normal (Fig. 4 and Fig. 5 ). By means of linkage analysis using phenotypic data and six polymorphic molecular markers (Table 2 ), qPS1.2 was located in a 2.95 cM region flanked by RM5362 and K1-40.6 on the long arm of chromosome 1 (Fig. 6 ). Segregation distortion and gametes transmission of the S67 locus To clarify the relationship between the introgression segments and the semi-sterility phenotype, the pollen fertility of 390 BC 4 F 2 plants and the segregation of their genotypes of the molecular marker RM5362 was analysed. One hundred and eighty-six plants exhibited semi-sterility pollen grain and 204 plants exhibited fully fertile pollen grain in BC 4 F 2 was found. All plants that exhibited semi-sterility carried heterozygous genotypes and all plants that showed fully fertile pollen grain harbored the homozygous temperate japonica DJY1 genotype, which were deteceted with molecular markers RM5362. The final detection results showed that no any plants with homozygous basmati Dom-sufid genotype was obtained in this population. This detected genotype segregation was χ 2 (1:2:1) = 214.25, did not match the expected ratio, but fitted the typical segregation ratio (1:1, χ 2 = 0.83) of hybrid sterility gene (Table 3 ). In fact, no plants with homozygous basmati Dom-sufid genotype were detected in another large population of 1344 BC 4 F 3 plants (Additional file 1: Table S1 ). This distinct phenomenon of segregation distortion indicates that male gametes carrying basmati Dom-sufid allele were selectively aborted, suggesting this heterozygous locus had a very strong biological effect on hybrid male sterility. By reviewing previous studies, qPS1.2 was a novel pollen grain hybrid sterility locus, and was named as S67 since there was no reported before. Therefore, plants with heterozygous S67 ( S67-te / S67-b ) genotype in BC 4 F 2 were selected as a near isogenic line, NIL- S67 (H). Table 3 Segregation analysis of S67 alleles in different populations Population Generation Number of plants Pollen fertility S67 genotype χ 2 (1:2:1) χ 2 (1:1) S67 BC 4 F 2 0 186 204 fully fertility semi-sterility fully fertility b/b b/te te/te 214.25 0.83 NIL- S67 (H)/DJY1 F 1 50 50 semi-sterility fully fertility b/te te/te 0 DJY1/ NIL- S67 (H) F 1 0 100 semi-sterility fully fertility b/te te/te The allele S67-b and S67-te were abbreviated as b and te , respectively, as determined using the SSR marker RM5362. Fourty to sixty percent of pollen fertility was defined as semi-sterility, ~ 90% pollen fertility was defined as fully fertility. Chi-squared tests ( χ 2 ) were performed for the segregations of the S67 genotypes in the BC 4 F 2 and F 1 and test-cross populations. For the convenience of description, the basmati S67 allele was named as S67-b and the temperate japonica DJY1 S67 allele as S67-te . Given that no homozygous plants having the S67-b / S67-b genotype using the SSR Marker RM5362 in BC 4 F 2 population was found (Table 3 ), therefore reciprocal test crosses between the NIL- S67 (H) and DJY1 were made to further analyze the gametes transmission. When the NIL- S67 (H) as the female parent, the segregation ratios of the NIL- S67 (H) genotype plants and DJY1 genotype plants fitted a 1:1 ratio (Table 3 ). This indicates that both the S67-te and S67-b female gametes in the NIL- S67 (H) were normally fertile, which corresponds to the normal seed setting of the field plants. Nevertheless, when the NIL- S67 (H) as the male parent in a cross with DJY1, only DJY1 genotype F 1 plants were obtained (Table 3 and Fig. 7 ). This observation showed that the S67-b type male gametes in the NIL- S67 (H) are sterility. All these experimental results strongly supported that S67 was a new hybrid male sterility locus between basmati and temperate japonica . All pollen grains containing the S67-b allele were selectively aborted, demonstrating the strong transmission advantage of the S67-te allele. Discussion Basmati is a very special and famous subgroups of the Asian cultivated rice germplasm, but it was not fully utilized yet, and the main reason is that the relationship between basmati and other groups in Asian cultivated rice is unclear. In terms of grain morphology, this group of some varieties had slender and short round grains (Khush 2000 ; Civáň et al . 2019). Some scholars believed that it belonged to the indica (Regina et al. 1975 ), while others classified them as the japonica type (Cheng et al. 1990 ). Numerous studies on the genome classified basmati as japonica or similar to japonica (Garris et al. 2005 ; McNally et al. 2009 ; Zhao et al. 2011 ; Wang et al. 2018 ). In terms of origin and evolution, some studies suggested that basmati was derived from hybridization-introgression between aus from South Asia and japonica (Civáň et al. 2015 ; Zhou et al. 2022 ; Zhang et al. 2022 ). Some scholars also believed that basmati was formed through domestication and selection of ancient japonica rice from China to South Asia after being transmitted (Huang et al. 2012 ; Xie et al. 2021 ; Chen et al. 2022 ). There were also views that basmati was directly domesticated from local Oryza rufipogon in South Asia (Zhang et al. 2021 ). In short, different research led to distinct results. So, as in indication of species formation, the relationship between basmati and other subgroups from the vision of reproductive isolation is the key to know the difference. In the present study, severe hybrid sterility between basmati and temperate japonica was found, and a novel hybrid male sterility locus S67 was identified, which will greatly help understand the hybridization compatibility between basmati and other subgroups from a new perspective, and will also help us fully understand the genetic differentiation of Asian cultivation rice from the perspective of reproductive isolation. However, in order to comprehensively and scientifically explain the hybrid sterility relationship between basmati and other subgroups, it is necessary to further systematically map and analyze the corresponding hybrid sterility genes. To this day, about 50 hybrid sterility loci/QTL were discovered and reported, with more than 30 responsible for the crosses between Asian cultivated rice two subspecies, and these loci mainly contributed to the hybrid sterility between indica and temperate japonica (Ouyang 2019 ; Xie et al. 2019 ; Zhang et al. 2022 ). But there are no reports on the hybrid sterility loci of basmati . In this study, a new hybrid male sterility locus, S67 , was discovered in hybrids between the basmati variety Dom-sufid and the temperate japonica variety DJY1, and located between RM5362 and K1-40.6 on the long arm of chromosome 1. In this chromosomal region, previous studies reported one inter-subspecific hybrid sterility locus, S16 , between indica and japonica , which was a hybrid sterility locus affecting female gametes (Wan et al . 1995). Another locus S58 controlled the hybrid male sterility in Asian–African cultivated rice hybrids was reported, too (Feng et al. 2023 ). Unlike the gamete elimination of S1 (Xie et al. 2017 ), the finding showed that male gametes carrying the S58-g allele (African rice-type S58 allele) were eliminated, resulting in the male gametes with the S58-s (Asian rice-type S58 allele) allele gaining a transmission advantage. Whether S67 and S58 are the different haplotypes of the same locus or different loci needs to be answered. This result not only fills the gap in the research on hybrid sterility between basmati and temperate japonica , but also lays a good foundation for the systematic study of the genetic rules of hybrid sterility between basmati and other subgroups. Basmati is a very excellent germplasm resource with rich genetic variation and great potential for increasing yield, improving quality and adaptability. However, the heterosis generated by hybridization between basmati and other subgroups is limited by hybrid sterility, thus overcoming the reproductive barrier by adopting different methods and technical means is the key step to use the diversity of basmati . Varieties carrying natural or artificial neutral alleles of hybrid sterility loci are important germplasm resources for overcoming the hybrid sterility (Xie et al. 2019 ). In this study, S67 was identified from basmati , which gives the first step to overcome S67 -mediated hybrid sterility. By repeatedly backcrossing, the fragment carrying the S67-b allele in the recurrent parent, as a "bridge parent" containing homozygous S67-b , is one way to achieve the goal. Hybridization between the "bridge parent" and basmati varieties can effectively overcome inter-subgroup hybrid sterility. But it might be difficulty since S67-b was completely aborted. Thus, artificial neutral lines can be made to overcome the sterility by editing the causal genes in the S67 locus through CRISPR/Cas9. Materials and Methods Materials One basmati variety named Dom-sufid was introduced from the International Rice Research Institute (IRRI) as the donor parent, one O. sativa ssp. temperate japonica variety, DJY1, from Yunnan province, P. R. China, as the maternal, were used to obtain F 1 . Afterwards, selected the sterility plants in each generation as female parent and continuously backcrossed with DJY1 until BC 4 F 1 . The cultivation of all relevant populations was completed in xishuangbanna, Yunnan province, P. R. China. In the BC 1 F 1 , 148 plants were used for QTL detection. Meanwhile, after phenotypic evaluation and marker-assisted selection, sterility individuals (pollen fertility below 90% and the genotype is heterozygous) were randomly selected as the maternal for continuous backcrossing until BC 4 F 1 . A total of 5 pollen grain semi-sterility plants were obtained in the backcross line 136 of BC 4 F 1 (Fig. 3 ). The background and target fragment introgression of plants in BC 4 F 1 were screened by using Rice 6k Chips (Illumina, USA). BC 4 F 2 , obtained by selfing of the target individual from BC 4 F 1 , was used for target locus mapping and near isogenic line raising. To study the gamete elimination and transmission pattern, reciprocal crosses were made between heterozygous individual in BC 4 F 2 and recurrent parent to obtain F 1 . Observation of pollen grain and spikelet fertility Anthers were collected from spikelet of the upper and middle parts of the main panicle at 1 to 2 days before anthesis, fixed and stored in 70% ethanol for determining pollen fertility (Doi et al. 1998 ). Pollen fertility was estimated based on the percentage of pollen grains stained with 1% (w/v) iodine-potassium iodide solution. The pollen grain sterility types were classified as typical, spherical and stained abortion types. Observation requires at least three independent microscopic fields, at least 100 pollen grains in each field were scored for counting the percentage of fertile pollen grains in each plant. Spikelet fertility was calculated as a percentage of fertilized spikelet per panicle for each of the individuals involved. Detection of QTL and DNA analysis To detect the QTL, a linkage map of the BC 1 F 1 population was constructed using QTL IciMapping Version 4.2 (Lei et al. 2015 ), with a minimum LOD score of 3.0. Composite interval analysis was conducted to determine QTL related to the tested traits. The experiment-wide LOD (log of the odds ratio) threshold significant level was determined from 1000 permutation tests (Churchill et al . 1994), as implemented by QTL IciMapping. The genotype data of BC 1 F 1 was obtained using rice 10K Liquid Chips by Boradi Biotechnology Co., Ltd, Shijiazhuang, Hebei. BC 4 F 2 population was used to target gene mapping and genetic analysis. QTL IciMapping Version 4.2 and MapChart 2.32 were used to construct linkage groups and map hybrid sterility loci. Ten days after transplanting, fresh leaves from each individual were sampled for extraction of genomic NDA using the CTAB method (Rogers et al . 1985). SSR and KASP markers, distributed throughout the entire rice genome, provided by Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, China, were used for polymorphism screening and genotyping. Rice 6k Chips was used to detect target fragments infiltration and background replacement. The protocol of Rice 6k Chips as Infinium HD Assay Ultra Protocol Guide ( https://support.illumina.com.cn/downloads/infinium_hd_ultra_assay_protocol_guide_(11328087_b).html ) was used. GGT 2.0 software was used to map and view the infiltration of target trait related fragments and background replacement. Genetic and gametic transmission assay To determine the genetic and gametic transmission nature of S67 , the segregation ratios of the S67-b (from basmati ) and the S67-te (from temperate japonica ) alleles were investigated in three populations: BC 4 F 2 , NIL- S67 (H)/DJY1 and DJY1/NIL- S67 (H). The S67 genotypes in these populations were checked using the SSR marker RM5362 (Table 3 ), allowing to analyze the transmission rates to offspring of the S67-b allele and the S67-te allele. Declarations Acknowledgments: This study was funded by National Natural Science Foundation of China (Grant Nos. 31991221, 32160489); Basic Research Foundation of Yunnan Provincial Science and Technology Department, China (Grant Nos. 202401AT070090, 202101AT070193, 202101AS070036, 202001AS070003, 202201AS070072, 202205AR070001-04); Yunnan Provincial Government (YNWR-QNBJ-2018-359); Technology Talent and Platform program of Yunnan Provincial Science and Technology Department, China (Grant Nos. 202205AC160057); and the Yunnan Seed Laboratory Program. Author. Contributions: D.T and Y.Z conceived and designed the experiments. Y.L participated in phenotyping, genotyping, drafting the manuscript. J.L and Y.Y participated in phenotyping and genotyping. Q.P, J.Z, and X.D participated in phenotyping. D.T and Y.Z corrected manuscript. All authors have read and agreed to the published version of the manuscript. Conflicts of Interest: The author(s) declare no competing interest. Ethics declarations: The plant collection and use was in accordance with all the relevant guidelines. Permissions statement: All the rice materials involved in this paper are gifted, and have no licensing disputes. Data Availability: The datasets used and/or analysed during the current study available from the corresponding author ( [email protected] ) on reasonable request. References Ashfaq, M. et al . Basmati rice a class apart (a review). Rice Research: Open Access 3, 156; 10.4172/2375-4338.1000156 (2015). Ashok, K.S. et al . Introgression of multiple disease resistance into a maintainer of basmati rice CMS line by marker assisted backcross breeding. Euphytica . 203, 97-107 (2015). Bai, S.W. et al . Retrospective and perspective of rice breeding in China. J. Genet. Genomics . 45, 603-612 (2018). Brar, D.S. & Khush, G.S. “Wild relatives of rice: a valuable genetic resource for genomics and breeding research,” in The Wild Oryza Genomes, Compendium of Plant Genomes (ed. Mondal, T.K. & Henry, R.J.) 1-25 (Springer International Publishing AG, 2018). Chen, M.J. et al . A new gene controlling hybrid sterility in rice ( Oryza sativa L.). Euphytica . 184, 15-22 (2012) . Chen, R.Z. et al . Rice functional genomics: decades' efforts and roads ahead. Sci. China. Life. Sci . 65, 33-92 (2022) . Chen, J.J. et al . A triallelic system of S5 is a major regulator of the reproductive barrier and compatibility of indica - japonica hybrids in rice. Proc. Natl. Acad. Sci. U.S.A . 105, 11436-11441 (2008). Cheng, K.S., Huang, N.W. & Zhang, Y.Z. Research on that sickle-shaped rice is an another king of intermediate type. Southwest China Journal of Agricultural Sciences 3, 102-103 (1990). Choi, J.Y. et al . Nanopore sequencing-based genome assembly and evolutionary genomics of circumbasmati rice. Genome Biol . 21, 21 (2020). Churchill, G.A. & Doerge, R.W. Empirical threshold values for quantitative trait mapping. Genetics . 138, 963-971 (1994) . traced to the Indian subcontinent. Genome Biol. Evol . 11, 832-843 (2019). Civáň, P. et al . Three geographically separate domestications of Asian rice. Nat. Plants . 1, 1-5 (2015). Doi, K., Yoshimura, A. & Iwata, N. RFLP mapping and QTL analysis of heading date and pollen sterility using backcross population between Oryza sativa L. and Oryza glaberrima Steud. Breeding Sci . 48, 395-399 (1998). Dolores, R.C., Chang, T.T. & Ramirez, D.A. Cytogenetics of sterility in F 2 hybrids of indica × indica and indica × javanica varieties of rice ( Oryza sativa L.). Cytologia . 40, 639-647 (1975). Feng, Y.M. et al . Characterization and fine-mapping of a new Asian rice selfish genetic locus S58 in Asian-African rice hybrids. Theoretical and Applied Genetics 136, 87 (2023). Foster-Powell, K., Holt, S.HA., & Brand-Miller, J.C. International table of glycemic index and glycemic load values. Am J Clin Nutr . 76, 5-56 (2002). Fukagawa, N.K. & Ziska, L.H. Rice: Importance for global nutrition. J. Nutr. Sci. Vitaminol . 65, S2-S3 (2019). Garris, A.J. et al . Genetic structure and diversity in Oryza sativa L. Genetics . 169, 1631-1638 (2005). Glaszmann, J.C. Isozymes and classification of Asian rice varieties. Theor. Appl. Genet . 74, 21-30 (1987). Hikoichi, O. Phylogenetic differentiation of the cultivated rice plant Ⅱ. Intervarietal hybrid sterility. Japanese Journal of Breeding . 3, 50-63 (1952). Huang, X.H. et al . A map of rice genome variation reveals the origin of cultivated rice. Nature . 490, 497-501 (2012). Kato, S. On the affinity of the cultivated varieties of rice plants Oryza sativa L. Journal of the Department of Agriculture, Kyushu Imperial University 2, 241-276 (1930) Khin, M.M. et al . Specific patterns of genetic diversity among aromatic rice varieties in Myanmar. Rice . 5, 1-13 (2012). Khush, G.S. Taxonomy and origin of rice (ed. Singh, R.K. & Khush, G.S.) 5-13 (New Delhi: Oxford & IBH Publishing, 2000). Kiran, B.G. et al . Deployment of wild relatives for genetic improvement in rice ( Oryza sativa ). Plant Breed . 140, 23-52 (2020). Kishor, D.S. et al . Evaluation of whole-genome Sequence, genetic diversity, and agronomic traits of Basmati rice ( Oryza sativa L.). Front Genet . 11, 86 (2020). Kubo, T. et al . Two tightly linked genes at the hsa1 locus cause both F 1 and F 2 hybrid sterility in rice. Mol. Plant . 9, 221-232 (2016). Lei, M. et al . QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J . 3, 269-283 (2015). Li, D.T. et al . Mapping for a new locus causing hybrid sterility in a China landrace ( Oryza sativa L.). Rice Genetics Newsletter . 22, 20 (2005). Li, D.T. et al . Fine mapping of S32(t) , a new gene causing hybrid embryo sac sterility in a Chinese landrace rice ( Oryza sativa L.). Theor. Appl. Genet. 114, 515-524 (2007). Liu, Y.Q. et al . Genomic basis of geographical adaptation to soil nitrogen in rice. Nature 590, 600-605 (2021). Long, Y. et al . Hybrid male sterility in rice controlled by interaction between divergent alleles of two adjacent genes. Proc. Natl. Acad. Sci. U.S.A . 105, 18871-18876 (2008). McNally, K.L. et al . Genome-wide SNP variation reveals relationships among landraces and modern varieties of rice. Proc. Natl. Acad. Sci. U.S.A . 106, 12273-12278 (2009). Mizuta, Y., Harushima, Y. & Kurata, N. Rice pollen hybrid incompatibility caused by reciprocal gene loss of duplicated genes. Proc. Natl. Acad. Sci. U.S.A . 107, 20417-20422 (2010). Ouyang, Y.D. Understanding and breaking down the reproductive barrier between Asian and African cultivated rice: a new start for hybrid rice breeding. Sci China Life Sci . 62, 1-3 (2019). Rao, J.L. et al . Genetic analysis of S5 -interacting genes regulating hybrid sterility in rice. Rice 14, 11 (2021). Regina, C.D., Chang, T.T. & Ramirez, D.A. Cytogenetics of sterility in F 2 hybrids of indica × indica and indica × javanica varieties of rice ( Oryza sativa L.). Cytologia 40, 639-647 (1975). Rogers, S.O. & Bendich, A.J. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol 5, 69-76 (1985). Satishkumar, M., Harishkumar, H. & Rangegowda, R. Growth export performance and competitiveness of basmati and non-basmati rice of India-an Markov chain approach. Int J Agr Biol Eng . 9, 305-311 (2016). Shen, R.X. et al . Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice. Nat. Commun . 8, 1310 (2017). Tang, H.W. et al . Advances in understanding the molecular mechanisms of cytoplasmic male sterility and restoration in rice. Plant Reprod . 30, 179-184 (2017). Wan, J.M. et al . Mapping of hybrid sterility gene S17 of rice ( Oryza sativa L.) by isozyme and RFLP markers. Rice Genetics Newsletter . 15, 151-154 (1998). Wan, J.C. et al . Two new loci for hybrid sterility in cultivated rice ( Oryza sativa L.). Theor. Appl. Genet . 92, 183-190 (1996). Wan, J.M. & Ikehashi, H. Identification of a new locus S-1 6 causing hybrid sterility in native rice varieties ( Oryza sativa L.) from Tai-hu lake region and Yunnan Province, China. Breeding Sci . 45, 446-470 (1995). Wan, J.M. et al . Multiple alleles at a new locus causing hybrid sterility between a Korean indica variety and a javanica variety in rice ( Oryza sativa L.). Japanese Journal of Breeding . 43, 507-516 (1993). Wang, C.L. et al . A natural gene drive system confers reproductive isolation in rice. Cell . 186, 1-16 (2023). Wang, C.M. et al . Mapping segregation distortion loci and quantitative trait loci for spikelet sterility in rice ( Oryza sativa L.). Genet. Res . 86, 97-106 (2005). Wang, H.R. et al . The Power of Inbreeding: NGS-Based GWAS of Rice Reveals Convergent Evolution during Rice Domestication. Mol Plant . 9, 975-85 (2016). Wang, J. et al . Studies on F 1 fertility of five different ecological types of Asian cultivated rice with indica and japonica . Journal of Yunnan University: Natural Sciences Edition 45, 1-9 (2023). Wang, W.S. et al . Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature . 557, 43-49 (2018). Xie, L. et al . RiceENCODE: A comprehensive epigenomic database as a rice Encyclopedia of DNA Elements. Mol Plant . 14, 1604-1606 (2021). Xie, Y.Y. et al . Suppression or knockout of SaF/SaM overcomes the Sa-mediated hybrid male sterility in rice. J Integr Plant Biol . 59, 669-679 (2017). Xie, Y.Y. et al . Molecular mechanisms of hybrid sterility in rice. Sci China Life Sci . 62, 737-743 (2019). Xu, N. et al . Introgression of a Complex Genomic Structural Variation Causes Hybrid Male Sterility in GJ Rice ( Oryza sativa L.) Subspecies. Int. J. Mol. Sci . 23, 1-10 (2022). Yanagihara, S., Kato, H. & Ikehashi, H. A new locus for multiple alleles causing hybrid sterility between an Aus variety and javanica varieties in rice ( Oryza sativa L.). Theor. Appl. Genet . 90, 182-188 (1992). Yu, S.B. et al . Hybrid rice and green super rice. Sci. Bull . 61, 3797-3803 (2016). Yu, Y. et al . Hybrid sterility in rice ( Oryza sativa L.) involves the tetratricopeptide repeat domain containing protein. Genetics . 203, 1439-1451 (2016). Zhang, F. et al . The landscape of gene-CDS-haplotype diversity in rice: Properties, population organization, footprints of domestication and breeding, and implications for genetic improvement. Mol Plant . 14, 787-804 (2021). Zhang, G.Q. Prospects of utilization of inter-subspecific heterosis between indica and japonica rice. J. Integr. Agric . 19, 1-10 (2020). Zhang, Y. et al . Understanding the nature of hybrid sterility and divergence of Asian cultivated rice. Front. Plant Sci. 13, 908342; 10.3389/fpls.2022.908342 (2022). Zhao, K.Y. et al . Genome-wide association mapping reveals a rich genetic architecture of complex traits in Oryza sativa . Nat. Commun . 2, 92-100 (2011). Zhao, Z.G. et al . Fine mapping of S31 , a gene responsible for hybrid embryo-sac abortion in rice ( Oryza sativa L.). Planta . 226, 1087-1096 (2007). Zhou, J.W. et al . Interspecific hybridization is an important driving force for origin and diversification of Asian cultivated rice ( Oryza sativa L). Front. Plant Sci. 13, 932737; 10.3389/fpls.2022.932737 (2022). Zhou, P.H. et al . A minimal genome design to maximally guarantee fertile inter-subspecific hybrid rice. Mol Plant . 16, 726-738 (2023). Zhu, S.S. et al . A new gene located on chromosome 2 causing hybrid sterility in a remote cross of rice. Plant Breed . 124, 440-445 (2005). Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Cite Share Download PDF Status: Published Journal Publication published 19 Nov, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 16 Oct, 2024 Reviews received at journal 16 Oct, 2024 Reviewers agreed at journal 15 Oct, 2024 Reviews received at journal 14 Aug, 2024 Reviewers agreed at journal 05 Aug, 2024 Reviewers agreed at journal 05 Aug, 2024 Reviewers invited by journal 05 Aug, 2024 Editor assigned by journal 05 Aug, 2024 Editor invited by journal 27 May, 2024 Submission checks completed at journal 22 May, 2024 First submitted to journal 17 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4434612","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":309537956,"identity":"cba79767-e2ef-40c5-b618-3732389de167","order_by":0,"name":"Yonggang Lv","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Yonggang","middleName":"","lastName":"Lv","suffix":""},{"id":309537958,"identity":"002fab68-15e4-4b07-94a1-4d4bf960aa18","order_by":1,"name":"Jing Li","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Li","suffix":""},{"id":309537959,"identity":"fe9c15a1-ecc9-41db-aea9-6ebd54dfddbf","order_by":2,"name":"Ying Yang","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Yang","suffix":""},{"id":309537960,"identity":"ed634f55-2e87-40b2-bae0-13847035f594","order_by":3,"name":"Qiuhong Pu","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Qiuhong","middleName":"","lastName":"Pu","suffix":""},{"id":309537961,"identity":"e22bb3ca-ef41-4404-ac03-b01274ba6df0","order_by":4,"name":"Jiawu Zhou","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Jiawu","middleName":"","lastName":"Zhou","suffix":""},{"id":309537962,"identity":"4b469356-bc8d-4793-a976-023d330b56fc","order_by":5,"name":"Xianneng Deng","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Xianneng","middleName":"","lastName":"Deng","suffix":""},{"id":309537963,"identity":"41de6b1c-7929-47d4-a4e1-06ab0c99b58e","order_by":6,"name":"Yu Zhang","email":"","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Zhang","suffix":""},{"id":309537964,"identity":"947a61fa-28e1-4a28-8920-8cab195ae241","order_by":7,"name":"Da-Yun Tao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYJACCQYDGzkGdsYG4pTzgLUUpBkzMJOm5cPhxAZmYh1lz3744G0eA+b0/mbmNmneHQzy/GIHCNjCk5ZszWPAljvjMCNQyxkGw5mzEwg5LMdMmseAJ7cBrKWNIcHgNiEt/G9AWiTS5YnXIgG2xSDBgHgtN54lW84xSDDceJix2XJumwRhv7D3Jx+88ebPf3m54+0Pb7xts5HnlyagBQSYeCA0iwQojogCjD8gNPMH4tSPglEwCkbBSAMAJWs6VMSIv2IAAAAASUVORK5CYII=","orcid":"","institution":"Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, 650200","correspondingAuthor":true,"prefix":"","firstName":"Da-Yun","middleName":"","lastName":"Tao","suffix":""}],"badges":[],"createdAt":"2024-05-17 06:24:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4434612/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4434612/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-80011-2","type":"published","date":"2024-11-19T15:56:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57676418,"identity":"9fc6f9f7-b37b-40b3-9a44-b3cfff1466b6","added_by":"auto","created_at":"2024-06-04 07:48:06","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30632,"visible":true,"origin":"","legend":"\u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e (DJY1/Dom-sufid) exhibits pollen and spikelet sterility. Pollen fertility of DJY1, Dom-sufid and F\u003csub\u003e1\u003c/sub\u003e plants was determined based on the average value of five independent florets from DJY1, Dom-sufid and F\u003csub\u003e1\u003c/sub\u003e plants. Data are shown as means ± SD (n=5). Spikelet fertility of DJY1, Dom-sufid and F\u003csub\u003e1\u003c/sub\u003e plants was determined based on the average value of five independent panicles from DJY1, Dom-sufid and F\u003csub\u003e1\u003c/sub\u003e plants. Data are shown as mean ± SD (n=5).\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/3b2e1b840367aaa5c618cc29.jpg"},{"id":57676876,"identity":"89520b3e-b85d-4c4e-a103-6b6d78d33db8","added_by":"auto","created_at":"2024-06-04 07:56:06","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":118766,"visible":true,"origin":"","legend":"\u003cp\u003eThe frequency distribution of pollen and spikelet fertility in BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e (a), BC\u003csub\u003e2\u003c/sub\u003eF\u003csub\u003e1 \u003c/sub\u003e(b), BC\u003csub\u003e3\u003c/sub\u003eF\u003csub\u003e1 \u003c/sub\u003e(c), and BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1 \u003c/sub\u003e(d).\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/739aeb6910184c5ff102a6cb.jpg"},{"id":57676412,"identity":"6be3cc5d-a935-40c8-b14c-fabafe45ff3a","added_by":"auto","created_at":"2024-06-04 07:48:05","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":98906,"visible":true,"origin":"","legend":"\u003cp\u003eRice 6k Chips detection of genetic background and target fragment introgression. The first column is the individual plant code of BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1 \u003c/sub\u003ein 2021 Late Crop Season in Xishuangbanna, Yunnan province, P. R. China. Green represents the homozygous genotype of DJY1; Red represents the heterozygous genotype of DJY1 and Dom-sufid; Yellow represents the homozygous genotype of Dom-sufid. The black wireframe represents the area where the target locus is located. The individual with the blue line below had the least background interference and was selected to selfing to form the BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e mapping population.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/c83d0b632b20f331cc2b634b.jpg"},{"id":57676419,"identity":"b5cc6e5f-806d-41ef-a120-c0818690c0a5","added_by":"auto","created_at":"2024-06-04 07:48:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":52263,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of pollen and spikelet fertility in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e mapping population. This population was obtained by selfing of a single plant 136-1-1 in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/622e5586211beeb743b46bad.jpg"},{"id":57676413,"identity":"7fc5cdda-8f8e-4266-851a-e6259f631f75","added_by":"auto","created_at":"2024-06-04 07:48:05","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":361474,"visible":true,"origin":"","legend":"\u003cp\u003eNIL-\u003cem\u003eS67\u003c/em\u003e(H) exhibits pollen semi-sterility. \u003cstrong\u003ea\u003c/strong\u003e Panicles of DJY1, Dom-sufid and NIL-\u003cem\u003eS67\u003c/em\u003e(H) plants. Scale bars, 3 cm. \u003cstrong\u003eb, c, d \u003c/strong\u003ePollen grains from DJY1, Dom-sufid and NIL-\u003cem\u003eS67\u003c/em\u003e(H) plants stained with a 1% (w/v) iodine-potassium iodide solution. Scale bars, 100 μm.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/cfe237ffef89aab2a325cf44.jpg"},{"id":57676415,"identity":"100f6835-b4fc-4423-87e3-cf79088d9b6d","added_by":"auto","created_at":"2024-06-04 07:48:06","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":28955,"visible":true,"origin":"","legend":"\u003cp\u003eThe position of \u003cem\u003eS67\u003c/em\u003e in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2 \u003c/sub\u003eand segmental linkage maps of locus mapped in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e mapping population for pollen hybrid sterility in rice chromosome 1.\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/815002a901f227bba42768c0.jpg"},{"id":57676414,"identity":"cd6e721e-05ec-4174-aaab-ff2b9081cd76","added_by":"auto","created_at":"2024-06-04 07:48:05","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":55534,"visible":true,"origin":"","legend":"\u003cp\u003eNumber and percentage of the DJY1 genotype and NIL-\u003cem\u003eS67\u003c/em\u003e(H) genotype plants in the hybrid F\u003csub\u003e1\u003c/sub\u003e generation of NIL-\u003cem\u003eS67\u003c/em\u003e(H)/DJY1 and DJY1/ NIL-\u003cem\u003eS67\u003c/em\u003e(H).\u003c/p\u003e","description":"","filename":"Fig.7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/7a546af2de85a459fda2b889.jpg"},{"id":69834507,"identity":"3fbde445-cebf-4f40-a493-9e964023a57c","added_by":"auto","created_at":"2024-11-25 16:02:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1639451,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/db6efb27-d831-48b1-a266-612579778439.pdf"},{"id":57676416,"identity":"c7351edb-58b4-4bd4-b323-b8ed3a6efe08","added_by":"auto","created_at":"2024-06-04 07:48:06","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21526,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-4434612/v1/45c6012b65d42110b6925bf7.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of A Novel Hybrid Sterility Locus S67 between temperate japonica subgroup and basmati subgroup in Oryza sativa L","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRice is one of the most important food crops in the world, feeding more than half of the global population (Fukagawa et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The utilization of heterosis played a significant role in improving rice yield per unit area (Yu et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, the growth of rice yield entered a bottleneck period, the fundamental reason is that the genetic diversity of hybrid rice parents is narrow (Tang et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Asian cultivated rice, the most important cultivated species in the AA genome rice species of the genus \u003cem\u003eOryza\u003c/em\u003e, mainly comprises two subspecies, \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e (Kato \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1930\u003c/span\u003e; Hikoichi \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1952\u003c/span\u003e), and some relatively small ecological subgroups. Currently, most studies classified Asian cultivated rice into five subgroups based on molecular biology, genomics, and other characteristics: temperate \u003cem\u003ejaponica\u003c/em\u003e, tropical \u003cem\u003ejaponica\u003c/em\u003e, \u003cem\u003eindica\u003c/em\u003e, \u003cem\u003eaus\u003c/em\u003e and \u003cem\u003ebasmati\u003c/em\u003e (Glaszmann \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Garris et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; McNally et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Civ\u0026aacute;ň et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kishor et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Numerous studies and breeding practices shown that the hybridization-introgression of subgroups within Asian cultivated rice played a very important role and had great potential for the utilization of heterosis and the improvement of rice yield, quality, and resistance (Brar \u003cem\u003eet al\u003c/em\u003e. 2018; McNally et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Bai et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kiran et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Thus, fully mining and introgression of favorable alleles from minor subgroups of Asian cultivated rice is an important way to enrich the genetic diversity of existing breeding populations.\u003c/p\u003e \u003cp\u003e \u003cem\u003eBasmati\u003c/em\u003e is a unique subgroup of Asian cultivated rice, mainly distributed in countries in South Asia, Southeast Asia, Central Asia, and West Asia such as Pakistan, India, Bangladesh, Myanmar, Iran, etc (Glaszmann \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Khush \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Khin et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Civ\u0026aacute;ň \u003cem\u003eet al\u003c/em\u003e. 2019; Choi et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It is one of the important agricultural trade commodities in these regions (Ashfaq et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Satishkumar et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e;). The main feature of \u003cem\u003ebasmati\u003c/em\u003e rice exhibits its excellent longitudinal elongation of rice grains during cooking (about twice as much as before), and the soft and fluffy texture of cooked rice, with a unique nutty aroma, known as the \"king of rice\". \u003cem\u003ebasmati\u003c/em\u003e rice is rich in trace elements such as zinc and iron, and has a low blood sugar index (Khush \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). In addition, \u003cem\u003ebasmati\u003c/em\u003e rice also contains rich WA-CMS restorer resources and significant potential for nitrogen efficient utilization and storage tolerance (Foster-Powell et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Ashok et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, \u003cem\u003ebasmati\u003c/em\u003e rice not only has very high economic value and international trade status, but also has a very important position and significance in the classification, genetic research, and breeding application in Asian cultivated rice. Temperate \u003cem\u003ejaponica\u003c/em\u003e is one of the main subgroup of Asian cultivated rice, mainly distributed in a few countries and regions such as East Asia, the Mediterranean, Europe, and North America, including China, Japan, South Korea, Egypt, North Korea, the United States, etc. The annual planting area of temperate \u003cem\u003ejaponica\u003c/em\u003e accounts for about 9% of the world's total rice area, and the total yield accounts for about 14% of the world's total rice production. Given the excellent quality, its market demand continues to increase. However, the breeding and production of temperate \u003cem\u003ejaponica\u003c/em\u003e rice also faces serious problems, such as insufficient genetic diversity of germplasm resources. \u003cem\u003eBasmati\u003c/em\u003e is a very excellent germplasm resource, which can be used for genetic improvement by hybridizing with temperate \u003cem\u003ejaponica\u003c/em\u003e varieties, which helps breed rice varieties with better yield, quality, and adaptability. Unfortunately, the severe hybrid sterility between these two subgroups limits the utilization of heterosis and introgression breeding between them (Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Identifying and analyzing the hybrid sterility genes between them can help overcome hybrid sterility and better understand the nature of this reproductive barrier, and promote the application of distant parents in hybrid breeding.\u003c/p\u003e \u003cp\u003eHybrid sterility is the most common form of postzygotic reproductive isolation in plant species. The hybrid sterility between Asian cultivated rice \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e subgroups is the most classic case of postzygotic reproductive isolation and has always been a focus of genetic research. So far, more than 30 genes/QTLs conferring sterility in inter-subspecific hybrids in Asian cultivated rice were reported (Ouyang \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhang \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), of which seven hybrid sterility loci (\u003cem\u003eS5\u003c/em\u003e, \u003cem\u003eSa\u003c/em\u003e, \u003cem\u003ehsa1\u003c/em\u003e, \u003cem\u003eS7\u003c/em\u003e, \u003cem\u003eSc\u003c/em\u003e, \u003cem\u003eRHS12/Pf12/Se, DPL1/DPL2\u003c/em\u003e) were cloned (Chen et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Long et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Mizuta et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Yang \u003cem\u003eet al.\u003c/em\u003e 2012; Kubo et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Shen et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Twenty-two hybrid sterility loci were described between \u003cem\u003eindica\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e cultivars, including major genes such as \u003cem\u003eS5\u003c/em\u003e, \u003cem\u003eSa\u003c/em\u003e, \u003cem\u003eSc\u003c/em\u003e, \u003cem\u003eRHS12/Pf12/Se\u003c/em\u003e (Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition to \u003cem\u003eindica\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e, some hybrid sterility loci were also found in other subgroups of Asian cultivated rice. \u003cem\u003eDPL1\u003c/em\u003e/\u003cem\u003eDPL2\u003c/em\u003e resulted in male gametes abortion and \u003cem\u003eqSIG3.1\u003c/em\u003e, \u003cem\u003eqSIG3.2\u003c/em\u003e, \u003cem\u003eqSIG6.1\u003c/em\u003e and \u003cem\u003eqSIG12.1\u003c/em\u003e resulted in female gametes abortion in the crosses between temperate \u003cem\u003ejaponica\u003c/em\u003e and \u003cem\u003eaus\u003c/em\u003e (Mizuta et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Rao et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e); \u003cem\u003eS7\u003c/em\u003e and \u003cem\u003eS15\u003c/em\u003e were responsible for female gamete sterility in the hybrid between \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003eaus\u003c/em\u003e (Wan et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e); \u003cem\u003eS8\u003c/em\u003e, \u003cem\u003eS9\u003c/em\u003e, \u003cem\u003eS16\u003c/em\u003e, \u003cem\u003eS17\u003c/em\u003e, \u003cem\u003eS29\u003c/em\u003e, \u003cem\u003eS31\u003c/em\u003e, \u003cem\u003eS32\u003c/em\u003e, \u003cem\u003eqSS-2\u003c/em\u003e, and \u003cem\u003eqSS-8b\u003c/em\u003e gave rise to female gametes abortion in the hybrid between tropical \u003cem\u003ejaponica\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e (Wan \u003cem\u003eet al\u003c/em\u003e. 1995; Wan et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2007\u003c/span\u003e); \u003cem\u003eS7\u003c/em\u003e, \u003cem\u003eS8\u003c/em\u003e, \u003cem\u003eS9\u003c/em\u003e, and \u003cem\u003eS35\u003c/em\u003e(t) led to the female sterility in the cross between tropical \u003cem\u003ejaponica\u003c/em\u003e and \u003cem\u003eindica\u003c/em\u003e (Wan et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1993\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2012\u003c/span\u003e); \u003cem\u003eS7\u003c/em\u003e and \u003cem\u003eS9\u003c/em\u003e controlled the hybrid female sterility between tropical \u003cem\u003ejaponica\u003c/em\u003e and \u003cem\u003eaus\u003c/em\u003e (Wan et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Yanagihara et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). These hybrid sterility genes or QTLs identified in the different subgroups will lay the foundation for elucidating the genetic and molecular mechanisms of hybrid sterility in Asian cultivated rice, and for breeding utilization. But, so far, due to the severe hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups, the hybrid introgression and utilization of favorable agronomic traits are very limited. A few of research was also limited to describing the phenomenon of hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups or the coincidental utilization of single hybrid sterility gene (Cheng et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Dolores et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1975\u003c/span\u003e; Xu et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). At present, there are no systematic studies on hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups, and no hybrid sterility genes or QTLs were identified in the cross between them.\u003c/p\u003e \u003cp\u003eIn the present study, a major inter-subgroup hybrid male sterility locus \u003cem\u003eS67\u003c/em\u003e in the hybrids between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e in Asian cultivated rice that conferred selective abortion of male gametes carrying the \u003cem\u003ebasmati\u003c/em\u003e allele, giving a transmission advantage to the temperate \u003cem\u003ejaponica\u003c/em\u003e allele, was identified. \u003cem\u003eS67\u003c/em\u003e was delimited between RM5362(41087022) and K1-40.6(41824986) on the long arm of chromosome 1 by linkage analysis. In addition, the degree of segregation distortion and the mode of gamete transmission were analysed by developing reciprocal test crosses between the plants with the NIL-\u003cem\u003eS67\u003c/em\u003e(H) genotype in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e and recurrent parent DJY1. Judging from the locus location and action mode, this locus was confirmed as a new finding of hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe confirmation of hybrid sterility between\u003c/b\u003e \u003cb\u003ebasmati\u003c/b\u003e \u003cb\u003eand temperate\u003c/b\u003e \u003cb\u003ejaponica\u003c/b\u003e \u003cb\u003erice\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSevere pollen and spikelet sterility was observed in the F\u003csub\u003e1\u003c/sub\u003e obtained between \u003cem\u003ebasmati\u003c/em\u003e accession Dom-sufid and temperate \u003cem\u003ejaponica\u003c/em\u003e cultivar DJY1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This phenomenon was also found when studying the cross compatibility between the five different subgroups of Asian cultivated rice with \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The pollen and spikelet fertility distribution of BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e to BC\u003csub\u003e3\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e was continuous, fertile, semi-sterility, and sterility plants could still be found, and gradually showing a bimodal distribution with the increase of backcross generations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c), while BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e only had fertile and semi sterility plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The results showed that inter-subgroup hybrid sterility between temperate \u003cem\u003ejaponica\u003c/em\u003e and \u003cem\u003ebasmati\u003c/em\u003e in Asian cultivated rice controlled by multiple genes in the preliminary populations was gradually decomposed into a simple inheritance mode, and a significant amount of genetic noise was removed after four generations phenotypic selection and continuous backcrossing, which facilitated the detection and confirmation of loci in the advanced backcrossing population.\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDetection of QTL for hybrid sterility in BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/h2\u003e \u003cp\u003eThe linkage map comprised of 663 polymorphic SNP markers and spans 2311.93 cM. The mean interval between markers was about 3.49 cM. QTL for pollen and spikelet fertility analyzed by composite interval mapping was presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Two QTL (\u003cem\u003eqSS3\u003c/em\u003e, \u003cem\u003eqSS6\u003c/em\u003e) for spikelet fertility were detected on chromosomes 3 and 6, explained 8.48% and 20.35% of the total spikelet fertility variation, respectively, and accounted for 28.83% of the total variation. Three QTL (\u003cem\u003eqPS1.1\u003c/em\u003e, \u003cem\u003eqPS1.2\u003c/em\u003e and \u003cem\u003eqPS2\u003c/em\u003e) for pollen fertility were detected on chromosomes 1, and 2. These QTL individually explained 5.52\u0026ndash;53.80% of the total phenotypic variation, and accounted for 66.14% of the total variation. Among these QTL, \u003cem\u003eqPS1.2\u003c/em\u003e was the most effective QTL, which explained 53.80% of the total pollen fertility variation, and was selected for in-depth mapping and genetic analysis in this study. Then, based on the molecular marker RM5362 genotypes (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), tightly linked to \u003cem\u003eqPS1.2\u003c/em\u003e locus, and the phenotypes in each generation, continuous backcross to obtain BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e was made.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eQTL detected for pollen and spikelet fertility based on interval mapping and composite interval mapping in the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e population\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrait\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChromosome\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePosition (cM)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLeft Marker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRight Marker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLOD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePVE (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eQTL\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePollen fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e114.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOsGRb01924\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOsGRg01176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eqPS1.1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePollen fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e165.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOsGRb02912\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOsGRb02939\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e26.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e53.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eqPS1.2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePollen fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e89.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOsGRg03023\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOsGRb04514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e5.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eqPS2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpikelet fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e49.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOsGRg04981\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOsGRg04861\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e6.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eqSS3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpikelet fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e80.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOsGRb30999\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOsGRg09935\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e20.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eqSS6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences of molecular markers for mapping the \u003cem\u003eS67\u003c/em\u003e locus on rice chromosome 1\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePosition\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMarker Type\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eK1-40.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGAACAATCGGTTGGGTTTCAGAGTTAGCTTCAGAGTAGACAGAACGC[A/G]ACCAAAATCAAATATGAATATGTATTTTTATACCTGCAAGTTGCAGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40448552\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSNP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eK1-40.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGAAGTCCTGGCAGACGTGCGCCACCGCTGGCTTCTCCGGTGGGCTGCT[A/C]CGTGCCATCTGCGCGATGATGGCGTTGTTGCTCTCCCAGAATCCCATTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41067447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSNP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRM5362\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GCGCTAGGGCTTTGGATC\u003c/p\u003e \u003cp\u003eR-TACCTTCCTTACTCTGCCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41087022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSSR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eK1-40.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTCCGGAGTCGGGTCTCCTCCAGCGCGAAGCTGACGAACTTGTGGTAC[A/G]GCAAGCCGGCGCCCAAGCTCCCGCCGCCGACGCCGCCGCTGCTCATGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41824986\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSNP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eK1-40.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCATTTACTAGTAGTAGGGGAGCGTGAAGGTTGCTCGATGCATTTAT[T/C]CCGGACGACGGGATAACTCGATGGATCGCTGCACCGTGTACACAAGCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e42050647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSNP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRM1067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF- CGATGGAGAGAGAATGTCTAGC\u003c/p\u003e \u003cp\u003eR- TAATACGCAAGGCAGAAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e42923261\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSSR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic linkage analysis and mapping of the\u003c/b\u003e \u003cb\u003eS67\u003c/b\u003e \u003cb\u003elocus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e, only two type plants: fertile and semi-sterility could be found, and they were used to detect for genetic background and target fragments introgression using Rice 6k Chips. The results showed that about 97% of the genetic background of BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e plants was the same as that of their recurrent parent (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), and introgression fragments of the \u003cem\u003eqPS1.2\u003c/em\u003e locus were also detected in 5 semi-sterility pollen grain plants, 136-1-1, 136-1-5, 136-1-6, 136-1-7, 136-1-10. To map \u003cem\u003eqPS1.2\u003c/em\u003e, one of the semi-sterility individual 136-1-1, which had a clean background and carried the \u003cem\u003eqPS1.2\u003c/em\u003e locus in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1,\u003c/sub\u003e was selected to selfing and form BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e mapping population.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAmong 390 plants in the BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population, pollen fertility showed bimodal distribution, divided into semi-sterility and fertile and spikelet fertility of all plant were normal (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). By means of linkage analysis using phenotypic data and six polymorphic molecular markers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), \u003cem\u003eqPS1.2\u003c/em\u003e was located in a 2.95 cM region flanked by RM5362 and K1-40.6 on the long arm of chromosome 1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSegregation distortion and gametes transmission of the\u003c/b\u003e \u003cb\u003eS67\u003c/b\u003e \u003cb\u003elocus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo clarify the relationship between the introgression segments and the semi-sterility phenotype, the pollen fertility of 390 BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e plants and the segregation of their genotypes of the molecular marker RM5362 was analysed. One hundred and eighty-six plants exhibited semi-sterility pollen grain and 204 plants exhibited fully fertile pollen grain in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e was found. All plants that exhibited semi-sterility carried heterozygous genotypes and all plants that showed fully fertile pollen grain harbored the homozygous temperate japonica DJY1 genotype, which were deteceted with molecular markers RM5362. The final detection results showed that no any plants with homozygous \u003cem\u003ebasmati\u003c/em\u003e Dom-sufid genotype was obtained in this population. This detected genotype segregation was \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e (1:2:1)\u0026thinsp;=\u0026thinsp;214.25, did not match the expected ratio, but fitted the typical segregation ratio (1:1, χ\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.83) of hybrid sterility gene (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In fact, no plants with homozygous \u003cem\u003ebasmati\u003c/em\u003e Dom-sufid genotype were detected in another large population of 1344 BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e3\u003c/sub\u003e plants (Additional file 1: Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). This distinct phenomenon of segregation distortion indicates that male gametes carrying \u003cem\u003ebasmati\u003c/em\u003e Dom-sufid allele were selectively aborted, suggesting this heterozygous locus had a very strong biological effect on hybrid male sterility. By reviewing previous studies, \u003cem\u003eqPS1.2\u003c/em\u003e was a novel pollen grain hybrid sterility locus, and was named as \u003cem\u003eS67\u003c/em\u003e since there was no reported before. Therefore, plants with heterozygous \u003cem\u003eS67\u003c/em\u003e (\u003cem\u003eS67-te\u003c/em\u003e/\u003cem\u003eS67-b\u003c/em\u003e) genotype in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e were selected as a near isogenic line, NIL-\u003cem\u003eS67\u003c/em\u003e(H).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSegregation analysis of \u003cem\u003eS67\u003c/em\u003e alleles in different populations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePopulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGeneration\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePollen fertility\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eS67\u003c/em\u003e genotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e (1:2:1)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e (1:1)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS67\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e186\u003c/p\u003e \u003cp\u003e204\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003efully fertility\u003c/p\u003e \u003cp\u003esemi-sterility\u003c/p\u003e \u003cp\u003efully fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eb/b\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003eb/te\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ete/te\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e214.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNIL-\u003cem\u003eS67\u003c/em\u003e(H)/DJY1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esemi-sterility\u003c/p\u003e \u003cp\u003efully fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eb/te\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ete/te\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDJY1/ NIL-\u003cem\u003eS67\u003c/em\u003e(H)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003esemi-sterility\u003c/p\u003e \u003cp\u003efully fertility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eb/te\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ete/te\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eThe allele \u003cem\u003eS67-b\u003c/em\u003e and \u003cem\u003eS67-te\u003c/em\u003e were abbreviated as \u003cem\u003eb\u003c/em\u003e and \u003cem\u003ete\u003c/em\u003e, respectively, as determined using the SSR marker RM5362. Fourty to sixty percent of pollen fertility was defined as semi-sterility, ~ 90% pollen fertility was defined as fully fertility. Chi-squared tests (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e) were performed for the segregations of the \u003cem\u003eS67\u003c/em\u003e genotypes in the BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e and F\u003csub\u003e1\u003c/sub\u003e and test-cross populations.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor the convenience of description, the \u003cem\u003ebasmati S67\u003c/em\u003e allele was named as \u003cem\u003eS67-b\u003c/em\u003e and the temperate \u003cem\u003ejaponica\u003c/em\u003e DJY1 \u003cem\u003eS67\u003c/em\u003e allele as \u003cem\u003eS67-te\u003c/em\u003e. Given that no homozygous plants having the \u003cem\u003eS67-b\u003c/em\u003e/\u003cem\u003eS67-b\u003c/em\u003e genotype using the SSR Marker RM5362 in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population was found (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), therefore reciprocal test crosses between the NIL-\u003cem\u003eS67\u003c/em\u003e(H) and DJY1 were made to further analyze the gametes transmission. When the NIL-\u003cem\u003eS67\u003c/em\u003e(H) as the female parent, the segregation ratios of the NIL-\u003cem\u003eS67\u003c/em\u003e(H) genotype plants and DJY1 genotype plants fitted a 1:1 ratio (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This indicates that both the \u003cem\u003eS67-te\u003c/em\u003e and \u003cem\u003eS67-b\u003c/em\u003e female gametes in the NIL-\u003cem\u003eS67\u003c/em\u003e(H) were normally fertile, which corresponds to the normal seed setting of the field plants. Nevertheless, when the NIL-\u003cem\u003eS67\u003c/em\u003e(H) as the male parent in a cross with DJY1, only DJY1 genotype F\u003csub\u003e1\u003c/sub\u003e plants were obtained (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). This observation showed that the \u003cem\u003eS67-b\u003c/em\u003e type male gametes in the NIL-\u003cem\u003eS67\u003c/em\u003e(H) are sterility. All these experimental results strongly supported that \u003cem\u003eS67\u003c/em\u003e was a new hybrid male sterility locus between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e. All pollen grains containing the \u003cem\u003eS67-b\u003c/em\u003e allele were selectively aborted, demonstrating the strong transmission advantage of the \u003cem\u003eS67-te\u003c/em\u003e allele.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eBasmati\u003c/em\u003e is a very special and famous subgroups of the Asian cultivated rice germplasm, but it was not fully utilized yet, and the main reason is that the relationship between \u003cem\u003ebasmati\u003c/em\u003e and other groups in Asian cultivated rice is unclear. In terms of grain morphology, this group of some varieties had slender and short round grains (Khush \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Civ\u0026aacute;ň \u003cem\u003eet al\u003c/em\u003e. 2019). Some scholars believed that it belonged to the \u003cem\u003eindica\u003c/em\u003e (Regina et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1975\u003c/span\u003e), while others classified them as the \u003cem\u003ejaponica\u003c/em\u003e type (Cheng et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Numerous studies on the genome classified \u003cem\u003ebasmati\u003c/em\u003e as \u003cem\u003ejaponica\u003c/em\u003e or similar to \u003cem\u003ejaponica\u003c/em\u003e (Garris et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; McNally et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In terms of origin and evolution, some studies suggested that \u003cem\u003ebasmati\u003c/em\u003e was derived from hybridization-introgression between \u003cem\u003eaus\u003c/em\u003e from South Asia and \u003cem\u003ejaponica\u003c/em\u003e (Civ\u0026aacute;ň et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Some scholars also believed that \u003cem\u003ebasmati\u003c/em\u003e was formed through domestication and selection of ancient \u003cem\u003ejaponica\u003c/em\u003e rice from China to South Asia after being transmitted (Huang et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). There were also views that \u003cem\u003ebasmati\u003c/em\u003e was directly domesticated from local \u003cem\u003eOryza rufipogon\u003c/em\u003e in South Asia (Zhang et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In short, different research led to distinct results. So, as in indication of species formation, the relationship between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups from the vision of reproductive isolation is the key to know the difference. In the present study, severe hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e was found, and a novel hybrid male sterility locus \u003cem\u003eS67\u003c/em\u003e was identified, which will greatly help understand the hybridization compatibility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups from a new perspective, and will also help us fully understand the genetic differentiation of Asian cultivation rice from the perspective of reproductive isolation. However, in order to comprehensively and scientifically explain the hybrid sterility relationship between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups, it is necessary to further systematically map and analyze the corresponding hybrid sterility genes.\u003c/p\u003e \u003cp\u003eTo this day, about 50 hybrid sterility loci/QTL were discovered and reported, with more than 30 responsible for the crosses between Asian cultivated rice two subspecies, and these loci mainly contributed to the hybrid sterility between \u003cem\u003eindica\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e (Ouyang \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). But there are no reports on the hybrid sterility loci of \u003cem\u003ebasmati\u003c/em\u003e. In this study, a new hybrid male sterility locus, \u003cem\u003eS67\u003c/em\u003e, was discovered in hybrids between the \u003cem\u003ebasmati\u003c/em\u003e variety Dom-sufid and the temperate \u003cem\u003ejaponica\u003c/em\u003e variety DJY1, and located between RM5362 and K1-40.6 on the long arm of chromosome 1. In this chromosomal region, previous studies reported one inter-subspecific hybrid sterility locus, \u003cem\u003eS16\u003c/em\u003e, between \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e, which was a hybrid sterility locus affecting female gametes (Wan \u003cem\u003eet al\u003c/em\u003e. 1995). Another locus \u003cem\u003eS58\u003c/em\u003e controlled the hybrid male sterility in Asian\u0026ndash;African cultivated rice hybrids was reported, too (Feng et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Unlike the gamete elimination of \u003cem\u003eS1\u003c/em\u003e (Xie et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), the finding showed that male gametes carrying the \u003cem\u003eS58-g\u003c/em\u003e allele (African rice-type \u003cem\u003eS58\u003c/em\u003e allele) were eliminated, resulting in the male gametes with the \u003cem\u003eS58-s\u003c/em\u003e (Asian rice-type \u003cem\u003eS58\u003c/em\u003e allele) allele gaining a transmission advantage. Whether \u003cem\u003eS67\u003c/em\u003e and \u003cem\u003eS58\u003c/em\u003e are the different haplotypes of the same locus or different loci needs to be answered. This result not only fills the gap in the research on hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e, but also lays a good foundation for the systematic study of the genetic rules of hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups.\u003c/p\u003e \u003cp\u003e \u003cem\u003eBasmati\u003c/em\u003e is a very excellent germplasm resource with rich genetic variation and great potential for increasing yield, improving quality and adaptability. However, the heterosis generated by hybridization between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups is limited by hybrid sterility, thus overcoming the reproductive barrier by adopting different methods and technical means is the key step to use the diversity of \u003cem\u003ebasmati\u003c/em\u003e. Varieties carrying natural or artificial neutral alleles of hybrid sterility loci are important germplasm resources for overcoming the hybrid sterility (Xie et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this study, \u003cem\u003eS67\u003c/em\u003e was identified from \u003cem\u003ebasmati\u003c/em\u003e, which gives the first step to overcome \u003cem\u003eS67\u003c/em\u003e-mediated hybrid sterility. By repeatedly backcrossing, the fragment carrying the \u003cem\u003eS67-b\u003c/em\u003e allele in the recurrent parent, as a \"bridge parent\" containing homozygous \u003cem\u003eS67-b\u003c/em\u003e, is one way to achieve the goal. Hybridization between the \"bridge parent\" and \u003cem\u003ebasmati\u003c/em\u003e varieties can effectively overcome inter-subgroup hybrid sterility. But it might be difficulty since \u003cem\u003eS67-b\u003c/em\u003e was completely aborted. Thus, artificial neutral lines can be made to overcome the sterility by editing the causal genes in the \u003cem\u003eS67\u003c/em\u003e locus through CRISPR/Cas9.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMaterials\u003c/h2\u003e \u003cp\u003eOne \u003cem\u003ebasmati\u003c/em\u003e variety named Dom-sufid was introduced from the International Rice Research Institute (IRRI) as the donor parent, one \u003cem\u003eO. sativa\u003c/em\u003e ssp. temperate \u003cem\u003ejaponica\u003c/em\u003e variety, DJY1, from Yunnan province, P. R. China, as the maternal, were used to obtain F\u003csub\u003e1\u003c/sub\u003e. Afterwards, selected the sterility plants in each generation as female parent and continuously backcrossed with DJY1 until BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e. The cultivation of all relevant populations was completed in xishuangbanna, Yunnan province, P. R. China. In the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e, 148 plants were used for QTL detection. Meanwhile, after phenotypic evaluation and marker-assisted selection, sterility individuals (pollen fertility below 90% and the genotype is heterozygous) were randomly selected as the maternal for continuous backcrossing until BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e. A total of 5 pollen grain semi-sterility plants were obtained in the backcross line 136 of BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The background and target fragment introgression of plants in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e were screened by using Rice 6k Chips (Illumina, USA). BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e, obtained by selfing of the target individual from BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e, was used for target locus mapping and near isogenic line raising. To study the gamete elimination and transmission pattern, reciprocal crosses were made between heterozygous individual in BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e and recurrent parent to obtain F\u003csub\u003e1\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eObservation of pollen grain and spikelet fertility\u003c/h3\u003e\n\u003cp\u003eAnthers were collected from spikelet of the upper and middle parts of the main panicle at 1 to 2 days before anthesis, fixed and stored in 70% ethanol for determining pollen fertility (Doi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Pollen fertility was estimated based on the percentage of pollen grains stained with 1% (w/v) iodine-potassium iodide solution. The pollen grain sterility types were classified as typical, spherical and stained abortion types. Observation requires at least three independent microscopic fields, at least 100 pollen grains in each field were scored for counting the percentage of fertile pollen grains in each plant. Spikelet fertility was calculated as a percentage of fertilized spikelet per panicle for each of the individuals involved.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetection of QTL and DNA analysis\u003c/h2\u003e \u003cp\u003eTo detect the QTL, a linkage map of the BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e population was constructed using QTL IciMapping Version 4.2 (Lei et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), with a minimum LOD score of 3.0. Composite interval analysis was conducted to determine QTL related to the tested traits. The experiment-wide LOD (log of the odds ratio) threshold significant level was determined from 1000 permutation tests (Churchill \u003cem\u003eet al\u003c/em\u003e. 1994), as implemented by QTL IciMapping. The genotype data of BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e was obtained using rice 10K Liquid Chips by Boradi Biotechnology Co., Ltd, Shijiazhuang, Hebei. BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e population was used to target gene mapping and genetic analysis. QTL IciMapping Version 4.2 and MapChart 2.32 were used to construct linkage groups and map hybrid sterility loci.\u003c/p\u003e \u003cp\u003eTen days after transplanting, fresh leaves from each individual were sampled for extraction of genomic NDA using the CTAB method (Rogers \u003cem\u003eet al\u003c/em\u003e. 1985). SSR and KASP markers, distributed throughout the entire rice genome, provided by Yunnan Seed Laboratory/Yunnan Key Laboratory for Rice Genetic Improvement, Food Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming, China, were used for polymorphism screening and genotyping. Rice 6k Chips was used to detect target fragments infiltration and background replacement. The protocol of Rice 6k Chips as Infinium HD Assay Ultra Protocol Guide (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://support.illumina.com.cn/downloads/infinium_hd_ultra_assay_protocol_guide_(11328087_b).html\u003c/span\u003e\u003cspan address=\"https://support.illumina.com.cn/downloads/infinium_hd_ultra_assay_protocol_guide_(11328087_b).html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used. GGT 2.0 software was used to map and view the infiltration of target trait related fragments and background replacement.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGenetic and gametic transmission assay\u003c/h3\u003e\n\u003cp\u003eTo determine the genetic and gametic transmission nature of \u003cem\u003eS67\u003c/em\u003e, the segregation ratios of the \u003cem\u003eS67-b\u003c/em\u003e (from \u003cem\u003ebasmati\u003c/em\u003e) and the \u003cem\u003eS67-te\u003c/em\u003e (from temperate \u003cem\u003ejaponica\u003c/em\u003e) alleles were investigated in three populations: BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e, NIL-\u003cem\u003eS67\u003c/em\u003e(H)/DJY1 and DJY1/NIL-\u003cem\u003eS67\u003c/em\u003e(H). The \u003cem\u003eS67\u003c/em\u003e genotypes in these populations were checked using the SSR marker RM5362 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), allowing to analyze the transmission rates to offspring of the \u003cem\u003eS67-b\u003c/em\u003e allele and the \u003cem\u003eS67-te\u003c/em\u003e allele.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003eThis study was funded by National Natural Science Foundation of China (Grant Nos. 31991221, 32160489); Basic Research Foundation of Yunnan Provincial Science and Technology Department, China (Grant Nos. 202401AT070090, 202101AT070193, 202101AS070036, 202001AS070003, 202201AS070072, 202205AR070001-04); Yunnan Provincial Government (YNWR-QNBJ-2018-359); Technology Talent and Platform program of Yunnan Provincial Science and Technology Department, China (Grant Nos. 202205AC160057); and the Yunnan Seed Laboratory Program.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor. Contributions:\u0026nbsp;\u003c/strong\u003eD.T and Y.Z conceived and designed the experiments. Y.L participated in phenotyping, genotyping, drafting the manuscript. J.L and Y.Y participated in phenotyping and genotyping. Q.P, J.Z, and X.D participated in phenotyping. D.T and Y.Z corrected manuscript. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003eThe author(s) declare no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations:\u0026nbsp;\u003c/strong\u003eThe plant collection and use was in accordance with all the relevant guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePermissions statement:\u003c/strong\u003e All the rice materials involved in this paper are gifted, and have no licensing disputes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability:\u003c/strong\u003e The datasets used and/or analysed during the current study available from the corresponding author ([email protected]) on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAshfaq, M. \u003cem\u003eet al\u003c/em\u003e. Basmati rice a class apart (a review). \u003cem\u003eRice Research: Open Access\u003c/em\u003e\u003cstrong\u003e3,\u003c/strong\u003e 156; 10.4172/2375-4338.1000156 (2015).\u003c/li\u003e\n\u003cli\u003eAshok, K.S. \u003cem\u003eet al\u003c/em\u003e. Introgression of multiple disease resistance into a maintainer of basmati rice CMS line by marker assisted backcross breeding. \u003cem\u003eEuphytica\u003c/em\u003e. \u003cstrong\u003e203, \u003c/strong\u003e97-107 (2015).\u003c/li\u003e\n\u003cli\u003eBai, S.W. \u003cem\u003eet al\u003c/em\u003e. Retrospective and perspective of rice breeding in China. \u003cem\u003eJ. Genet. Genomics\u003c/em\u003e. \u003cstrong\u003e45,\u003c/strong\u003e 603-612 (2018). \u003c/li\u003e\n\u003cli\u003eBrar, D.S. \u0026amp; Khush, G.S. \u0026ldquo;Wild relatives of rice: a valuable genetic resource for genomics and breeding research,\u0026rdquo; in The Wild \u003cem\u003eOryza\u003c/em\u003e Genomes, Compendium of Plant Genomes (ed. Mondal, T.K. \u0026amp; Henry, R.J.) 1-25 (Springer International Publishing AG, 2018).\u003c/li\u003e\n\u003cli\u003eChen, M.J.\u003cem\u003e et al\u003c/em\u003e. A new gene controlling hybrid sterility in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eEuphytica\u003c/em\u003e. \u003cstrong\u003e184,\u003c/strong\u003e 15-22 (2012) .\u003c/li\u003e\n\u003cli\u003eChen, R.Z.\u003cem\u003e et al\u003c/em\u003e. Rice functional genomics: decades\u0026apos; efforts and roads ahead. \u003cem\u003eSci. China. Life. Sci\u003c/em\u003e. \u003cstrong\u003e65,\u003c/strong\u003e 33-92 (2022) .\u003c/li\u003e\n\u003cli\u003eChen, J.J.\u003cem\u003e et al\u003c/em\u003e. A triallelic system of \u003cem\u003eS5\u003c/em\u003e is a major regulator of the reproductive barrier and compatibility of \u003cem\u003eindica\u003c/em\u003e-\u003cem\u003ejaponica\u003c/em\u003e hybrids in rice. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A\u003c/em\u003e. \u003cstrong\u003e105,\u003c/strong\u003e 11436-11441 (2008).\u003c/li\u003e\n\u003cli\u003eCheng, K.S., Huang, N.W. \u0026amp; Zhang, Y.Z. Research on that sickle-shaped rice is an another king of intermediate type. \u003cem\u003eSouthwest China Journal of Agricultural Sciences\u003c/em\u003e\u003cstrong\u003e3,\u003c/strong\u003e 102-103 (1990).\u003c/li\u003e\n\u003cli\u003eChoi, J.Y.\u003cem\u003e et al\u003c/em\u003e. Nanopore sequencing-based genome assembly and evolutionary genomics of circumbasmati rice. \u003cem\u003eGenome Biol\u003c/em\u003e. \u003cstrong\u003e21,\u003c/strong\u003e 21 (2020).\u003c/li\u003e\n\u003cli\u003eChurchill, G.A. \u0026amp; Doerge, R.W. Empirical threshold values for quantitative trait mapping. \u003cem\u003eGenetics\u003c/em\u003e. \u003cstrong\u003e138,\u003c/strong\u003e 963-971 (1994) .\u003c/li\u003e\n\u003cli\u003etraced to the Indian subcontinent. \u003cem\u003eGenome Biol. Evol\u003c/em\u003e. \u003cstrong\u003e11,\u003c/strong\u003e 832-843 (2019).\u003c/li\u003e\n\u003cli\u003eCiv\u0026aacute;ň, P.\u003cem\u003e et al\u003c/em\u003e. Three geographically separate domestications of Asian rice. \u003cem\u003eNat. Plants\u003c/em\u003e. \u003cstrong\u003e1,\u003c/strong\u003e 1-5 (2015).\u003c/li\u003e\n\u003cli\u003eDoi, K., Yoshimura, A. \u0026amp; Iwata, N. RFLP mapping and QTL analysis of heading date and pollen sterility using backcross population between \u003cem\u003eOryza sativa\u003c/em\u003e L. and \u003cem\u003eOryza glaberrima\u003c/em\u003e Steud. \u003cem\u003eBreeding Sci\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e48, \u003c/strong\u003e395-399 (1998).\u003c/li\u003e\n\u003cli\u003eDolores, R.C., Chang, T.T. \u0026amp; Ramirez, D.A. Cytogenetics of sterility in F\u003csub\u003e2\u003c/sub\u003e hybrids of \u003cem\u003eindica\u003c/em\u003e\u0026times;\u003cem\u003eindica\u003c/em\u003e and \u003cem\u003eindica\u003c/em\u003e\u0026times;\u003cem\u003ejavanica\u003c/em\u003e varieties of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eCytologia\u003c/em\u003e. \u003cstrong\u003e40,\u003c/strong\u003e 639-647 (1975).\u003c/li\u003e\n\u003cli\u003eFeng, Y.M.\u003cem\u003e et al\u003c/em\u003e. Characterization and fine-mapping of a new Asian rice selfish genetic locus\u003cem\u003e S58\u003c/em\u003e in Asian-African rice hybrids. \u003cem\u003eTheoretical and Applied Genetics\u003c/em\u003e\u003cstrong\u003e136,\u003c/strong\u003e 87 (2023).\u003c/li\u003e\n\u003cli\u003eFoster-Powell, K., Holt, S.HA., \u0026amp; Brand-Miller, J.C. International table of glycemic index and glycemic load values. \u003cem\u003eAm J Clin Nutr\u003c/em\u003e. \u003cstrong\u003e76,\u003c/strong\u003e 5-56 (2002).\u003c/li\u003e\n\u003cli\u003eFukagawa, N.K. \u0026amp; Ziska, L.H. Rice: Importance for global nutrition. \u003cem\u003eJ. Nutr. Sci. Vitaminol\u003c/em\u003e. \u003cstrong\u003e65,\u003c/strong\u003e S2-S3 (2019).\u003c/li\u003e\n\u003cli\u003eGarris, A.J.\u003cem\u003e et al\u003c/em\u003e. Genetic structure and diversity in \u003cem\u003eOryza sativa\u003c/em\u003e L. \u003cem\u003eGenetics\u003c/em\u003e. \u003cstrong\u003e169, \u003c/strong\u003e1631-1638 (2005).\u003c/li\u003e\n\u003cli\u003eGlaszmann, J.C. Isozymes and classification of Asian rice varieties. \u003cem\u003eTheor. Appl. Genet\u003c/em\u003e. \u003cstrong\u003e74,\u003c/strong\u003e 21-30 (1987).\u003c/li\u003e\n\u003cli\u003eHikoichi, O. Phylogenetic differentiation of the cultivated rice plant Ⅱ. Intervarietal hybrid sterility. \u003cem\u003eJapanese Journal of Breeding\u003c/em\u003e. \u003cstrong\u003e3, \u003c/strong\u003e50-63 (1952).\u003c/li\u003e\n\u003cli\u003eHuang, X.H.\u003cem\u003e et al\u003c/em\u003e. A map of rice genome variation reveals the origin of cultivated rice. \u003cem\u003eNature\u003c/em\u003e. \u003cstrong\u003e490, \u003c/strong\u003e497-501 (2012).\u003c/li\u003e\n\u003cli\u003eKato, S. On the affinity of the cultivated varieties of rice plants Oryza sativa L. \u003cem\u003eJournal of the Department of Agriculture, Kyushu Imperial University\u003c/em\u003e\u003cstrong\u003e2,\u003c/strong\u003e 241-276 (1930)\u003c/li\u003e\n\u003cli\u003eKhin, M.M.\u003cem\u003e et al\u003c/em\u003e. Specific patterns of genetic diversity among aromatic rice varieties in Myanmar. \u003cem\u003eRice\u003c/em\u003e. \u003cstrong\u003e5,\u003c/strong\u003e 1-13 (2012).\u003c/li\u003e\n\u003cli\u003eKhush, G.S. Taxonomy and origin of rice (ed. Singh, R.K. \u0026amp; Khush, G.S.) 5-13 (New Delhi: Oxford \u0026amp; IBH Publishing, 2000).\u003c/li\u003e\n\u003cli\u003eKiran, B.G.\u003cem\u003e et al\u003c/em\u003e. Deployment of wild relatives for genetic improvement in rice (\u003cem\u003eOryza sativa\u003c/em\u003e). \u003cem\u003ePlant Breed\u003c/em\u003e. \u003cstrong\u003e140,\u003c/strong\u003e 23-52 (2020).\u003c/li\u003e\n\u003cli\u003eKishor, D.S.\u003cem\u003e et al\u003c/em\u003e. Evaluation of whole-genome Sequence, genetic diversity, and agronomic traits of Basmati rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eFront Genet\u003c/em\u003e. \u003cstrong\u003e11,\u003c/strong\u003e 86 (2020).\u003c/li\u003e\n\u003cli\u003eKubo, T.\u003cem\u003e et al\u003c/em\u003e. Two tightly linked genes at the hsa1 locus cause both F\u003csub\u003e1\u003c/sub\u003e and F\u003csub\u003e2\u003c/sub\u003e hybrid sterility in rice. \u003cem\u003eMol. Plant\u003c/em\u003e. \u003cstrong\u003e9,\u003c/strong\u003e 221-232 (2016).\u003c/li\u003e\n\u003cli\u003eLei, M.\u003cem\u003e et al\u003c/em\u003e. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. \u003cem\u003eCrop J\u003c/em\u003e. \u003cstrong\u003e3, \u003c/strong\u003e269-283 (2015).\u003c/li\u003e\n\u003cli\u003eLi, D.T.\u003cem\u003e et al\u003c/em\u003e. Mapping for a new locus causing hybrid sterility in a China landrace (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eRice Genetics Newsletter\u003c/em\u003e. \u003cstrong\u003e22,\u003c/strong\u003e 20 (2005).\u003c/li\u003e\n\u003cli\u003eLi, D.T.\u003cem\u003e et al\u003c/em\u003e. Fine mapping of \u003cem\u003eS32(t)\u003c/em\u003e, a new gene causing hybrid embryo sac sterility in a Chinese landrace rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eTheor. Appl. Genet. \u003c/em\u003e\u003cstrong\u003e114,\u003c/strong\u003e 515-524 (2007). \u003c/li\u003e\n\u003cli\u003eLiu, Y.Q.\u003cem\u003e et al\u003c/em\u003e. Genomic basis of geographical adaptation to soil nitrogen in rice. \u003cem\u003eNature\u003c/em\u003e\u003cstrong\u003e590,\u003c/strong\u003e 600-605 (2021).\u003c/li\u003e\n\u003cli\u003eLong, Y.\u003cem\u003e et al\u003c/em\u003e. Hybrid male sterility in rice controlled by interaction between divergent alleles of two adjacent genes. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A\u003c/em\u003e. \u003cstrong\u003e105,\u003c/strong\u003e 18871-18876 (2008).\u003c/li\u003e\n\u003cli\u003eMcNally, K.L.\u003cem\u003e et al\u003c/em\u003e. Genome-wide SNP variation reveals relationships among landraces and modern varieties of rice.\u003cem\u003e Proc. Natl. Acad. Sci. U.S.A\u003c/em\u003e. \u003cstrong\u003e106,\u003c/strong\u003e 12273-12278 (2009).\u003c/li\u003e\n\u003cli\u003eMizuta, Y., Harushima, Y. \u0026amp; Kurata, N. Rice pollen hybrid incompatibility caused by reciprocal gene loss of duplicated genes. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A\u003c/em\u003e. \u003cstrong\u003e107,\u003c/strong\u003e 20417-20422 (2010).\u003c/li\u003e\n\u003cli\u003eOuyang, Y.D. Understanding and breaking down the reproductive barrier between Asian and African cultivated rice: a new start for hybrid rice breeding. \u003cem\u003eSci China Life Sci\u003c/em\u003e. \u003cstrong\u003e62,\u003c/strong\u003e 1-3 (2019).\u003c/li\u003e\n\u003cli\u003eRao, J.L.\u003cem\u003e et al\u003c/em\u003e. Genetic analysis of \u003cem\u003eS5\u003c/em\u003e-interacting genes regulating hybrid sterility in rice. \u003cem\u003eRice\u003c/em\u003e\u003cstrong\u003e14,\u003c/strong\u003e 11 (2021).\u003c/li\u003e\n\u003cli\u003eRegina, C.D., Chang, T.T. \u0026amp; Ramirez, D.A. Cytogenetics of sterility in F\u003csub\u003e2\u003c/sub\u003e hybrids of \u003cem\u003eindica\u003c/em\u003e\u0026times;\u003cem\u003eindica\u003c/em\u003e and \u003cem\u003eindica\u003c/em\u003e\u0026times;\u003cem\u003ejavanica\u003c/em\u003e varieties of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eCytologia\u003c/em\u003e\u003cstrong\u003e40, \u003c/strong\u003e639-647 (1975). \u003c/li\u003e\n\u003cli\u003eRogers, S.O. \u0026amp; Bendich, A.J. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues.\u003cem\u003e Plant Mol Biol\u003c/em\u003e\u003cstrong\u003e5,\u003c/strong\u003e 69-76 (1985).\u003c/li\u003e\n\u003cli\u003eSatishkumar, M., Harishkumar, H. \u0026amp; Rangegowda, R. Growth export performance and competitiveness of basmati and non-basmati rice of India-an Markov chain approach. \u003cem\u003eInt J Agr Biol Eng\u003c/em\u003e. \u003cstrong\u003e9, \u003c/strong\u003e305-311 (2016).\u003c/li\u003e\n\u003cli\u003eShen, R.X.\u003cem\u003e et al\u003c/em\u003e. Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice. \u003cem\u003eNat. Commun\u003c/em\u003e. \u003cstrong\u003e8,\u003c/strong\u003e 1310 (2017).\u003c/li\u003e\n\u003cli\u003eTang, H.W.\u003cem\u003e et al\u003c/em\u003e. Advances in understanding the molecular mechanisms of cytoplasmic male sterility and restoration in rice. \u003cem\u003ePlant Reprod\u003c/em\u003e. \u003cstrong\u003e30, \u003c/strong\u003e179-184 (2017).\u003c/li\u003e\n\u003cli\u003eWan, J.M.\u003cem\u003e et al\u003c/em\u003e. Mapping of hybrid sterility gene \u003cem\u003eS17\u003c/em\u003e of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) by isozyme and RFLP markers. \u003cem\u003eRice Genetics Newsletter\u003c/em\u003e. \u003cstrong\u003e15,\u003c/strong\u003e 151-154 (1998).\u003c/li\u003e\n\u003cli\u003eWan, J.C.\u003cem\u003e et al\u003c/em\u003e. Two new loci for hybrid sterility in cultivated rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eTheor. Appl. Genet\u003c/em\u003e. \u003cstrong\u003e92,\u003c/strong\u003e 183-190 (1996).\u003c/li\u003e\n\u003cli\u003eWan, J.M. \u0026amp; Ikehashi, H. Identification of a new locus \u003cem\u003eS-1\u003c/em\u003e6 causing hybrid sterility in native rice varieties (\u003cem\u003eOryza sativa\u003c/em\u003e L.) from Tai-hu lake region and Yunnan Province, China.\u003cem\u003e \u003c/em\u003e\u003cem\u003eBreeding Sci\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e45,\u003c/strong\u003e 446-470 (1995).\u003c/li\u003e\n\u003cli\u003eWan, J.M.\u003cem\u003e et al\u003c/em\u003e. Multiple alleles at a new locus causing hybrid sterility between a Korean indica variety and a \u003cem\u003ejavanica\u003c/em\u003e variety in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eJapanese Journal of Breeding\u003c/em\u003e. \u003cstrong\u003e43,\u003c/strong\u003e 507-516 (1993).\u003c/li\u003e\n\u003cli\u003eWang, C.L.\u003cem\u003e et al\u003c/em\u003e. A natural gene drive system confers reproductive isolation in rice. \u003cem\u003eCell\u003c/em\u003e. \u003cstrong\u003e186,\u003c/strong\u003e 1-16 (2023).\u003c/li\u003e\n\u003cli\u003eWang, C.M.\u003cem\u003e et al\u003c/em\u003e. Mapping segregation distortion loci and quantitative trait loci for spikelet sterility in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eGenet. Res\u003c/em\u003e. \u003cstrong\u003e86, \u003c/strong\u003e97-106 (2005).\u003c/li\u003e\n\u003cli\u003eWang, H.R.\u003cem\u003e et al\u003c/em\u003e. The Power of Inbreeding: NGS-Based GWAS of Rice Reveals Convergent Evolution during Rice Domestication. \u003cem\u003eMol Plant\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e9,\u003c/strong\u003e 975-85 (2016).\u003c/li\u003e\n\u003cli\u003eWang, J.\u003cem\u003e et al\u003c/em\u003e. Studies on F\u003csub\u003e1\u003c/sub\u003e fertility of five different ecological types of Asian cultivated rice with \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e.\u003cem\u003e Journal of Yunnan University: Natural Sciences Edition\u003c/em\u003e\u003cstrong\u003e45, \u003c/strong\u003e1-9 (2023).\u003c/li\u003e\n\u003cli\u003eWang, W.S.\u003cem\u003e et al\u003c/em\u003e. Genomic variation in 3,010 diverse accessions of Asian cultivated rice. \u003cem\u003eNature\u003c/em\u003e. \u003cstrong\u003e557,\u003c/strong\u003e 43-49 (2018).\u003c/li\u003e\n\u003cli\u003eXie, L.\u003cem\u003e et al\u003c/em\u003e. RiceENCODE: A comprehensive epigenomic database as a rice Encyclopedia of DNA Elements. \u003cem\u003eMol Plant\u003c/em\u003e. \u003cstrong\u003e14,\u003c/strong\u003e 1604-1606 (2021).\u003c/li\u003e\n\u003cli\u003eXie, Y.Y.\u003cem\u003e et al\u003c/em\u003e. Suppression or knockout of \u003cem\u003eSaF/SaM\u003c/em\u003e overcomes the Sa-mediated hybrid male sterility in rice. \u003cem\u003eJ Integr Plant Biol\u003c/em\u003e. \u003cstrong\u003e59,\u003c/strong\u003e 669-679 (2017).\u003c/li\u003e\n\u003cli\u003eXie, Y.Y.\u003cem\u003e et al\u003c/em\u003e. Molecular mechanisms of hybrid sterility in rice. \u003cem\u003eSci China Life Sci\u003c/em\u003e. \u003cstrong\u003e62,\u003c/strong\u003e 737-743 (2019).\u003c/li\u003e\n\u003cli\u003eXu, N.\u003cem\u003e et al\u003c/em\u003e. Introgression of a Complex Genomic Structural Variation Causes Hybrid Male Sterility in \u003cem\u003eGJ\u003c/em\u003e Rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) Subspecies. \u003cem\u003eInt. J. Mol. Sci\u003c/em\u003e. \u003cstrong\u003e23,\u003c/strong\u003e 1-10 (2022).\u003c/li\u003e\n\u003cli\u003eYanagihara, S., Kato, H. \u0026amp; Ikehashi, H. A new locus for multiple alleles causing hybrid sterility between an \u003cem\u003eAus\u003c/em\u003e variety and \u003cem\u003ejavanica\u003c/em\u003e varieties in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.). \u003cem\u003eTheor. Appl. Genet\u003c/em\u003e. \u003cstrong\u003e90, \u003c/strong\u003e182-188 (1992). \u003c/li\u003e\n\u003cli\u003eYu, S.B.\u003cem\u003e et al\u003c/em\u003e. Hybrid rice and green super rice. \u003cem\u003eSci. Bull\u003c/em\u003e. \u003cstrong\u003e61,\u003c/strong\u003e 3797-3803 (2016).\u003c/li\u003e\n\u003cli\u003eYu, Y.\u003cem\u003e et al\u003c/em\u003e. Hybrid sterility in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) involves the tetratricopeptide repeat domain containing protein. \u003cem\u003eGenetics\u003c/em\u003e. \u003cstrong\u003e203,\u003c/strong\u003e 1439-1451 (2016).\u003c/li\u003e\n\u003cli\u003eZhang, F.\u003cem\u003e et al\u003c/em\u003e. The landscape of gene-CDS-haplotype diversity in rice: Properties, population organization, footprints of domestication and breeding, and implications for genetic improvement. \u003cem\u003eMol Plant\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e\u003cstrong\u003e14,\u003c/strong\u003e 787-804 (2021).\u003c/li\u003e\n\u003cli\u003eZhang, G.Q. Prospects of utilization of inter-subspecific heterosis between \u003cem\u003eindica\u003c/em\u003e and \u003cem\u003ejaponica\u003c/em\u003e rice. \u003cem\u003eJ. Integr. Agric\u003c/em\u003e. \u003cstrong\u003e19,\u003c/strong\u003e 1-10 (2020).\u003c/li\u003e\n\u003cli\u003eZhang, Y.\u003cem\u003e et al\u003c/em\u003e. Understanding the nature of hybrid sterility and divergence of Asian cultivated rice. \u003cem\u003eFront. Plant Sci. \u003c/em\u003e\u003cstrong\u003e13,\u003c/strong\u003e 908342; 10.3389/fpls.2022.908342 (2022). \u003c/li\u003e\n\u003cli\u003eZhao, K.Y.\u003cem\u003e et al\u003c/em\u003e. Genome-wide association mapping reveals a rich genetic architecture of complex traits in \u003cem\u003eOryza sativa\u003c/em\u003e. \u003cem\u003eNat. Commun\u003c/em\u003e. \u003cstrong\u003e2,\u003c/strong\u003e 92-100 (2011).\u003c/li\u003e\n\u003cli\u003eZhao, Z.G.\u003cem\u003e et al\u003c/em\u003e. Fine mapping of \u003cem\u003eS31\u003c/em\u003e, a gene responsible for hybrid embryo-sac abortion in rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.).\u003cem\u003e Planta\u003c/em\u003e. \u003cstrong\u003e226,\u003c/strong\u003e 1087-1096 (2007). \u003c/li\u003e\n\u003cli\u003eZhou, J.W.\u003cem\u003e et al\u003c/em\u003e. Interspecific hybridization is an important driving force for origin and diversification of Asian cultivated rice (\u003cem\u003eOryza sativa\u003c/em\u003e L). \u003cem\u003eFront. Plant Sci.\u003c/em\u003e\u003cstrong\u003e13,\u003c/strong\u003e 932737; 10.3389/fpls.2022.932737 (2022).\u003c/li\u003e\n\u003cli\u003eZhou, P.H.\u003cem\u003e et al\u003c/em\u003e. A minimal genome design to maximally guarantee fertile inter-subspecific hybrid rice. \u003cem\u003eMol Plant\u003c/em\u003e. \u003cstrong\u003e16, \u003c/strong\u003e726-738 (2023).\u003c/li\u003e\n\u003cli\u003eZhu, S.S.\u003cem\u003e et al\u003c/em\u003e. A new gene located on chromosome 2 causing hybrid sterility in a remote cross of rice. \u003cem\u003ePlant Breed\u003c/em\u003e. \u003cstrong\u003e124,\u003c/strong\u003e 440-445 (2005). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"hybrid sterility, Oryza sativa, basmati, temperate japonica, S67","lastPublishedDoi":"10.21203/rs.3.rs-4434612/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4434612/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAsian cultivated rice (\u003cem\u003eOryza sativa\u003c/em\u003e) is the most important cultivated species in the AA genome species of the genus \u003cem\u003eOryza\u003c/em\u003e. \u003cem\u003ebasmati\u003c/em\u003e is a special and famous subgroup in Asian cultivated rice, and temperate \u003cem\u003ejaponica\u003c/em\u003e is one of the most important cultivated subgroup, too. However, hybrid sterility hinders the introgression of favorable traits and the utilization of hybrid vigour between them. The genetic basis of intraspecific hybrid sterility between temperate \u003cem\u003ejaponica\u003c/em\u003e and \u003cem\u003ebasmati\u003c/em\u003e remained elusive. In this study, a novel hybrid sterility locus \u003cem\u003eS67\u003c/em\u003e was identified, which caused hybrid male sterility in hybrids between the temperate \u003cem\u003ejaponica\u003c/em\u003e rice variety Dianjingyou 1(DJY1) and the \u003cem\u003ebasmati\u003c/em\u003e rice variety Dom-sufid. Initial mapping with BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e, BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e, BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e populations and DNA markers located \u003cem\u003eS67\u003c/em\u003e between RM5362(41087022) and K1-40.6(41824986) on the long arm of chromosome 1. Genetic analysis confirmed that \u003cem\u003eS67\u003c/em\u003e caused a transmission advantage for the temperate \u003cem\u003ejaponica\u003c/em\u003e rice \u003cem\u003eS67-te\u003c/em\u003e allele in the hybrid offsprings. This result not only fills the gap in the research on hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and temperate \u003cem\u003ejaponica\u003c/em\u003e, but also lays a good foundation for the systematic study of the genetic rules of hybrid sterility between \u003cem\u003ebasmati\u003c/em\u003e and other subgroups, as well as the full exploration and utilization of this subgroup through the creation of wide or specific compatibility lines to overcome hybrid sterility. In addition, this result can also help us broaden our understanding of genetic differentiation within Asian cultivated rice and hybrid sterility between inter-subgroups.\u003c/p\u003e","manuscriptTitle":"Identification of A Novel Hybrid Sterility Locus S67 between temperate japonica subgroup and basmati subgroup in Oryza sativa L","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-04 07:47:57","doi":"10.21203/rs.3.rs-4434612/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-16T12:41:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-16T07:02:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"246416121371658206325448328199287574373","date":"2024-10-16T00:03:16+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-14T06:33:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"65885568326134479813870691790213906723","date":"2024-08-05T05:09:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"189000013830551802779178786538182321673","date":"2024-08-05T04:43:48+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-08-05T04:14:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-05T04:12:43+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-05-27T14:47:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-22T10:20:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-05-17T06:22:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b4ab68d0-101c-4a20-8a51-5803b82ee6cd","owner":[],"postedDate":"June 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":32705463,"name":"Biological sciences/Genetics"},{"id":32705464,"name":"Biological sciences/Genetics/Genetic hybridization"},{"id":32705465,"name":"Biological sciences/Genetics/Plant breeding"},{"id":32705466,"name":"Biological sciences/Genetics/Plant genetics"},{"id":32705467,"name":"Biological sciences/Plant sciences"},{"id":32705468,"name":"Biological sciences/Plant sciences/Plant breeding"},{"id":32705469,"name":"Biological sciences/Plant sciences/Plant genetics"}],"tags":[],"updatedAt":"2024-11-25T15:58:40+00:00","versionOfRecord":{"articleIdentity":"rs-4434612","link":"https://doi.org/10.1038/s41598-024-80011-2","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-11-19 15:56:51","publishedOnDateReadable":"November 19th, 2024"},"versionCreatedAt":"2024-06-04 07:47:57","video":"","vorDoi":"10.1038/s41598-024-80011-2","vorDoiUrl":"https://doi.org/10.1038/s41598-024-80011-2","workflowStages":[]},"version":"v1","identity":"rs-4434612","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4434612","identity":"rs-4434612","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0