Anti-obesity effect of the bacterial product, nisin

Anti-obesity effect of the bacterial product, nisin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Anti-obesity effect of the bacterial product, nisin Muslim Al-Emarah, Hamid Reza Kazerani, Fereidoun Taghizad, Hesam Dehghani, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2336816/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Feb, 2023 Read the published version in Lipids in Health and Disease → Version 1 posted 10 You are reading this latest preprint version Abstract Obesity is one of the most important metabolic disorder that predisposes individuals to other diseases. We investigated the effect of nisin, a bacteriocin produced by some bacteria, on obesity and some of its related parameters. Forty mice were randomly divided into four groups and received a placebo (saline) or nisin (25, 50, or 100 µg/kg, ip), daily, for 8 weeks. Bodyweight and food intake were measured weekly, and at the end of the experiment, the levels of fasting blood sugar, serum triglyceride, cholesterol, high-density lipoprotein, low-density lipoprotein, and hepatic enzymes were tested, and red and white blood cell counts, haemoglobin concentration, mean corpuscular volume, mean corpuscular haemoglobin, and mean corpuscular haemoglobin concentration were determined. Finally, the expression levels of some obesity-related genes, including stearoyl-CoA desaturase-1 (SCD-1), glucose transporter-4 (GLUT4), zfp423, 422(ap2), and tumor necrosis factor-alpha (TNF-α) were assessed using RT-qPCR. After the experiment, the body weights, abdominal fat, and body mass index were significantly lower in the nisin-treated groups than in the control. The highest effect was observed with 50 µg/kg of nisin, and this dose caused a significant reduction in the total food intake. The expression of SCD-1, GLUT4, 422(ap2), and TNF-α decreased significantly following treatment with nisin. No significant differences were observed in the other studied parameters, and no toxic effects were observed for nisin under these experimental conditions. Our results suggest that nissin could have weight-protective effects. Obesity nisin bacteriocin microbiota. Figures Figure 1 Figure 2 Figure 3 Introduction Obesity and overweight refer to the excessive accumulation of fat in various parts of the body. According to the World Health Organization (WHO), overweight is defined by a body mass index (BMI) of between 25 and 30 kg/m 2 . When the BMI exceeds 30 kg/m 2 , the condition is referred to as obesity. According to the reports of the WHO, nearly four million people a year lose their lives as a consequence of the complications of obesity. Obesity and being overweight were once considered to be problems of wealthy societies; however, nowadays, more people in intermediate-to-poor societies are dealing with this phenomenon [ 1 ]. Obesity can lead to a variety of health issues, ranging from heart conditions and hypertension to cancer. In addition to an increased burden on the skeletal system, and particularly the joints, that is a natural consequence of excessive weight, the production of IL-6 from fat cells predisposes the individual with obesity to a state of constant low-level inflammation. The secretion of fatty acids from the adipose tissue, which finally lodge in the muscular and liver tissues, is a preliminary stage of developing insulin resistance and diabetes. What’s more, oestrogens produced by enlarged adipocytes could lead to a proliferative and eventually cancerous state in the breast [ 2 ]. Basically, overweight and obesity occur when the rate of energy supply exceeds that of consumption over a period of time long enough to allow the accumulation of fat droplets in adipocytes. Different causes have been suggested for this process, mostly related to diet and physical activity patterns. However, the effects of diet and physical activity can be augmented or decreased by genetic factors and the metabolic state, as seen in some genetic disorders causing obesity [ 3 ]. The word microbiota refers to the microbial population of different organs all over the body. These microorganisms might include bacteria, fungi, and viruses. The most studied role of microbiota in human health is in relation to the gut microbiota and particularly the resident bacteria. The bacterial population of a healthy gut mostly comprises two phyla, Bacteroidetes and Firmicutes. These phyla and others play crucial roles in the maintenance of the intestinal integrity, immunomodulation, protection against pathogens, and drug metabolism [ 4 ]. Several studies have shown the relationship between the composition of the microbial population in the digestive system and body composition/weight [ 5 ]. A study in children showed that obese children have a lower abundance of bacterial species in the intestines [ 6 ]. The same observation has been verified in adults [ 7 ]. Bacteriocins, peptides produced and secreted by certain strains of bacteria, appear to have significant effects on the regulation of weight. A bioinformatics study suggests that certain bacteriocins of the family Lactobacillaceae, probiotics of the human intestine, could exert some effects on weight and adiposity [ 8 ]. One recent study using the bacteriocin gassericin A from the probiotic L.gasseri LA39 on 3T3-L1 pre-adipocytes showed a significant reduction in the expression of some genes related to adipogenesis [ 9 ]. Nisin, a bacteriocin discovered by Rogers and Whittier in 1928, is a 3500-Da peptide containing 34 amino acids and with bactericidal properties. Nisin is produced during the exponential growth phase of the producing strain ( Lactobacillus lactis , subspecies lactis ), and when the growth of the bacteria has halted, the production of the peptide also halts [ 10 ]. Nisin has long been used in the food industry as a preservative and it is produced on a commercial scale to be used in packed foods. Nisin has shown a strong inhibiting effect toward gram-negative bacteria [ 11 ]. Accordingly, we decided to conduct an experiment using this bacteriocin to evaluate its effects on weight, some serum factors, and some significant genes involved in the development and growth of adipocytes. Materials And Methods Nisin was purchased in the form of balanced 2.5% sodium chloride lyophilized powder (Sigma-Aldrich, Germany) and was diluted with normal saline containing 0.05% acetic acid. Animals and treatment Forty healthy male laboratory mice, Mus musculus , weighing 25–45 grams were chosen for the experiment. The animals were treated according to the guidelines of Animal Ethics Committee of the Ferdowsi University of Mashhad (IR.UM.REC.1400.250). The mice were kept in individual cages throughout the experiment. The mice were randomly divided into four groups of ten: the control group that received a placebo and the test groups that received nisin at 25, 50, and 100 µg/kg, daily, for 42 days. The mice were fed ad libitum on a high sugar diet beginning five days before the start of the experiment (Table 1 ). Table 1 Nutrition information of the diet fed to the mice during the experiment. Nutrients Quantity Energy (kcal/kg) 3345 Protein (%) 10–10.5 Fat (%) 1–1.5 Fibre (%) 2.5–3 Sucrose (%) 50 Methionine (%) 0.025 Lysine (%) 0.025 Salt (%) 0.25 P/Ca ratio 1.5–2.5 Ash (%) 2 At the end of each week, the body weights and the amount of consumed food for each animal were measured. Sampling, blood and serum markers At the end of the 8th week, the mice were deprived of food for 12 hours, anaesthetized with 50 mg/kg of thiopental sodium, and their abdominal-area fat extracted and kept in liquid nitrogen for further molecular tests. Blood sampling was performed from the abdominal vena cava. Blood serum was separated by centrifugation at 3500 rpm and the serum was kept at -20ºC for further biochemical assays. The weights of the kidneys and spleen, the length of the small intestine, and the BMI were measured. Serum parameters, including glucose, cholesterol, triglyceride, high-density lipoprotein (HDL), low-density lipoprotein (LDL), alanine transaminase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP), were measured using enzymatic colourimetric methods (kits: Pars Azmoon®, Iran; system: Autoanalyzer Alpha Classic®). RNA isolation and RT-qPCR In order to check the effect of nisin on the level of expression of adipocyte-specific genes, four genes were assayed using RT-qPCR: stearoyl-CoA desaturase-1 (SCD-1) gene which regulates a rate-limiting step in the production of unsaturated fatty acids, SLC2A4 gene encoding glucose transporter-4 (GLUT4) as the main transporter of glucose into the adipocytes, zfp423 gene encoding zinc finger protein 423 as a determinant of differentiation and maintenance of white adipocytes, and the gene encoding 422(ap2) protein as a fatty acid binding protein which increases with the differentiation of pre-adipocytes to adipocytes. We also assayed the expression of the tumour necrosis factor-alpha (TNF-α) gene to evaluate any possible inflammatory response. To reduce the effect of any possible DNA contamination on the results of RT-qPCR, the primers were designed in exon-exon junction form. TATA-binding protein (TBP) was chosen as the reference (housekeeping) gene due to its higher stability in adipocytes [ 12 ]. The list and sequence of primers are shown in Table 2 . Table 2 The primers used in RT-qPCR Gene Forward primer Reverse primer 422ap2 TGAAATCACCGCAGACGACA ACACATTCCACCACCAGCTT GLUT4 GCCCGGACCCTATACCCTAT GGGTTCCCCATCGTCAGAG SCD-1 CAGGTTTCCAAGCGCAGTTC ACTGGAGATCTCTTGGAGCA TBP CCTATCACTCCTGCCACACC ATGACTGCAGCAAATCGCTTG TNF-α TAGCCCACGTCGTAGCAAAC GCAGCCTTGTCCCTTGAAGA Zfp-423 CCGCGATCGGTGAAAGTTGA ACGCTGTTCCTGTCTTCCAG Statistical analysis Statistical analysis and drawing of the graphs were performed using GraphPad Prism Software (GraphPad Software Inc, USA). The non-parametric Mann–Whitney test was used for RT-PCR results. All other comparisons were made using one-way analysis of variance followed by Dunnett's multiple comparison test. P values less than 0.05 were considered statistically significant. Results Body weight, total food intake, abdominal fat and body mass index The statistical analyses showed a significant decrease in weight in the treatment groups in comparison to the control group. As can be seen in Fig. 1 a, all three groups showed a significant loss of weight, with the greatest effect being seen in group 3. The amount of food intake was only reduced in group 3 (50 µg/kg of nicin), with other groups showing no significant changes (Fig. 1 b). A much more significant change was seen in the amount of abdominal fat content, which showed a very sharp reduction in all three treatment groups, with group 3 showing the greatest effect (Fig. 1 c). Another prominent effect of nisin was the change in the BMI, which was significantly reduced in all three treatment groups (Fig. 1 d). Studied body organs, markers of blood and serum The studied serum markers (including fasting blood sugar (FBS), cholesterol, triglyceride, HDL, LDL, AST, ALT, and ALP), the length of the small intestine, the weight of the kidneys and spleen, the red and white blood cell counts, the concentration of haemoglobin, packed cell volume, mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), and mean corpuscular haemoglobin concentration (MCHC) did not show any significant changes (Table 3 ). Table 3 the studied markers of serum, blood, and body organs. Nisin (µg/Kg) FBS (mg/dL) Cholesterol (mg/dL) Triglyceride (mg/dL) HDL (mg/dL) LDL (mg/dL) AST (U/L) ALT (IU/L) ALP (IU/L) RBC (⋅10 6 ) WBC (⋅10 3 ) Hb (g/dL) PCV (%) MCV (fL) MCH (pg) MCHC (g/dL) Small Int (cm) Kidney Wt (g) Spleen Wt (g) 0 93 ± 6.4 116 ± 11.5 84.7 ± 14.6 48.6 ± 5 53 ± 5.1 369 ± 48.2 99.9 ± 10.6 176 ± 24 8.09 ± 0.357 5.16 ± 0.78 12.2 ± 0.6 40.1 ± 1.8 49.5 ± 0.6 15.1 ± 0.2 30.5 ± 0.3 49.9 ± 1.9 0.61 ± 0.02 0.27 ± 0.03 25 90.1 ± 3.6 113 ± 10.3 75.6 ± 8.9 46.2 ± 4.2 51.7 ± 4 317 ± 59.6 118 ± 25.9 182 ± 13.8 7.74 ± 0.244 4.98 ± 0.76 11.6 ± 0.3 38.6 ± 0.9 50.1 ± 1.4 15.1 ± 0.2 30.2 ± 0.5 49.6 ± 1.5 0.6 ± 0.04 0.31 ± 0.05 50 77.7 ± 9.8 128 ± 8.6 90.4 ± 12.1 50.4 ± 3.9 57 ± 4 412 ± 67.6 112 ± 8.5 163 ± 16.8 8.49 ± 0.418 6.76 ± 1.2 12.8 ± 0.7 42.1 ± 2.3 49.6 ± 1 15.1 ± 0.5 30.4 ± 0.5 46.2 ± 1.6 0.61 ± 0.04 0.4 ± 0.04 100 92.3 ± 3.9 114 ± 12.7 87 ± 6.5 49.1 ± 2.6 56.2 ± 3 465 ± 55 140 ± 26.7 175 ± 18.8 8.21 ± 0.565 5.99 ± 0.48 12.3 ± 0.8 42.1 ± 2.4 52 ± 1.6 15.1 ± 0.3 29 ± 0.4 48.2 ± 1.3 0.64 ± 0.04 0.38 ± 0.06 The results of differential white blood cell counts showed a significant increase in the number of neutrophils in the group receiving 50 µg/kg of nisin. Other comparisons, however, did not yield statistical significance (Fig. 2 ). Preliminary histologic evaluation Our preliminary results regarding the cytometry of abdominal fat showed a prominent decrease in the size of adipocytes in the test groups. However, the minute amount of specimen in nisin-treated animals did not allow a sample size enough for statistical comparison. PCR results The data from RT-qPCR showed that the levels of expression of SCD-1, GLUT4, TNF-α, and 422ap2 were significantly reduced, while that of zfp423 did not show any significant changes (Fig. 3 ). Discussion There is public concern regarding the physical and mental problems of obesity. Even the social well-being of an individual can be affected by being overweight or obese, as obese people are more uncomfortable with their body imagery [ 13 ]. There have been numerous studies on the cure of obesity, including the classical dietary and physical activity methods. Recently, attention has been drawn toward molecular interventions such as growth differentiation factor-15 [ 14 ], glucagon-like peptide-1 co-agonists [ 15 ], and some herbal medicines. Many studies have targeted alterations in the microbiota and even the application of bacteriocins [ 9 ], and as using bacteriocins is a pretty novel approach to weight protection, we decided to explore this option. Previous studies on bacteriocins have mainly focused on their antibacterial properties and their potential application as food preservatives. For instance, the antibacterial properties of nisin have been widely studied, and it has been extensively used, alone or in combination with other substances, as a food preservative [ 16 ]. Accordingly, some studies have evaluated the potential toxic effects of nisin, but only the oral route of administration has been used, and these studies have mainly supported the safety of this peptide as a food preservative, which led to its approval by the Food and Drug Administration. However, there is no information regarding the potential therapeutic effect of nisin against obesity. Our team first conducted a pilot study using nisin in laboratory rats and the results showed a significant decrease in the adipose content of the abdominal area (unpublished results). We, therefore, decided to use it in our study to evaluate its possible weight-changing effects. Our results suggest significant weight loss in animals treated with nisin via i.p. injection. Although a significant reduction in food intake was only seen in one of the treatment groups, food-intake reduction can be considered as one of the mechanisms by which nisin exerts its effect on weight reduction. A similar result of decreased food intake was seen in a study determining the biological activity of nisin as a food additive [ 17 ]. In this study, nisin caused a dramatic decline in the level of SCD-1 expression. Stearoyl CoA desaturase-1 is a rate-limiting enzyme in the production of palmitoleic and oleic acids, two important monounsaturated fatty acids that are produced in the liver. The gene for SCD-1 is suppressed by leptin and the suppression of SCD-1 can lead to a considerable loss of weight in people affected by obesity [ 18 ]. A study in high fat-fed rats showed that obesity-prone rats have a higher proportion of the SCD-1 product, palmitoleic acid [ 19 ]. Consistently, in the present study, the body weight, amounts of abdominal fat content, and BMI were significantly lower in the animals that received nisin. These findings suggest that nisin could impose a significant reduction in adiposity and body weight in vivo . However, treatment with nisin did not affect the concentrations of serum triglyceride and cholesterol, suggesting that the most noticeable effect of nisin is on the fat tissue, rather than serum factors. According to the present results, nisin may exert its weight-protecting effect, at least partly, via reducing food intake. It is noteworthy that the high level of SCD-1 expression and subsequently higher levels of monounsaturated fatty acids have also been related to higher cancer death in patients affected by obesity [ 20 ], conferring more benefits to the use of nisin as a health-protective agent. In this study, treatment with nisin caused a significant reduction in the expression of the GLUT4 gene which encodes the main transporter of glucose into adipocytes and skeletal muscle cells. The expression of GLUT4 is reduced in adipocytes (but not skeletal muscle cells) in type II diabetes mellitus (T2D) [ 21 ]. Impairment in the uptake of glucose by GLUT4 is the primary stage in the onset of T2D. Although the expression of GLUT4 was reduced in the animals, we did not observe any impairment in either fasting blood sugar, suggesting that at least in a period of 8 weeks, nisin does not increase the risk of diabetes. Inflammation is a key element in the onset and development of insulin resistance in T2D. To preliminary evaluate the effect of nisin on the inflammatory response of the adipose tissue, we assayed the level of TNF-α expression in the adipose samples. It is generally accepted that the serum level of TNF-α is mildly increased in people affected by obesity. What’s more, the adipose tissue obtained from people affected by obesity has higher levels of mRNA for TNF-α. Increased levels of TNF-α reduce the uptake of glucose via GLUT4 by adipocytes [ 22 ]. TNF-α stimulates the death of hepatocytes and the progression of fatty liver disease. A reduction in the inflammation of adipose tissue in non-alcoholic fatty liver disease (NAFLD) improves the condition of the liver [ 23 ]. In the present study, nisin caused a significant and dramatic reduction in the level of expression of TNF-α in adipose tissue, and thus seems to be beneficial from this point of view. However, more experiments are necessary to further evaluate this effect. Zinc finger protein-423 (zfp423) is a key regulator in the differentiation and maturity of pre-adipocytes. The expression of this protein in pre-adipocytes leads to an increase in the cellular amounts of PPARγ, and this can lead to the differentiation of adipocytes [ 24 ]. Deletion of zfp423 predisposes the white adipocytes to enter the path of beige fat cells, and this can reverse diet-induced obesity. The thermogenic program initiator in beige adipocytes, Ebf2, is suppressed by the activation of zfp423, which leads to the maintenance of the white adipocyte destiny [ 25 ]. Nisin did not change the level of expression of zfp423 significantly in our experiment. This might be an indicator that probably nisin does not have any significant effects on the fate of adipocytes, but just reduces the amount of fat accumulation in these cells through repressing SCD-1 and probably some other yet-unknown mechanisms. Adipocyte protein 422ap2 is expressed after the induction of adipose-specific genes C/EBPβ, C/EBPα, and PPARγ. This protein is representative of adipocytes [ 26 ]. The expression level of 422ap2 was dramatically reduced in the cells treated with nisin, which is an indicator of reduced adiposity. Generally speaking, since 422ap2 is not a fate determiner, we could say that the adipose tissue keeps its identity as a tissue, however, its capacity for producing and storing fat is reduced. In this study, treatment with nisin increased the number of blood neutrophils but had no significant effects on other white blood cells. Neutrophilic leukocytosis, which is an increase in the number of circulating neutrophils, may be triggered by the introduction of bacterial products such as peptides into the bloodstream [ 27 ]. Since nisin is a bacterial peptide, such an increase is predictable. We also performed a preliminary study on some potential side effects of parenterally injected nisin on the animals. Regarding the lack of previous studies, some routine screening tests were employed to monitor the general health status of the mice. It is noteworthy that previous reports on the possible adverse effects of nisin, as a food supplement, are conflicting. While some studies report no adverse effect for supplementary nisin [ 17 , 28 ], there are reports indicating weight loss and decreased food intake in laboratory animals [ 29 ]. Since there is no information regarding the bioavailability of nisin and whether it is absorbed from the intestine, the results of these studies may not be extrapolatable to the present study in which nisin has been parenterally injected to the animals. Diabetes mellitus is a destructive metabolic condition characterized by constant elevation of blood glucose levels, and FBS is a significant marker in predicting diabetes, even more reliable than HbA1c [ 30 ]. We did not observe any significant changes in the FBS level following 8 weeks of treatment with nisin, suggesting no deteriorating effects on the ability of the body to manage glucose levels. One of the major causes of death in modern societies is atherosclerosis, and high serum cholesterol is one of the main risk factors in this regard [ 31 ]. In addition to cardiovascular diseases, an increased cholesterol level has been associated with Parkinson’s disease [ 32 ] and some neural conditions such as cerebral amyloidosis [ 33 ]. Nisin caused no changes in the levels of serum cholesterol, suggesting no related harmful effects under the studied conditions. High levels of triglyceride, low levels of HDL, and high levels of LDL are indicators of potential cardiovascular risk [ 34 ]. There is also some evidence of a connection between the levels of these serum markers and the risk of some types of cancer [ 35 ]. Nisin did not cause any significant changes in the serum concentrations of these factors in this experiment. One of the most important safety concerns of any therapeutic agent is its liver toxicity. The two enzymes AST and ALT are used to determine damage to the liver [ 36 ]. We did not see any changes in the levels of either enzyme, denoting that nisin may not be hepatotoxic. The red and white blood cell counts, the concentration of haemoglobin, and the factors denoting anaemia (such as MCV and MCH) all remained normal during the experiment, suggesting that nisin may not exert negative effects on the general health condition. Conclusion A new perspective is being opened to the issue of health and obesity by the attention being drawn towards the use of bacteriocins as metabolic modulators. We have showed in this research that the bacteriocin nisin is well worthy of attention in relation to the problem of obesity in addition to classical ways including physical activity and dieting. Although therapy could never be a surrogate to a healthy lifestyle, paying attention to human microbiota and its products is a factor not to be underestimated in dealing with this problem. Abbreviations ALT alanine transaminase ALP alkaline phosphatase AST aspartate transaminase BMI body mass index FBS fasting blood sugar GLUT4 glucose transporter-4 HDL high-density lipoprotein LDL low-density lipoprotein MCH mean corpuscular haemoglobin MCHC mean corpuscular haemoglobin concentration MCV mean corpuscular volume NAFLD non-alcoholic fatty liver disease SCD-1 stearoyl-CoA desaturase-1 TBP TATA-binding protein TNF-α tumour necrosis factor-alpha T2D type II diabetes mellitus WHO World Health Organization zfp423 zinc finger protein-423. Declarations Acknowledgement We thank the Research Deputy of the Ferdowsi University of Mashhad for financial support (Grant no: 3/55237). References WHO. Obesity. World Health Organization. https://www.who.int/health-topics/obesity _1 . Accessed 9 November 2022. Bray GA. Medical consequences of obesity. J Clin Endocrinol Metab. 2004;89:2583–9. https://doi.org/10.1210/jc.2004-0535 . Martinez JA. Body-weight regulation: causes of obesity. Proc Nutr Soc. 2000;59:337–45. https://doi.org/10.1017/s0029665100000380 . Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Nageshwar Reddy D. Role of the normal gut microbiota. World J Gastroenterol. 2015;21:8836–47. https://doi.org/10.3748/wjg.v21.i29.8787 . Cunningham AL, Stephens JW, Harris DA. A review on gut microbiota: a central factor in the pathophysiology of obesity. Lipids Health Dis. 2021;20:65. https://doi.org/10.1186/s12944-021-01491-z . Chen X, Zhang D, Sun H, Jiang F, Shen Y, Wei P, Shen X. Characterization of the gut microbiota in Chinese children with overweight and obesity using 16S rRNA gene sequencing. PeerJ. 2021;9:e11439. https://doi.org/10.7717/peerj.11439 . Sun L, Ma L, Ma Y, Zhang F, Zhao C, Nie Y. Insights into the role of gut microbiota in obesity: pathogenesis, mechanisms, and therapeutic perspectives. Protein Cell. 2018;9:397–403. https://doi.org/10.1007/s13238-018-0546-3 . Drissi F, Merhej V, Angelakis E, El Kaoutari A, Carrière F, Henrissat B, Raoult D. Comparative genomics analysis of Lactobacillus species associated with weight gain or weight protection. Nutr Diabetes. 2014;4:e109–e. https://doi.org/10.1038/nutd.2014.6 . Taghizad F, Kazerani HR, Dehghani H, Asoodeh A, Yaghubi DA. Novel approach towards obesity: The use of a bacterial product, gassericin A, in 3T3-L1 cells. Obes Res Clin Pract. 2021;15:499–505. https://doi.org/10.1016/j.orcp.2021.08.005 . De Arauz LJ, Jozala AF, Mazzola PG. Penna TCV. Nisin biotechnological production and application: a review. Trends Food Sci Technol. 2009;20:146–54. https://doi.org/10.1016/j.tifs.2009.01.056 . Zapaśnik A, Sokołowska B, Bryła M. Role of lactic acid bacteria in food preservation and safety. Foods. 2022;11:1283. https://doi.org/10.3390/foods11091283 . Almeida-Oliveira F, Leandro JG, Ausina P, Sola-Penna M, Majerowicz D. Reference genes for quantitative PCR in the adipose tissue of mice with metabolic disease. Biomed Pharmacother. 2017;88:948–55. https://doi.org/10.1016/j.biopha.2017.01.091 . Scarpina F, Paschino C, Scacchi M, Mauro A, Sedda A. Does physical weight alter the mental representation of the body? Evidence from motor imagery in obesity. Q J Exp Psychol (Hove). 2022;75:2349–65. https://doi.org/10.1177/17470218221075038 . Hale C, Véniant MM. Growth differentiation factor 15 as a potential therapeutic for treating obesity. Mol Metab. 2021;46:101117. https://doi.org/10.1016/j.molmet.2020.101117 . Baggio LL, Drucker DJ. Glucagon-like peptide-1 receptor co-agonists for treating metabolic disease. Mol Metab. 2021;46:101090. https://doi.org/10.1016/j.molmet.2020.101090 . Punyauppa-path S, Phumkhachorn P, Rattanachaikunsopon P. Nisin: production and mechanism of antimicrobial action. Int J Curr Res Rev. 2015;7:47. Frazer A, Sharratt M, Hickman J. The biological effects of food additives. I.-Nisin. J Sci Food Agric. 1962;13:32–42. https://doi.org/10.1002/jsfa.2740130106 . Cohen P, Friedman JM. Leptin and the control of metabolism: role for stearoyl-CoA desaturase-1 (SCD-1). J Nutr. 2004;134:2455S–63S. https://doi.org/10.1093/jn/134.9.2455S . Cedernaes J, Alsiö J, Västermark Å, Risérus U, Schiöth HB. Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet. Lipids Health Dis. 2013;12:1–11. https://doi.org/10.1186/1476-511X-12-2 . Byberg L, Kilander L, Warensjö Lemming E, Michaëlsson K, Vessby B. Cancer death is related to high palmitoleic acid in serum and to polymorphisms in the SCD-1 gene in healthy Swedish men. Am J Clin Nutr. 2014;99:551–8. https://doi.org/10.3945/ajcn.113.065714 . Govers R. Molecular mechanisms of GLUT4 regulation in adipocytes. Diabetes Metab. 2014;40:400–10. https://doi.org/10.1016/j.diabet.2014.01.005 . Coppack SW. Pro-inflammatory cytokines and adipose tissue. Proc Nutr Soc. 2001;60:349–56. https://doi.org/10.1079/pns2001110 . Parker R. The role of adipose tissue in fatty liver diseases. Liver Res. 2018;2:35–42. https://doi.org/10.1016/j.livres.2018.02.002 . Gupta RK, Arany Z, Seale P, Mepani RJ, Ye L, Conroe HM, Roby YA, Kulaga H, Reed RR, Spiegelman BM. Transcriptional control of preadipocyte determination by Zfp423. Nature. 2010;464:619–23. https://doi.org/10.1038/nature08816 . Shao M, Ishibashi J, Kusminski CM, Wang QA, Hepler C, Vishvanath L, Holland WL. Zfp423 maintains white adipocyte identity through suppression of the beige cell thermogenic gene program. Cell Metab. 2016;23:1167–84. https://doi.org/10.1016/j.cmet.2016.04.023 . Tang QQ, Zhang JW, Lane MD. Sequential gene promoter interactions of C/EBPβ, C/EBPα, and PPARγ during adipogenesis. Biochem Biophys Res Commun. 2004;319:235–39. https://doi.org/10.1016/j.bbrc.2004.04.176 . Jagels MA, Hugli TE. Mechanisms and mediators of neutrophilic leukocytosis. Immunopharm. 1994;28:1–18. https://doi.org/10.1016/0162-3109(94)90034-5 . Reddy K, Gupta S, Aranha C. Effect of antimicrobial peptide, nisin, on the reproductive functions of rats. ISRN Vet Sci. 2012;2011:828736. https://doi.org/10.5402/2011/828736 . Hagiwara A, Imai N, Nakashima H, Toda Y, Kawabe M, Furukawa F, Delves-Broughton J, Yasuhara K, Hayashi SM. A 90-day oral toxicity study of nisin A, an anti-microbial peptide derived from Lactococcus lactis subsp. lactis, in F344 rats. Food Chem Toxicol. 2010;48:2421–8. https://doi.org/10.1016/j.fct.2010.06.002 . Ghazanfari Z, Haghdoost AA, Alizadeh SM, Atapour J, Zolala F. A comparison of HbA1c and fasting blood sugar tests in general population. Int J Prev Med. 2010;1:187. Rosberg V, Vishram-Nielsen JK, Kristensen AMD, Pareek M, Sehested TS, Nilsson PM, Donfrancesco C. Simple cardiovascular risk stratification by replacing total serum cholesterol with anthropometric measures: The MORGAM prospective cohort project. Prev Med Reports. 2022;26:101700. https://doi.org/10.1016/j.pmedr.2022.101700 . De Lau LM, Koudstaal PJ, Hofman A, Breteler MM. Serum cholesterol levels and the risk of Parkinson's disease. Am J Epidemiol. 2006;164:998–1002. https://doi.org/10.1093/aje/kwj283 . Reed B, Villeneuve S, Mack W, DeCarli C, Chui HC, Jagust W. Low HDL and high LDL serum cholesterol are associated with cerebral amyloidosis. JAMA Neurol. 2014;71:195. https://doi.org/10.1001/jamaneurol.2013.5390 . Jeppesen J, Hein HO, Suadicani P, Gyntelberg F. Relation of high TG–low HDL cholesterol and LDL cholesterol to the incidence of ischemic heart disease: An 8-year follow-up in the Copenhagen male study. Arterioscler Thromb Vasc Biol. 1997;17:1114–20. https://doi.org/10.1161/01.ATV.17.6.1114 . Wu Y, Xin J, Loehrer EA, Jiang X, Yuan Q, Christiani DC, Wang M. High-density lipoprotein, low-density lipoprotein and triglyceride levels and upper gastrointestinal cancers risk: a trans-ancestry Mendelian randomization study. Eur J Clin Nutr. 2022;76:995–1002. https://doi.org/10.1038/s41430-022-01078-6 . Goorden S, Buffart TE, Bakker A, Buijs MM. Liver disorders in adults: ALT and AST. Ned Tijdschr Geneesk. 2013;157:A6443. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 10 Feb, 2023 Read the published version in Lipids in Health and Disease → Version 1 posted Editorial decision: Major revision 31 Dec, 2022 Reviewers agreed at journal 07 Dec, 2022 Reviews received at journal 06 Dec, 2022 Reviews received at journal 05 Dec, 2022 Reviewers agreed at journal 05 Dec, 2022 Reviewers agreed at journal 05 Dec, 2022 Reviewers invited by journal 05 Dec, 2022 Editor assigned by journal 05 Dec, 2022 Submission checks completed at journal 05 Dec, 2022 First submitted to journal 02 Dec, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2336816","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":157394688,"identity":"7cba8247-b344-4a04-907a-c27768d8c8c6","order_by":0,"name":"Muslim Al-Emarah","email":"","orcid":"","institution":"Department of Basic Sciences, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muslim","middleName":"","lastName":"Al-Emarah","suffix":""},{"id":157394689,"identity":"f423c6e5-5bb1-4577-9019-e635415a24bc","order_by":1,"name":"Hamid Reza Kazerani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYBACCSjNww9jEK9FsoFULQwGB4h1mGT78YePK2ruyBjfyE5g+FHDIGPeQECLNE9CsuGZY894zG7kbmDsOcbAI0PIOjmGhGOSDWyHwVoYeBsYeCQI6GCQ43/Y/rPh32Ee4xlAW/4So0VaIpmNsbHtMI+BRO4GZqJskZzxjFmyse8wj8SZtxsOyxyTIKxF4nz6w48N3w7b87fnbnz4psbGnqAWFHAAKZ5GwSgYBaNgFFACAAUMOLySmjn+AAAAAElFTkSuQmCC","orcid":"","institution":"Department of Basic Sciences, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hamid","middleName":"Reza","lastName":"Kazerani","suffix":""},{"id":157394690,"identity":"5fd4af81-3e9b-4263-a463-50695123dc07","order_by":2,"name":"Fereidoun Taghizad","email":"","orcid":"","institution":"Department of Basic Sciences, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fereidoun","middleName":"","lastName":"Taghizad","suffix":""},{"id":157394691,"identity":"ab22f22d-a684-47ff-ad25-220220c17870","order_by":3,"name":"Hesam Dehghani","email":"","orcid":"","institution":"Stem Cell Biology and Regenerative Medicine Research Group, Research Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hesam","middleName":"","lastName":"Dehghani","suffix":""},{"id":157394692,"identity":"7749cc37-39c4-4b5a-8ddf-3c7d60a222c7","order_by":4,"name":"Mohammad Elahi","email":"","orcid":"","institution":"Department of Basic Sciences, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Elahi","suffix":""}],"badges":[],"createdAt":"2022-12-02 09:44:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2336816/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2336816/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12944-023-01788-1","type":"published","date":"2023-02-10T18:43:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":30016620,"identity":"7239a378-a79a-4be1-920b-b275e3ecdfee","added_by":"auto","created_at":"2022-12-07 15:49:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":62973,"visible":true,"origin":"","legend":"\u003cp\u003eBody weight (a), total food intake (b), abdominal fat (c), and body mass index (d) of the mice at the end of the experiment. The mice were treated with placebo or different doses of nisin for 8 weeks. The asterisk indicate statistical significance compared to the control group (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-2336816/v1/6500fc7dd3552276218e8cf8.png"},{"id":30017742,"identity":"6a1638be-a8b4-4857-9701-2a84736c0783","added_by":"auto","created_at":"2022-12-07 15:57:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":78777,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential count of white blood cells in different experimental groups at the end of 8 weeks of the experiment. The rats in the test groups were treated daily, with different doses of nisin, while those of the control group received placebo. **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. the control group.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-2336816/v1/1bd9e150c9bd546aa3c5fbd6.png"},{"id":30016621,"identity":"05f76cf2-8312-4941-9258-a96e5aba43a8","added_by":"auto","created_at":"2022-12-07 15:49:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":32310,"visible":true,"origin":"","legend":"\u003cp\u003elevel of expression of some of the important genes in adipose tissue in the mice receiving nisin (50 µg/kg, i.p.) compared to the control group. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-2336816/v1/45ec813fa1e5c7ca628e95a5.png"},{"id":44718859,"identity":"63e086b3-f992-4cff-94e3-b2b9b313dfce","added_by":"auto","created_at":"2023-10-16 18:51:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":616441,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2336816/v1/f24adf0a-b62c-4603-a5f3-6bbad69d28cf.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anti-obesity effect of the bacterial product, nisin","fulltext":[{"header":"Introduction","content":"\u003cp\u003eObesity and overweight refer to the excessive accumulation of fat in various parts of the body. According to the World Health Organization (WHO), overweight is defined by a body mass index (BMI) of between 25 and 30 kg/m\u003csup\u003e2\u003c/sup\u003e. When the BMI exceeds 30 kg/m\u003csup\u003e2\u003c/sup\u003e, the condition is referred to as obesity. According to the reports of the WHO, nearly four million people a year lose their lives as a consequence of the complications of obesity. Obesity and being overweight were once considered to be problems of wealthy societies; however, nowadays, more people in intermediate-to-poor societies are dealing with this phenomenon [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eObesity can lead to a variety of health issues, ranging from heart conditions and hypertension to cancer. In addition to an increased burden on the skeletal system, and particularly the joints, that is a natural consequence of excessive weight, the production of IL-6 from fat cells predisposes the individual with obesity to a state of constant low-level inflammation. The secretion of fatty acids from the adipose tissue, which finally lodge in the muscular and liver tissues, is a preliminary stage of developing insulin resistance and diabetes. What\u0026rsquo;s more, oestrogens produced by enlarged adipocytes could lead to a proliferative and eventually cancerous state in the breast [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBasically, overweight and obesity occur when the rate of energy supply exceeds that of consumption over a period of time long enough to allow the accumulation of fat droplets in adipocytes. Different causes have been suggested for this process, mostly related to diet and physical activity patterns. However, the effects of diet and physical activity can be augmented or decreased by genetic factors and the metabolic state, as seen in some genetic disorders causing obesity [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe word microbiota refers to the microbial population of different organs all over the body. These microorganisms might include bacteria, fungi, and viruses. The most studied role of microbiota in human health is in relation to the gut microbiota and particularly the resident bacteria. The bacterial population of a healthy gut mostly comprises two phyla, Bacteroidetes and Firmicutes. These phyla and others play crucial roles in the maintenance of the intestinal integrity, immunomodulation, protection against pathogens, and drug metabolism [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Several studies have shown the relationship between the composition of the microbial population in the digestive system and body composition/weight [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. A study in children showed that obese children have a lower abundance of bacterial species in the intestines [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The same observation has been verified in adults [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBacteriocins, peptides produced and secreted by certain strains of bacteria, appear to have significant effects on the regulation of weight. A bioinformatics study suggests that certain bacteriocins of the family Lactobacillaceae, probiotics of the human intestine, could exert some effects on weight and adiposity [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. One recent study using the bacteriocin gassericin A from the probiotic \u003cem\u003eL.gasseri\u003c/em\u003e LA39 on 3T3-L1 pre-adipocytes showed a significant reduction in the expression of some genes related to adipogenesis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNisin, a bacteriocin discovered by Rogers and Whittier in 1928, is a 3500-Da peptide containing 34 amino acids and with bactericidal properties. Nisin is produced during the exponential growth phase of the producing strain (\u003cem\u003eLactobacillus lactis\u003c/em\u003e, subspecies \u003cem\u003elactis\u003c/em\u003e), and when the growth of the bacteria has halted, the production of the peptide also halts [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Nisin has long been used in the food industry as a preservative and it is produced on a commercial scale to be used in packed foods. Nisin has shown a strong inhibiting effect toward gram-negative bacteria [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Accordingly, we decided to conduct an experiment using this bacteriocin to evaluate its effects on weight, some serum factors, and some significant genes involved in the development and growth of adipocytes.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003eNisin was purchased in the form of balanced 2.5% sodium chloride lyophilized powder (Sigma-Aldrich, Germany) and was diluted with normal saline containing 0.05% acetic acid.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and treatment\u003c/h2\u003e \u003cp\u003eForty healthy male laboratory mice, \u003cem\u003eMus musculus\u003c/em\u003e, weighing 25\u0026ndash;45 grams were chosen for the experiment. The animals were treated according to the guidelines of Animal Ethics Committee of the Ferdowsi University of Mashhad (IR.UM.REC.1400.250). The mice were kept in individual cages throughout the experiment. The mice were randomly divided into four groups of ten: the control group that received a placebo and the test groups that received nisin at 25, 50, and 100 \u0026micro;g/kg, daily, for 42 days.\u003c/p\u003e \u003cp\u003eThe mice were fed \u003cem\u003ead libitum\u003c/em\u003e on a high sugar diet beginning five days before the start of the experiment (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNutrition information of the diet fed to the mice during the experiment.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQuantity\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnergy (kcal/kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3345\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u0026ndash;10.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFat (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026ndash;1.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibre (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.5\u0026ndash;3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSucrose (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.025\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.025\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP/Ca ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.5\u0026ndash;2.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAt the end of each week, the body weights and the amount of consumed food for each animal were measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eSampling, blood and serum markers\u003c/h2\u003e \u003cp\u003eAt the end of the 8th week, the mice were deprived of food for 12 hours, anaesthetized with 50 mg/kg of thiopental sodium, and their abdominal-area fat extracted and kept in liquid nitrogen for further molecular tests. Blood sampling was performed from the abdominal vena cava. Blood serum was separated by centrifugation at 3500 rpm and the serum was kept at -20\u0026ordm;C for further biochemical assays. The weights of the kidneys and spleen, the length of the small intestine, and the BMI were measured. Serum parameters, including glucose, cholesterol, triglyceride, high-density lipoprotein (HDL), low-density lipoprotein (LDL), alanine transaminase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP), were measured using enzymatic colourimetric methods (kits: Pars Azmoon\u0026reg;, Iran; system: Autoanalyzer Alpha Classic\u0026reg;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and RT-qPCR\u003c/h2\u003e \u003cp\u003eIn order to check the effect of nisin on the level of expression of adipocyte-specific genes, four genes were assayed using RT-qPCR: stearoyl-CoA desaturase-1 (SCD-1) gene which regulates a rate-limiting step in the production of unsaturated fatty acids, SLC2A4 gene encoding glucose transporter-4 (GLUT4) as the main transporter of glucose into the adipocytes, zfp423 gene encoding zinc finger protein 423 as a determinant of differentiation and maintenance of white adipocytes, and the gene encoding 422(ap2) protein as a fatty acid binding protein which increases with the differentiation of pre-adipocytes to adipocytes. We also assayed the expression of the tumour necrosis factor-alpha (TNF-α) gene to evaluate any possible inflammatory response. To reduce the effect of any possible DNA contamination on the results of RT-qPCR, the primers were designed in exon-exon junction form. TATA-binding protein (TBP) was chosen as the reference (housekeeping) gene due to its higher stability in adipocytes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The list and sequence of primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primers used in RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e422ap2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAATCACCGCAGACGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACATTCCACCACCAGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGLUT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCGGACCCTATACCCTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGTTCCCCATCGTCAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSCD-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGTTTCCAAGCGCAGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTGGAGATCTCTTGGAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTBP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTATCACTCCTGCCACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGACTGCAGCAAATCGCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGCCCACGTCGTAGCAAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGCCTTGTCCCTTGAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZfp-423\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGCGATCGGTGAAAGTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCTGTTCCTGTCTTCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis and drawing of the graphs were performed using GraphPad Prism Software (GraphPad Software Inc, USA). The non-parametric Mann\u0026ndash;Whitney test was used for RT-PCR results. All other comparisons were made using one-way analysis of variance followed by Dunnett's multiple comparison test. P values less than 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBody weight, total food intake, abdominal fat and body mass index\u003c/h2\u003e \u003cp\u003eThe statistical analyses showed a significant decrease in weight in the treatment groups in comparison to the control group. As can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, all three groups showed a significant loss of weight, with the greatest effect being seen in group 3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe amount of food intake was only reduced in group 3 (50 \u0026micro;g/kg of nicin), with other groups showing no significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). A much more significant change was seen in the amount of abdominal fat content, which showed a very sharp reduction in all three treatment groups, with group 3 showing the greatest effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Another prominent effect of nisin was the change in the BMI, which was significantly reduced in all three treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStudied body organs, markers of blood and serum\u003c/h2\u003e \u003cp\u003eThe studied serum markers (including fasting blood sugar (FBS), cholesterol, triglyceride, HDL, LDL, AST, ALT, and ALP), the length of the small intestine, the weight of the kidneys and spleen, the red and white blood cell counts, the concentration of haemoglobin, packed cell volume, mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), and mean corpuscular haemoglobin concentration (MCHC) did not show any significant changes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ethe studied markers of serum, blood, and body organs.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"19\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c19\" colnum=\"19\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNisin\u003c/p\u003e \u003cp\u003e(\u0026micro;g/Kg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFBS\u003c/p\u003e \u003cp\u003e(mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCholesterol\u003c/p\u003e \u003cp\u003e(mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTriglyceride\u003c/p\u003e \u003cp\u003e(mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHDL\u003c/p\u003e \u003cp\u003e(mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLDL\u003c/p\u003e \u003cp\u003e(mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAST\u003c/p\u003e \u003cp\u003e(U/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eALT\u003c/p\u003e \u003cp\u003e(IU/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eALP\u003c/p\u003e \u003cp\u003e(IU/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eRBC\u003c/p\u003e \u003cp\u003e(\u0026sdot;10\u003csup\u003e6\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eWBC\u003c/p\u003e \u003cp\u003e(\u0026sdot;10\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eHb\u003c/p\u003e \u003cp\u003e(g/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003ePCV\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eMCV\u003c/p\u003e \u003cp\u003e(fL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eMCH\u003c/p\u003e \u003cp\u003e(pg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eMCHC\u003c/p\u003e \u003cp\u003e(g/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003eSmall Int\u003c/p\u003e \u003cp\u003e(cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eKidney Wt\u003c/p\u003e \u003cp\u003e(g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c19\"\u003e \u003cp\u003eSpleen Wt\u003c/p\u003e \u003cp\u003e(g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e0\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e93\u0026thinsp;\u0026plusmn;\u0026thinsp;6.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e116\u0026thinsp;\u0026plusmn;\u0026thinsp;11.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e84.7\u0026thinsp;\u0026plusmn;\u0026thinsp;14.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e48.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e53\u0026thinsp;\u0026plusmn;\u0026thinsp;5.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e369\u0026thinsp;\u0026plusmn;\u0026thinsp;48.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e99.9\u0026thinsp;\u0026plusmn;\u0026thinsp;10.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e176\u0026thinsp;\u0026plusmn;\u0026thinsp;24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e8.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.357\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e5.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e12.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e40.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c14\"\u003e \u003cp\u003e49.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c15\"\u003e \u003cp\u003e15.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c16\"\u003e \u003cp\u003e30.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c17\"\u003e \u003cp\u003e49.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c18\"\u003e \u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c19\"\u003e \u003cp\u003e0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e25\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e90.1\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e113\u0026thinsp;\u0026plusmn;\u0026thinsp;10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e75.6\u0026thinsp;\u0026plusmn;\u0026thinsp;8.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e46.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e51.7\u0026thinsp;\u0026plusmn;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e317\u0026thinsp;\u0026plusmn;\u0026thinsp;59.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e118\u0026thinsp;\u0026plusmn;\u0026thinsp;25.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e182\u0026thinsp;\u0026plusmn;\u0026thinsp;13.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e7.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.244\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e4.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e11.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e38.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c14\"\u003e \u003cp\u003e50.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c15\"\u003e \u003cp\u003e15.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c16\"\u003e \u003cp\u003e30.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c17\"\u003e \u003cp\u003e49.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c18\"\u003e \u003cp\u003e0.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c19\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e50\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e77.7\u0026thinsp;\u0026plusmn;\u0026thinsp;9.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e128\u0026thinsp;\u0026plusmn;\u0026thinsp;8.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e90.4\u0026thinsp;\u0026plusmn;\u0026thinsp;12.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e50.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e57\u0026thinsp;\u0026plusmn;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e412\u0026thinsp;\u0026plusmn;\u0026thinsp;67.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e112\u0026thinsp;\u0026plusmn;\u0026thinsp;8.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e163\u0026thinsp;\u0026plusmn;\u0026thinsp;16.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e8.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.418\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e6.76\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e12.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e42.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c14\"\u003e \u003cp\u003e49.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c15\"\u003e \u003cp\u003e15.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c16\"\u003e \u003cp\u003e30.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c17\"\u003e \u003cp\u003e46.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c18\"\u003e \u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c19\"\u003e \u003cp\u003e0.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e100\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e92.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e114\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e87\u0026thinsp;\u0026plusmn;\u0026thinsp;6.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e49.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e56.2\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e465\u0026thinsp;\u0026plusmn;\u0026thinsp;55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e140\u0026thinsp;\u0026plusmn;\u0026thinsp;26.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e175\u0026thinsp;\u0026plusmn;\u0026thinsp;18.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e8.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.565\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e5.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e12.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e42.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c14\"\u003e \u003cp\u003e52\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c15\"\u003e \u003cp\u003e15.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c16\"\u003e \u003cp\u003e29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c17\"\u003e \u003cp\u003e48.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c18\"\u003e \u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c19\"\u003e \u003cp\u003e0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe results of differential white blood cell counts showed a significant increase in the number of neutrophils in the group receiving 50 \u0026micro;g/kg of nisin. Other comparisons, however, did not yield statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePreliminary histologic evaluation\u003c/h2\u003e \u003cp\u003eOur preliminary results regarding the cytometry of abdominal fat showed a prominent decrease in the size of adipocytes in the test groups. However, the minute amount of specimen in nisin-treated animals did not allow a sample size enough for statistical comparison.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePCR results\u003c/h2\u003e \u003cp\u003eThe data from RT-qPCR showed that the levels of expression of SCD-1, GLUT4, TNF-α, and 422ap2 were significantly reduced, while that of zfp423 did not show any significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThere is public concern regarding the physical and mental problems of obesity. Even the social well-being of an individual can be affected by being overweight or obese, as obese people are more uncomfortable with their body imagery [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. There have been numerous studies on the cure of obesity, including the classical dietary and physical activity methods. Recently, attention has been drawn toward molecular interventions such as growth differentiation factor-15 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], glucagon-like peptide-1 co-agonists [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and some herbal medicines. Many studies have targeted alterations in the microbiota and even the application of bacteriocins [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and as using bacteriocins is a pretty novel approach to weight protection, we decided to explore this option.\u003c/p\u003e \u003cp\u003ePrevious studies on bacteriocins have mainly focused on their antibacterial properties and their potential application as food preservatives. For instance, the antibacterial properties of nisin have been widely studied, and it has been extensively used, alone or in combination with other substances, as a food preservative [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Accordingly, some studies have evaluated the potential toxic effects of nisin, but only the oral route of administration has been used, and these studies have mainly supported the safety of this peptide as a food preservative, which led to its approval by the Food and Drug Administration. However, there is no information regarding the potential therapeutic effect of nisin against obesity. Our team first conducted a pilot study using nisin in laboratory rats and the results showed a significant decrease in the adipose content of the abdominal area (unpublished results). We, therefore, decided to use it in our study to evaluate its possible weight-changing effects.\u003c/p\u003e \u003cp\u003eOur results suggest significant weight loss in animals treated with nisin via i.p. injection. Although a significant reduction in food intake was only seen in one of the treatment groups, food-intake reduction can be considered as one of the mechanisms by which nisin exerts its effect on weight reduction. A similar result of decreased food intake was seen in a study determining the biological activity of nisin as a food additive [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, nisin caused a dramatic decline in the level of SCD-1 expression. Stearoyl CoA desaturase-1 is a rate-limiting enzyme in the production of palmitoleic and oleic acids, two important monounsaturated fatty acids that are produced in the liver. The gene for SCD-1 is suppressed by leptin and the suppression of SCD-1 can lead to a considerable loss of weight in people affected by obesity [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. A study in high fat-fed rats showed that obesity-prone rats have a higher proportion of the SCD-1 product, palmitoleic acid [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Consistently, in the present study, the body weight, amounts of abdominal fat content, and BMI were significantly lower in the animals that received nisin. These findings suggest that nisin could impose a significant reduction in adiposity and body weight \u003cem\u003ein vivo\u003c/em\u003e. However, treatment with nisin did not affect the concentrations of serum triglyceride and cholesterol, suggesting that the most noticeable effect of nisin is on the fat tissue, rather than serum factors. According to the present results, nisin may exert its weight-protecting effect, at least partly, via reducing food intake. It is noteworthy that the high level of SCD-1 expression and subsequently higher levels of monounsaturated fatty acids have also been related to higher cancer death in patients affected by obesity [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], conferring more benefits to the use of nisin as a health-protective agent.\u003c/p\u003e \u003cp\u003eIn this study, treatment with nisin caused a significant reduction in the expression of the GLUT4 gene which encodes the main transporter of glucose into adipocytes and skeletal muscle cells. The expression of GLUT4 is reduced in adipocytes (but not skeletal muscle cells) in type II diabetes mellitus (T2D) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Impairment in the uptake of glucose by GLUT4 is the primary stage in the onset of T2D. Although the expression of GLUT4 was reduced in the animals, we did not observe any impairment in either fasting blood sugar, suggesting that at least in a period of 8 weeks, nisin does not increase the risk of diabetes.\u003c/p\u003e \u003cp\u003eInflammation is a key element in the onset and development of insulin resistance in T2D. To preliminary evaluate the effect of nisin on the inflammatory response of the adipose tissue, we assayed the level of TNF-α expression in the adipose samples. It is generally accepted that the serum level of TNF-α is mildly increased in people affected by obesity. What\u0026rsquo;s more, the adipose tissue obtained from people affected by obesity has higher levels of mRNA for TNF-α. Increased levels of TNF-α reduce the uptake of glucose via GLUT4 by adipocytes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. TNF-α stimulates the death of hepatocytes and the progression of fatty liver disease. A reduction in the inflammation of adipose tissue in non-alcoholic fatty liver disease (NAFLD) improves the condition of the liver [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In the present study, nisin caused a significant and dramatic reduction in the level of expression of TNF-α in adipose tissue, and thus seems to be beneficial from this point of view. However, more experiments are necessary to further evaluate this effect.\u003c/p\u003e \u003cp\u003eZinc finger protein-423 (zfp423) is a key regulator in the differentiation and maturity of pre-adipocytes. The expression of this protein in pre-adipocytes leads to an increase in the cellular amounts of PPARγ, and this can lead to the differentiation of adipocytes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Deletion of zfp423 predisposes the white adipocytes to enter the path of beige fat cells, and this can reverse diet-induced obesity. The thermogenic program initiator in beige adipocytes, Ebf2, is suppressed by the activation of zfp423, which leads to the maintenance of the white adipocyte destiny [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Nisin did not change the level of expression of zfp423 significantly in our experiment. This might be an indicator that probably nisin does not have any significant effects on the fate of adipocytes, but just reduces the amount of fat accumulation in these cells through repressing SCD-1 and probably some other yet-unknown mechanisms.\u003c/p\u003e \u003cp\u003eAdipocyte protein 422ap2 is expressed after the induction of adipose-specific genes C/EBPβ, C/EBPα, and PPARγ. This protein is representative of adipocytes [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The expression level of 422ap2 was dramatically reduced in the cells treated with nisin, which is an indicator of reduced adiposity. Generally speaking, since 422ap2 is not a fate determiner, we could say that the adipose tissue keeps its identity as a tissue, however, its capacity for producing and storing fat is reduced.\u003c/p\u003e \u003cp\u003eIn this study, treatment with nisin increased the number of blood neutrophils but had no significant effects on other white blood cells. Neutrophilic leukocytosis, which is an increase in the number of circulating neutrophils, may be triggered by the introduction of bacterial products such as peptides into the bloodstream [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Since nisin is a bacterial peptide, such an increase is predictable.\u003c/p\u003e \u003cp\u003eWe also performed a preliminary study on some potential side effects of parenterally injected nisin on the animals. Regarding the lack of previous studies, some routine screening tests were employed to monitor the general health status of the mice. It is noteworthy that previous reports on the possible adverse effects of nisin, as a food supplement, are conflicting. While some studies report no adverse effect for supplementary nisin [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], there are reports indicating weight loss and decreased food intake in laboratory animals [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Since there is no information regarding the bioavailability of nisin and whether it is absorbed from the intestine, the results of these studies may not be extrapolatable to the present study in which nisin has been parenterally injected to the animals.\u003c/p\u003e \u003cp\u003eDiabetes mellitus is a destructive metabolic condition characterized by constant elevation of blood glucose levels, and FBS is a significant marker in predicting diabetes, even more reliable than HbA1c [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We did not observe any significant changes in the FBS level following 8 weeks of treatment with nisin, suggesting no deteriorating effects on the ability of the body to manage glucose levels.\u003c/p\u003e \u003cp\u003eOne of the major causes of death in modern societies is atherosclerosis, and high serum cholesterol is one of the main risk factors in this regard [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In addition to cardiovascular diseases, an increased cholesterol level has been associated with Parkinson\u0026rsquo;s disease [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and some neural conditions such as cerebral amyloidosis [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Nisin caused no changes in the levels of serum cholesterol, suggesting no related harmful effects under the studied conditions.\u003c/p\u003e \u003cp\u003eHigh levels of triglyceride, low levels of HDL, and high levels of LDL are indicators of potential cardiovascular risk [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. There is also some evidence of a connection between the levels of these serum markers and the risk of some types of cancer [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Nisin did not cause any significant changes in the serum concentrations of these factors in this experiment.\u003c/p\u003e \u003cp\u003eOne of the most important safety concerns of any therapeutic agent is its liver toxicity. The two enzymes AST and ALT are used to determine damage to the liver [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We did not see any changes in the levels of either enzyme, denoting that nisin may not be hepatotoxic.\u003c/p\u003e \u003cp\u003eThe red and white blood cell counts, the concentration of haemoglobin, and the factors denoting anaemia (such as MCV and MCH) all remained normal during the experiment, suggesting that nisin may not exert negative effects on the general health condition.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eA new perspective is being opened to the issue of health and obesity by the attention being drawn towards the use of bacteriocins as metabolic modulators. We have showed in this research that the bacteriocin nisin is well worthy of attention in relation to the problem of obesity in addition to classical ways including physical activity and dieting. Although therapy could never be a surrogate to a healthy lifestyle, paying attention to human microbiota and its products is a factor not to be underestimated in dealing with this problem.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eALT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ealanine transaminase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eALP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ealkaline phosphatase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAST\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003easpartate transaminase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBMI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebody mass index\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efasting blood sugar\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGLUT4\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eglucose transporter-4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehigh-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elow-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMCH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emean corpuscular haemoglobin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMCHC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emean corpuscular haemoglobin concentration\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMCV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emean corpuscular volume\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNAFLD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enon-alcoholic fatty liver disease\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSCD-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003estearoyl-CoA desaturase-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTBP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTATA-binding protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTNF-α\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etumour necrosis factor-alpha\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eT2D\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etype II diabetes mellitus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWHO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWorld Health Organization\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ezfp423\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ezinc finger protein-423.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgement\u003c/h2\u003e \u003cp\u003eWe thank the Research Deputy of the Ferdowsi University of Mashhad for financial support (Grant no: 3/55237).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWHO. Obesity. World Health Organization. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/health-topics/obesity _1\u003c/span\u003e\u003cspan address=\"https://www.who.int/health-topics/obesity _1\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 9 November 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBray GA. Medical consequences of obesity. J Clin Endocrinol Metab. 2004;89:2583\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/jc.2004-0535\u003c/span\u003e\u003cspan address=\"10.1210/jc.2004-0535\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez JA. Body-weight regulation: causes of obesity. Proc Nutr Soc. 2000;59:337\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/s0029665100000380\u003c/span\u003e\u003cspan address=\"10.1017/s0029665100000380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Nageshwar Reddy D. Role of the normal gut microbiota. World J Gastroenterol. 2015;21:8836\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3748/wjg.v21.i29.8787\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v21.i29.8787\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCunningham AL, Stephens JW, Harris DA. A review on gut microbiota: a central factor in the pathophysiology of obesity. Lipids Health Dis. 2021;20:65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12944-021-01491-z\u003c/span\u003e\u003cspan address=\"10.1186/s12944-021-01491-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Zhang D, Sun H, Jiang F, Shen Y, Wei P, Shen X. Characterization of the gut microbiota in Chinese children with overweight and obesity using 16S rRNA gene sequencing. PeerJ. 2021;9:e11439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7717/peerj.11439\u003c/span\u003e\u003cspan address=\"10.7717/peerj.11439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun L, Ma L, Ma Y, Zhang F, Zhao C, Nie Y. Insights into the role of gut microbiota in obesity: pathogenesis, mechanisms, and therapeutic perspectives. Protein Cell. 2018;9:397\u0026ndash;403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13238-018-0546-3\u003c/span\u003e\u003cspan address=\"10.1007/s13238-018-0546-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrissi F, Merhej V, Angelakis E, El Kaoutari A, Carri\u0026egrave;re F, Henrissat B, Raoult D. Comparative genomics analysis of Lactobacillus species associated with weight gain or weight protection. Nutr Diabetes. 2014;4:e109\u0026ndash;e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nutd.2014.6\u003c/span\u003e\u003cspan address=\"10.1038/nutd.2014.6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaghizad F, Kazerani HR, Dehghani H, Asoodeh A, Yaghubi DA. Novel approach towards obesity: The use of a bacterial product, gassericin A, in 3T3-L1 cells. Obes Res Clin Pract. 2021;15:499\u0026ndash;505. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.orcp.2021.08.005\u003c/span\u003e\u003cspan address=\"10.1016/j.orcp.2021.08.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Arauz LJ, Jozala AF, Mazzola PG. Penna TCV. Nisin biotechnological production and application: a review. Trends Food Sci Technol. 2009;20:146\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tifs.2009.01.056\u003c/span\u003e\u003cspan address=\"10.1016/j.tifs.2009.01.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZapaśnik A, Sokołowska B, Bryła M. Role of lactic acid bacteria in food preservation and safety. Foods. 2022;11:1283. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/foods11091283\u003c/span\u003e\u003cspan address=\"10.3390/foods11091283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmeida-Oliveira F, Leandro JG, Ausina P, Sola-Penna M, Majerowicz D. Reference genes for quantitative PCR in the adipose tissue of mice with metabolic disease. Biomed Pharmacother. 2017;88:948\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2017.01.091\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2017.01.091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScarpina F, Paschino C, Scacchi M, Mauro A, Sedda A. Does physical weight alter the mental representation of the body? Evidence from motor imagery in obesity. Q J Exp Psychol (Hove). 2022;75:2349\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/17470218221075038\u003c/span\u003e\u003cspan address=\"10.1177/17470218221075038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHale C, V\u0026eacute;niant MM. Growth differentiation factor 15 as a potential therapeutic for treating obesity. Mol Metab. 2021;46:101117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molmet.2020.101117\u003c/span\u003e\u003cspan address=\"10.1016/j.molmet.2020.101117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaggio LL, Drucker DJ. Glucagon-like peptide-1 receptor co-agonists for treating metabolic disease. Mol Metab. 2021;46:101090. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molmet.2020.101090\u003c/span\u003e\u003cspan address=\"10.1016/j.molmet.2020.101090\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePunyauppa-path S, Phumkhachorn P, Rattanachaikunsopon P. Nisin: production and mechanism of antimicrobial action. Int J Curr Res Rev. 2015;7:47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrazer A, Sharratt M, Hickman J. The biological effects of food additives. I.-Nisin. J Sci Food Agric. 1962;13:32\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jsfa.2740130106\u003c/span\u003e\u003cspan address=\"10.1002/jsfa.2740130106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen P, Friedman JM. Leptin and the control of metabolism: role for stearoyl-CoA desaturase-1 (SCD-1). J Nutr. 2004;134:2455S\u0026ndash;63S. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jn/134.9.2455S\u003c/span\u003e\u003cspan address=\"10.1093/jn/134.9.2455S\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCedernaes J, Alsi\u0026ouml; J, V\u0026auml;stermark \u0026Aring;, Ris\u0026eacute;rus U, Schi\u0026ouml;th HB. Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet. Lipids Health Dis. 2013;12:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1476-511X-12-2\u003c/span\u003e\u003cspan address=\"10.1186/1476-511X-12-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eByberg L, Kilander L, Warensj\u0026ouml; Lemming E, Micha\u0026euml;lsson K, Vessby B. Cancer death is related to high palmitoleic acid in serum and to polymorphisms in the SCD-1 gene in healthy Swedish men. Am J Clin Nutr. 2014;99:551\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3945/ajcn.113.065714\u003c/span\u003e\u003cspan address=\"10.3945/ajcn.113.065714\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGovers R. Molecular mechanisms of GLUT4 regulation in adipocytes. Diabetes Metab. 2014;40:400\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.diabet.2014.01.005\u003c/span\u003e\u003cspan address=\"10.1016/j.diabet.2014.01.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoppack SW. Pro-inflammatory cytokines and adipose tissue. Proc Nutr Soc. 2001;60:349\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/pns2001110\u003c/span\u003e\u003cspan address=\"10.1079/pns2001110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParker R. The role of adipose tissue in fatty liver diseases. Liver Res. 2018;2:35\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.livres.2018.02.002\u003c/span\u003e\u003cspan address=\"10.1016/j.livres.2018.02.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta RK, Arany Z, Seale P, Mepani RJ, Ye L, Conroe HM, Roby YA, Kulaga H, Reed RR, Spiegelman BM. Transcriptional control of preadipocyte determination by Zfp423. Nature. 2010;464:619\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature08816\u003c/span\u003e\u003cspan address=\"10.1038/nature08816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao M, Ishibashi J, Kusminski CM, Wang QA, Hepler C, Vishvanath L, Holland WL. Zfp423 maintains white adipocyte identity through suppression of the beige cell thermogenic gene program. Cell Metab. 2016;23:1167\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2016.04.023\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2016.04.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang QQ, Zhang JW, Lane MD. Sequential gene promoter interactions of C/EBPβ, C/EBPα, and PPARγ during adipogenesis. Biochem Biophys Res Commun. 2004;319:235\u0026ndash;39. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2004.04.176\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2004.04.176\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJagels MA, Hugli TE. Mechanisms and mediators of neutrophilic leukocytosis. Immunopharm. 1994;28:1\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0162-3109(94)90034-5\u003c/span\u003e\u003cspan address=\"10.1016/0162-3109(94)90034-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReddy K, Gupta S, Aranha C. Effect of antimicrobial peptide, nisin, on the reproductive functions of rats. ISRN Vet Sci. 2012;2011:828736. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5402/2011/828736\u003c/span\u003e\u003cspan address=\"10.5402/2011/828736\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHagiwara A, Imai N, Nakashima H, Toda Y, Kawabe M, Furukawa F, Delves-Broughton J, Yasuhara K, Hayashi SM. A 90-day oral toxicity study of nisin A, an anti-microbial peptide derived from Lactococcus lactis subsp. lactis, in F344 rats. Food Chem Toxicol. 2010;48:2421\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2010.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2010.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhazanfari Z, Haghdoost AA, Alizadeh SM, Atapour J, Zolala F. A comparison of HbA1c and fasting blood sugar tests in general population. Int J Prev Med. 2010;1:187.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosberg V, Vishram-Nielsen JK, Kristensen AMD, Pareek M, Sehested TS, Nilsson PM, Donfrancesco C. Simple cardiovascular risk stratification by replacing total serum cholesterol with anthropometric measures: The MORGAM prospective cohort project. Prev Med Reports. 2022;26:101700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pmedr.2022.101700\u003c/span\u003e\u003cspan address=\"10.1016/j.pmedr.2022.101700\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Lau LM, Koudstaal PJ, Hofman A, Breteler MM. Serum cholesterol levels and the risk of Parkinson's disease. Am J Epidemiol. 2006;164:998\u0026ndash;1002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aje/kwj283\u003c/span\u003e\u003cspan address=\"10.1093/aje/kwj283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReed B, Villeneuve S, Mack W, DeCarli C, Chui HC, Jagust W. Low HDL and high LDL serum cholesterol are associated with cerebral amyloidosis. JAMA Neurol. 2014;71:195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1001/jamaneurol.2013.5390\u003c/span\u003e\u003cspan address=\"10.1001/jamaneurol.2013.5390\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeppesen J, Hein HO, Suadicani P, Gyntelberg F. Relation of high TG\u0026ndash;low HDL cholesterol and LDL cholesterol to the incidence of ischemic heart disease: An 8-year follow-up in the Copenhagen male study. Arterioscler Thromb Vasc Biol. 1997;17:1114\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.ATV.17.6.1114\u003c/span\u003e\u003cspan address=\"10.1161/01.ATV.17.6.1114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Y, Xin J, Loehrer EA, Jiang X, Yuan Q, Christiani DC, Wang M. High-density lipoprotein, low-density lipoprotein and triglyceride levels and upper gastrointestinal cancers risk: a trans-ancestry Mendelian randomization study. Eur J Clin Nutr. 2022;76:995\u0026ndash;1002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41430-022-01078-6\u003c/span\u003e\u003cspan address=\"10.1038/s41430-022-01078-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoorden S, Buffart TE, Bakker A, Buijs MM. Liver disorders in adults: ALT and AST. Ned Tijdschr Geneesk. 2013;157:A6443.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"lipids-in-health-and-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"lhad","sideBox":"Learn more about [Lipids in Health and Disease](http://lipidworld.biomedcentral.com/)","snPcode":"12944","submissionUrl":"https://submission.nature.com/new-submission/12944/3","title":"Lipids in Health and Disease","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Obesity, nisin, bacteriocin, microbiota.","lastPublishedDoi":"10.21203/rs.3.rs-2336816/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2336816/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eObesity is one of the most important metabolic disorder that predisposes individuals to other diseases. We investigated the effect of nisin, a bacteriocin produced by some bacteria, on obesity and some of its related parameters. Forty mice were randomly divided into four groups and received a placebo (saline) or nisin (25, 50, or 100 \u0026micro;g/kg, ip), daily, for 8 weeks. Bodyweight and food intake were measured weekly, and at the end of the experiment, the levels of fasting blood sugar, serum triglyceride, cholesterol, high-density lipoprotein, low-density lipoprotein, and hepatic enzymes were tested, and red and white blood cell counts, haemoglobin concentration, mean corpuscular volume, mean corpuscular haemoglobin, and mean corpuscular haemoglobin concentration were determined. Finally, the expression levels of some obesity-related genes, including stearoyl-CoA desaturase-1 (SCD-1), glucose transporter-4 (GLUT4), zfp423, 422(ap2), and tumor necrosis factor-alpha (TNF-α) were assessed using RT-qPCR. After the experiment, the body weights, abdominal fat, and body mass index were significantly lower in the nisin-treated groups than in the control. The highest effect was observed with 50 \u0026micro;g/kg of nisin, and this dose caused a significant reduction in the total food intake. The expression of SCD-1, GLUT4, 422(ap2), and TNF-α decreased significantly following treatment with nisin. No significant differences were observed in the other studied parameters, and no toxic effects were observed for nisin under these experimental conditions. Our results suggest that nissin could have weight-protective effects.\u003c/p\u003e","manuscriptTitle":"Anti-obesity effect of the bacterial product, nisin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-07 15:49:02","doi":"10.21203/rs.3.rs-2336816/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-12-31T10:11:26+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"2e0348bb-632a-4267-9540-745cc0b83652","date":"2022-12-07T11:22:21+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-12-06T12:49:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-12-05T17:29:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7b13865d-c90c-4171-8fd3-75c0a588c10a","date":"2022-12-05T15:19:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"a4a6012c-7e9c-48be-9283-ad47addb0a91","date":"2022-12-05T13:21:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-12-05T13:10:53+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-12-05T05:11:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-12-05T05:11:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Lipids in Health and Disease","date":"2022-12-02T09:39:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"lipids-in-health-and-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"lhad","sideBox":"Learn more about [Lipids in Health and Disease](http://lipidworld.biomedcentral.com/)","snPcode":"12944","submissionUrl":"https://submission.nature.com/new-submission/12944/3","title":"Lipids in Health and Disease","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"48128c0f-fc04-4f86-ab74-19359e9c38aa","owner":[],"postedDate":"December 7th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T18:47:58+00:00","versionOfRecord":{"articleIdentity":"rs-2336816","link":"https://doi.org/10.1186/s12944-023-01788-1","journal":{"identity":"lipids-in-health-and-disease","isVorOnly":false,"title":"Lipids in Health and Disease"},"publishedOn":"2023-02-10 18:43:37","publishedOnDateReadable":"February 10th, 2023"},"versionCreatedAt":"2022-12-07 15:49:02","video":"","vorDoi":"10.1186/s12944-023-01788-1","vorDoiUrl":"https://doi.org/10.1186/s12944-023-01788-1","workflowStages":[]},"version":"v1","identity":"rs-2336816","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2336816","identity":"rs-2336816","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}