HBP1 facilitates PGR transcriptional activity and IGFBP1 expression conducive to human endometrial decidualization

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Decidualization of human endometrial stromal cells (HESCs) is one of the critical steps in the establishment of human pregnancy. HESCs decidualization provides a suitable microenvironment for embryo implantation and pregnancy maintenance. Nevertheless, little is known about the molecular mechanisms underlying human decidualization. In this study, we identified HBP1 as a key player in the decidualization of HESCs. Knockdown of HBP1 significantly reduced the mRNA and protein expression levels of decidualization markers IGFBP1 and FOXO1. Although PGR expression showed no significant change, the expression levels of PGR-regulated target molecules were decreased. Furthermore, ChIP-Seq and RNA-seq analyses revealed that HBP1 directly transcriptionally regulates IGFBP1 expression. Additionally, overexpression of HBP1 promoted the enrichment of histone H3K4me3 at the promoter regions of PGR and its target molecules FKBP5, FOSL2, and FKBP4, which indicated that HBP1 enhances PGR transcriptional activity, thereby playing a pivotal role in endometrial decidualization. Clinical specimen analysis further confirmed that the expression of HBP1 and PGR target molecules was significantly downregulated in the endometrium of patients with recurrent implantation failure. In conclusion, this study demonstrated that HBP1 played a crucial regulatory role in endometrial decidualization by directly transcriptionally regulating the decidualization marker IGFBP1 and enhancing PGR transcriptional activity through H3K4me3 modification.
Full text 137,696 characters · extracted from preprint-html · click to expand
HBP1 facilitates PGR transcriptional activity and IGFBP1 expression conducive to human endometrial decidualization | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article HBP1 facilitates PGR transcriptional activity and IGFBP1 expression conducive to human endometrial decidualization Pinxiu Huang, Aiping Qin, Yuying Guo, Zhong Lin, Wencai Tian, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6254635/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Jan, 2026 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Abstract Decidualization of human endometrial stromal cells (HESCs) is one of the critical steps in the establishment of human pregnancy. HESCs decidualization provides a suitable microenvironment for embryo implantation and pregnancy maintenance. Nevertheless, little is known about the molecular mechanisms underlying human decidualization. In this study, we identified HBP1 as a key player in the decidualization of HESCs. Knockdown of HBP1 significantly reduced the mRNA and protein expression levels of decidualization markers IGFBP1 and FOXO1. Although PGR expression showed no significant change, the expression levels of PGR-regulated target molecules were decreased. Furthermore, ChIP-Seq and RNA-seq analyses revealed that HBP1 directly transcriptionally regulates IGFBP1 expression. Additionally, overexpression of HBP1 promoted the enrichment of histone H3K4me3 at the promoter regions of PGR and its target molecules FKBP5, FOSL2, and FKBP4, which indicated that HBP1 enhances PGR transcriptional activity, thereby playing a pivotal role in endometrial decidualization. Clinical specimen analysis further confirmed that the expression of HBP1 and PGR target molecules was significantly downregulated in the endometrium of patients with recurrent implantation failure. In conclusion, this study demonstrated that HBP1 played a crucial regulatory role in endometrial decidualization by directly transcriptionally regulating the decidualization marker IGFBP1 and enhancing PGR transcriptional activity through H3K4me3 modification. Biological sciences/Genetics/Epigenetics Health sciences/Endocrinology/Endocrine system and metabolic diseases/Endocrine reproductive disorders Biological sciences/Genetics/Gene regulation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Decidualization of human endometrial stromal cells (HESCs) is critically important for the establishment and maintenance of pregnancy 1,2 .This process is a key event during the "implantation window" 3 . Studies have shown that insufficient decidualization of HESCs is closely associated with various pregnancy-related disorders, including embryo implantation failure, recurrent spontaneous abortion, intrauterine growth restriction, and preeclampsia 4-8 . Therefore, a deeper understanding of the molecular mechanisms underlying HESCs decidualization not only benefits in the prevention of decidualization-related disorders but also provides clinicians with more effective therapeutic strategies, which will improve the outcome of pregnancy. Under the synergistic regulation of estrogen and progesterone, HESCs undergo cyclic changes. During the proliferative phase, estrogen plays a dominant role, promoting endometrial proliferation. Following ovulation, as progesterone secretion increases, the endometrium gradually transitions from the proliferative phase to the secretory phase. During the establishment of a human pregnancy, the embryo can only be successfully implanted if the endometrium is decidualized and reaches a receptive state 9 . The progesterone (P4) and its receptor (PGR) signaling pathway plays a pivotal role in the decidualization process of HESCs 10 . As one of the key regulatory factors in decidualization, P4 exerts its biological functions through the PGR-mediated signaling pathway, and the proper response and regulation of P4 signaling by PGR are essential for the successful progression of decidualization 11 . Any factors that affect the P4/PGR signaling pathway may potentially influence the establishment and maintenance of pregnancy 12 . The P4/PGR signaling not only directly regulates the expression of decidualization marker genes but also exerts profound effects on the successful establishment of pregnancy and outcomes through interactions with multiple signaling pathways 13-15 . However, the precise molecular mechanisms governing endometrial decidualization remain incompletely understood and warrant further investigation. High-mobility group box-containing protein 1 (HBP1) is a widely expressed transcription factor belonging to the sequence-specific HMG family 16 . Research has demonstrated that HBP1 plays a crucial role in cellular proliferation and differentiation, exhibiting dual functionality in transcriptional regulation 17-19 . On one hand, HBP1 can activate the transcription of specific genes, inducing cellular senescence and apoptosis 20 . On the other hand, HBP1 primarily functions as a transcriptional repressor 16 , exerting significant cell cycle inhibitory effects in both normal and cancer cells 21 . Studies have demonstrated that HBP1 deletion in mouse liver tissue exacerbates diabetic symptoms. HBP1 regulates glucose and insulin homeostasis by forming an insulin/HBP1/IGFBP1 negative feedback loop, which involves transcriptional activation of IGFBP1 and suppression of the PI3K/AKT signaling pathway 22 . Notably, IGFBP1 is a well-established marker of endometrial decidualization in humans 23 . A recent RNA-Seq analysis of in vitro decidualization in primary endometrial stromal cells revealed that HBP1 expression is significantly upregulated on day 3 of decidualization 24 , suggesting its potential role in regulating this process. Nevertheless, the specific molecular mechanisms of HBP1 in endometrial decidualization, its downstream signaling pathways, and its regulatory relationship with IGFBP1 remain poorly understood and require further investigation. This study provides evidence that HBP1 plays an important regulatory role in embryo implantation. On the one hand, HBP1 can directly regulate the expression of IGFBP1, a decidualization marker; on the other hand, HBP1 can also enhance the transcriptional activity of PGR by H3K4me3 modification, which plays a key role in endometrial decidualization. In addition, decreased levels of HBP1 expression in the endometrium were found to be closely associated with repeated implantation failure (RIF), suggesting that HBP1 may play an important role in successful embryo implantation. Results Dynamic expression of HBP1 in human endometrial stromal cells. RNA-Seq data was obtained from a previous study 24 , which performed heatmap analysis of differentially expressed genes in HESCs during in vitro decidualization on day 3 (D3). HBP1 expression was significantly upregulated at D3 (Fig. 1 A). In the model of in vitro decidualization of HESCs induced by MPA combined with cAMP, mRNA levels of HBP1, IGFBP1, and PRL progressively increased from D0 to D6 (Fig. 1 B), with corresponding increases in IGFBP1 and HBP1 protein levels (Fig. 1 C, D). IHC analysis of endometrial biopsies from healthy volunteers revealed minimal HBP1 expression during the proliferative phase, with progressive nuclear accumulation in stromal cells throughout the secretory phase (Fig. 1 E). IF confirmed predominant nuclear localization of HBP1 at D4 of decidualization (Fig. 1 F). These findings demonstrated that HBP1 undergoes dynamic regulation under progesterone control. HBP 1 plays an important role in the decidualization of human endometrial stromal cells. Quantitative PCR analysis of PRL (Fig. 2 A), IGFBP1 (Fig. 2 B), and FOXO1 (Fig. 2 C) revealed time-dependent upregulation during HESC decidualization (D0-D6), with HBP1 knockdown significantly reducing these markers' expression. Western blot analysis showed progressive increases in HBP1, IGFBP1, and FOXO1 protein levels during decidualization (D0-D6), which were markedly suppressed by HBP1 knockdown (Fig. 2 D). Immunofluorescence analysis demonstrated that HBP1 knockdown HESCs maintained spindle-shaped morphology after 3 days of decidualization, failing to exhibit typical polygonal morphology (Fig. 2 E). MTS assays revealed significantly reduced proliferation in overexpressing HBP1 HESCs (Fig. 2 F) and enhanced proliferation in HBP1 knockdown cells (Fig. 2 G). Consistently, HBP1 overexpression significantly decreased Ki67-positive cells after 3 days of decidualization (Fig. 2 H). These findings demonstrate that HBP1 regulates both decidualization and endometrial homeostasis through proliferation control. HBP1 Promotes Human Endometrial Decidualization through Suppression of AKT Phosphorylation. To investigate the molecular mechanisms underlying HBP1-mediated decidualization, we performed RNA-Seq transcriptome analysis on knockdown HBP1 and control groups at day 3 (D3) of in vitro decidualization in HESCs. KEGG pathway enrichment analysis of differentially expressed genes revealed significant activation of the PI3K-AKT signaling pathway (Fig. 3 A). Subsequent Western blot analysis demonstrated that while total AKT protein levels remained unchanged upon HBP1 knockdown, phosphorylated AKT (p-AKT) levels were markedly elevated, accompanied by downregulation of IGFBP1 expression (Fig. 3 B). Importantly, treatment with the PI3K inhibitor LY294002 in knockdown HBP1 cells significantly reduced p-AKT levels and restored IGFBP1 expression, without affecting total AKT protein levels (Fig. 3 B). These findings suggest that HBP1 promotes decidualization of HESCs through suppression of AKT phosphorylation. HBP1 potentiates progesterone signaling by upregulating PGR target gene expression while maintaining constant PGR levels in Human Endometrial Decidualization. Quantitative PCR analysis revealed a significant upregulation of HBP1 mRNA levels in MPA-treated HESCs, which was markedly attenuated upon PGR knockdown (Fig. 4 A), indicating positive regulation of HBP1 expression by the P4/PGR signaling pathway. During in vitro decidualization (D2-D6), HBP1 knockdown did not alter PGR expression at either mRNA (Fig. 4 B) or protein levels (Fig. 4 C). RNA-Seq analysis of HBP1-knockdown and control groups at day 3 of decidualization identified distinct clusters of differentially expressed genes (Fig. 4 D). Heatmap analysis demonstrated that HBP1 depletion significantly downregulated multiple decidualization markers and PGR target genes, while PGR expression remained unchanged (Fig. 4 E). Subsequent qPCR validation confirmed that HBP1 knockdown had no significant effect on PGR mRNA levels but significantly reduced the expression of PGR target genes, including FOSL2, FKBP4, FKBP5, and SRC1 (Fig. 4 F)(P < 0.05). Western blot analysis further showed that HBP1 knockdown significantly decreased protein levels of FOSL2, FKBP4, and FKBP5 during decidualization (D2-D6) (Fig. 4 G). These findings collectively demonstrate that HBP1 enhances the transcriptional activity of PGR. HBP1 directly regulates IGFBP1 transcription and modulates PGR transcriptional activity through H3K4me3 modification. To elucidate the molecular mechanisms underlying HBP1-mediated decidualization, we performed ChIP-Seq analysis on HESCs overexpressing Flag-tagged HBP1 at day 3 (D3) of in vitro decidualization. Genomic distribution analysis revealed that HBP1 binding sites were predominantly located in promoter regions, distal intergenic regions, and intronic areas (Fig. 5 A), while H3K4me3 peaks were primarily enriched in promoter regions (Fig. 5 B). Integrated analysis of RNA-Seq and ChIP-Seq data demonstrated significant activation of the FOXO signaling pathway among genes that were both downregulated upon HBP1 knockdown and bound by HBP1 (Fig. 5 C). ChIP-Seq data indicated co-occupancy of HBP1 and H3K4me3 at the IGFBP1 promoter region, with HBP1 overexpression significantly enhancing H3K4me3 peak intensity at this locus (Fig. 5 D). RNA-Seq confirmed IGFBP1 downregulation upon HBP1 knockdown, indicating direct transcriptional regulation by HBP1 with H3K4me3 cooperation. Notably, HBP1 overexpression significantly increased H3K4me3 peak intensities at the promoters of PGR and its target genes (FKBP5, FOSL2, and FKBP4) compared to controls (Fig. 5 E), suggesting that HBP1 may enhance the transcriptional activity of PGR and its targets through modulating H3K4me3 modification. Further analysis of HBP1 and H3K4me3 binding patterns revealed predominant localization within ± 3kb regions surrounding the transcription start sites (TSS) (Fig. 5 F), with significantly higher H3K4me3 read counts in HBP1-overexpressing cells (Fig. 5 G). GO functional enrichment analysis indicated that H3K4me3-bound upregulated genes following HBP1 overexpression were primarily involved in cellular differentiation processes (Fig. 5 H), while KEGG pathway analysis demonstrated significant enrichment in Progesterone response signal pathway (Fig. 5 I). These results collectively demonstrate that HBP1 promotes endometrial decidualization by regulating PGR transcriptional activity through modulation of H3K4me3 histone modifications. The decrease in the expression of HBP 1 and PGR target molecules in the endometrium is related to the occurrence of RIF. Comparative analysis of HBP1, PGR, IGFBP1, FRBP5, and FOSL2 expression was performed in mid-secretory endometrial tissues obtained from healthy controls (n = 12) and RIF patients (n = 12) using IHC, qPCR, and WB. Quantitative analysis revealed significant downregulation of HBP1, IGFBP1, FRBP5, and FOSL2 at both transcriptional (Fig. 6 B, D-F) and translational levels (Fig. 6 A, G) in the RIF cohort compared to healthy controls. In contrast, PGR expression remained comparable between groups at mRNA (Fig. 6 C) and protein levels (Fig. 6 A, G). These findings, supported by comprehensive in vivo and in vitro functional studies, demonstrated that HBP1 serves as a critical regulator of endometrial decidualization and implantation competence, with its dysregulation potentially contributing to the pathogenesis of RIF. Discussion Embryo implantation failure remains a significant clinical challenge in reproductive medicine. Emerging evidence suggests that impaired endometrial decidualization may contribute more substantially to reproductive dysfunction than embryo quality alone 25 , although the underlying molecular mechanisms remain incompletely understood 26 . Our findings demonstrate that the transcription factor HBP1 plays a pivotal role in endometrial decidualization through direct transcriptional regulation of IGFBP1, a well-established decidualization marker, and modulation of H3K4me3 histone modification to enhance PGR transcriptional activity. Furthermore, we observed that downregulation of HBP1 and its downstream targets (FKBP5 and FOSL2) in the endometrium may disrupt decidualization processes, potentially contributing to the pathogenesis of implantation failure. The progesterone receptor (PGR) plays a critical role in embryo implantation and pregnancy maintenance 27 . Impaired endometrial decidualization has been implicated in both unexplained infertility and RIF 28 . Clinical evidence suggests that progesterone resistance, rather than absolute hormone levels, represents a key determinant of decidualization competence, with PGR expression and functionality serving as the primary mediators 29 , 30 . PGR activity is regulated through interactions with coregulatory proteins, including FOSL2, FKBP4, FKBP5, and SRC1 31–34 . Specifically, FOSL2 functions as both a transcriptional coregulator and downstream target of PGR, directly binding to regulatory regions of decidualization-associated genes 35 . FKBP4, another PGR target, has been shown to regulate decidualization through modulation of IGFBP1 expression, with FKBP4 siRNA treatment reducing IGFBP1 levels by 60% in HESCs 36 . FKBP5 contributes to decidualization through multiple mechanisms, including regulation of Clock Genes and formation of functional complexes with PGR-B and MAGE-11 in response to progesterone signalin 37 , 38 . Additionally, the nuclear receptor coactivator SRC1 enhances PGR transcriptional activity both directly and through interactions with coregulatory proteins FKBP5 38 . Our experimental data demonstrate that HBP1 knockdown in HESCs does not affect PGR expression at either mRNA or protein levels during in vitro decidualization. However, it significantly downregulates key PGR target molecules in the progesterone response pathway, including FOSL2, FKBP4, and FKBP5. These findings suggest that HBP1 modulates PGR transcriptional activity primarily through the regulation of downstream targets, providing a mechanistic explanation for impaired decidualization in HESCs. IGFBP1, a well-established decidualization marker 39 , is regulated by a complex network of transcription factors that bind to its promoter region, including FOXO1 40 , WT1 41 , Sp1 42 , ATF4 43 , C/EBPβ 44,45 , FOXA1/2 46 , HIF-1α 47,48 , and STAT5 49 . Additionally, STAT1 and STAT3 have been implicated in IGFBP1 regulation under inflammatory or stress conditions, with cytokines such as IL-6 modulating IGFBP1 expression through STAT3 activation 3 . Our findings identify HBP1 as a novel transcriptional regulator of IGFBP1, expanding the known regulatory network of this critical decidualization marker. The AKT signaling pathway has been extensively implicated in HESC decidualization 50 , 51 . Our results demonstrate that HBP1 promotes decidualization through direct transcriptional regulation of IGFBP1 expression, and inhibition of AKT phosphorylation. These findings provide new insights into the molecular mechanisms governing endometrial decidualization and establish HBP1 as a key regulatory component in this process. Recent studies have shown the crucial role of epigenetic regulation in endometrial decidualization, with histone modifications serving as key mediators of gene expression during this process 52 . Among various epigenetic mechanisms, histone methylation and acetylation have been particularly implicated in the precise regulation of decidualization-associated genes 53 . Notably, the active chromatin marks H3K27ac and H3K4me3 demonstrate significant enrichment during HESCs decidualization 54 , 55 . Our ChIP-seq analysis revealed that HBP1 orchestrates decidualization through direct binding to the TSS of IGFBP1, and facilitation of H3K4me3 modification at the IGFBP1 locus. Furthermore, we observed that HBP1 enhances H3K4me3 enrichment at the transcriptional regulatory regions of both PGR and its downstream targets, thereby potentiating progesterone responsiveness. These findings position HBP1 as a critical epigenetic regulator in endometrial decidualization. In summary, our study demonstrates that the transcription factor HBP1 plays a pivotal role in endometrial decidualization through direct transcriptional regulation of IGFBP1, a well-established decidualization marker, and enhancement of PGR transcriptional activity via modulation of H3K4me3 modifications. Furthermore, we identified that the downregulation of HBP1 and its downstream PGR targets in the endometrium is significantly associated with RIF. These findings not only advance our understanding of the molecular mechanisms underlying endometrial decidualization but also identify potential diagnostic biomarkers and therapeutic targets for RIF management. Methods Sample of clinical cases. The specimens for this study were obtained from patients with recurrent implantation failure (RIF) and healthy multiparous women recruited from Liuzhou Maternal and Child Health Hospital in China. All specimens were collected from the endometrium during the "implantation window." This study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital (2021-079), and written informed consent was obtained from all participants prior to enrollment. Participants were aged 20–38 years, with a body mass index (BMI) of 18–23 kg/m², regular menstrual cycles, and normal endocrine function. Patients with polycystic ovary syndrome, endometrial polyps, chronic endometritis, hydrosalpinx, salpingitis, endometriosis, adenomyosis, chromosomal abnormalities, or autoimmune diseases were excluded. The diagnostic criteria for RIF were defined as the failure of at least three transfers of euploid embryos (or an equivalent number of unscreened embryos adjusted for patient age) 56 . Isolation and culturing of primary HESCs. Primary HESCs were isolated from proliferative-phase endometrial tissues of healthy reproductive-aged female volunteers with regular menstrual cycles. This study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital, and informed consent was obtained from all participants prior to sample collection. The isolation procedure was as follows: endometrial tissues were minced and digested with 2% collagenase for 1 hour, followed by medium replacement to remove floating cells. The digested mixture was sequentially filtered through 100 µm and 40 µm cell strainers. The filtered cells were cultured overnight at 37°C with 5% CO₂ in complete medium containing DMEM/F12 (Thermo), 1% penicillin/streptomycin (Solarbio), and 10% fetal bovine serum (Vivacell). The next day, HESCs exhibited a typical spindle-shaped, fibroblast-like morphology. Immunohistochemical (IHC) staining. All endometrial biopsy samples were fixed in formalin and embedded in paraffin. The section preparation process was as follows: paraffin sections were dewaxed and rehydrated, and 5 µm thick endometrial sections were placed in 10 mM citrate buffer (pH 6.0) for antigen retrieval using autoclaving for 10–15 minutes. Subsequently, the sections were incubated with 3% hydrogen peroxide to inactivate endogenous peroxidase activity, followed by blocking with 5% bovine serum albumin (BSA) for 1 hour. The sections were incubated overnight (24 hours) at 4°C with primary antibodies (HBP1, PGR, IGFBP1, FOSL2, and FKBP5), followed by incubation with secondary antibodies at room temperature for 1 hour. Finally, the sections were developed using DAB, counterstained with hematoxylin, and mounted after dehydration and clearing. Immunofluorescence (IF) staining . IF was performed as previously described 57 . Cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100. After permeabilization, the cells were incubated with the primary antibody (HBP1, F-actin, and Ki67) overnight at 4°C. The next day, the cells were incubated with a fluorescence-labeled secondary antibody for 1 hour, and nuclei were counterstained with DAPI. Finally, images were captured and analyzed using a fluorescence microscope. Cell proliferation assay. Cell proliferation and viability were assessed using the MTS assay, following the manufacturer's instructions. Real-time qPCR. Total RNA was extracted using TRIzol reagent (Invitrogen) from either endometrial biopsy tissues or cultured cells, following the manufacturer's instructions. Real-time quantitative PCR (qPCR) was performed as previously described 57 . RNA integrity was assessed by 1% agarose gel electrophoresis, and RNA concentration was measured using a Nanodrop spectrophotometer. One microgram of total RNA was reverse-transcribed into cDNA using a reverse transcription kit. Subsequently, qPCR analysis was performed using the ABI Q5 real-time PCR system with SYBR Green dye (Takara). The mRNA expression levels of all target genes were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Western blot analysis. Total proteins were extracted from either endometrial tissue samples or cultured cells using RIPA lysis buffer (Thermo) supplemented with 10% protease inhibitor cocktail (MCE). Western blot analysis was performed as previously described 57 . Primary antibodies used in the experiments included those against HBP1, IGFBP1, PGR, FOXO1, FOSL2, AKT, P-AKT, FKBP4, and FKBP5, with GAPDH serving as the internal control. Following enhanced chemiluminescence analysis for P-AKT, the membrane was stripped using stripping buffer (Solarbio) and subsequently reprobed with an AKT antibody. The band intensities of target proteins were quantified using ImageJ software, and relative protein expression levels were calculated by normalizing to GAPDH. RNA-Seq. Total RNA was extracted from endometrial biopsy tissues or cultured cells using TRIzol® Reagent (Invitrogen). The RNA samples were then sent to BGI (China) for RNA sequencing (RNA-Seq). Purified RNA was used to construct 50 bp single-end sequencing libraries following the standard protocol of the BGISEQ platform. ChIP-Seq. Chromatin immunoprecipitation sequencing (ChIP-Seq) was performed as previously described 57 . Briefly, primary endometrial stromal cells (decidualized for 3 days) were cross-linked with 1% formaldehyde for 10 minutes, followed by chromatin shearing via sonication in lysis buffer. The lysates were incubated overnight at 4°C with anti-IgG (negative control) or anti-H3K4me3 antibody, and immunoprecipitation was performed using protein A/G agarose beads. The precipitated complexes were reverse-cross-linked at 65°C for 4 hours, and the immunoprecipitated DNA fragments were extracted using phenol/chloroform/isoamyl alcohol (25:24:1). Finally, the PCR products were analyzed by agarose gel electrophoresis. Statistical analysis. Experimental data are presented as mean ± standard error of the mean (SEM). Statistical analyses were performed using Prism 9.0 software (GraphPad, San Diego, CA). Comparisons between groups were conducted using Student's t-test or one-way analysis of variance (ANOVA), while rate comparisons were assessed using the chi-square test. P < 0.05 was statistically significant. All experiments were independently repeated at least three times to ensure the reliability and reproducibility of the results. Declarations Data availability The RNA sequencing data during this study have been deposited in the NCBI Sequence Read Archive (accession: PRJNA1233012; https://www.ncbi.nlm.nih.gov/sra/PRJNA1233012). Furthermore, the ChIP-Seq date are available under accession number PRJNA1234783; (https://www.ncbi.nlm.nih.gov/sra/PRJNA1234783). Additional supporting datasets and methodological details have been archived and can be retrieved via the aforementioned accession links. Code availability The "Methods" section provides information on the publicly accessible software used in the study.There was no application of any proprietary code or mathematical algorithm thought to be essential to the findings. Acknowledgements This work was supported by the National Natural Science Foundation of China (82160296 and 82460309) and Guangxi Medical and health key discipline construction project. Author contributions P.H. and A.Q. designed the experiments. Y.G. and W.T. performed the experiments. C.N., H.F., and J.H.collected the human endometrial tissues. Z.C. and Z.L. performed the statistical analysis. Y.G. wrote the manuscript. P.H., A.Q., and Z.L. revised the manuscript. All authors reviewed the manuscript. Competing interests The authors declare no competing interests. Ethical approval This study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital (2021-079), and written informed consent was obtained from all participants prior to enrollment. Correspondence and requests for materials should be addressed to Aiping Qin or Pinxiu Huang. References Okada, H., Tsuzuki, T. & Murata, H. Decidualization of the human endometrium. Reproductive Medicine and Biology. 17 , 220-227 (2018). Lacconi, V. , et al. Characterization of epidermal growth factor-like domain 7 (EGFL7) expression in normal endometrium and in the endometrium of women with poor reproductive outcomes. Human Reproduction. 38 , 1345-1358 (2023). Zhou, M. , et al. Decreased PIBF1/IL6/p-STAT3 during the mid-secretory phase inhibits human endometrial stromal cell proliferation and decidualization. Journal of Advanced Research. 30 , 15-25 (2021). Bashiri, A., Halper, K.I. & Orvieto, R. Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. Reproductive Biology and Endocrinology. https://doi.org/16, 10.1186/s12958-018-0438-7(2018). Tang, L. , et al. Dysregulated Gln-Glu-α-ketoglutarate axis impairs maternal decidualization and increases the risk of recurrent spontaneous miscarriage. Cell Reports Medicine. 4 , 101026(2023). Turco, M.Y. & Moffett, A. Development of the human placenta. Development. https://doi.org/10.1242/dev.163428 (2019). Yang, J. , et al. Single-cell RNA-seq reveals developmental deficiencies in both the placentation and the decidualization in women with late-onset preeclampsia. Frontiers in Immunology. 14 , 1513-1530(2023). Peter Durairaj, R.R. , et al. Deregulation of the endometrial stromal cell secretome precedes embryo implantation failure. MHR: Basic science of reproductive medicine. 23 , 582-582 (2017). Kohlmeier, A. , et al. GATA2 and Progesterone Receptor Interaction in Endometrial Stromal Cells Undergoing Decidualization. Endocrinology. 161 , 1-9 (2020). Chi, R.-p.A. , et al. Human Endometrial Transcriptome and Progesterone Receptor Cistrome Reveal Important Pathways and Epithelial Regulators. The Journal of Clinical Endocrinology & Metabolism. 105 , e1419-e1439 (2020). Cope, D. & Monsivais, D. Progesterone Receptor Signaling in the Uterus Is Essential for Pregnancy Success. Cells. 11 , 1474(2022). Petousis, S. , et al. Unexplained infertility patients present the mostly impaired levels of progesterone receptors: Prospective observational study. American Journal of Reproductive Immunology. 79 , e12828(2018). Li, R. , et al. The role of epithelial progesterone receptor isoforms in embryo implantation. iScience. 24 , 103487(2021). Wu, S.-P., Li, R. & DeMayo, F.J. Progesterone Receptor Regulation of Uterine Adaptation for Pregnancy. Trends in Endocrinology & Metabolism. 29 , 481-491 (2018). DeMayo, F.J. & Lydon, J.P. 90 YEARS OF PROGESTERONE: New insights into progesterone receptor signaling in the endometrium required for embryo implantation. Journal of Molecular Endocrinology. 65 , T1-T14 (2020). Yee, S.G.T.H.H.S.K.G.M.K.-A.S.E.P.A.S. HBPl: a HMG box transcriptional repressor that is targeted by the retinoblastoma family. Genes Dev. 11 , 383–96 (1997). Yang R. , et al . The transcription factor HBP1 promotes ferroptosis in tumor cells by regulating the UHRF1-CDO1 axis. PLoS Biol. https://doi.org/10.1371/journal (2023). Wang, J. , et al. Methylation of HBP1 by PRMT1 promotes tumor progression by regulating actin cytoskeleton remodeling. Oncogenesis. https://doi.org/10.1038/s41389-022-00421-7(2022). Watanabe, N., Kageyama, R. & Ohtsuka, T. Hbp1 regulates the timing of neuronal differentiation during cortical development by controlling cell cycle progression. Development. 142 , 2278-2290 (2015). Wang, S. , et al. A positive feedback loop between Pim-1 kinase and HBP1 transcription factor contributes to hydrogen peroxide-induced premature senescence and apoptosis. Journal of Biological Chemistry. 292 , 8207-8222 (2017). Bollaert, E., de Rocca Serra, A. & Demoulin, J. B. The HMG box transcription factor HBP1: a cell cycle inhibitor at the crossroads of cancer signaling pathways. Cellular and Molecular Life Sciences. 76 , 1529-1539 (2019). Cheng Y. , et al . HBP1 inhibits the development of type 2 diabetes mellitus through transcriptional activation of the IGFBP1 gene. AGING. 14 , 8763-8782 (2022). B Gellersen, J.B. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178 , 357-372 (2003). Pavličev, M. , et al. Single-cell transcriptomics of the human placenta: inferring the cell communication network of the maternal-fetal interface. Genome Research. 27 , 349-361 (2017). Ng, S.-W. , et al. Endometrial Decidualization: The Primary Driver of Pregnancy Health. International Journal of Molecular Sciences. 21 , 4092(2020). Sebastian-Leon, P., Garrido, N., Remohí, J., Pellicer, A. & Diaz-Gimeno, P. Asynchronous and pathological windows of implantation: two causes of recurrent implantation failure†. Human Reproduction. 33 , 626-635 (2018). Zhang, Y. , et al. Circadian gene PER1 senses progesterone signal during human endometrial decidualization. Journal of Endocrinology. 243 , 229-242 (2019). Lai, Z.-Z. , et al. Single-cell transcriptome profiling of the human endometrium of patients with recurrent implantation failure. Theranostics. 12 , 6527-6547 (2022). Labied, S. , et al. Progestins Regulate the Expression and Activity of the Forkhead Transcription Factor FOXO1 in Differentiating Human Endometrium. Molecular Endocrinology. 20 , 35-44 (2006). Bartolomei, M.S. , et al. FOXO1 regulates uterine epithelial integrity and progesterone receptor expression critical for embryo implantation. PLOS Genetics. 14 , e1007787(2018). Rekawiecki, R., Dobrzyn, K., Kotwica, J. & Kowalik, M.K. Progesterone Receptor Coregulators as Factors Supporting the Function of the Corpus Luteum in Cows. Genes. 11 , 923 (2020). Joshi, N.R. , et al. Progesterone resistance in endometriosis is modulated by the altered expression of microRNA-29c and FKBP4. The Journal of Clinical Endocrinology & Metabolism. https://doi.org/10.1210/jc.2016-2076 (2016). Albaghdadi, A.J.H. & Kan, F.W.K. Immunosuppression with tacrolimus improved implantation and rescued expression of uterine progesterone receptor and its co-regulators FKBP52 and PIASy at nidation in the obese and diabetic mice: Comparative studies with metformin. Molecular and Cellular Endocrinology. 460 , 73-84 (2018). Hirota, Y. , et al. Deficiency of Immunophilin FKBP52 Promotes Endometriosis. The American Journal of Pathology. 173 , 1747-1757 (2008). DeMayo, F.J. , et al. Progesterone Receptor Transcriptome and Cistrome in Decidualized Human Endometrial Stromal Cells. Endocrinology. 156 , 2239-2253 (2015). Yang, H. , et al. FKBP4 is regulated by HOXA10 during decidualization and in endometriosis. Reproduction. 143 , 531-538 (2012). Zhai, J. , et al. In Silico, In Vitro, and In Vivo Analysis Identifies Endometrial Circadian Clock Genes in Recurrent Implantation Failure. The Journal of Clinical Endocrinology & Metabolism. 106 , 2077-2091 (2021). Su, S. , et al. Primate-specific Melanoma Antigen-A11 Regulates Isoform-specific Human Progesterone Receptor-B Transactivation. Journal of Biological Chemistry. 287 , 34809-34824 (2012). Popovici, R.M. , et al. Gene Expression Profiling of Human Endometrial-Trophoblast Interaction in a Coculture Model. Endocrinology. 147 , 5662-5675 (2006). Vaziri-Gohar, A., Zheng, Y. & Houston, K.D. IGF-1 Receptor Modulates FoxO1-Mediated Tamoxifen Response in Breast Cancer Cells. Molecular Cancer Research. 15 , 489-497 (2017). Tamura, I. , et al. Novel Function of a Transcription Factor WT1 in Regulating Decidualization in Human Endometrial Stromal Cells and Its Molecular Mechanism. Endocrinology. 158 , 3696-3707 (2017). Tang, Q., Wu, J., Zheng, F., Hann, Swei S. & Chen, Y. Emodin Increases Expression of Insulin-Like Growth Factor Binding Protein 1 through Activation of MEK/ERK/AMPKα and Interaction of PPARγ and Sp1 in Lung Cancer. Cellular Physiology and Biochemistry. 41 , 339-357 (2017). Zhou, H. , et al. Effects of natural 24-epibrassinolide on inducing apoptosis and restricting metabolism in hepatocarcinoma cells. Phytomedicine. 107 , 154428 (2022). Takagi, H. , et al. Transcriptional coactivator PGC-1α contributes to decidualization by forming a histone-modifying complex with C/EBPβ and p300. Journal of Biological Chemistry. 298 , 101874 (2022). Tamura, I. , et al. The distal upstream region of insulin-like growth factor–binding protein-1 enhances its expression in endometrial stromal cells during decidualization. Journal of Biological Chemistry. 293 , 5270-5280 (2018). Schill, D., Nord, J. FoxO1 and FoxA1/2 form a complex on DNA and cooperate to open chromatin at insulin regulated genes. Biochemistry and Cell Biology. https://doi.org/10.1139/bcb-2018-0104 (2018). Kajimura, S., Aida, K. & Duan, C. Understanding Hypoxia-Induced Gene Expression in Early Development: In Vitro and In Vivo Analysis of Hypoxia-Inducible Factor 1-Regulated Zebra Fish Insulin-Like Growth Factor Binding Protein 1 Gene Expression. Molecular and Cellular Biology. 26 , 1142-1155 (2006). Rahman, M.S. & Thomas, P. Characterization of three IGFBP mRNAs in Atlantic croaker and their regulation during hypoxic stress: potential mechanisms of their upregulation by hypoxia. American Journal of Physiology-Endocrinology and Metabolism. 301 , E637-E648 (2011). Laz, E.V., Sugathan, A. & Waxman, D.J. Dynamic in Vivo Binding of STAT5 to Growth Hormone-Regulated Genes in Intact Rat Liver. Sex-Specific Binding at Low- But Not High-Affinity STAT5 Sites. Molecular Endocrinology. 23 , 1242-1254 (2009). Wang, Y. , et al. Interleukin-25 induced by human chorionic gonadotropin promotes the proliferation of decidual stromal cells by activation of JNK and AKT signal pathways. Fertility and Sterility. 102 , 257-263 (2014). Jiang, Y. , et al. Osteoprotegerin interacts with syndecan-1 to promote human endometrial stromal decidualization by decreasing Akt phosphorylation. Human Reproduction. 35 , 2439-2453 (2020). Liu, M. , et al. Menin directs regionalized decidual transformation through epigenetically setting PTX3 to balance FGF and BMP signaling. Nature Communications. 13 , 1006 (2022). Xiong, Y., Wen, X., Liu, H., Zhang, M. & Zhang, Y. Bisphenol a affects endometrial stromal cells decidualization, involvement of epigenetic regulation. The Journal of Steroid Biochemistry and Molecular Biology. 200 , 105640 (2020). Liu, H., Huang, X., Mor, G. & Liao, A. Epigenetic modifications working in the decidualization and endometrial receptivity. Cellular and Molecular Life Sciences. 77 , 2091-2101 (2019). Tamura, I. , et al. Genome-wide analysis of histone modifications that underlie the dynamic changes in gene expression during decidualization in human endometrial stromal cells. Molecular Human Reproduction. 29 , gaad019(2023). Pirtea, P. , et al. Recurrent implantation failure: reality or a statistical mirage? Fertility and Sterility. 120 , 45-59 (2023). Deng, W. , et al. SOX4 facilitates PGR protein stability and FOXO1 expression conducive for human endometrial decidualization. eLife. 11 , e72073(2022). Tables Table 1 Information on the antibodies used in this study. Antibody Manufacturer Catalog Applications WB ICC IF IP ChIP HBP1 proteintech 11746-1-AP 1:600 1:1000 1:300 FKBP52 Abcam ab129097 1:1000 1:1000 PGR CST 8757 1:500 1:3000 FKBP5 Proteintech 14155-1-AP 1:1000 1:1000 FOXO1 Abcam ab39670 1:1000 1:3000 IGFBP1 Abcam ab228741 1:1000 1:500 FOSL2 CST 19967 1:1000 AKT proteintech 10176-2-AP 1:1000 pAKT proteintech 66444-1-Ig :1000 HA CST C29F4 1:1000 1:100 1:100 FLAG Sigma F9291 1:1000 1:100 1:100 GAPDH Abmart P30008 1:2000 Table 2 Main reagent name and concentration reagent name Manufacturer concentration MPA Sigma 1μM cAMP MCE 0.5mM CHX MCE 20μg/ml insulin-transferrin-selenium Thermo Fisher 1% glucose Sigma 3.1 g/L sodium pyruvate Sigma 1 mM sodium bicarbonate Sigma 1.5 g/L Penicillin-Streptomycin Sigma 50 mg/ml puromycin Sigma 500 ng/ml RNAi MAX Thermo Scientific 7.5μl/6well Lipofectamine 2000 Thermo Scientific 5μl/6well/2500ngDNA LY294002 MCE(154447-36-6) 20μM DMEM/F12 without phenolic red Gibco charcoal stripped fetal bovine serum Biological Industries Table 3 The sequence of oligonucleotide. Forward primer (5’-3’) Reverse primer (5’-3’) siRNA sequence siRNA sequence-HBP1 ACACGACTGTGCTTTCATA / siRNA sequence-PGR CCAGCATGTCGCCTTAGAA / QPCR primer GAPDH ACGGATTTGGTCGTATTGGG CGCTCCTGGAAGATGGTGAT IGFBP1 AGAGTCGTAGAGAGTTTAGC ACACTGTCTGCTGTGATAA PRL CTACATCCATAACCTCTCCTCAG GGGCTTGCTCCTTGTCTTC FOXO1 GGCAGCCAGGCATCTCAT TGGGTCAGGCGGTTCATAC PGR TGTATTTGTGCGTGTGGGTG TACAGCCCATTCCCAGGAAG FOSL2 AAACCAGAGCAGGTTGTTGC CAGAATCGAGACCCCAAGCA FKBP5 TATGGCTCGGCTGGCAGTCTC CCCTCTCCTTTCCGTTTGGTTCTC FKBP52 CCAACAACAAAGCCGCCAAGAC CTCCTCCTCAGCCAGCCTCTC HBP1 GAGGTGGACTGGCTAACAGAATTGG GTGGAGGGCGTGCATAGGAATG Table 4 Main plasmid name 1 pLVX-HA-IRES-ZSgrenn-HBP1 2 pLVX- FLAG -IRES-ZSgrenn-HBP1 Additional Declarations There is NO Competing Interest. Supplementary Files nrreportingsummary220253292.pdf Reporting Summary Cite Share Download PDF Status: Published Journal Publication published 18 Jan, 2026 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6254635","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":434584439,"identity":"a75000bc-22d9-46df-858c-5b87f33c80a1","order_by":0,"name":"Pinxiu Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYBACAwglwcDAzMD4IKGihjQtzAYPzhwjWgsYsEk+bGEmrMVcIvnZw687LPIMjvOYVSQ2sDHwt3cn4NViOSPN3Fj2jESxZDOP2Y3EHTIMEmfObsDvsBsJZtKSbRKJ/cwgLWfYGAwkcglpSf8G1tIG1FIAJInRkmMm+RFqCwNxWs68KZNmPCOROLOZrVgi4cwxHsJ+OZ6+TfLnjrrEDecPb/z4o6JGjr+9F78WEGDmbUBweAgqBwHGnw0E1YyCUTAKRsFIBgDDh0Xae1lnggAAAABJRU5ErkJggg==","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Pinxiu","middleName":"","lastName":"Huang","suffix":""},{"id":434584440,"identity":"9142bba2-3d3b-468e-a9c1-632a83aff937","order_by":1,"name":"Aiping Qin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Aiping","middleName":"","lastName":"Qin","suffix":""},{"id":434584441,"identity":"e87942f5-b727-4dd9-86f7-4b55667f401d","order_by":2,"name":"Yuying Guo","email":"","orcid":"https://orcid.org/0000-0002-9227-2630","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuying","middleName":"","lastName":"Guo","suffix":""},{"id":434584442,"identity":"a222cf9a-6d82-438e-9728-7ea7bd3afaeb","order_by":3,"name":"Zhong Lin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhong","middleName":"","lastName":"Lin","suffix":""},{"id":434584443,"identity":"2e8f5f17-8f17-47cb-9cfc-72ac30abf8ae","order_by":4,"name":"Wencai Tian","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Wencai","middleName":"","lastName":"Tian","suffix":""},{"id":434584444,"identity":"dc3cb391-3794-47fa-b145-ab580c70ce71","order_by":5,"name":"Changjun Nie","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Changjun","middleName":"","lastName":"Nie","suffix":""},{"id":434584445,"identity":"fd889c4e-37ea-42bc-9de7-4c6b458bbd51","order_by":6,"name":"Jiwei Huang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiwei","middleName":"","lastName":"Huang","suffix":""},{"id":434584446,"identity":"a7c6275b-ff58-4a6e-956f-6f9f74d81bfe","order_by":7,"name":"Huiliu Fan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Huiliu","middleName":"","lastName":"Fan","suffix":""},{"id":434584447,"identity":"b8fa23eb-e3c6-424b-a2a4-f26d1fed9b6b","order_by":8,"name":"Zhengqin Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhengqin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-03-18 15:28:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6254635/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6254635/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s42003-026-09567-1","type":"published","date":"2026-01-18T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80807936,"identity":"d7deea45-e281-4e1f-aad3-d4ab5a0017d3","added_by":"auto","created_at":"2025-04-17 09:42:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":458253,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDynamic expression of HBP1 in human endometrial stromal cells. A\u003c/strong\u003e Heatmap analysis of differentially expressed genes in non-decidualized (D0) and decidualized (D3) human endometrial stromal cells using RNA-Seq data from the literature\u003csup\u003e24\u003c/sup\u003e.\u003cstrong\u003e B\u003c/strong\u003e qPCR analysis of IGFBP1, PRL, and HBP1 mRNA expression levels at D0, D2, D4, and D6 after in vitro decidualization of HESCs treated with MPA plus cAMP. n = 3. \u003cstrong\u003eC, D\u003c/strong\u003e Western blot analysis of IGFBP1 and HBP1 protein expression levels in HESCs at different time points after treatment with MPA plus cAMP.\u003cstrong\u003e E\u003c/strong\u003e Immunohistochemical (IHC) analysis of HBP1 protein expression during the proliferative, early secretory, mid-secretory, and late secretory phases of the menstrual cycle. GE: glandular epithelium; S: stroma. Scale bar: 100 μm.\u003cstrong\u003e F \u003c/strong\u003eImmunofluorescence (IF) analysis of HBP1 protein localization in non-decidualized (D0) and decidualized (D4) human endometrial stromal cells. Scale bar: 100 μm. All data are presented as the mean ± standard error of the mean (SEM). *P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/fe545d676f7a2fe527fba7e9.png"},{"id":80808470,"identity":"0a2599ba-0fce-4501-96c8-975a5798f2c1","added_by":"auto","created_at":"2025-04-17 09:50:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":690986,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP1 regulates genes during the decidualization of human endometrial stromal cells.\u003c/strong\u003e qPCR analysis of PRL \u003cstrong\u003eA\u003c/strong\u003e, IGFBP1 \u003cstrong\u003eB\u003c/strong\u003e, and FOXO1 \u003cstrong\u003eC \u003c/strong\u003emRNA levels at D0, D2, D4, and D6 in HESCs treated with MPA plus cAMP for in vitro decidualization following HBP1 knockdown (Si-HBP1), n = 3.\u003cstrong\u003eD\u003c/strong\u003e Western blot analysis of IGFBP1 and FOXO1 protein levels at D2, D4, and D6 during in vitro decidualization of HESCs following HBP1 knockdown (Si-HBP1).\u003cstrong\u003eE \u003c/strong\u003eImmunofluorescence (IF) analysis of F-actin in control and Si-HBP1 groups of HESCs after 3 days of in vitro decidualization. Scale bar: 10 μm.\u003cstrong\u003e F, G \u003c/strong\u003eLine graphs showing the results of MTS assay for HESCs treated with OE-HBP1 (F) and Si-HBP1 (G) during in vitro decidualization at days 0, 1, 2, 3, 4, and 5.\u003cstrong\u003e H\u003c/strong\u003eIF analysis of Ki67 expression in control and OE-HBP1 groups of HESCs after 3 days of in vitro decidualization (D3), Scale bar: 100 μm. All data are presented as the mean ± standard error of the mean (SEM). *P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/6fad91a4294e312c5d24aa99.png"},{"id":80808468,"identity":"2feffa61-e981-46db-a139-bad4338b73aa","added_by":"auto","created_at":"2025-04-17 09:50:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":89604,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP1 inhibits AKT phosphorylation and promotes decidualization in human endometrial stromal cells (HESCs). A\u003c/strong\u003e KEGG pathway enrichment analysis of differentially expressed genes identified by RNA-Seq.\u003cstrong\u003e B\u003c/strong\u003eRescue experiment in Si-HBP1 cells. Western blot analysis demonstrated that si-HBP1 attenuated IGFBP1 levels through activation of AKT phosphorylation, whereas the PI3K inhibitor LY294002 restored IGFBP1 levels by suppressing AKT phosphorylation.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/1a32e52341b925cc458a1970.png"},{"id":80807941,"identity":"7e73cec3-d266-4f69-aded-43d34bccaf83","added_by":"auto","created_at":"2025-04-17 09:42:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":134656,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP1 regulates PGR transcriptional activity by mediating P4/RGR signaling. A\u003c/strong\u003e qPCR analysis of HBP1 mRNA levels in HESCs under control conditions, MPA treatment, and MPA treatment following Si-PGR transfection. Expression levels were normalized to GAPDH, n = 3.\u003cstrong\u003e B\u003c/strong\u003e qPCR analysis of PGR mRNA levels in HESCs during in vitro decidualization at days 0, 2, 4, and 6 in control and Si-HBP1 groups. Data were normalized to GAPDH.\u003cstrong\u003e C\u003c/strong\u003eWestern blot analysis of PGR protein levels in HESCs during in vitro decidualization at days 2, 4, and 6 in control and Si-HBP1 groups. GAPDH served as loading control. RNA-Seq analysis of HESCs under control and Si-HBP1 conditions during 3 days of in vitro decidualization: volcano plot \u003cstrong\u003eD\u003c/strong\u003e and heatmap of differentially expressed genes \u003cstrong\u003eE\u003c/strong\u003e.\u003cstrong\u003e F\u003c/strong\u003e qPCR analysis of mRNA expression levels of PGR, FOSL2, FKBP4, FKBP5, and SRC1 in HESCs during 3 days of in vitro decidualization in control and Si-HBP1 groups, n = 3.\u003cstrong\u003e G\u003c/strong\u003eWestern blot analysis of protein levels of HBP1, FOSL2, FKBP4, and FKBP5 in HESCs during in vitro decidualization at days 2, 4, and 6 in control and Si-HBP1 groups. GAPDH was used as the loading control. All data are presented as the mean ± standard error of the mean (SEM). *P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/3e8f157dff12459394660557.png"},{"id":80807943,"identity":"6cbd0d7a-fc07-4329-a636-94f9b23b5cfc","added_by":"auto","created_at":"2025-04-17 09:42:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":545926,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHBP1 directly transcriptionally regulates the expression of IGFBP1. \u003c/strong\u003eDistribution patterns of gene structural elements for HBP1 \u003cstrong\u003eA \u003c/strong\u003eand H3K4me3 \u003cstrong\u003eB\u003c/strong\u003e in HESCs during 3 days of in vitro decidualization, as determined by ChIP-seq analysis.\u003cstrong\u003e C\u003c/strong\u003e Bubble plot of KEGG pathway enrichment analysis for genes regulated by siHBP1-RNAseq and Flag-HBP1-ChIP-seq.\u003cstrong\u003e D\u003c/strong\u003e ChIP-seq peak profiles of HBP1 and H3K4me3 at the IGFBP1 locus in control and Flag -HBP1 groups; RNA-seq read distribution of IGFBP1 gene expression in control and Si-HBP1 groups.\u003cstrong\u003e E\u003c/strong\u003e ChIP-seq peak profiles of H3K4me3 at binding sites of PGR, FKBP5, FOSL2, and FKBP4 in control and Flag-HBP1 groups.\u003cstrong\u003e F\u003c/strong\u003e Top: Distribution of HBP1 and H3K4me3 binding within ±3.0 kb regions around transcription start sites (TSS) in control and Flag-HBP1 groups, as determined by ChIP-seq. Bottom: Enrichment heatmap of HBP1 and H3K4me3 binding sites in control and Flag-HBP1 groups.\u003cstrong\u003e G\u003c/strong\u003e Comparison of H3K4me3 read profiles between control and Flag-HBP1 groups.\u003cstrong\u003e H\u003c/strong\u003e GO analysis bar plot and KEGG pathway enrichment bubble plot \u003cstrong\u003eI \u003c/strong\u003eof genes upregulated by H3K4me3-Flag-HBP1.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/9712c8cab9f6a6180f3e72bc.png"},{"id":80808485,"identity":"582ef134-86cf-46ad-9018-695b31f29ab8","added_by":"auto","created_at":"2025-04-17 09:50:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":676182,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression levels of HBP1, PGR, IGFBP1, FKBP5, and FOSL2 in endometrial tissues obtained from RIF patients.\u003c/strong\u003e The expression patterns of FGR, HBP1, IGFBP1, FKBP5, and FOSL2 were evaluated in secretory-phase endometrial tissues through immunohistochemistry \u003cstrong\u003eA\u003c/strong\u003e, qPCR \u003cstrong\u003eB-F\u003c/strong\u003e, and Western blot \u003cstrong\u003eG\u003c/strong\u003e. Comparative analysis was performed between control subjects (n=12) and patients with RIF (n=12). GE: glandular epithelium; S: stroma. Scale bar: 100 μm. All data are presented as the mean ± standard error of the mean (SEM). *P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/e1d164f22806a9bce335dd8c.png"},{"id":103053391,"identity":"fb9fc04f-d73b-4b57-bc29-4554e15989ec","added_by":"auto","created_at":"2026-02-20 08:13:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3979158,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/34223f19-6d0c-49b6-b816-e295204c41ab.pdf"},{"id":80807935,"identity":"65de7188-3424-494d-b569-60cf992db26a","added_by":"auto","created_at":"2025-04-17 09:42:14","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1668437,"visible":true,"origin":"","legend":"Reporting Summary","description":"","filename":"nrreportingsummary220253292.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6254635/v1/ddbacbbecb00a04aefc0e81b.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"HBP1 facilitates PGR transcriptional activity and IGFBP1 expression conducive to human endometrial decidualization","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDecidualization of human endometrial stromal cells (HESCs) is critically important for the establishment and maintenance of pregnancy\u003csup\u003e1,2\u003c/sup\u003e.This process is a key event during the \u0026quot;implantation window\u0026quot;\u003csup\u003e3\u003c/sup\u003e. Studies have shown that insufficient decidualization of HESCs is closely associated with various pregnancy-related disorders, including embryo implantation failure, recurrent spontaneous abortion, intrauterine growth restriction, and preeclampsia\u003csup\u003e4-8\u003c/sup\u003e. Therefore, a deeper understanding of the molecular mechanisms underlying HESCs decidualization not only benefits in the prevention of decidualization-related disorders but also provides clinicians with more effective therapeutic strategies, which will improve the outcome of pregnancy.\u003c/p\u003e\n\u003cp\u003eUnder the synergistic regulation of estrogen and progesterone, HESCs undergo cyclic changes. During the proliferative phase, estrogen plays a dominant role, promoting endometrial proliferation. Following ovulation, as progesterone secretion increases, the endometrium gradually transitions from the proliferative phase to the secretory phase. During the establishment of a human pregnancy, the embryo can only be successfully implanted if the endometrium is decidualized and reaches a receptive state\u003csup\u003e9\u003c/sup\u003e. The progesterone (P4) and its receptor (PGR) signaling pathway plays a pivotal role in the decidualization process of HESCs\u003csup\u003e10\u003c/sup\u003e. As one of the key regulatory factors in decidualization, P4 exerts its biological functions through the PGR-mediated signaling pathway, and the proper response and regulation of P4 signaling by PGR are essential for the successful progression of decidualization\u003csup\u003e11\u003c/sup\u003e. Any factors that affect the P4/PGR signaling pathway may potentially influence the establishment and maintenance of pregnancy\u003csup\u003e12\u003c/sup\u003e. The P4/PGR signaling not only directly regulates the expression of decidualization marker genes but also exerts profound effects on the successful establishment of pregnancy and outcomes through interactions with multiple signaling pathways\u003csup\u003e13-15\u003c/sup\u003e. However, the precise molecular mechanisms governing endometrial decidualization remain incompletely understood and warrant further investigation.\u003c/p\u003e\n\u003cp\u003eHigh-mobility group box-containing protein 1 (HBP1) is a widely expressed transcription factor belonging to the sequence-specific HMG family\u003csup\u003e16\u003c/sup\u003e. Research has demonstrated that HBP1 plays a crucial role in cellular proliferation and differentiation, exhibiting dual functionality in transcriptional regulation\u003csup\u003e17-19\u003c/sup\u003e. On one hand, HBP1 can activate the transcription of specific genes, inducing cellular senescence and apoptosis\u003csup\u003e20\u003c/sup\u003e. On the other hand, HBP1 primarily functions as a transcriptional repressor\u003csup\u003e16\u003c/sup\u003e, exerting significant cell cycle inhibitory effects in both normal and cancer cells\u003csup\u003e21\u003c/sup\u003e. Studies have demonstrated that HBP1 deletion in mouse liver tissue exacerbates diabetic symptoms. HBP1 regulates glucose and insulin homeostasis by forming an insulin/HBP1/IGFBP1 negative feedback loop, which involves transcriptional activation of IGFBP1 and suppression of the PI3K/AKT signaling pathway\u003csup\u003e22\u003c/sup\u003e. Notably, IGFBP1 is a well-established marker of endometrial decidualization in humans\u003csup\u003e23\u003c/sup\u003e. A recent RNA-Seq analysis of in vitro decidualization in primary endometrial stromal cells revealed that HBP1 expression is significantly upregulated on day 3 of decidualization\u003csup\u003e24\u003c/sup\u003e, suggesting its potential role in regulating this process. Nevertheless, the specific molecular mechanisms of HBP1 in endometrial decidualization, its downstream signaling pathways, and its regulatory relationship with IGFBP1 remain poorly understood and require further investigation.\u003c/p\u003e\n\u003cp\u003eThis study provides evidence that HBP1 plays an important regulatory role in embryo implantation. On the one hand, HBP1 can directly regulate the expression of IGFBP1, a decidualization marker; on the other hand, HBP1 can also enhance the transcriptional activity of PGR by H3K4me3 modification, which plays a key role in endometrial decidualization. In addition, decreased levels of HBP1 expression in the endometrium were found to be closely associated with repeated implantation failure (RIF), suggesting that HBP1 may play an important role in successful embryo implantation.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDynamic expression of HBP1 in human endometrial stromal cells.\u003c/b\u003e RNA-Seq data was obtained from a previous study\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, which performed heatmap analysis of differentially expressed genes in HESCs during in vitro decidualization on day 3 (D3). HBP1 expression was significantly upregulated at D3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In the model of in vitro decidualization of HESCs induced by MPA combined with cAMP, mRNA levels of HBP1, IGFBP1, and PRL progressively increased from D0 to D6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), with corresponding increases in IGFBP1 and HBP1 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). IHC analysis of endometrial biopsies from healthy volunteers revealed minimal HBP1 expression during the proliferative phase, with progressive nuclear accumulation in stromal cells throughout the secretory phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). IF confirmed predominant nuclear localization of HBP1 at D4 of decidualization (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). These findings demonstrated that HBP1 undergoes dynamic regulation under progesterone control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP 1 plays an important role in the decidualization of human endometrial stromal cells.\u003c/b\u003e Quantitative PCR analysis of PRL (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), IGFBP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), and FOXO1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) revealed time-dependent upregulation during HESC decidualization (D0-D6), with HBP1 knockdown significantly reducing these markers' expression. Western blot analysis showed progressive increases in HBP1, IGFBP1, and FOXO1 protein levels during decidualization (D0-D6), which were markedly suppressed by HBP1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Immunofluorescence analysis demonstrated that HBP1 knockdown HESCs maintained spindle-shaped morphology after 3 days of decidualization, failing to exhibit typical polygonal morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). MTS assays revealed significantly reduced proliferation in overexpressing HBP1 HESCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) and enhanced proliferation in HBP1 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Consistently, HBP1 overexpression significantly decreased Ki67-positive cells after 3 days of decidualization (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). These findings demonstrate that HBP1 regulates both decidualization and endometrial homeostasis through proliferation control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP1 Promotes Human Endometrial Decidualization through Suppression of AKT Phosphorylation.\u003c/b\u003e To investigate the molecular mechanisms underlying HBP1-mediated decidualization, we performed RNA-Seq transcriptome analysis on knockdown HBP1 and control groups at day 3 (D3) of in vitro decidualization in HESCs. KEGG pathway enrichment analysis of differentially expressed genes revealed significant activation of the PI3K-AKT signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Subsequent Western blot analysis demonstrated that while total AKT protein levels remained unchanged upon HBP1 knockdown, phosphorylated AKT (p-AKT) levels were markedly elevated, accompanied by downregulation of IGFBP1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Importantly, treatment with the PI3K inhibitor LY294002 in knockdown HBP1 cells significantly reduced p-AKT levels and restored IGFBP1 expression, without affecting total AKT protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These findings suggest that HBP1 promotes decidualization of HESCs through suppression of AKT phosphorylation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP1 potentiates progesterone signaling by upregulating PGR target gene expression while maintaining constant PGR levels in Human Endometrial Decidualization.\u003c/b\u003e Quantitative PCR analysis revealed a significant upregulation of HBP1 mRNA levels in MPA-treated HESCs, which was markedly attenuated upon PGR knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), indicating positive regulation of HBP1 expression by the P4/PGR signaling pathway. During in vitro decidualization (D2-D6), HBP1 knockdown did not alter PGR expression at either mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) or protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). RNA-Seq analysis of HBP1-knockdown and control groups at day 3 of decidualization identified distinct clusters of differentially expressed genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Heatmap analysis demonstrated that HBP1 depletion significantly downregulated multiple decidualization markers and PGR target genes, while PGR expression remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Subsequent qPCR validation confirmed that HBP1 knockdown had no significant effect on PGR mRNA levels but significantly reduced the expression of PGR target genes, including FOSL2, FKBP4, FKBP5, and SRC1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF)(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Western blot analysis further showed that HBP1 knockdown significantly decreased protein levels of FOSL2, FKBP4, and FKBP5 during decidualization (D2-D6) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). These findings collectively demonstrate that HBP1 enhances the transcriptional activity of PGR.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHBP1 directly regulates IGFBP1 transcription and modulates PGR transcriptional activity through H3K4me3 modification.\u003c/b\u003e To elucidate the molecular mechanisms underlying HBP1-mediated decidualization, we performed ChIP-Seq analysis on HESCs overexpressing Flag-tagged HBP1 at day 3 (D3) of in vitro decidualization. Genomic distribution analysis revealed that HBP1 binding sites were predominantly located in promoter regions, distal intergenic regions, and intronic areas (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), while H3K4me3 peaks were primarily enriched in promoter regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Integrated analysis of RNA-Seq and ChIP-Seq data demonstrated significant activation of the FOXO signaling pathway among genes that were both downregulated upon HBP1 knockdown and bound by HBP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). ChIP-Seq data indicated co-occupancy of HBP1 and H3K4me3 at the IGFBP1 promoter region, with HBP1 overexpression significantly enhancing H3K4me3 peak intensity at this locus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). RNA-Seq confirmed IGFBP1 downregulation upon HBP1 knockdown, indicating direct transcriptional regulation by HBP1 with H3K4me3 cooperation.\u003c/p\u003e \u003cp\u003eNotably, HBP1 overexpression significantly increased H3K4me3 peak intensities at the promoters of PGR and its target genes (FKBP5, FOSL2, and FKBP4) compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), suggesting that HBP1 may enhance the transcriptional activity of PGR and its targets through modulating H3K4me3 modification. Further analysis of HBP1 and H3K4me3 binding patterns revealed predominant localization within \u0026plusmn;\u0026thinsp;3kb regions surrounding the transcription start sites (TSS) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), with significantly higher H3K4me3 read counts in HBP1-overexpressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). GO functional enrichment analysis indicated that H3K4me3-bound upregulated genes following HBP1 overexpression were primarily involved in cellular differentiation processes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH), while KEGG pathway analysis demonstrated significant enrichment in Progesterone response signal pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). These results collectively demonstrate that HBP1 promotes endometrial decidualization by regulating PGR transcriptional activity through modulation of H3K4me3 histone modifications.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe decrease in the expression of HBP 1 and PGR target molecules in the endometrium is related to the occurrence of RIF.\u003c/b\u003e Comparative analysis of HBP1, PGR, IGFBP1, FRBP5, and FOSL2 expression was performed in mid-secretory endometrial tissues obtained from healthy controls (n\u0026thinsp;=\u0026thinsp;12) and RIF patients (n\u0026thinsp;=\u0026thinsp;12) using IHC, qPCR, and WB. Quantitative analysis revealed significant downregulation of HBP1, IGFBP1, FRBP5, and FOSL2 at both transcriptional (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, D-F) and translational levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, G) in the RIF cohort compared to healthy controls. In contrast, PGR expression remained comparable between groups at mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, G). These findings, supported by comprehensive in vivo and in vitro functional studies, demonstrated that HBP1 serves as a critical regulator of endometrial decidualization and implantation competence, with its dysregulation potentially contributing to the pathogenesis of RIF.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eEmbryo implantation failure remains a significant clinical challenge in reproductive medicine. Emerging evidence suggests that impaired endometrial decidualization may contribute more substantially to reproductive dysfunction than embryo quality alone\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, although the underlying molecular mechanisms remain incompletely understood\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Our findings demonstrate that the transcription factor HBP1 plays a pivotal role in endometrial decidualization through direct transcriptional regulation of IGFBP1, a well-established decidualization marker, and modulation of H3K4me3 histone modification to enhance PGR transcriptional activity. Furthermore, we observed that downregulation of HBP1 and its downstream targets (FKBP5 and FOSL2) in the endometrium may disrupt decidualization processes, potentially contributing to the pathogenesis of implantation failure.\u003c/p\u003e \u003cp\u003eThe progesterone receptor (PGR) plays a critical role in embryo implantation and pregnancy maintenance\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Impaired endometrial decidualization has been implicated in both unexplained infertility and RIF\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Clinical evidence suggests that progesterone resistance, rather than absolute hormone levels, represents a key determinant of decidualization competence, with PGR expression and functionality serving as the primary mediators\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. PGR activity is regulated through interactions with coregulatory proteins, including FOSL2, FKBP4, FKBP5, and SRC1\u003csup\u003e31–34\u003c/sup\u003e. Specifically, FOSL2 functions as both a transcriptional coregulator and downstream target of PGR, directly binding to regulatory regions of decidualization-associated genes\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. FKBP4, another PGR target, has been shown to regulate decidualization through modulation of IGFBP1 expression, with FKBP4 siRNA treatment reducing IGFBP1 levels by 60% in HESCs\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. FKBP5 contributes to decidualization through multiple mechanisms, including regulation of Clock Genes and formation of functional complexes with PGR-B and MAGE-11 in response to progesterone signalin\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Additionally, the nuclear receptor coactivator SRC1 enhances PGR transcriptional activity both directly and through interactions with coregulatory proteins FKBP5\u003csup\u003e38\u003c/sup\u003e. Our experimental data demonstrate that HBP1 knockdown in HESCs does not affect PGR expression at either mRNA or protein levels during in vitro decidualization. However, it significantly downregulates key PGR target molecules in the progesterone response pathway, including FOSL2, FKBP4, and FKBP5. These findings suggest that HBP1 modulates PGR transcriptional activity primarily through the regulation of downstream targets, providing a mechanistic explanation for impaired decidualization in HESCs.\u003c/p\u003e \u003cp\u003eIGFBP1, a well-established decidualization marker\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, is regulated by a complex network of transcription factors that bind to its promoter region, including FOXO1\u003csup\u003e40\u003c/sup\u003e, WT1\u003csup\u003e41\u003c/sup\u003e, Sp1\u003csup\u003e42\u003c/sup\u003e, ATF4 \u003csup\u003e43\u003c/sup\u003e, C/EBPβ\u003csup\u003e44,45\u003c/sup\u003e, FOXA1/2\u003csup\u003e46\u003c/sup\u003e, HIF-1α\u003csup\u003e47,48\u003c/sup\u003e, and STAT5\u003csup\u003e49\u003c/sup\u003e. Additionally, STAT1 and STAT3 have been implicated in IGFBP1 regulation under inflammatory or stress conditions, with cytokines such as IL-6 modulating IGFBP1 expression through STAT3 activation\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Our findings identify HBP1 as a novel transcriptional regulator of IGFBP1, expanding the known regulatory network of this critical decidualization marker. The AKT signaling pathway has been extensively implicated in HESC decidualization\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e,\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Our results demonstrate that HBP1 promotes decidualization through direct transcriptional regulation of IGFBP1 expression, and inhibition of AKT phosphorylation. These findings provide new insights into the molecular mechanisms governing endometrial decidualization and establish HBP1 as a key regulatory component in this process.\u003c/p\u003e \u003cp\u003eRecent studies have shown the crucial role of epigenetic regulation in endometrial decidualization, with histone modifications serving as key mediators of gene expression during this process\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Among various epigenetic mechanisms, histone methylation and acetylation have been particularly implicated in the precise regulation of decidualization-associated genes\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Notably, the active chromatin marks H3K27ac and H3K4me3 demonstrate significant enrichment during HESCs decidualization\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Our ChIP-seq analysis revealed that HBP1 orchestrates decidualization through direct binding to the TSS of IGFBP1, and facilitation of H3K4me3 modification at the IGFBP1 locus. Furthermore, we observed that HBP1 enhances H3K4me3 enrichment at the transcriptional regulatory regions of both PGR and its downstream targets, thereby potentiating progesterone responsiveness. These findings position HBP1 as a critical epigenetic regulator in endometrial decidualization.\u003c/p\u003e \u003cp\u003eIn summary, our study demonstrates that the transcription factor HBP1 plays a pivotal role in endometrial decidualization through direct transcriptional regulation of IGFBP1, a well-established decidualization marker, and enhancement of PGR transcriptional activity via modulation of H3K4me3 modifications. Furthermore, we identified that the downregulation of HBP1 and its downstream PGR targets in the endometrium is significantly associated with RIF. These findings not only advance our understanding of the molecular mechanisms underlying endometrial decidualization but also identify potential diagnostic biomarkers and therapeutic targets for RIF management.\u003c/p\u003e "},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eSample of clinical cases.\u003c/b\u003e The specimens for this study were obtained from patients with recurrent implantation failure (RIF) and healthy multiparous women recruited from Liuzhou Maternal and Child Health Hospital in China. All specimens were collected from the endometrium during the \"implantation window.\" This study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital (2021-079), and written informed consent was obtained from all participants prior to enrollment. Participants were aged 20–38 years, with a body mass index (BMI) of 18–23 kg/m², regular menstrual cycles, and normal endocrine function. Patients with polycystic ovary syndrome, endometrial polyps, chronic endometritis, hydrosalpinx, salpingitis, endometriosis, adenomyosis, chromosomal abnormalities, or autoimmune diseases were excluded. The diagnostic criteria for RIF were defined as the failure of at least three transfers of euploid embryos (or an equivalent number of unscreened embryos adjusted for patient age) \u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e \u003cb\u003eIsolation and culturing of primary HESCs.\u003c/b\u003e Primary HESCs were isolated from proliferative-phase endometrial tissues of healthy reproductive-aged female volunteers with regular menstrual cycles. This study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital, and informed consent was obtained from all participants prior to sample collection. The isolation procedure was as follows: endometrial tissues were minced and digested with 2% collagenase for 1 hour, followed by medium replacement to remove floating cells. The digested mixture was sequentially filtered through 100 µm and 40 µm cell strainers. The filtered cells were cultured overnight at 37°C with 5% CO₂ in complete medium containing DMEM/F12 (Thermo), 1% penicillin/streptomycin (Solarbio), and 10% fetal bovine serum (Vivacell). The next day, HESCs exhibited a typical spindle-shaped, fibroblast-like morphology.\u003c/p\u003e\u003cp\u003e \u003cb\u003eImmunohistochemical (IHC) staining.\u003c/b\u003e All endometrial biopsy samples were fixed in formalin and embedded in paraffin. The section preparation process was as follows: paraffin sections were dewaxed and rehydrated, and 5 µm thick endometrial sections were placed in 10 mM citrate buffer (pH 6.0) for antigen retrieval using autoclaving for 10–15 minutes. Subsequently, the sections were incubated with 3% hydrogen peroxide to inactivate endogenous peroxidase activity, followed by blocking with 5% bovine serum albumin (BSA) for 1 hour. The sections were incubated overnight (24 hours) at 4°C with primary antibodies (HBP1, PGR, IGFBP1, FOSL2, and FKBP5), followed by incubation with secondary antibodies at room temperature for 1 hour. Finally, the sections were developed using DAB, counterstained with hematoxylin, and mounted after dehydration and clearing.\u003c/p\u003e\u003cp\u003e \u003cb\u003eImmunofluorescence (IF) staining\u003c/b\u003e. IF was performed as previously described\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100. After permeabilization, the cells were incubated with the primary antibody (HBP1, F-actin, and Ki67) overnight at 4°C. The next day, the cells were incubated with a fluorescence-labeled secondary antibody for 1 hour, and nuclei were counterstained with DAPI. Finally, images were captured and analyzed using a fluorescence microscope.\u003c/p\u003e\u003cp\u003e \u003cb\u003eCell proliferation assay.\u003c/b\u003e Cell proliferation and viability were assessed using the MTS assay, following the manufacturer's instructions.\u003c/p\u003e\u003cp\u003e \u003cb\u003eReal-time qPCR.\u003c/b\u003e Total RNA was extracted using TRIzol reagent (Invitrogen) from either endometrial biopsy tissues or cultured cells, following the manufacturer's instructions. Real-time quantitative PCR (qPCR) was performed as previously described\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. RNA integrity was assessed by 1% agarose gel electrophoresis, and RNA concentration was measured using a Nanodrop spectrophotometer. One microgram of total RNA was reverse-transcribed into cDNA using a reverse transcription kit. Subsequently, qPCR analysis was performed using the ABI Q5 real-time PCR system with SYBR Green dye (Takara). The mRNA expression levels of all target genes were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).\u003c/p\u003e\u003cp\u003e \u003cb\u003eWestern blot analysis.\u003c/b\u003e Total proteins were extracted from either endometrial tissue samples or cultured cells using RIPA lysis buffer (Thermo) supplemented with 10% protease inhibitor cocktail (MCE). Western blot analysis was performed as previously described\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Primary antibodies used in the experiments included those against HBP1, IGFBP1, PGR, FOXO1, FOSL2, AKT, P-AKT, FKBP4, and FKBP5, with GAPDH serving as the internal control. Following enhanced chemiluminescence analysis for P-AKT, the membrane was stripped using stripping buffer (Solarbio) and subsequently reprobed with an AKT antibody. The band intensities of target proteins were quantified using ImageJ software, and relative protein expression levels were calculated by normalizing to GAPDH.\u003c/p\u003e\u003cp\u003e \u003cb\u003eRNA-Seq.\u003c/b\u003eTotal RNA was extracted from endometrial biopsy tissues or cultured cells using TRIzol® Reagent (Invitrogen). The RNA samples were then sent to BGI (China) for RNA sequencing (RNA-Seq). Purified RNA was used to construct 50 bp single-end sequencing libraries following the standard protocol of the BGISEQ platform.\u003c/p\u003e\u003cp\u003e \u003cb\u003eChIP-Seq.\u003c/b\u003e\u0026nbsp;Chromatin immunoprecipitation sequencing (ChIP-Seq) was performed as previously described\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Briefly, primary endometrial stromal cells (decidualized for 3 days) were cross-linked with 1% formaldehyde for 10 minutes, followed by chromatin shearing via sonication in lysis buffer. The lysates were incubated overnight at 4°C with anti-IgG (negative control) or anti-H3K4me3 antibody, and immunoprecipitation was performed using protein A/G agarose beads. The precipitated complexes were reverse-cross-linked at 65°C for 4 hours, and the immunoprecipitated DNA fragments were extracted using phenol/chloroform/isoamyl alcohol (25:24:1). Finally, the PCR products were analyzed by agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003e \u003cb\u003eStatistical analysis.\u003c/b\u003e Experimental data are presented as mean ± standard error of the mean (SEM). Statistical analyses were performed using Prism 9.0 software (GraphPad, San Diego, CA). Comparisons between groups were conducted using Student's t-test or one-way analysis of variance (ANOVA), while rate comparisons were assessed using the chi-square test. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was statistically significant. All experiments were independently repeated at least three times to ensure the reliability and reproducibility of the results.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNA sequencing data during this study have been deposited in the NCBI Sequence Read Archive (accession: PRJNA1233012; https://www.ncbi.nlm.nih.gov/sra/PRJNA1233012). Furthermore, the ChIP-Seq date are available under accession number PRJNA1234783; (https://www.ncbi.nlm.nih.gov/sra/PRJNA1234783). Additional supporting datasets and methodological details have been archived and can be retrieved via the aforementioned accession links.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u0026quot;Methods\u0026quot; section provides information on the publicly accessible software used in the study.There was no application of any proprietary code or mathematical algorithm thought to be essential to the findings.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (82160296 and 82460309) and Guangxi Medical and health key discipline construction project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP.H. and A.Q. designed the experiments. Y.G. and W.T. performed the experiments. C.N., H.F., and J.H.collected the human endometrial tissues. Z.C. and Z.L. performed the statistical analysis. Y.G. wrote the manuscript. P.H., A.Q., and Z.L. revised the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of Liuzhou Maternal and Child Health Hospital (2021-079), and written informed consent was obtained from all participants prior to enrollment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence\u0026nbsp;\u003c/strong\u003eand requests for materials should be addressed to Aiping Qin or Pinxiu Huang.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eOkada, H., Tsuzuki, T. \u0026amp; Murata, H. Decidualization of the human endometrium. \u003cem\u003eReproductive Medicine and Biology.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 220-227 (2018).\u003c/li\u003e\n\u003cli\u003eLacconi, V.\u003cem\u003e, et al.\u003c/em\u003e Characterization of epidermal growth factor-like domain 7 (EGFL7) expression in normal endometrium and in the endometrium of women with poor reproductive outcomes. \u003cem\u003eHuman Reproduction.\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 1345-1358 (2023).\u003c/li\u003e\n\u003cli\u003eZhou, M.\u003cem\u003e, et al.\u003c/em\u003e Decreased PIBF1/IL6/p-STAT3 during the mid-secretory phase inhibits human endometrial stromal cell proliferation and decidualization. \u003cem\u003eJournal of Advanced Research.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 15-25 (2021).\u003c/li\u003e\n\u003cli\u003eBashiri, A., Halper, K.I. \u0026amp; Orvieto, R. Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. \u003cem\u003eReproductive Biology and Endocrinology.\u003c/em\u003e https://doi.org/16, 10.1186/s12958-018-0438-7(2018).\u003c/li\u003e\n\u003cli\u003eTang, L.\u003cem\u003e, et al.\u003c/em\u003e Dysregulated Gln-Glu-\u0026alpha;-ketoglutarate axis impairs maternal decidualization and increases the risk of recurrent spontaneous miscarriage. \u003cem\u003eCell Reports Medicine.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 101026(2023).\u003c/li\u003e\n\u003cli\u003eTurco, M.Y. \u0026amp; Moffett, A. Development of the human placenta. \u003cem\u003eDevelopment.\u003c/em\u003e https://doi.org/10.1242/dev.163428 (2019).\u003c/li\u003e\n\u003cli\u003eYang, J.\u003cem\u003e, et al.\u003c/em\u003e Single-cell RNA-seq reveals developmental deficiencies in both the placentation and the decidualization in women with late-onset preeclampsia. \u003cem\u003eFrontiers in Immunology.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1513-1530(2023).\u003c/li\u003e\n\u003cli\u003ePeter Durairaj, R.R.\u003cem\u003e, et al.\u003c/em\u003e Deregulation of the endometrial stromal cell secretome precedes embryo implantation failure. \u003cem\u003eMHR: Basic science of reproductive medicine.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 582-582 (2017).\u003c/li\u003e\n\u003cli\u003eKohlmeier, A.\u003cem\u003e, et al.\u003c/em\u003e GATA2 and Progesterone Receptor Interaction in Endometrial Stromal Cells Undergoing Decidualization. \u003cem\u003eEndocrinology.\u003c/em\u003e \u003cstrong\u003e161\u003c/strong\u003e, 1-9 (2020).\u003c/li\u003e\n\u003cli\u003eChi, R.-p.A.\u003cem\u003e, et al.\u003c/em\u003e Human Endometrial Transcriptome and Progesterone Receptor Cistrome Reveal Important Pathways and Epithelial Regulators. \u003cem\u003eThe Journal of Clinical Endocrinology \u0026amp; Metabolism.\u003c/em\u003e \u003cstrong\u003e105\u003c/strong\u003e, e1419-e1439 (2020).\u003c/li\u003e\n\u003cli\u003eCope, D. \u0026amp; Monsivais, D. Progesterone Receptor Signaling in the Uterus Is Essential for Pregnancy Success. \u003cem\u003eCells.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1474(2022).\u003c/li\u003e\n\u003cli\u003ePetousis, S.\u003cem\u003e, et al.\u003c/em\u003e Unexplained infertility patients present the mostly impaired levels of progesterone receptors: Prospective observational study. \u003cem\u003eAmerican Journal of Reproductive Immunology.\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, e12828(2018).\u003c/li\u003e\n\u003cli\u003eLi, R.\u003cem\u003e, et al.\u003c/em\u003e The role of epithelial progesterone receptor isoforms in embryo implantation. \u003cem\u003eiScience.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 103487(2021).\u003c/li\u003e\n\u003cli\u003eWu, S.-P., Li, R. \u0026amp; DeMayo, F.J. Progesterone Receptor Regulation of Uterine Adaptation for Pregnancy. \u003cem\u003eTrends in Endocrinology \u0026amp; Metabolism.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 481-491 (2018).\u003c/li\u003e\n\u003cli\u003eDeMayo, F.J. \u0026amp; Lydon, J.P. 90 YEARS OF PROGESTERONE: New insights into progesterone receptor signaling in the endometrium required for embryo implantation. \u003cem\u003eJournal of Molecular Endocrinology.\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, T1-T14 (2020).\u003c/li\u003e\n\u003cli\u003eYee, S.G.T.H.H.S.K.G.M.K.-A.S.E.P.A.S. HBPl: a HMG box transcriptional repressor that is targeted by the retinoblastoma family. \u003cem\u003eGenes Dev.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 383\u0026ndash;96 (1997).\u003c/li\u003e\n\u003cli\u003eYang R.\u003cem\u003e, et al\u003c/em\u003e. The transcription factor HBP1 promotes ferroptosis in tumor cells by regulating the UHRF1-CDO1 axis. \u003cem\u003ePLoS Biol.\u003c/em\u003e https://doi.org/10.1371/journal (2023).\u003c/li\u003e\n\u003cli\u003eWang, J.\u003cem\u003e, et al.\u003c/em\u003e Methylation of HBP1 by PRMT1 promotes tumor progression by regulating actin cytoskeleton remodeling. \u003cem\u003eOncogenesis.\u003c/em\u003e https://doi.org/10.1038/s41389-022-00421-7(2022).\u003c/li\u003e\n\u003cli\u003eWatanabe, N., Kageyama, R. \u0026amp; Ohtsuka, T. Hbp1 regulates the timing of neuronal differentiation during cortical development by controlling cell cycle progression. \u003cem\u003eDevelopment.\u003c/em\u003e \u003cstrong\u003e142\u003c/strong\u003e, 2278-2290 (2015).\u003c/li\u003e\n\u003cli\u003eWang, S.\u003cem\u003e, et al.\u003c/em\u003e A positive feedback loop between Pim-1 kinase and HBP1 transcription factor contributes to hydrogen peroxide-induced premature senescence and apoptosis. \u003cem\u003eJournal of Biological Chemistry.\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e, 8207-8222 (2017).\u003c/li\u003e\n\u003cli\u003eBollaert, E., de Rocca Serra, A. \u0026amp; Demoulin, J. B. The HMG box transcription factor HBP1: a cell cycle inhibitor at the crossroads of cancer signaling pathways. \u003cem\u003eCellular and Molecular Life Sciences.\u003c/em\u003e \u003cstrong\u003e76\u003c/strong\u003e, 1529-1539 (2019).\u003c/li\u003e\n\u003cli\u003eCheng Y.\u003cem\u003e, et al\u003c/em\u003e. HBP1 inhibits the development of type 2 diabetes mellitus through transcriptional activation of the IGFBP1 gene. \u003cem\u003eAGING.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 8763-8782 (2022).\u003c/li\u003e\n\u003cli\u003eB Gellersen, J.B. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. \u003cem\u003eJ Endocrinol.\u003c/em\u003e \u003cstrong\u003e178\u003c/strong\u003e, 357-372 (2003).\u003c/li\u003e\n\u003cli\u003ePavličev, M.\u003cem\u003e, et al.\u003c/em\u003e Single-cell transcriptomics of the human placenta: inferring the cell communication network of the maternal-fetal interface. \u003cem\u003eGenome Research.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 349-361 (2017).\u003c/li\u003e\n\u003cli\u003eNg, S.-W.\u003cem\u003e, et al.\u003c/em\u003e Endometrial Decidualization: The Primary Driver of Pregnancy Health. \u003cem\u003eInternational Journal of Molecular Sciences.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 4092(2020).\u003c/li\u003e\n\u003cli\u003eSebastian-Leon, P., Garrido, N., Remoh\u0026iacute;, J., Pellicer, A. \u0026amp; Diaz-Gimeno, P. Asynchronous and pathological windows of implantation: two causes of recurrent implantation failure\u0026dagger;. \u003cem\u003eHuman Reproduction.\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 626-635 (2018).\u003c/li\u003e\n\u003cli\u003eZhang, Y.\u003cem\u003e, et al.\u003c/em\u003e Circadian gene PER1 senses progesterone signal during human endometrial decidualization. \u003cem\u003eJournal of Endocrinology.\u003c/em\u003e \u003cstrong\u003e243\u003c/strong\u003e, 229-242 (2019).\u003c/li\u003e\n\u003cli\u003eLai, Z.-Z.\u003cem\u003e, et al.\u003c/em\u003e Single-cell transcriptome profiling of the human endometrium of patients with recurrent implantation failure. \u003cem\u003eTheranostics.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 6527-6547 (2022).\u003c/li\u003e\n\u003cli\u003eLabied, S.\u003cem\u003e, et al.\u003c/em\u003e Progestins Regulate the Expression and Activity of the Forkhead Transcription Factor FOXO1 in Differentiating Human Endometrium. \u003cem\u003eMolecular Endocrinology.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 35-44 (2006).\u003c/li\u003e\n\u003cli\u003eBartolomei, M.S.\u003cem\u003e, et al.\u003c/em\u003e FOXO1 regulates uterine epithelial integrity and progesterone receptor expression critical for embryo implantation. \u003cem\u003ePLOS Genetics.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e1007787(2018).\u003c/li\u003e\n\u003cli\u003eRekawiecki, R., Dobrzyn, K., Kotwica, J. \u0026amp; Kowalik, M.K. Progesterone Receptor Coregulators as Factors Supporting the Function of the Corpus Luteum in Cows. \u003cem\u003eGenes.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 923 (2020).\u003c/li\u003e\n\u003cli\u003eJoshi, N.R.\u003cem\u003e, et al.\u003c/em\u003e Progesterone resistance in endometriosis is modulated by the altered expression of microRNA-29c and FKBP4. \u003cem\u003eThe Journal of Clinical Endocrinology \u0026amp; Metabolism.\u003c/em\u003e https://doi.org/10.1210/jc.2016-2076 (2016).\u003c/li\u003e\n\u003cli\u003eAlbaghdadi, A.J.H. \u0026amp; Kan, F.W.K. Immunosuppression with tacrolimus improved implantation and rescued expression of uterine progesterone receptor and its co-regulators FKBP52 and PIASy at nidation in the obese and diabetic mice: Comparative studies with metformin. \u003cem\u003eMolecular and Cellular Endocrinology.\u003c/em\u003e \u003cstrong\u003e460\u003c/strong\u003e, 73-84 (2018).\u003c/li\u003e\n\u003cli\u003eHirota, Y.\u003cem\u003e, et al.\u003c/em\u003e Deficiency of Immunophilin FKBP52 Promotes Endometriosis. \u003cem\u003eThe American Journal of Pathology.\u003c/em\u003e \u003cstrong\u003e173\u003c/strong\u003e, 1747-1757 (2008).\u003c/li\u003e\n\u003cli\u003eDeMayo, F.J.\u003cem\u003e, et al.\u003c/em\u003e Progesterone Receptor Transcriptome and Cistrome in Decidualized Human Endometrial Stromal Cells. \u003cem\u003eEndocrinology.\u003c/em\u003e \u003cstrong\u003e156\u003c/strong\u003e, 2239-2253 (2015).\u003c/li\u003e\n\u003cli\u003eYang, H.\u003cem\u003e, et al.\u003c/em\u003e FKBP4 is regulated by HOXA10 during decidualization and in endometriosis. \u003cem\u003eReproduction.\u003c/em\u003e \u003cstrong\u003e143\u003c/strong\u003e, 531-538 (2012).\u003c/li\u003e\n\u003cli\u003eZhai, J.\u003cem\u003e, et al.\u003c/em\u003e In Silico, In Vitro, and In Vivo Analysis Identifies Endometrial Circadian Clock Genes in Recurrent Implantation Failure. \u003cem\u003eThe Journal of Clinical Endocrinology \u0026amp; Metabolism.\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 2077-2091 (2021).\u003c/li\u003e\n\u003cli\u003eSu, S.\u003cem\u003e, et al.\u003c/em\u003e Primate-specific Melanoma Antigen-A11 Regulates Isoform-specific Human Progesterone Receptor-B Transactivation. \u003cem\u003eJournal of Biological Chemistry.\u003c/em\u003e \u003cstrong\u003e287\u003c/strong\u003e, 34809-34824 (2012).\u003c/li\u003e\n\u003cli\u003ePopovici, R.M.\u003cem\u003e, et al.\u003c/em\u003e Gene Expression Profiling of Human Endometrial-Trophoblast Interaction in a Coculture Model. \u003cem\u003eEndocrinology.\u003c/em\u003e \u003cstrong\u003e147\u003c/strong\u003e, 5662-5675 (2006).\u003c/li\u003e\n\u003cli\u003eVaziri-Gohar, A., Zheng, Y. \u0026amp; Houston, K.D. IGF-1 Receptor Modulates FoxO1-Mediated Tamoxifen Response in Breast Cancer Cells. \u003cem\u003eMolecular Cancer Research.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 489-497 (2017).\u003c/li\u003e\n\u003cli\u003eTamura, I.\u003cem\u003e, et al.\u003c/em\u003e Novel Function of a Transcription Factor WT1 in Regulating Decidualization in Human Endometrial Stromal Cells and Its Molecular Mechanism. \u003cem\u003eEndocrinology.\u003c/em\u003e \u003cstrong\u003e158\u003c/strong\u003e, 3696-3707 (2017).\u003c/li\u003e\n\u003cli\u003eTang, Q., Wu, J., Zheng, F., Hann, Swei S. \u0026amp; Chen, Y. Emodin Increases Expression of Insulin-Like Growth Factor Binding Protein 1 through Activation of MEK/ERK/AMPK\u0026alpha; and Interaction of PPAR\u0026gamma; and Sp1 in Lung Cancer. \u003cem\u003eCellular Physiology and Biochemistry.\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 339-357 (2017).\u003c/li\u003e\n\u003cli\u003eZhou, H.\u003cem\u003e, et al.\u003c/em\u003e Effects of natural 24-epibrassinolide on inducing apoptosis and restricting metabolism in hepatocarcinoma cells. \u003cem\u003ePhytomedicine.\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 154428 (2022).\u003c/li\u003e\n\u003cli\u003eTakagi, H.\u003cem\u003e, et al.\u003c/em\u003e Transcriptional coactivator PGC-1\u0026alpha; contributes to decidualization by forming a histone-modifying complex with C/EBP\u0026beta; and p300. \u003cem\u003eJournal of Biological Chemistry.\u003c/em\u003e \u003cstrong\u003e298\u003c/strong\u003e, 101874 (2022).\u003c/li\u003e\n\u003cli\u003eTamura, I.\u003cem\u003e, et al.\u003c/em\u003e The distal upstream region of insulin-like growth factor\u0026ndash;binding protein-1 enhances its expression in endometrial stromal cells during decidualization. \u003cem\u003eJournal of Biological Chemistry.\u003c/em\u003e \u003cstrong\u003e293\u003c/strong\u003e, 5270-5280 (2018).\u003c/li\u003e\n\u003cli\u003eSchill, D., Nord, J. FoxO1 and FoxA1/2 form a complex on DNA and cooperate to open chromatin at insulin regulated genes. \u003cem\u003eBiochemistry and Cell Biology.\u003c/em\u003e https://doi.org/10.1139/bcb-2018-0104 (2018).\u003c/li\u003e\n\u003cli\u003eKajimura, S., Aida, K. \u0026amp; Duan, C. Understanding Hypoxia-Induced Gene Expression in Early Development: In Vitro and In Vivo Analysis of Hypoxia-Inducible Factor 1-Regulated Zebra Fish Insulin-Like Growth Factor Binding Protein 1 Gene Expression. \u003cem\u003eMolecular and Cellular Biology.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 1142-1155 (2006).\u003c/li\u003e\n\u003cli\u003eRahman, M.S. \u0026amp; Thomas, P. Characterization of three IGFBP mRNAs in Atlantic croaker and their regulation during hypoxic stress: potential mechanisms of their upregulation by hypoxia. \u003cem\u003eAmerican Journal of Physiology-Endocrinology and Metabolism.\u003c/em\u003e \u003cstrong\u003e301\u003c/strong\u003e, E637-E648 (2011).\u003c/li\u003e\n\u003cli\u003eLaz, E.V., Sugathan, A. \u0026amp; Waxman, D.J. Dynamic in Vivo Binding of STAT5 to Growth Hormone-Regulated Genes in Intact Rat Liver. Sex-Specific Binding at Low- But Not High-Affinity STAT5 Sites. \u003cem\u003eMolecular Endocrinology.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1242-1254 (2009).\u003c/li\u003e\n\u003cli\u003eWang, Y.\u003cem\u003e, et al.\u003c/em\u003e Interleukin-25 induced by human chorionic gonadotropin promotes the proliferation of decidual stromal cells by activation of JNK and AKT signal pathways. \u003cem\u003eFertility and Sterility.\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 257-263 (2014).\u003c/li\u003e\n\u003cli\u003eJiang, Y.\u003cem\u003e, et al.\u003c/em\u003e Osteoprotegerin interacts with syndecan-1 to promote human endometrial stromal decidualization by decreasing Akt phosphorylation. \u003cem\u003eHuman Reproduction.\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 2439-2453 (2020).\u003c/li\u003e\n\u003cli\u003eLiu, M.\u003cem\u003e, et al.\u003c/em\u003e Menin directs regionalized decidual transformation through epigenetically setting PTX3 to balance FGF and BMP signaling. \u003cem\u003eNature Communications.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1006 (2022).\u003c/li\u003e\n\u003cli\u003eXiong, Y., Wen, X., Liu, H., Zhang, M. \u0026amp; Zhang, Y. Bisphenol a affects endometrial stromal cells decidualization, involvement of epigenetic regulation. \u003cem\u003eThe Journal of Steroid Biochemistry and Molecular Biology.\u003c/em\u003e \u003cstrong\u003e200\u003c/strong\u003e, 105640 (2020).\u003c/li\u003e\n\u003cli\u003eLiu, H., Huang, X., Mor, G. \u0026amp; Liao, A. Epigenetic modifications working in the decidualization and endometrial receptivity. \u003cem\u003eCellular and Molecular Life Sciences.\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 2091-2101 (2019).\u003c/li\u003e\n\u003cli\u003eTamura, I.\u003cem\u003e, et al.\u003c/em\u003e Genome-wide analysis of histone modifications that underlie the dynamic changes in gene expression during decidualization in human endometrial stromal cells. \u003cem\u003eMolecular Human Reproduction.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, gaad019(2023).\u003c/li\u003e\n\u003cli\u003ePirtea, P.\u003cem\u003e, et al.\u003c/em\u003e Recurrent implantation failure: reality or a statistical mirage? \u003cem\u003eFertility and Sterility.\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 45-59 (2023).\u003c/li\u003e\n\u003cli\u003eDeng, W.\u003cem\u003e, et al.\u003c/em\u003e SOX4 facilitates PGR protein stability and FOXO1 expression conducive for human endometrial decidualization. \u003cem\u003eeLife.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, e72073(2022).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u0026emsp;Information on the antibodies used in this study.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eManufacturer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCatalog\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 52.0796%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eApplications\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003eWB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003eICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003eIF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003eIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003eChIP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eHBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eproteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e11746-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:600\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e1:300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eFKBP52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eab129097\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003ePGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e8757\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:3000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eFKBP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e14155-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eFOXO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eab39670\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:3000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eIGFBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eab228741\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e1:500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eFOSL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e19967\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eAKT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eproteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e10176-2-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003epAKT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eproteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003e66444-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eHA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eC29F4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e1:100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e1:100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eFLAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eF9291\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e1:100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e1:100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 13.7432%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.264%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.9132%;\"\u003e\n \u003cp\u003eP30008\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.8391%;\"\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.6691%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.76492%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.58409%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.22242%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Table 2 \u003cstrong\u003eMain reagent name and concentration\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ereagent name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eManufacturer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003econcentration\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eMPA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1\u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ecAMP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eMCE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e0.5mM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eCHX\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eMCE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e20\u0026mu;g/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003einsulin-transferrin-selenium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eThermo Fisher\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eglucose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e3.1 g/L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003esodium pyruvate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003esodium bicarbonate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1.5 g/L\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ePenicillin-Streptomycin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e50 mg/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003epuromycin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eSigma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e500 ng/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eRNAi MAX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eThermo Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e7.5\u0026mu;l/6well\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLipofectamine 2000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eThermo Scientific\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e5\u0026mu;l/6well/2500ngDNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eLY294002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eMCE(154447-36-6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e20\u0026mu;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eDMEM/F12 without phenolic red\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eGibco\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003echarcoal stripped fetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eBiological Industries\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Table 3 The sequence of oligonucleotide.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003e\u003cstrong\u003esiRNA sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003esiRNA sequence-HBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eACACGACTGTGCTTTCATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003esiRNA sequence-PGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eCCAGCATGTCGCCTTAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQPCR primer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eACGGATTTGGTCGTATTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eCGCTCCTGGAAGATGGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eIGFBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eAGAGTCGTAGAGAGTTTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eACACTGTCTGCTGTGATAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003ePRL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eCTACATCCATAACCTCTCCTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eGGGCTTGCTCCTTGTCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eFOXO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eGGCAGCCAGGCATCTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eTGGGTCAGGCGGTTCATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003ePGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eTGTATTTGTGCGTGTGGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eTACAGCCCATTCCCAGGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eFOSL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eAAACCAGAGCAGGTTGTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eCAGAATCGAGACCCCAAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eFKBP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eTATGGCTCGGCTGGCAGTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eCCCTCTCCTTTCCGTTTGGTTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eFKBP52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eCCAACAACAAAGCCGCCAAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eCTCCTCCTCAGCCAGCCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 23.2394%;\"\u003e\n \u003cp\u003eHBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.2042%;\"\u003e\n \u003cp\u003eGAGGTGGACTGGCTAACAGAATTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 38.5563%;\"\u003e\n \u003cp\u003eGTGGAGGGCGTGCATAGGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Table 4 \u0026nbsp;Main plasmid name\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8664%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.1336%;\"\u003e\n \u003cp\u003epLVX-HA-IRES-ZSgrenn-HBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8664%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.1336%;\"\u003e\n \u003cp\u003epLVX- FLAG -IRES-ZSgrenn-HBP1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6254635/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6254635/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Decidualization of human endometrial stromal cells (HESCs) is one of the critical steps in the establishment of human pregnancy. HESCs decidualization provides a suitable microenvironment for embryo implantation and pregnancy maintenance. Nevertheless, little is known about the molecular mechanisms underlying human decidualization. In this study, we identified HBP1 as a key player in the decidualization of HESCs. Knockdown of HBP1 significantly reduced the mRNA and protein expression levels of decidualization markers IGFBP1 and FOXO1. Although PGR expression showed no significant change, the expression levels of PGR-regulated target molecules were decreased. Furthermore, ChIP-Seq and RNA-seq analyses revealed that HBP1 directly transcriptionally regulates IGFBP1 expression. Additionally, overexpression of HBP1 promoted the enrichment of histone H3K4me3 at the promoter regions of PGR and its target molecules FKBP5, FOSL2, and FKBP4, which indicated that HBP1 enhances PGR transcriptional activity, thereby playing a pivotal role in endometrial decidualization. Clinical specimen analysis further confirmed that the expression of HBP1 and PGR target molecules was significantly downregulated in the endometrium of patients with recurrent implantation failure. In conclusion, this study demonstrated that HBP1 played a crucial regulatory role in endometrial decidualization by directly transcriptionally regulating the decidualization marker IGFBP1 and enhancing PGR transcriptional activity through H3K4me3 modification.","manuscriptTitle":"HBP1 facilitates PGR transcriptional activity and IGFBP1 expression conducive to human endometrial decidualization","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-17 09:42:09","doi":"10.21203/rs.3.rs-6254635/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4100aef4-fb89-4617-8233-d99064823597","owner":[],"postedDate":"April 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46274624,"name":"Biological sciences/Genetics/Epigenetics"},{"id":46274625,"name":"Health sciences/Endocrinology/Endocrine system and metabolic diseases/Endocrine reproductive disorders"},{"id":46274626,"name":"Biological sciences/Genetics/Gene regulation"}],"tags":[],"updatedAt":"2026-02-20T08:13:02+00:00","versionOfRecord":{"articleIdentity":"rs-6254635","link":"https://doi.org/10.1038/s42003-026-09567-1","journal":{"identity":"communications-biology","isVorOnly":false,"title":"Communications Biology"},"publishedOn":"2026-01-18 05:00:00","publishedOnDateReadable":"January 18th, 2026"},"versionCreatedAt":"2025-04-17 09:42:09","video":"","vorDoi":"10.1038/s42003-026-09567-1","vorDoiUrl":"https://doi.org/10.1038/s42003-026-09567-1","workflowStages":[]},"version":"v1","identity":"rs-6254635","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6254635","identity":"rs-6254635","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0