DNMT aberration-incurred GPX4 suppression prompts osteoblast ferroptosis and osteoporosis

DNMT aberration-incurred GPX4 suppression prompts osteoblast ferroptosis and osteoporosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article DNMT aberration-incurred GPX4 suppression prompts osteoblast ferroptosis and osteoporosis Yongxiang Wang, Hongwei Wang, Wangsen Cao, bin-jia ruan, Jian Dong, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4301039/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Dec, 2024 Read the published version in Bone Research → Version 1 posted 9 You are reading this latest preprint version Abstract Osteoporosis (OP) is a common and fracture-prone skeletal disease featured by deteriorated trabecular microstructure and pathologically involves various forms of regulated bone cell death. However, the role and regulatory mechanisms of ferroptosis in OP are not fully understood. Our study showed marked iron deposition, ferroptosis, and a core anti-ferroptotic factor GPX4 (glutathione peroxidase 4) suppression in OP femurs of ovariectomized (Ovx) mice, coinciding with Gpx4 promoter hypermethylation and elevated DNMT1/3a/3b levels. In addition, KLF5, along with the transcriptional corepressors NCoR and SnoN, induces binding to the hypermethylated GPX4 promoter in osteoporotic femurs sensitive to DNMT inhibition. Conversely, DNMT inhibition with SGI-1027 reversed hypermethylation and GPX4 suppression, reducing the ferroptotic and osteoporotic damage. In cultured primary bone cells, ferric ammonium citrate (FAC) mimicking iron loading similarly induced GPX4 suppression and ferroptosis in osteoblasts, but not in osteoclasts, which were rescued by siRNA-mediated individual knockdown of DNMT 1/3a/3b respectively. Intriguingly, SGI-1027 relieved the ferroptotic alterations induced by FAC, but not by a GPX4 inactivator RSL3. More importantly, we generated a strain of osteoblast-specific Gpx4 haplo-deficient mice (Gpx4+/-) that developed spontaneous ferroptotic OP alterations and further demonstrated that GPX4 inactivation by RSL3 or osteoblastic GPX4 haplo-deficiency largely abrogated the anti-ferroptotic and osteoprotective effects of SGI-1027. Together, our data suggest that the DNMT aberration-incurred epigenetic GPX4 suppression and the resultant osteoblastic ferroptosis contribute significantly to OP pathogenesis and the strategies preserving GPX4 by DNMT intervention is potentially effective to treat OP and the related bone disorders. Biological sciences/Physiology/Bone Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic bone disease/Osteoporosis Health sciences/Pathogenesis DNA methylation Epigenetics Ferroptosis GPX4 Osteoporosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 INTRODUCTION Osteoporosis (OP) is a common and silent skeletal disease with a high risk of fragility fracture that affects approximately 18.3% of populations globally, especially in postmenopausal women ( 11.6 % of men and 23.1% of women) 1 , 2 . OP pathogenesis is characterized by reduced bone mass and deteriorated trabecular microstructure attributed directly to imbalanced osteoclastogenesis and osteoblastogenesis 3 . Under normal condition, bone undergoes constant turnover mainly controlled by osteoblasts and osteoclasts of opposite functions. Osteoclasts secret hydrochloric acid and proteolytic enzymes that dissolve organic collagen, inorganic calcium and phosphoruse, resulting in bone resorption 4 , 5 . In contrast, osteoblasts produce various growth factors, hormones and collagens to ensure proper bone biosynthesis 6 , 7 . OP occurs as a result of increased osteoclastogenesis or decreased osteoblastogenesis, or both 8 , 9 . Although past researches have established that various forms of regulated cell death, such as apoptosis 10 , autophagic cell death 11 , pyroptosis 12 , necroptosis 13 .and ferroptosis 14 , 15 contribute to OP pathogenesis, the precise role, cell nature and the regulatory mechanisms of ferroptosis are only partially understood. Ferroptosis is a unique form of regulated cell death featured by iron-dependent lipid peroxide accumulation and actively involved in various pathological conditions, including cancers, neurodegenerative disorders, cardiovascular and bone diseases 16-18 . Ferroptosis is not prevented by inhibitors of necroptosis, pyroptosis or apoptosis, but inhibited by iron chelators and small lipophilic antioxidants such as ferrostatin 19 and liproxstatin 20 and directly regulated by endogenous glutathione GSH/GPX4 (glutathione peroxidase 4), the core anti-ferroptosis signaling pathway 21 . GSH tripeptide composed of glutamic acid, cysteine and glycine acts as a scavenger of free radicals and cofactor of GPX4. Insufficient GSH generation reduces the synthesis of GPX4 that is capable of converting the deleterious phospholipid hydroperoxides to the corresponding benign phospholipid alcohols and blocking ferroptosis 22 . GPX4 repression due to its reduced synthesis, enzymatic inactivation or protein degradation is a hallmark of ferroptosis 23 . However, GPX4 transcriptional regulation by epigenetic or non-epigenetic regulations might also affect its abundances. GPX4 promoter contains a dense CpG island, a structural feature of DNA methylation modification. GPX4 suppression due to DNA methylation affects its transcription under various ferroptotic conditions 24 , 25 , suggesting that GPX4 expression is likely subjected to epigenetic DNA methylation controls in OP, which represents a fundamental novel mechanism of OP pathogenesis. DNA methylation on cytosine of CpG dinucleotide (5-methylcytosine, 5mC) is one of the core epigenetic machineries that potentially regulate the transcription of more than 60% of genes 26 , 27 . DNA methylation is catalyzed by maintaining DNA methyltransferases DNMT1 and de novo DNMT3a and DNMT3b, while the demethylation is processed by three ten-eleven translocation enzymes TET1, TET2 and TET3 28 . DNA methylation can occur on any CpG site along the genome, however its preferential modifications of CpG islands in gene promoters/enhancers attract DNA methylation readers, transcriptional repressors/cofactors and histone deacetylases to form a transcriptional repressive complex, resulting in silencing of the downstream gene transcription 28 . DNA methylation-mediated suppressions of tumor suppressors, anti-aging and cellular protective proteins are common epigenetic features of tumorgenesis, aging and various degenerative and chronic diseases. Recent DNA methylation profiling investigations of OP bone tissues from animal models and OP patients detect a large number of genomic loci/genes that are modified by DNA methylations 29-31 . More pertinently, DNA methylation-incurred suppression of ferroptosis-associated genes GPX4 and CDH1 increases the ferrotosis sensitivity 24 , 32 , strongly suggesting that epigenetic GPX4 suppression due to DNA methylation aberration might mechanistically affect OP. In this study, we aimed to investigate the role, nature and regulatory network of ferroptosis in a mouse OP model of ovariectomy (Ovx). We discovered that GPX4 suppression and ferroptotic alterations in both Ovx mouse femurs and ferroptotic osteoblasts occurred substantially at mRNA levels that correlated with aberrant elevations of bioactive DNMT1/3a/3b. We then employed both pharmacological and genetic approaches to determine the critical role of the GPX4 suppression and ferroptosis in OP. Our study might provide molecular insights into the epigenetic mechanisms of ferroptosis in the OP pathologies with clinical prophylactic and therapeutic implications. RESULTS 1 ． Mouse osteoporotic femurs induced by ovariectomy displays marked ferroptosis and GPX4 suppression To gain insight into the possible epigenetic GPX4 suppression and ferroptosis in OP, we employed a well-established mouse OP model of ovariectomy 33 . As anticipated, mice receiving Ovx surgery for 6 weeks demonstrated thinned trabeculae with lost continuity and enlarged areolae in distal femurs as stained by H&E (Fig.1a). Microcomputed tomography (μCT) scanning revealed that the OP femurs had reduced trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), trabecular thickness (Tb,Th) and increased trabecular bone separation (Tb.Sp) (Fig.1a and b). Perls’ Prussian blue staining recognizing the hemosiderin-associated Fe 3+ showed an increase of iron deposition (Fig.1c), and TUNEL assay, a sensitive way to catch both apoptotic and ferroptotic cells 20 , detected an increased numbers of positively-stained cells (Fig.1c). We further performed western blotting assays and detected reduced osteoblast marker type 1 collagen and enhanced osteoclast marker NFATc1 (Nuclear Factor Of Activated T Cells 1), the typical osteoporotic signs of reduced osteoblastogenesis and enhanced osteoclatsogenesis. Notably, GPX4, a core anti-ferroptosis enzyme, was repressed with concomitant elevation of a lipid peroxidation marker 4-hydroxynonenal (4-HNE), while the expression of another anti-ferroptosis protein FSP-1 (ferroptosis suppressor protein 1) whose reduced form ubiquinol supposedly traps lipid peroxyl radicals independent of GSH/GPX4 signaling 34 was not affected (Fig. 1d). We also analyzed a RNA-seq data from CNCB(China National Center for Bioinformation) database 35 which confirmed Gpx4 down-regulation in tibia of Ovx mice ((Log2 (FC)=-2.49906, Fig.1e). We further performed immunohistochemistry (IHC) staining of femur sections and found that GPX4 was broadly expressed in almost all visible cells around femoral trabecular, where both osteoblasts and osteoclasts resided, but drastically decreased in Ovx mice (Fig. 1f). Finally, we confirmed by electron microscopy that the mouse OP femurs displayed distinct mitochondrial characters of ferroptotic alterations, such as smaller mitochondria and diminished mitochondrial crista (Fig.1g). These results indicate that OP pathogenesis is associated with marked GPX4 suppression and ferroptosis. 2. The GPX4 suppression was mainly due to aberrant elevations of all three bioactive DNMT isoforms To explore the potential role of DNA methylation that might account for the GPX4 suppression, we analyzed the human and mouse GPX4 / Gpx4 promoters online (http://www.urogene.org/methprimer), and found that both contained conserved CpG islands at -253/47 (human, relative to the transcriptional starting site) and -210/170 loci (mouse) as depicted in Fig.2a, suggesting that GPX4 is sensitive to DNA methylation modification. We then assayed the expression of all three bioactive DNA methyltransferases DNMT1, DNMT3a and DNMT3b by western blotting and found that all three isoforms were relatively low in control femurs, but significantly upregulated in femurs of Ovx mice and OP patients (Fig.2b). We further confirmed by RT-PCR that the femoral Gpx4 / GPX4 mRNA was substantially reduced in Ovx mice and patients with OP (Fig.2c). Since DNMTs negatively affect gene transcription via increasing the gene promoter methylation, We subsequently examined the femoral DNA methylation status of the promoters by MSP. The results showed that the OP bone tissues from both OP patients and Ovx mice exhibited Gpx4 / GPX4 promoter hypermethylation comparing to the controls (77.45 ± 4.32 % of Ovx vs 20.15 ± 2.74 % of Sham and 72.53 ± 2.81 % of OP vs 21.89 ± 2.63 % of Normal, respectively, P < 0.05, Fig. 3d). However, administration of a DNMT inhibitor SGI-1027 to Ovx mice significantly reduced the methylation levels (43.07 ± 3.44 % of SGI/Ovx vs 73.03 ± 2.99 % of Ovx, P < 0.05, Fig. 3e). To confirm the results, we performed BSP, the gold standard of DNA methylation measurement that detects individual CpG site. The results showed that Ovx caused an increase of Gpx4 promoter methylation from 3.19 ± 1.57 % to 31.23 ± 1.26 %, but SGI-1027 treatment lowered the level to 14.74 ± 1.05 %, P < 0.05 (Fig. 3f). These results indicate that the GPX4 suppression was mainly caused by DNMT aberrations-incurred promoter hypermethylation. 3. KLF5 is a potential co-regulator of the Gpx4 transcriptional inhibition To understand the regulatory mechanisms of the DNMT-incurred Gpx4 transcriptional inhibition, we analyzed the mouse Gpx4 promoter by AnimalTFBD (http://bioinfo.life.hust.edu.cn/AnimalTFDB#!) that predicts the potential binding sites for both transcriptional and co-transcriptional regulators. The results showed that mouse Gpx4 proximate promoter contained a numerous potential binding motifs for various transcriptional factors, including Sp1, C/EBPβ and NF-1C, and transcriptional co-repressors known to participate in epigenetic gene transcriptional inhibition. Among them a Kruppel- like factor 5 (KLF5) motif was close to the transcriptional stating site with a very high binding score (-43/gccccgccca, score 19.303, Fig.3a). KLF5 plays critical roles in various cancers 36 and is capable of either positively or negatively regulate the downstream gene transcription 37 , 38 . However its regulations of ferroptosis or bone metabolisms are largely unknown. We found that the expressions of KLF5, but not KLF2 of similar binding specificity, as well as transcriptional co-repressor NCoR, SMRT and SnoN, were upregulated in Ovx femurs (Fig.3b). Subsequently, we performed chromatin immunoprecipitation assay (ChIP) and found that KLF5 together with NCoR and SnoN, but not SMRT, inducibly bound to the KLF5 motif region of the Gpx4 promoter in Ovx femurs, but SGI-1027 treatment significantly reduced the bindings (Fig.3c and d). Further, primary osteoblasts treated with ferric ammonium citrate (FAC) known to mimic iron overloading and induce ferroptosis 39 also exhibited KLF5 upregulation, GPX4 suppression and 4-HNE induction. A KLF5-selective inhibitor ML264, however, significantly reduced the alterations (Fig.3e and f). In addition, we also constructed a Gpx4 promoter/luciferase reporter plasmid (Fig.3a) and found that the reporter transfected into osteoblastics displayed reduced luciferase activity upon FAC treatment, which was relieved partially by SGI-1027, coincidentally a KLF5-selective inhibitor ML264 partially blocked the reduction (Fig. 3g). Taken together, these results suggest that the DNMT-incurred Gpx4 transcriptional inhibition is at least partially mediated by KLF5 with NCoR and SnoN participations. 4. DNMT inhibition by SGI-1027 derepresses GPX4 and protects Ovx mice from ferroptotic osteoporosis To gain further insight into the functional relevance of the GPX4 suppressionand ferroptosis in OP pathogenesis, we treated the control and Ovx mice with or without SGI-1027 (6 weeks, 6 animals in each group), and found that Ovx-incurred osteoporotic alterations of trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), thickness (Tb,Th) and bone separation (Tb.Sp), as well as the TUNEL assays, were effectively corrected by SGI-1027 (Fig. 4a and b). Consistently, SGI-1027 also significantly reduced the Ovx-induced adverse expressions of GPX4 and the lipid peroxidation marker MDA (malondialdehyde), the osteoblast marker collagen 1 (Col1) and osteopontin (OPN) and the osteoclast marker NFATc1 and ACP5 (acid phosphatase 5, Fig. 4c and d). In addition, ferropstatin-1 (Fer-1), a lipophilic antioxidant that specifically inhibits ferroptosis by preventing lipid peroxidation without affecting other forms of regulated cell death 19 , also achieved similar, although less effective, anti-ferroptotic and osteoprotective effects (Fig. 4a-d). Together, these results indicate that the DNMT aberration and the GPX4 suppression-associated ferroptosis are central to the pathologies of OP. 5. The GPX4 suppression and ferroptosis ocurr mainly in osteoblasts To explore the cell nature of the GPX4 suppression and ferroptosis, we performed immunofluorescent double-staining of femurs with GPX4 plus osteoblast marker OCN (osteocalcin) or osteoclast marker CTSK, respectively. The results showed that GPX4 was co-expressed with OCN in osteoblasts, and both reduced in Ovx femurs (Fig. 5a, the left panel). In contrast, CTSK was barely detectable with discernable GPX4 co-expression in normal femurs but increased in Ovx femurs, in which GPX4 expression remained relatively high (Fig. 5a, the right panel), suggesting that GPX4 suppression mainly occurred in osteoblasts. We further isolated and cultured primary osteoblasts and osteoclasts (differentiated from bone marrow monocytes/macrophages induced by RANKL) and treated both cells with FAC, which induced the alkaline phosphatase activities in osteobalsts and increased TRAP activities in osteoclasts (Fig.5b). We found that FAC induced GPX4 suppression, 4-HNE induction and OPN reduction accompanied by the increases of all three DNMT isoforms in osteoblasts, but only DNMT1 elevation and NFATc1 induction in osteoclasts (Fig.5c and d). We also transfected the osteoblasts with individual siRNAs specifically knocking down DNMT1, DNMT3a and DNMT3b, respectively (Fig. 5e) and found that knockdown of DNMT1, DNMT3a and DNMT3b each reversed the FAC-induced GPX4 suppression (Fig.5f), suggesting all three DNMT isoforms contribute to the ferroptotic GPX4 suppression in osteoblasts. 6. The GPX4 inactivation by RSL3 blunts the anti-ferroptosis effects of DNMT inhibition To determine the critical role of GPX4 preservation by SGI-1027 in osteoblastic ferroptosis, we treated osteoblasts with FAC or RSL3 (RAS-selective lethal 3), a small molecule that induces ferroptosis via inactivating and degrading GPX4 20 , and observed drastic GPX4 suppression and 4-HNE induction (Fig.6a). However, SGI-1027 significantly corrected the abnormal GPX4 and 4-HNE alterations induced by FAC, but not by RSL3 (Fig.6a and 6b). To confirm the osteoblast ferroptosis, we performed TUNEL assay and found that FAC and RSL3 induced significant increase of TUNEL-positive osteoblasts, but not osteoclasts, and SGI-1027 treatment reduced the positive cell numbers of osteoblasts induced by FAC, but not that by RSL3 (Fig.6c, the upper two panels, and 6d). We further assessed the lipid peroxidation status of osteoblasts with C11-BODIPY, a fluorescent radio-probe that monitors lipid peroxidation in live cells 40 . The results showed that the resting osteoblasts displayed prominent non-oxidized BODIPY (N-BOD), but barely detectable oxidized BODIPY (O-BOD). FAC or RSL3 treatment caused an inversion of the O-BODIPY/N-BODIPY distributions; however, SGI-1027 effectively corrected the inversion conferred by FAC, but not that by RSL3 (Fig.6c, the middle three panels). Furthermore, we examined the osteoblasts by EM and found that FAC and RSL3 induced the typical ferroptotic alterations, such as smaller mitochondria and demolished crista; however, SGI-1027 lightened the alterations induced by FAC, but not by RSL3 (Fig.6c, the bottom panel). Collectively, these results suggest that osteoblasts, but not osteoclasts, undergo ferroptosis under OP condition that are regulated by DNMT1/3a/3b aberration and the GPX4 suppression. 7 . Osteoblast Gpx4 deficiency potentiates ferroptotic osteoporosis To directly test the role of osteoblast Gpx4 suppression in the ferroptotic osteoporosis, we generated a strain of osteoblast-specific Gpx4 knockout mice by crossing Gpx4 fl/fl mice with collagen 1 promoter-driven Cre mice ( Col1a1 -Cre), in which the exons 2-4 of Gpx4 gene were deleted in osteoblasts (Fig.7a). Previous study indicated that globe Gpx4 gene knockout was embryonically lethal 41 . We found that the offsprings (more than 70 tested) were either wild type or heterozygous Gpx4 +/- mice, but none was homozygous Gpx4 -/- by genotyping (Fig.7b), indicating that osteoblast-specific Gpx4 depletion is also lethal. These Gpx4 +/- mice at 8 weeks appeared smaller, displayed lighter weights, shorter femurs (Fig.7c), reduced femoral GPX4 and adverse expressions of osteoblastic markers OPN and collagen1, but not osteoclast markers NFATc1 and ACP5 comparing to Gpx4 fl/fl controls (Fig.7d). IHC staining of osteoblast marker OCN and TRAP staining confirmed the reduced OCN intensities and unchanged the numbers of TRAP-positive cells, respectively (Fig.7e). In addition, these mice displayed altered osteoporotic parameters of BV/TV, Tb.N, Tb,Th and Tb.Sp (Fig.7e and f) and increased TUNEL-positive cells (Fig.6e, the lower panel), supporting that GPX4 deficiency potentiates osteoblastic ferroptosis and OP pathologies. 8. GPX4 derepression is essential for the anti-ferroptotic and anti-osteoporotic effects of SGI-1027 DNMT aberrations and the SGI-1027 intervention might affect the transcription of numerous genes. We assumed that if the GPX4 derepression by SGI-1027 was critical for its anti-ferroptotic and anti-osteoporotic effects, blocking the GPX4 reactivation would eliminate the protective effects. To test the idea, we compared the anti-ferroptotic and anti-osteoporotic effects of SGI-1017 between Gpx4 fl/fl and Gpx4 +/- mice as well as RSL3-treated Gpx4 fl/fl mice. Both Gpx4 +/- mice and RSL3-treated Gpx4 fl/fl mice displayed the adverse femoral osteoporotic alterations of trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), trabecular thickness (Tb,Th) and trabecular bone separation (Tb.Sp), as well as increased TUNEL positive cell ratio under basal and Ovx-conditions (Fig.8a and b). SGI-1027 treatment significantly improved the bone microstructural and TUNE staining abnormalities in Gpx4 fl/fl mice; however the protective effects were largely abrogated in Gpx4 +/- and RSL3- Gpx4 fl/fl mice (Fig.8a and b). Similarly, SGI-1027 significantly reduced the abnormal protein levels of GPX4, MDA, collagen I, OPN, NFATc1 and ACP5 in Gpx4 fl/fl mice, but the beneficial effects were largely diminished in in Gpx4 +/- and RSL3- Gpx4 fl/fl mice (Fig.8c and d). Together, these results indicate that the GPX4 preservation is essential for the anti-ferroptotic and osteoprotective effects of SGI-1027. DISCUSSION Study of epigenetic ferroptosis in OP represents a novel approach to better understand the OP pathogenesis and potentially leads to novel therapeutic strategies. In this study, we have discovered that (1) GPX4, a key anti-ferroptotic factor, was transcriptionally suppressed in Ovx mouse femurs due to DNMT1/3a/3b elevations and subsequent GPX4 promoter hypermethylation; (2) The GPX4 suppression was co-regulated by repressive KLF5 and likely by transcriptional co-repressor NCoR and SnoN; (3) A DNMT inhibitor SGI-1027 effectively reduced the GPX4 suppression and mitigated the ferroptotic bone loss in Ovx mice; (4) The GPX4 suppression and ferroptosis occurred mainly in osteoblasts and osteoblast-specific GPX4 semi-knockout ( Gpx4 -/+ ) incurred spontaneous and exacerbated ferroptotic OP alterations in Ovx mice, and finally (5) GPX4 pharmacoligical inactivation or semi-knockout in osteoblasts significantly diminished the protective effect of SGI-1027 against DNMT-mediated ferroptotic bone loss. Thus, our data indicate that the DNMT1/3a/3b aberration-incurred GPX4 suppression and the consequential osteoblastic ferroptosis causally impact the development of OP, which can be effectively targeted by DNA demethylating agents for therapeutic benefits. Identification of DNMT1/3a/3b as the critical initiators of GPX4 suppression and ferroptosis critical for OP is an important discovery of study. It is well known that both ferroptosis and OP are affected by epigenetic DNA methylation aberration 29 , 42 , however the mechanistic linker of these two events has been missing. Recent studies suggest that GPX4 suppression due to aberrant DNA methylation might be a decisive event of ferroptosis under ferroptotic conditions 24 , 25 . The actual methylation status of a particular gene promoter is regulated by a number of regulators, including methyl donors, DNA insulators, DNA methylation “writer” NDMTs, “reader” methyl-CpG-binding domain (MBD) proteins and DNA demethylating TET enzymes 43-45 , and the initiative “drivers” of the DNA methylation alterations in OP are unclear. Previous studies from our and other labs have reported that aberrant DNMT elevations causally affected OP 46-49 . In this study, we detected that the GPX4 suppression occurred substantially at transcriptional level that correlated with increased expression of all three bioactive DNMT isoforms and GPX4 promoter hypermethylations in the distal femurs of both OP patients and Ovx mice. We further demonstrated that individual knockdown of DNMT1/3a/3b significantly reduced the GPX4 suppression and lipid peroxidation in osteoblasts, and a pan-DNMT inhibitor SGI-1027 effectively corrected the GPX4 promoter hypermethylation, GPX4 suppression and the ferroptotic OP alterations in Ovx mice, which were abrogated when GPX4 was genetically-deficient or pharmacologically-inactivated (Fig.8). These are strong evidence that DNMT1/3a/3b aberration-driven GPX4 suppression and ferroptosis contribute substantially to OP pathologies. Osteo-ferroptosis has been reported in OP animals of various etiologies, including estrogen deficiency such as postmenopausal OP modeled by Ovx mice, glucocorticoid and diabetic OP, which affects bone marrow mesenchymal stem cells 50 , osteocytes 51 osteoblasts 52 and osteoclasts 53 . However the cell nature of ferroptosis involved in estrogen-deficient OP has been controversial. In this study, we showed that GPX4 suppression and ferroptotic alterations mainly occurred in osteoblasts as demonstrated by immunofluorescent double-staining of femoral sections and in primarily-cultured osteoblasts, which also displayed typical ferroptotic alterations such as GPX4 suppression, abnormal lipid peroxidation and mitochondrial morphological changes that were absent from osteoclasts. This is further confirmed by osteoblast-specific Gpx4 deficient mice that developed spontaneous and worse ferroptotic OP alterations in Ovx mice. These are consistent with the consensus that the reduced osteoblastic cell numbers and activities break the balanced of osteoblastogenesis and osteoclastogenesis, leading to OP. Revealing of KLF5 as a transcriptional co-regulator critically involved in DNA methylation-associated Gpx4 suppression has provided meaningful information regarding the DNA methuylation-incurred transcriptional silencing of the downstream genes. DNA methylation-incurred gene transcriptional inhibition is mediated by a transcriptional repressive complex containing multiple transcriptional repressors and co-regulators that might confer the gene specificity 28 . KLF5 is well documented for its regulation of multiple cellular processes, including the cell cycle and proliferation, apoptosis and autophagy, migration and invasion, and stemness and differentiation 36 , via either positively or negatively regulating the transcription of target genes 54 , 55 . We found that Gpx4 promoter contains a strong KLF5 motif and KLF5 together with transcriptional co-repressor NCoR and SnoN inducibly bound to the hypermethylated Gpx4 promoter in OP femurs that is sensitive to DNMT inhibition (Fig.3). We further showed that KLF5 inhibition by ML264 partially relieved the GPX4 suppression in osteoblasts. These data support that KLF5, NCoR and SnoN might be the core components of the transcriptional repressive complex that mediates the DNA methylation-incurred Gpx4 transcriptional suppression in OP. It is noteworthy that our study has revealed an important feature of epigenetic osteoblast ferroptosis in OP pathogenesis, but some important questions remain to be answered. For example, GPX4 suppression is affected by many known and unkonwn ferroptotic stimulations and it is unclear which upstream network actually induced the DNMT aberration. It is also unclear how epigenetic DNMT alterations differentially affect ferroptosis of osteoblasts versus osteocytes and osteoclasts under OP conditions and whether the DNMT aberration-incurred ferroptosis is unique to Ovx mice or a general OP character of all etiologies, which warrant further investigation. In conclusion, the results from our study demonstrate that aberrant DNMT1/3a/3b elevations and subsequent GPX4 suppression play a decisive role in osteoblastic ferroptosis that contributes significantly to OP. Since epigenetic modifications are reversible and DNA demethylating drugs such as 5-azacytidine and 5-aza-2-deoxycytidine (decitabine) have been approved for clinical treatment of myelodysplastic syndromes and chronic myelomonocytic leukemia 56 , our results also suggest that targeting epigenetic GPX4 suppression and ferroptosis by DNMT intervention might be a feasible and effective strategy to treat patients with OP and the related bone disorders. Materials and Methods Animal and treatment The use of animals and the experimental protocols were approved by the Animal Care Committee of Nanjing University in accordance with the Institutional Animal Care and Use guidelines (2020AE01113). C57BL/6J mice were from Gempharmatech Co., Ltd., Nanjing, China. We intended to generate osteoblastic Gpx4 knockout mice by crossing Gpx4 -flox mice ( Gpx4 fl/fl , Strain NO. T050827) and Col1a1 -Cre mice (Strain NO. T004734, both were of C57BL/6J background, GemPharmatech, Nanjing, China), but only obtained Gpx4 haplo-deficient ( Gpx4 -/+ ) progenies. The PCR genotyping was performed on mouse toe DNAs with primers F1: GTACTGCAACAGCTCCGAGTTC; R1: ACTTATCCAGGCAGACCATGTG; R2: AACTCCAATTCCCAGGACTCAC as depicted in figure 7A. All mice were housed under specific pathogen-free and standard 25 ± 2 °C, 50 ± 5% humidity and a 12 h/12 h light/dark cycle conditions. A mouse OP model was established with a bilateral ovariectomy protocol 33 . Briefly, the experimental mice were anesthetized with isoflurane and the bilateral ovaries of Ovx mice were removed through a midline incision of the skin and flank incisions of the peritoneum. The skin incision was then closed with metallic clips. Sham operation was processed similarly without ovary removal. For intervention study, female C57BL/6J mice of around 10-12 weeks old were divided into four groups: (1) Sham surgery group; (2) SGI-1027 (2.5 mg/kg, HY-13962) or Ferrostatin-1 (Fer-1, 5 mg/kg, HY-100579) from MCE, USA, dissolved in 2% DMSO, 30% PEG 300 and 2% Tween 80 administered by daily intraperitoneal injection; (3) The Ovx group; (4) SGI-1027/Fer-1 intervention group. For assay to determine the role of GPX4 in SGI-1027 intervention, C57BL/6J mice treated with or without RSL3 (100 mg/kg, HY-100218A, MCE, USA), or Gpx4 -/+ mice and the control Gpx4 fl/fl were subjected to sham, Ovx and SGI-1027 intervention described above. The experiments went for six weeks, and then mice were sacrificed by excessive isoflurane and the mouse femurs were collected and stored at -80 o C or treated with paraformaldehyde for further analysis. Human samples Human samples were collected from the Northern Jiangsu People's Hospital, the Teaching Hospital of Nanjing University Medical School. OP is defined as a T score of ≤−2.5, and a T score of ≥−1 is considered normal bone density according to the National Osteoporosis Foundation. Osteoporotic lumbar were obtained from 6 female patients with lumbar fracture who received percutaneous vertebroplasty (62–82 years old) with an average bone densitometry T score of −3.9 (−3.6, −4.8, −4.4, −4.5, −3.8 and −2.8). The control non-OP lumbar were from six age-matched patients receiving internal fixation treatment (58–79 years old) with an average T score of −0.5 (−0.3, −0.6, −0.2, −0.6, -0.3 and −0.9). The T scores were determined by dual energy X-ray absorptiometry. The samples were stored at −80 °C before further protein, histology and MSP analyses. The study was approved by the ethics committee of the Northern Jiangsu People's Hospital (2023ky232), and written informed consent was received from all subjects. Patients or members of the public are not involved in the design, conduct, reporting, or dissemination plans of the research. Bone micro-CT analysis Trabecular microstructure analysis was performed as described previously 57 with freshly-removed mouse right femurs fixed in 4% paraformaldehyde for 24 h. The micro-CT scanner (Scanco Medical, Bruettisellen, Switzerland) was set at 55 kV, 145 μA and 15.6 μm voxel with 250 ms integration time. Femoral mid-diaphysis above the growth plate and distal metaphysis were selected as the region of interest (ROI). For each sample, a total of 100 slices were evaluated to generate the three dimensional (3D) trabecular images, and ratio of the sectional trabecular volume to total bone tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp) were calculated. Histological, immunohistochemical (IHC), Perl's Prussian blue, TUNEL and immunofluorescent staining The mouse femural sections were processed with hematoxylin and eosin (H&E), Perl's Prussian blue or IHC staining essentially as described before 58 . For IHC staining, the sectioned slides were incubated overnight at 4 °C with primary antibodies against GPX4 (A11243, Abclonal, China), osteocalcin (OCN, 23418-1-AP, proteintech, China), and then with HRP-conjugated secondary antibodies. Afterward, the slides were processed with a DAB horseradish peroxidase color development kit (PR30010, proteintech, china) and counterstained with hematin, the IHC Profiler plug-in in Image J was used to automatically score the staining status of samples (High positive (3), Positive (2), Low Positive (1) and Negative (0)). Perl's Prussian blue staining (G1029, Servicebio, china) and TUNEL (TdT-mediated dUTP Nick-End Labeling, A111-01, Vazyme, China) followed the instructions in the kit. The percentages of TUNEL-positively-stained cells over total cells from 10 randomly-selected fields were counted in a double-blinded manner. Immunofluorescent double-staining of murine femural sections were performed essentially as before 59 . The sections were first incubated overnight with primary antibody mouse anti-GPX4 (67763-1-Ig, proteintech, China) plus rabbit anti-OCN or rabbit anti-CTSK (11239-1-AP, proteintech, China), respectively. Next day, the sections were incubated with secondary antibody CoraLite488-conjugated Goat Anti-Rabbit IgG (SA00013-2, Proteintech, China) and CoraLite594-conjugated goat anti-mouse IgG (SA00013-3, Proteintech, China) followed by nuclear DAPI (C1005, Beyotime, China) staining. A laser confocal microscope (Olympus, Tokyo, Japan) was used for image capturing. RNA sequencing data analysis We downloaded the transcriptome data of bone tissue from Sham and Ovx mice (https://ngdc.cncb.ac.cn/gsa/browse/CRA007214). The reads from mice data were aligned against mm10 genome assembly with hisat 2.1.0. SAM files were sorted and converted to BAM with samtools v1.4. Reads with QS < 20 were excluded. For each sample, unique map reads with map quality score ≥20 were reserved for subsequent analyses. HT Seq Python package (version 0.9.1) was used to count the number of reads of a unique map for each gene. The DESeq2 R package was used to perform differential expression analysis. Differentially expressed genes (DEGs) were assessed by |log2FC|≥1 and P value < 0.05. Transmission Electron microscopy (TEM) examination Fresh murine femurs were placed in a fixative containing 2% PFA and 2.5% glutaraldehyde (G5882, Sigma-Aldrich, USA), rinsed sequentially according to a conventional TEM sample preparation protocol, and fixed again in 1% osmium tetroxide. After dehydration and embedding in Epon812 (45345, Sigma-Aldrich,USA), the ultrathin sections were stained with lead citrate and uranyl acetate and observed under JEOL-1200EX microscope (Japan) at Shandong Weiya Laboratory, China. Primary Cell culture Primary osteoblasts were extracted as previously described 60 from 3-day-young mice. Briefly, calvarial bones were dissected and digested with 0.1% collagenase type I (SCR103, Sigma, USA) for three rounds after periosteum removal, and the final cell pellets were collected and cultured in fresh α-MEM media (SH30265.01B, HyClone, USA) containing 10% FBS(FSD500, ExCell, China) and 1% penicillin/ streptomycin(15140122, Gibco, USA). For osteoblast differentiation, the cells were changed the medium to osteogenic medium (PD-003; Procell, Wuhan, China)which contain 50 μg/mL ascorbic acid, 5 mM β-glycerophosphate, and 10 nM dexamethasone. For primary osteoclast culture, bone marrow monocytes (BMMs) were isolated from 3-week-old mice by flushing the bone marrow of long bones and cultured in complete α-MEM medium containing 10% FBS and M-CSF (Macrophage colony-stimulating factor, 30 ng/mL, CB34, Novoprotein, China) as before 61 . Three days later, RANKL (Receptor activator for nuclear factor-κB ligand, 50 ng/mL, CR06, Novoprotein, China) was added to induce osteoclast differentiation. ALP or TRAP activity staining For osteoblast ALP activity assay, FAC was added for 48 hours, washed with phosphate-buffered saline (PBS) and then fixed with 4% formaldehyde for 15 min. After rinsing with PBS again, cells were stained for ALP activity with the BCIP/NBT ALP color development kit (Beyotime, Nanjing, China). Image J software was used to evaluate the positively stained areas over the total areas from 5 predetermined fixed locations. For osteoclast TRAP activity assay, the differentiated primary osteoclast treated with FAC for 48 h or mouse femoral sections were fixed with 4% paraformaldehyde and stained for TRAP activities with a commercial kit (Sigma, 387A-1 KT, USA) according to the manufacturer's instructions. For primary osteoclast staining, the positively stained cell areas over the whole fields from 5 pre-set fixed locations were quantified using Image J software. For mouse femural staining, the sections were counterstained with methyl green and the average numbers of TRAP-positively stained cells in 10 randomly selected fields were calculated in a double-blind manner. C11-BODIPY staining A fluorescent radioprobe C11-BODIPY(581/591, D3861, Thermo Fisher, USA) was used to assess lipid peroxidation in osteoblasts. Briefly, the primary osteoblasts inoculated in 6-well plates under various treatments were treated with C11-BODIPY dye (10 μM dissolved in DMSO) for 1 hour at 37 o C in dark. After excess C11-BODIPY were removed by washing, the cells were observed under a confocal fluorescence microscope with excitation/emission wavelengths of 488/510 nm for oxidized BODIPY (green) and 581/591 nm for non-oxidized BODIPY (red). The average fluorescence intensities were based on six randomly-selected view fields, adjusted for the number of cells of view and.calculated using ImageJ software. Western blotting Western blot assays of mouse hind limb bones or cell homogenates were performed essentially as before 62 . The primary antibodies used were: NFATc1(AF06823) and DNMT3b (AF300068) from AiFangbiological, China; Col1 (Collagen I, GB114197) and OPN (Osteopontin, GB112328) from Servicebio, China; GPX4 (A1933), MeCP2 (A0707) and β-actin (AC026) from ABclonal, China; 4-HNE (4 Hydroxynonenal, ab46545, Abcam, Cambridge, UK); MDA (Malondialdehyde, abx445120, Abbexa, Cambridge, UK); CTSK (DF6614), KLF5 (AF7542), KFL2 (DF13602), NCoR (AF0270) SMRT (DF8896), SnoN (DF3088) from Affinity Biosciences, China. The horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from proteintech, China. Western blots were visualized with fully automated chemiluminescence image analysis system (5200, Tanon, China) and the protein quantities were analyzed by Image J software. Methylated specific PCR (MSP) and bisulfite-sequencing PCR (BSP) Prediction of CpG islands in Gpx4 promoters and primer design for methylation-specific PCR (MSP) and bisulfite-sequencing PCR (BSP) were performed with online software MethPrimer (www.urogene.org/methprimer). DNeasy Blood & Tissue Kit (69504, QIAGEN, Germany) was used to isolated total DNA, and DNA Bisulfite Conversion Kit (DP215, TIANGEN Biotech, China) was used to convert unmethylated cytosine to uracil according to manufacturer’s instructions. MSP and BSP were performed following previously-established protocols 63 . The mouse Gpx4 promoter methylation was assayed by MSP with methylated forward primer 5’-TTTTTTAAGGGGATGATTTTGATAC (-247/-223) and reverse primer 5’- ATACCCAATAATAAAAACGCGA A (-78/-100); unmethylated forward primer 5’-TTTTAAGGGGATGATTTTGATATGT (-245/-221) and reverse primer 5’-CATACC CAATAATAAAAACACAAA (-77/-100); and input DNA control forward primer 5’-CTCTTTAAGGGGATGACTTTGACAC and reverse primer 5’-ATGCCCAGTGAT AGGGACGCGGG. The human GPX4 promoter methylation was assayed by MSP with methylated forward primer 5’-AGTATTTTTAGGTTGTTTGGTTTGC (7/33) and reverse primer 5’-CGAACGTACGAACTTATTATTAACGA (152/179); unmethylated forward primer 5’-GTATTTTTAGGTTGTTTGGTTTGTG (8/34) and reverse primer 5’- CAAA CATACAAACTTATTATTAACAAC (152/180); and input DNA control forward primer 5’-TAGACACAAGCGA GCATGCGCAGTC and reverse primer 5’- CCAGAGCGCTCATTGGTCAGACG. The PCR products were analyzed on a 2% agarose gel and visualized under ultraviolet light, and densitometric analysis was performed using ImageJ software. The methylation status was assayed by BSP with forward primer 5’- GTTTTTTAAGGGGATGATTTTGATA (-248/-224) and reverse primer 5’- CCCTACAA CCAATAAA AAACTAAATA (5/-22). The PCR products were separated by electrophoresis, and the target DNA fragments were purified and cloned into pGEM T Easy Vector (A1360; Promega). Five colonies from each mouse/PCR reaction were randomly chosen for sequencing, and the percentages of methylated cytosines over total cytosines within the cloned fragment were calculated. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA from mouse and human bone tissues was extracted essentially as before 64 . After cDNA synthesis, PCR was performed with following mouse Gpx4 primers Gpx4 F: CCCATTCCTGAACCTTTCAA and Gpx4 R: GCACACGAAACCCCT GTACT; Actb F: GATCATTGCTCC TCCTGAGC and Actb R: TGCACCGCAAGTGCT TCTA as internal control and human GPX4 primers Gpx4 F: GAAGCAGGAGCCAG GGAGTA and Gpx4 R: ATGGCATTTCCCAGGATGCC; Actb primers Actb F: GCCTT CCTTCCTGGGCAT and Actb R: CTTCATTGTGCTGGGTGCC, respectively. PCR products were resolved on a 1.5% agarose gel and visualized under UV light. Chromatin immunoprecipitation (ChIP) ChIP assay was performed with mouse bone tissues as before 65 . The immunoprecipitation was performed with ChIP quality antibodies to KLF5, NCoR , SMRT and SnoN. The starting (input) and immunoprecipitated DNAs were analyzed by PCR and quantitative real-time PCR (qRT-PCR) using primer sets for Gpx4 promoter (Forward, 5’-GGGGATGACTTTGACACGC and Reverse, 5’-GCCTGAATGAAGGGA CGG, which covered the -239 to -14 locus containing a putative KLF5 binding motif (-43/gccccgccca). Regular PCR products were separated on 1.5% agarose gels and analysis of PCR product densitometry were performed with Image J Software. Luciferase assay Primary osteoblasts were transiently transfected (FuGENE® HD Transfection Reagent, Promega, USA) with Gpx4 promoter reporter plasmid Gpx4 p-luc (containing 2000 bp of the Gpx4 proximal promoter, costumer-constructed by Genechem, China) plus a renilla luciferase reporter (Genechem, China) as internal control. After the cells received various treatments, the luciferase activities from cell lysates were assayed using a dual luciferase reporter assay kit (Promega, USA). The luciferase activities of Gpx4 p-luc were normalized to renilla luciferase levels and expressed as relative fold changes. Statistical analysis The data normal distribution and assumption of homogeneity of variances were assessed by Shapiro-Wilk test and Levene’s test, respectively. The data quantitation and graphic plotting were accomplished with GraphpadPrism. Main effect P and effect size η 2 (large effect size, η 2 ≥0.1379; medium effect size, 0.0588 ≤ η 2 < 0.1379; small effect size, 0.0099 ≤ η 2 < 0.0588) were calculated by SPSS V22.0 software. Data were expressed as means ± SEM for animal studies or ± SD for cell assays. The Box-and-whisker plots were defined as follows: midline represents median, box is the 25 th -75 th percentiles, and whiskers are minimum and maximum. The group differences were analyzed by Student’s t test, two-way ANOVA, or two-way ANOVA followed by Tukey’s post-hoc test. The thresholds of P < 0.05 were set as statistically significant. Declarations Contributions: BR, JD and FW conducted the assays, acquired and analyzed the data and drafted the manuscript. ZH, LZ and BY provided technical support and assistance. CL and HD contributed reagents and provided scientific insight and discussion. WC conceived, designed and supervised the study, arranged and interpreted the results, and wrote the manuscript. HW and YW provided supervision and research resources. All authors approved the final version of the manuscript. Data availability statements RNA-seq data: China National Center for Bioinformation CRA007214 (https://ngdc.cncb.ac.cn/gsa/browse/CRA007214) Acknowledgements: This work was supported by the National Key Research and Development Program of China (2023YFB3810200, 2023YFB3810204), the National Natural Science Foundation of China (82272502, 82072423, 81970577) Conflict of interests: The authors have declared that no conflict of interest exists. References MARCU, F., BOGDAN, F., MUŢIU, G. & LAZĂR, L. The histopathological study of osteoporosis Rom J Morphol Embryol 52 , 321-325 (2011). Salari, N. et al. The global prevalence of osteoporosis in the world: a comprehensive systematic review and meta-analysis. Journal of Orthopaedic Surgery and Research 16 , doi:10.1186/s13018-021-02772-0 (2021). Rouf, R. S. B., Qureshi, N. K., Afsana, F. & Ferdous, H. S. Osteoporosis: A Review. BIRDEM Medical Journal 5 , 30-36, doi:10.3329/birdem.v5i1.28371 (2016). Wauquier, F., Leotoing, L., Coxam, V., Guicheux, J. & Wittrant, Y. Oxidative stress in bone remodelling and disease. Trends in Molecular Medicine 15 , 468-477, doi:10.1016/j.molmed.2009.08.004 (2009). Hameister, R., Kaur, C., Dheen, S. T., Lohmann, C. H. & Singh, G. Reactive oxygen/nitrogen species (ROS/RNS) and oxidative stress in arthroplasty. Journal of Biomedical Materials Research Part B: Applied Biomaterials 108 , 2073-2087, doi:10.1002/jbm.b.34546 (2020). Wang, Z. et al. Autophagy mediated CoCrMo particle-induced peri-implant osteolysis by promoting osteoblast apoptosis. Autophagy 11 , 2358-2369, doi:10.1080/15548627.2015.1106779 (2016). Pellegrini, G., Morales, C., Wallace, T., Plotkin, L. & Bellido, T. Avenanthramides Prevent Osteoblast and Osteocyte Apoptosis and Induce Osteoclast Apoptosis in Vitro in an Nrf2-Independent Manner. Nutrients 8 , 423, doi:10.3390/nu8070423 (2016). Komori, T. Cell Death in Chondrocytes, Osteoblasts, and Osteocytes. International Journal of Molecular Sciences 17 , 2045, doi:10.3390/ijms17122045 (2016). Cui, J. et al. Regulated cell death: discovery, features and implications for neurodegenerative diseases. Cell Communication and Signaling 19 , doi:10.1186/s12964-021-00799-8 (2021). Zou, D.-B., Mou, Z., Wu, W. & Liu, H. TRIM33 protects osteoblasts from oxidative stress-induced apoptosis in osteoporosis by inhibiting FOXO3a ubiquitylation and degradation. Aging Cell 20 , e13367, doi:10.1111/acel.13367 (2021). Ma, Y. et al. Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell 17 , doi:10.1111/acel.12709 (2018). Tao, Z. et al. Pyroptosis in Osteoblasts: A Novel Hypothesis Underlying the Pathogenesis of Osteoporosis. Frontiers in Endocrinology 11 , doi:10.3389/fendo.2020.548812 (2021). Cui, H. et al. Necrostatin-1 treatment inhibits osteocyte necroptosis and trabecular deterioration in ovariectomized rats. Sci Rep 6 , 33803, doi:10.1038/srep33803 (2016). Yan, C. et al. Research Progress of Ferroptosis Regulatory Network and Bone Remodeling in Osteoporosis. Frontiers in Public Health 10 , doi:10.3389/fpubh.2022.910675 (2022). Liu, P. et al. Ferroptosis: A New Regulatory Mechanism in Osteoporosis. Oxidative Medicine and Cellular Longevity 2022 , 2634431, doi:10.1155/2022/2634431 (2022). Zhang, W., Wang, C., Zhu, W., Liu, F. & Liu, Y. Ferrostatin-1 alleviates cytotoxicity of cobalt nanoparticles by inhibiting ferroptosis. Bioengineered 13 , 6163-6172, doi:10.1080/21655979.2022.2042143 (2022). Li, Y. et al. Carnosol suppresses RANKL-induced osteoclastogenesis and attenuates titanium particles-induced osteolysis. Journal of Cellular Physiology 236 , 1950-1966, doi:10.1002/jcp.29978 (2020). Xu, Y. et al. CoCrMo-Nanoparticles induced peri-implant osteolysis by promoting osteoblast ferroptosis via regulating Nrf2-ARE signalling pathway. Cell Proliferation 54 , e13142., doi:10.1111/cpr.13142 (2021). Miotto, G. et al. Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. Redox Biology 28 , 101328, doi:10.1016/j.redox.2019.101328 (2020). Friedmann Angeli, J. P. et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nature Cell Biology 16 , 1180-1191, doi:10.1038/ncb3064 (2014). Jiang, X., Stockwell, B. R. & Conrad, M. Ferroptosis: mechanisms, biology and role in disease. Nature Reviews Molecular Cell Biology 22 , 266-282, doi:10.1038/s41580-020-00324-8 (2021). Dixonl, S. J. & Stockwell, B. R. The Hallmarks of Ferroptosis. Annual Review of Cancer Biology 3 , 35-54, doi:10.1146/annurev-cancerbio030518-055844 (2019). Stockwell, B. R. et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 171 , 273-285, doi:10.1016/j.cell.2017.09.021 (2017). Zhang, X. et al. Homocysteine induces oxidative stress and ferroptosis of nucleus pulposus via enhancing methylation of GPX4. Free Radical Biology and Medicine 160 , 552-565, doi:10.1016/j.freeradbiomed.2020.08.029 (2020). Zeng, Z. et al. DNA dioxygenases TET2 deficiency promotes cigarette smoke induced chronic obstructive pulmonary disease by inducing ferroptosis of lung epithelial cell. Redox Biol 67 , 102916, doi:10.1016/j.redox.2023.102916 (2023). Oton-Gonzalez, L. et al. Genetics and Epigenetics of Bone Remodeling and Metabolic Bone Diseases. International Journal of Molecular Sciences 23 , 1500, doi:10.3390/ijms23031500 (2022). Ludwig, A. K., Zhang, P. & Cardoso, M. C. Modifiers and Readers of DNA Modifications and Their Impact on Genome Structure, Expression, and Stability in Disease. Frontiers in Genetics 7 , doi:10.3389/fgene.2016.00115 (2016). Moore, L. D., Le, T. & Fan, G. DNA Methylation and Its Basic Function. Neuropsychopharmacology 38 , 23-38, doi:10.1038/npp.2012.112 (2012). Letarouilly, J.-G., Broux, O. & Clabaut, A. New insights into the epigenetics of osteoporosis. Genomics 111 , 793-798, doi:10.1016/j.ygeno.2018.05.001 (2019). Reppe, S. et al. Distinct DNA methylation profiles in bone and blood of osteoporotic and healthy postmenopausal women. Epigenetics 12 , 674-687, doi:10.1080/15592294.2017.1345832 (2017). Visconti, V. V. et al. DNA Methylation Signatures of Bone Metabolism in Osteoporosis and Osteoarthritis Aging-Related Diseases: An Updated Review. International Journal of Molecular Sciences 22 , 4244, doi:10.3390/ijms22084244 (2021). Lee, J., You, J. H., Kim, M.-S. & Roh, J.-L. Epigenetic reprogramming of epithelial-mesenchymal transition promotes ferroptosis of head and neck cancer. Redox Biology 37 , 101697, doi:10.1016/j.redox.2020.101697 (2020). Yu, B. et al. PGC-1α Controls Skeletal Stem Cell Fate and Bone-Fat Balance in Osteoporosis and Skeletal Aging by Inducing TAZ. Cell Stem Cell 23 , 615-623, doi:10.1016/j.stem.2018.06.009 (2018). Doll, S. et al. FSP1 is a glutathione-independent ferroptosis suppressor. Nature 575 , 693-698, doi:10.1038/s41586-019-1707-0 (2019). Xu, Z. et al. Mechanisms of estrogen deficiency-induced osteoporosis based on transcriptome and DNA methylation. Front Cell Dev Biol 10 , 1011725, doi:10.3389/fcell.2022.1011725 (2022). Luo, Y. & Chen, C. The roles and regulation of the KLF5 transcription factor in cancers. Cancer Science 112 , 2097-2117, doi:10.1111/cas.14910 (2021). Yang, Y., Goldstein, B. G., Chao, H.-H. & Katz, J. KLF4 and KLF5 regulate proliferation, Apoptosis and invasion in esophageal cancer cells. Cancer Biology & Therapy 4 , 1216-1221, doi:10.4161/cbt.4.11.2090 (2014). Li, Y., Li, J., Hou, Z., Yu, Y. & Yu, B. KLF5 overexpression attenuates cardiomyocyte inflammation induced by oxygen-glucose deprivation/reperfusion through the PPARγ/PGC-1α/TNF-α signaling pathway. Biomedicine & Pharmacotherapy 84 , 940-946, doi:10.1016/j.biopha.2016.09.100 (2016). Zhang, P. et al. Ferroptosis was more initial in cell death caused by iron overload and its underlying mechanism in Parkinson's disease. Free Radical Biology and Medicine 152 , 227-234, doi:10.1016/j.freeradbiomed.2020.03.015 (2020). Pap, E. H. W. et al. Ratio-fluorescence microscopy of lipid oxidation in living cells using C11-BODIPY581/591. FEBS Letters 453 , 278-282, doi:10.1016/s0014-5793(99)00696-1 (1999). Yoo, S.-E. et al. Gpx4 ablation in adult mice results in a lethal phenotype accompanied by neuronal loss in brain. Free Radical Biology and Medicine 52 , 1820-1827, doi:10.1016/j.freeradbiomed.2012.02.043 (2012). Pei, Y., Qian, Y., Wang, H. & Tan, L. Epigenetic Regulation of Ferroptosis-Associated Genes and Its Implication in Cancer Therapy. Frontiers in Oncology 12 , doi:10.3389/fonc.2022.771870 (2022). Yu Shan, L. W., Guangfei Li, Guangsi Shen, Peng Zhang, Youjia Xu. Methylation of bone SOST impairs SP7, RUNX2, and ERα transactivation in patients with postmenopausal osteoporosis Biochemistry and Cell Biology 97 , 369-374 (2018). Greally, J. M. et al. A Six Months Exercise Intervention Influences the Genome-wide DNA Methylation Pattern in Human Adipose Tissue. PLoS Genetics 9 , e1003572, doi:10.1371/journal.pgen.1003572 (2013). Mann V, H. C., Kogianni G, Jones D, Noble B. The influence of mechanical stimulation on osteocyte apoptosis and bone viability in human trabecular bone. J Musculoskelet Neuronal Interact 6 , 408-417 (2006). Nishikawa, K. et al. DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine–producing metabolic pathway. Nature Medicine 21 , 281-287, doi:10.1038/nm.3774 (2015). Guan, H. et al. Decitabine represses osteoclastogenesis through inhibition of RANK and NF-κB. Cellular Signalling 27 , 969-977, doi:10.1016/j.cellsig.2015.02.006 (2015). Li, B. et al. Overexpression of DNMT1 leads to hypermethylation of H19 promoter and inhibition of Erk signaling pathway in disuse osteoporosis. Bone 111 , 82-91, doi:10.1016/j.bone.2018.03.017 (2018). Wang, C. et al. Mechanical stimulation promote the osteogenic differentiation of bone marrow stromal cells through epigenetic regulation of Sonic Hedgehog. Experimental Cell Research 352 , 346-356, doi:10.1016/j.yexcr.2017.02.021 (2017). Zhu, X., Zhang, Y., Yang, H., He, F. & Lin, J. Melatonin suppresses Ti-particle-induced inflammatory osteolysis via activation of the Nrf2/Catalase signaling pathway. International Immunopharmacology 88 , 106847, doi:10.1016/j.intimp.2020.106847 (2020). Jiang, Z. et al. Ferroptosis in Osteocytes as a Target for Protection Against Postmenopausal Osteoporosis. Advanced Science , doi:10.1002/advs.202307388 (2024). Wang, X. et al. Mitochondrial Ferritin Deficiency Promotes Osteoblastic Ferroptosis Via Mitophagy in Type 2 Diabetic Osteoporosis. Biological Trace Element Research 200 , 298-307, doi:10.1007/s12011-021-02627-z (2021). Xue, C. et al. Aconine attenuates osteoclast-mediated bone resorption and ferroptosis to improve osteoporosis via inhibiting NF-kappaB signaling. Front Endocrinol (Lausanne) 14 , 1234563, doi:10.3389/fendo.2023.1234563 (2023). Ma, J.-B. et al. KLF5 inhibits STAT3 activity and tumor metastasis in prostate cancer by suppressing IGF1 transcription cooperatively with HDAC1. Cell Death & Disease 11 , doi:10.1038/s41419-020-2671-1 (2020). Meyer, S. E. et al. Krüppel-Like Factor 5 Is Not Required for K-RasG12D Lung Tumorigenesis, but Represses ABCG2 Expression and Is Associated with Better Disease-Specific Survival. The American Journal of Pathology 177 , 1503-1513, doi:10.2353/ajpath.2010.090651 (2010). Tsai, H.-C. et al. Transient Low Doses of DNA-Demethylating Agents Exert Durable Antitumor Effects on Hematological and Epithelial Tumor Cells. Cancer Cell 21 , 430-446, doi:10.1016/j.ccr.2011.12.029 (2012). Chen, X. et al. Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. Bone Res 9 , 15, doi:10.1038/s41413-020-00128-8 (2021). Zhu, X. et al. PPARγ preservation via promoter demethylation alleviates osteoarthritis in mice. Ann Rheum Dis 78 , 1420-1429, doi:10.1136/annrheumdis-2018-214940 (2019). Dong, J. et al. NRF2 is a critical regulator and therapeutic target of metal implant particle-incurred bone damage. Biomaterials 288 , 121742, doi:10.1016/j.biomaterials.2022.121742 (2022). Xu, R. et al. Targeting skeletal endothelium to ameliorate bone loss. Nat Med 24 , 823-833, doi:10.1038/s41591-018-0020-z (2018). Nishikawa, K. et al. DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine-producing metabolic pathway. Nat Med 21 , 281-287, doi:10.1038/nm.3774 (2015). Chen, X. et al. Reversal of Epigenetic Peroxisome Proliferator-Activated Receptor-γ Suppression by Diacerein Alleviates Oxidative Stress and Osteoarthritis in Mice. Antioxid Redox Signal 37 , 40-53, doi:10.1089/ars.2021.0219 (2022). Gao, Q. et al. Inhibition of DNA methyltransferase aberrations reinstates antioxidant aging suppressors and ameliorates renal aging. Aging Cell 21 , e13526, doi:10.1111/acel.13526 (2022). Ali, D. et al. High-fat diet-induced obesity augments the deleterious effects of estrogen deficiency on bone: Evidence from ovariectomized mice. Aging Cell 21 , e13726, doi:10.1111/acel.13726 (2022). Chen, F. et al. Histone deacetylase 3 aberration inhibits Klotho transcription and promotes renal fibrosis. Cell Death Differ 28 , 1001-1012, doi:10.1038/s41418-020-00631-9 (2021). Additional Declarations (Not answered) Cite Share Download PDF Status: Published Journal Publication published 02 Dec, 2024 Read the published version in Bone Research → Version 1 posted Editorial decision: revise 22 May, 2024 Review # 2 received at journal 17 May, 2024 Review # 1 received at journal 13 May, 2024 Reviewer # 2 agreed at journal 04 May, 2024 Reviewer # 1 agreed at journal 27 Apr, 2024 Reviewers invited by journal 27 Apr, 2024 Submission checks completed at journal 22 Apr, 2024 First submitted to journal 21 Apr, 2024 Editor assigned by journal 21 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4301039","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":296248782,"identity":"93617c5c-e726-4b8d-8ae4-652dbb3c23cc","order_by":0,"name":"Yongxiang Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIie3RMUvEMBTA8VcCueVpV2PxOwQCETnIfRUl4FRuEaSDw0HhVmeh+BmcOlcCdqncWvCWQ+hiB2/wuNHkOqdwm2D+Q/KG9yOFAoRCfzrijmy4zo4gzVHEFS2He5Tw+t18YbZWLzXpNj/P6wmvyOsHgpp7STO/nWLT6aecXoqLsiO8onqKoO98RFapFCdLo2MCMmGlsQRlglDdLHxk1Q+EkskuYYUj8W6ctKn4tETFBCXbLg6v0FEya3sZFY25ZjneJ/BmCDNUXBVcewl7TMV3n5kZX9Ul2z8YfVrnm7bPlJfY6DkCHBaIHfTwM7l/3y1u9/YD3RTZQY3uhkKh0L/sF8dSVehqr8UZAAAAAElFTkSuQmCC","orcid":"","institution":"Northern Jiangsu People’s Hospital, the Affiliated Hospital of Nanjing University Medical School","correspondingAuthor":true,"prefix":"","firstName":"Yongxiang","middleName":"","lastName":"Wang","suffix":""},{"id":296248783,"identity":"f8899cc0-930d-4098-9153-6ef09b49dd36","order_by":1,"name":"Hongwei Wang","email":"","orcid":"","institution":"Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Hongwei","middleName":"","lastName":"Wang","suffix":""},{"id":296248784,"identity":"10ee0e6e-fd75-4282-9600-adf87e5cc23b","order_by":2,"name":"Wangsen Cao","email":"","orcid":"https://orcid.org/0000-0001-6209-3482","institution":"Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Wangsen","middleName":"","lastName":"Cao","suffix":""},{"id":296248785,"identity":"e6dec90d-432a-4a4c-8feb-5729d211ab65","order_by":3,"name":"bin-jia ruan","email":"","orcid":"","institution":"Department of Orthopedics, Northern Jiangsu People's Hospital, Clinical Teaching Hospital of Medical School, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"bin-jia","middleName":"","lastName":"ruan","suffix":""},{"id":296248786,"identity":"28b7e2e1-ae99-450c-ad60-837d6b6683aa","order_by":4,"name":"Jian Dong","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Dong","suffix":""},{"id":296248787,"identity":"f8480ba0-fd88-45e8-97a7-f4e5922db4d8","order_by":5,"name":"Fanhao Wei","email":"","orcid":"","institution":"Northern Jiangsu People’s Hospital, the Affiliated Hospital of Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Fanhao","middleName":"","lastName":"Wei","suffix":""},{"id":296248788,"identity":"9e31316b-775b-477e-8aac-82edf47ff925","order_by":6,"name":"Zhiqiang Huang","email":"","orcid":"","institution":"Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Zhiqiang","middleName":"","lastName":"Huang","suffix":""},{"id":296248789,"identity":"56eedcfb-3c0b-4e8b-99d3-a10594084940","order_by":7,"name":"Bin Yang","email":"","orcid":"","institution":"Northern Jiangsu People’s Hospital, the Affiliated Hospital of Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Yang","suffix":""},{"id":296248790,"identity":"fc7c1f12-01da-4ac1-a645-c606accea732","order_by":8,"name":"Lijun Zhang","email":"","orcid":"","institution":"Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Lijun","middleName":"","lastName":"Zhang","suffix":""},{"id":296248791,"identity":"be6bac22-6568-471a-a883-f08956650f1b","order_by":9,"name":"Chulin Li","email":"","orcid":"","institution":"Jinling Hospital, Affiliated Hospital of Medical School, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Chulin","middleName":"","lastName":"Li","suffix":""},{"id":296248792,"identity":"a1ecb816-ee34-466a-94b7-a82755641bc1","order_by":10,"name":"Hui Dong","email":"","orcid":"","institution":"Northern Jiangsu People’s Hospital, the Affiliated Hospital of Nanjing University Medical School","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Dong","suffix":""}],"badges":[],"createdAt":"2024-04-21 14:00:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4301039/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4301039/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41413-024-00365-1","type":"published","date":"2024-12-02T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56020645,"identity":"f4af578c-b979-4fde-9f96-4357ad21aa84","added_by":"auto","created_at":"2024-05-07 16:09:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":255056,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMouse osteoporotic femurs induced by ovariectomy display marked ferroptosis and GPX4 suppression. (a) \u003c/strong\u003eFemale C57BL/6J\u003cstrong\u003e \u003c/strong\u003emice of 12 weeks old were subjected to sham or ovariectomy (Ovx) surgery for 6 weeks (n=6).\u003cstrong\u003e (A) \u003c/strong\u003eRepresentative microphotographs of\u003cstrong\u003e \u003c/strong\u003eH\u0026amp;E-stained distal femur sections (the upper panel, the arrows indicated trabeculae) and micro-CT-scanned (μ-CT) and 3-D reconstructed distal femurs from sham or Ovx mice (the lower panel). \u003cstrong\u003e(b) \u003c/strong\u003eQuantitative analysis of μ-CT data in Fig.1a for the ratio of bone volume to tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp), presented as Box-and-whisker plots. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, n=6, Student’s t test. \u003cstrong\u003e(c) \u003c/strong\u003eRepresentative distal femur sections stained by Perls’ method (the upper panel, the arrows indicate the iron deposition) and by TUNEL staining (the lower panel, the arrows indicate the positively-stained cells). \u003cstrong\u003e(d) \u003c/strong\u003eWestern blotting. The fbone homogenates from Sham/Ovx mice and Contros (Ctrl)/OP patients were assayed for type 1 collagen (Col 1), NFATc1, GPX4, 4-HNE and FSP1. GAPDH served as the loading controls. Three randomly-selected samples from 6 in each group were shown.\u003cstrong\u003e \u003c/strong\u003eQuantitations of Fig.1d on the right side of the blots were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Student’s t test. \u003cstrong\u003e(e) \u003c/strong\u003eVolcano plot of gene expression profile from CRA007214 database (total 21422 genes, n = 3 mice for sham group, n = 3 mice for Ovx group). The numbers and positions of genes statistic-significantly increased (2535, red), no difference (15573, grey) or decreased (3314, blue) including \u003cem\u003eGpx4\u003c/em\u003e (Log2 (FC)=-2.49906, white) were marked.\u003cstrong\u003e (f) \u003c/strong\u003eRepresentative distal femur sections of Sham and Ovx mice stained for GPX4 by immunohistochemistry (IHC) staining. The right images of each panel were enlarged frames of the left panel. The positive-stained cells in brown were indicated by arrows. \u003cstrong\u003e(g) \u003c/strong\u003eRepresentative EM microphotographs of the sham and Ovx mouse femurs. The normal and ferroptotic mitochondria in sham and Ovx mice were indicated by blue and red arrows, respectively.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/5ce172e343d5800a1326663f.png"},{"id":56020648,"identity":"1b2dd748-e210-4111-b723-ec2c13ea6882","added_by":"auto","created_at":"2024-05-07 16:09:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":110721,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe GPX4 suppression is accompanied by aberrant DNMT elevations and GPX4 promoter hypermethylation. (a) \u003c/strong\u003eSchematic diagrams of mouse (\u003cem\u003eGpx4\u003c/em\u003e) and human (\u003cem\u003eGPX4\u003c/em\u003e)\u003cem\u003e \u003c/em\u003epromoters. The position of CpG islands (grey area) and MSP/BSP primers (boxes) were depicted relative to the transcription starting site. \u003cstrong\u003e(b) \u003c/strong\u003eWestern blotting of the bone homogenates from Sham/Ovx mice and Control (Ctrl)/OP patients for DNMT1, DNMT2 and DNMT3 and GAPDH served as loading controls (three randomly selected samples are shown). The Quantitations were on the right side. Data were presented as relative means ± SEM of 6 samples in each group. *\u003cem\u003eP\u003c/em\u003e \u0026lt;0.05, Student’s unpaired t test.\u003cstrong\u003e (c) \u003c/strong\u003eRT-PCR and agarose gel analysis of \u003cem\u003eGpx4\u003c/em\u003e/\u003cem\u003eGPX4\u003c/em\u003e mRNAs from Sham/Ovx and Ctrl/OP bone tissues. Beta-actin genes (\u003cem\u003eActb\u003c/em\u003e/\u003cem\u003eACTB\u003c/em\u003e) served as the internal controls (three randomly selected samples are shown). The Quantitations were on the right side. Data were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt;0.05, unpaired Student’s t test.\u003cstrong\u003e (d)\u003c/strong\u003e Representative agarose gel analyses of MSP products (methylated, unmethylated and input PCR) from femurs of Sham/Ovx mice and lumbars of Ctrl/OP patients , or \u003cstrong\u003e(e) \u003c/strong\u003efrom femurs of Sham, SGI-1027 (SGI, 2.5 mg/kg daily), Ovx and SGI-1027-treated Ovx mice (S/Ovx, n=6, two/three representative samples from each group were shown.\u003cstrong\u003e \u003c/strong\u003eThe\u003cstrong\u003e \u003c/strong\u003eQuantitations were on the right side. Data were presented as ratio ± SEM of methylated/unmethylated over total PCR products after adjusted with input controls. *\u003cem\u003eP \u003c/em\u003e\u0026lt;0.05, Unpaired Student’s t test\u003cstrong\u003e (d) \u003c/strong\u003eor two-way ANOVA \u003cstrong\u003e(e)\u003c/strong\u003e.\u003cstrong\u003e (f) \u003c/strong\u003eBSP analysis of mouse\u003cem\u003e Gpx4 \u003c/em\u003epromoter. Three randomly-selected mice (M1, M2, and M3) from each group were subjected to BSP. Five cloned PCR products from each animal sample were sequenced. One box represented one mouse. Each box row represented one single sequenced clone and each dot represented one CpG site. The empty or dark dots indicated unmethylated or methylated CpGs, respectively. Quantitations were on the right side. Data are presented as ratios ± SEM of methylated CpGs over total CpGs in the cloned fragments. \u003csup\u003e\u003cem\u003e*\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.05, two-way ANOVA.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/81f25a7705cbdf1089293897.png"},{"id":56020641,"identity":"d2309658-b617-4398-80d1-90127321eeaa","added_by":"auto","created_at":"2024-05-07 16:09:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":79334,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKLF5 coregulates the Gpx4 transcriptional inhibition. (a) \u003c/strong\u003eA schematic diagram of \u003cem\u003eGpx4\u003c/em\u003e promoter/luciferase reporter with KLF5 motif and the position relative to transcriptional start site indicated. \u003cstrong\u003e(b)\u003c/strong\u003e Western blotting of sham and Ovx mouse femurs for KLF5, KLF2, NCoR, SMRT and SnoN with β-actin served as internal control. Three randomly-selected samples from each group (n=6) were shown. The Quantitations were on the right side. Data were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Student’s t test. \u003cstrong\u003e(c) \u003c/strong\u003eChIP assay. The same femoral homogenates treated as above were immunoprecipitated first with antibodies to KLF5, NCoR, SMRT, or SnoN, separately, and then the precipitated DNA fragments were amplified by PCR with primers covering the KLF5 motif. The non-immunoprecipitated DNA served as control (Input). The representative PCR products were analyzed on agarose gel. \u003cstrong\u003e(d)\u003c/strong\u003eQuantitations of Fig.3c. Data were presented as\u003cstrong\u003e \u003c/strong\u003emeans ± SEM (n=6). \u003cem\u003e*P\u003c/em\u003e \u0026lt; 0.05, two-way ANOVA. \u003cstrong\u003e(e)\u003c/strong\u003e Western blotting. Primary osteoblasts were treated with FAC (100 μM) in presence or absence of ML264 (10 μM) for 48 h, and then the cell lysates were assayed for GPX4, 4-HNE and KLF5 with β-actin serving as control. \u003cstrong\u003e(f)\u003c/strong\u003e Quantitations of Fig.3e. Data were presented as\u003cstrong\u003e \u003c/strong\u003emeans ± SD of three repeated assays. \u003cem\u003e*P\u003c/em\u003e \u0026lt; 0.05, two-way ANOVA.\u003cstrong\u003e (g)\u003c/strong\u003e Luciferase assay. The \u003cem\u003eGpx4\u003c/em\u003e promoter/luciferase reporter plasmid and a rennila luciferase reporter plasmid were co-transfected into primary osteoblasts, treated with FAC (100μM) with or without SGI-1027 (10 μM) in presence or absence of KLF5 inhibitor ML264 (10 μM) for 48 h, and then the\u003cem\u003e Gpx4 \u003c/em\u003epromoter-driven luciferase activities were normalized with renilla’s, and presented as Box-and-whisker plots of four repeated assays, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, two-way ANOVA.\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/066f0b25d3d8576f49eceb4a.png"},{"id":56020642,"identity":"09805d69-cbf8-452f-a660-429f84c55801","added_by":"auto","created_at":"2024-05-07 16:09:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157983,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDNMT inhibition by SGI-1027 preserves GPX4 and protects Ovx mice from ferroptotic osteoporosis. \u003c/strong\u003eThe female C57BL/6J\u003cstrong\u003e \u003c/strong\u003emice were divided into Sham, SGI-1027 (SGI, 2.5 mg/kg daily) or Ferropstatin-1 (Fer-1, 5 mg/kg daily), Ovx, SGI/Ovx or Fer-1/Ovx groups (n=6, 6 weeks). \u003cstrong\u003e(a)\u003c/strong\u003e Representative microphotographs of μ-CT-scanned (the upper panel) or TUNEL-stained (the lower panel, the positively-stained cells were indicated by arrows) mouse distal femurs/femoral sections. \u003cstrong\u003e(b) \u003c/strong\u003eQuantitative analysis of Fig.4a for the ratio of bone volume to tissue volume (BV/TV), trabecular number (Tb. N), trabecular thickness (Tb. Th), trabecular separation (Tb. Sp) and TUNEL-positive cell numbers. Data were presented as Box-and-whisker plots. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, n=6, two-way ANOVA. The effect size of SGI-1027 (η\u003csup\u003e2\u003c/sup\u003e1) or Ferropstatin-1 (Fer-1, η\u003csup\u003e2\u003c/sup\u003e2) intervention was indicated as inserts. \u003cstrong\u003e(c) \u003c/strong\u003eWestern blotting of the femoral homogenates for GPX4, MDA, Col1, OPN, NFATc1 and ACP5. Two-samples from each group were shown.\u003cstrong\u003e (d)\u003c/strong\u003e Quantitations of Fig.4c. Data were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, two-way ANOVA.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/801017028eca70a1dbf20f1a.png"},{"id":56020649,"identity":"018c5c31-62e2-44f4-9cc3-4a6ace9a8bec","added_by":"auto","created_at":"2024-05-07 16:09:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":240498,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe GPX4 suppression occurs mainly in osteoblasts and mediated by all three DNMT isoforms.\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(a) \u003c/strong\u003eImmunofluoresent double-staining. The distal femoral sections of sham or Ovx mice were double-stained for GPX4 (red) plus OCN or CTSK (green), respectively, counter-stained by DAPI (blue) and then merged. The single or double-stained cells in yellow were indicated by arrows. \u003cstrong\u003e(b)\u003c/strong\u003eRepresentative images of osteoblasts stained for ALP (alkaline phosphatase, the left panel) activity and osteoclasts stained for TRAP (tartrate-resistant acid phosphatase, the right panel) activity. Quantification mean percentages of positively-stained areas over total areas ± SD, n = 3, *P \u0026lt; 0.05, Student’s t test.\u003cstrong\u003e (c) \u003c/strong\u003eWestern blotting. Primary osteoblasts (Ob) and osteoclasts (Oc) treated with or without FAC (100 μM) for 48 h were assayed for GPX4, 4-HNE, OPN (Ob), NFATc1 (Oc), DNMT1, DNMT3a and DNMT3b. β-actin served as the controls. \u003cstrong\u003e(d) \u003c/strong\u003eQuantitations of Fig.5c. Data were presented as means ± SD of 4 repeated experiments. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, Student’s unpaired t test. \u003cstrong\u003e(e) \u003c/strong\u003eWestern blotting. Primary osteoblasts were transfected with siRNA-control(C), siRNA-DNMT1(D1), siRNA-DNMT3a (D3a) and siRNA-DNMT3b (D3b), respectively for 24 h, and assayed for DNMT1, DNMT3a and DNMT3b, respectively.\u003cstrong\u003e (f) \u003c/strong\u003eWestern blotting. The siRNA-transfected osteoblasts were treated with or without FAC (100 μM), and then the cell lysates were assayed for GPX4 and DNMT1, DNMT3a and DNMT3b. The quantitation of GPX4 was under the blots. Data were presented as means ± SD of 4 repeated experiments. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Student’s unpaired t test.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/fc7fa171c022dce93a61cbdf.png"},{"id":56020644,"identity":"0d6fb7df-2eea-4b64-9cf3-99f1beeb4579","added_by":"auto","created_at":"2024-05-07 16:09:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":222180,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX4 inactivation by RSL3 blunts the anti-ferroptosis effects of DNMT inhibition in osteoblasts.\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(a) \u003c/strong\u003eWestern blotting. Primary osteoblasts treated with FAC (100 μM) or RSL3 (0.3 μM) with or without SGI-1027 (SGI, 10 μM) for 48 h were assayed for GPX4 and 4-HNE. \u003cstrong\u003e(b)\u003c/strong\u003e Quantitations of fig.6a. Data were presented as means ± SD. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, n=4, two-way ANOVA. \u003cstrong\u003e(c)\u003c/strong\u003e Representative images of TUNEL staining, C11-BODIPY assay and EM examinations. Primary osteoblasts (Ob) and osteoclasts (Oc) treated as above were examined by TUNEL staining (the upper panel, the positive cells were indicated by arrows). The osteoblasts (Ob) were examined by C11-BODIPY (the middle panel. N-BOD, non-oxidized-BODIPY: O-BOD, oxidized-BODIPY), and EM (the lower panel, the ferroptotic mitochondrial alterations were indicated by arrows.\u003cstrong\u003e (d) \u003c/strong\u003eQuantitations of TUNEL assay and N-BOD or O-BOD of Fig.6c. Data were presented as mean ratios ± SD, (n= 6). *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, two-way ANOVA.\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/2f0c081909473b9e6740b401.png"},{"id":56020647,"identity":"d86c511b-e95d-4207-bad3-7765c50068cf","added_by":"auto","created_at":"2024-05-07 16:09:26","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":193871,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOsteoblastic \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eGpx4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e deficiency potentiates ferroptotic osteoporosis. (a) \u003c/strong\u003eA diagram of \u003cem\u003eGpx4\u003c/em\u003e gene locus in wild-type (WT), \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/-\u003c/em\u003e\u003c/sup\u003e mice. \u003cem\u003eGpx4\u003c/em\u003e gene contains seven exons represented by boxes. The positions of flox sites (triangles) and genotyping PCR primers F1, R1 and R2 (arrows) were depicted.\u003cstrong\u003e (b) \u003c/strong\u003eAgarose gel displays of genotyping of WT, \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e mice.\u003cstrong\u003e (c)\u003c/strong\u003e The appearances (the upper panel) and femurs (the lower panel) of \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl \u003c/sup\u003eand \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/-\u003c/em\u003e\u003c/sup\u003e mice at 8 weeks. Quantitations of mouse body weight and femur length were on the right side (6 mice in each group). Data were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Student’s t test.\u003cstrong\u003e (d) \u003c/strong\u003eWestern blotting of femoral homogenates from \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl \u003c/sup\u003eand \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/-\u003c/em\u003e\u003c/sup\u003e mice for GPX4, Col1, OPN, NFATc1 and ACP5. The Quantitations were on the right side of each blot and resented means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Student’s t test.\u003cstrong\u003e (e)\u003c/strong\u003e Representative IHC images of femur sections from \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e mice stained for OCN and TRAP. The quantitations were on the right side. The arrows indicated the positively-stained osteobalsts (the left panel) or osteoclasts (the right panel).\u003cstrong\u003e \u003c/strong\u003eThe Quantitations were on the right side of each blot and resented means ± SEM. *P \u0026lt; 0.05, Student’s t test. \u003cstrong\u003e(f)\u003c/strong\u003e Representative microphotographs of μ-CT-scanned (the upper panel) and TUNEL-stained (the lower panel) distal femurs/femoral sections of \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl \u003c/sup\u003eand \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/-\u003c/em\u003e\u003c/sup\u003e mice. Quantitative analysis of μ-CT 3D reconstruction data in Fig.7e (the right side) for ratio of bone volume to tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp). Data are presented as Box-and-whisker plots. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, n=6, Student’s t test.\u003c/p\u003e","description":"","filename":"Slide7.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/723a9bc5b2269c60f1622f65.png"},{"id":56020646,"identity":"c49f8f70-0bda-4c1b-882c-ba305bb20c3b","added_by":"auto","created_at":"2024-05-07 16:09:26","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":290449,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX4 inactivation/osteoblastic GPX4 deficiency abrogates the anti-ferroptotic and anti-osteoporotic effects of SGI-1027. \u003c/strong\u003e\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e, \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e and RSL3-treated \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice underwent Sham, Ovx or SGI-1027/Ovx for 6 weeks, respectively (n=6). \u003cstrong\u003e(a)\u003c/strong\u003e Representative microphotographs of the μ-CT-scanned (the left paenl) and TUNEL-stained (the right panel, The arrows indicated the positive cells) mouse distal femurs/femoral sections. \u003cstrong\u003e(b) \u003c/strong\u003eQuantitative analysis of the ratio of bone volume to tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp) and TUNEL staining in Fig.8a. Data are presented as Box-and-whisker plots. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, two-way ANOVA. \u003cstrong\u003e(c) \u003c/strong\u003eWestern blotting of the femoral homogenates from mice in Fig.8a for GPX4, MDA, Col1, OPN, NFATc1 and ACP5. Two-samples from each group were shown.\u003cstrong\u003e (d)\u003c/strong\u003e Quantificatins of Fig.8c. Data were presented as means ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, n=6, Two-way ANOVA.\u003cstrong\u003e (e)\u003c/strong\u003e A schematic diagram of sequential DNMT1/3a/3belevations, GPX4 promoter hypermethylation, GPX4 suppression and osteoblast ferroptosis that promotes femur osteoporosis in Ovx mice. DNMT inhibition by SGI-1027 preserves GPX4 and blocks the ferroptotic osteoporosis.\u003c/p\u003e","description":"","filename":"Slide8.png","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/1ef7b7615af1de6b4be7ef00.png"},{"id":70328539,"identity":"bceb2368-e796-4b62-bba4-3227b83c35d7","added_by":"auto","created_at":"2024-12-02 08:06:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2711561,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4301039/v1/be221040-588c-487a-9dcc-20d3fce7e606.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"DNMT aberration-incurred GPX4 suppression prompts osteoblast ferroptosis and osteoporosis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOsteoporosis (OP) is a common and silent skeletal disease with a high risk of fragility fracture that affects approximately 18.3% of populations globally, especially in postmenopausal women (\u003cstrong\u003e11.6 %\u003c/strong\u003e of men and 23.1% of women) \u003csup\u003e1\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e. OP pathogenesis is characterized by reduced bone mass and deteriorated trabecular microstructure attributed directly to imbalanced osteoclastogenesis and osteoblastogenesis \u003csup\u003e3\u003c/sup\u003e. Under normal condition, bone undergoes constant turnover mainly controlled by osteoblasts and osteoclasts of opposite functions. Osteoclasts secret hydrochloric acid and proteolytic enzymes that dissolve organic collagen, inorganic calcium and phosphoruse, resulting in bone resorption \u003csup\u003e4\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e. In contrast, osteoblasts produce various growth factors, hormones and collagens to ensure proper bone biosynthesis \u003csup\u003e6\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e. OP occurs as a result of increased osteoclastogenesis or decreased osteoblastogenesis, or both \u003csup\u003e8\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. Although past researches have established that various forms of regulated cell death, such as apoptosis \u003csup\u003e10\u003c/sup\u003e, autophagic cell death \u003csup\u003e11\u003c/sup\u003e, pyroptosis \u003csup\u003e12\u003c/sup\u003e, necroptosis \u003csup\u003e13\u003c/sup\u003e.and ferroptosis \u003csup\u003e14\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e15\u003c/sup\u003e contribute to OP pathogenesis, the precise role, cell nature and the regulatory mechanisms of ferroptosis are only partially understood. \u003c/p\u003e\n\u003cp\u003eFerroptosis is a unique form of regulated cell death featured by iron-dependent lipid peroxide accumulation and actively involved in various pathological conditions, including cancers, neurodegenerative disorders, cardiovascular and bone diseases \u003csup\u003e16-18\u003c/sup\u003e. Ferroptosis is not prevented by inhibitors of necroptosis, pyroptosis or apoptosis, but inhibited by iron chelators and small lipophilic antioxidants such as ferrostatin\u003csup\u003e19\u003c/sup\u003e and liproxstatin \u003csup\u003e20\u003c/sup\u003e and directly regulated by endogenous glutathione GSH/GPX4 (glutathione peroxidase 4), the core anti-ferroptosis signaling pathway \u003csup\u003e21\u003c/sup\u003e. GSH tripeptide composed of glutamic acid, cysteine and glycine acts as a scavenger of free radicals and cofactor of GPX4. Insufficient GSH generation reduces the synthesis of GPX4 that is capable of converting the deleterious phospholipid hydroperoxides to the corresponding benign phospholipid alcohols and blocking ferroptosis \u003csup\u003e22\u003c/sup\u003e. GPX4 repression due to its reduced synthesis, enzymatic inactivation or protein degradation is a hallmark of ferroptosis \u003csup\u003e23\u003c/sup\u003e. However, GPX4 transcriptional regulation by epigenetic or non-epigenetic regulations might also affect its abundances. GPX4 promoter contains a dense CpG island, a structural feature of DNA methylation modification. GPX4 suppression due to DNA methylation affects its transcription under various ferroptotic conditions \u003csup\u003e24\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e25\u003c/sup\u003e, suggesting that GPX4 expression is likely subjected to epigenetic DNA methylation controls in OP, which represents a fundamental novel mechanism of OP pathogenesis.\u003c/p\u003e\n\u003cp\u003eDNA methylation on cytosine of CpG dinucleotide (5-methylcytosine, 5mC) is one of the core epigenetic machineries that potentially regulate the transcription of more than 60% of genes \u003csup\u003e26\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e27\u003c/sup\u003e. DNA methylation is catalyzed by maintaining DNA methyltransferases DNMT1 and de novo DNMT3a and DNMT3b, while the demethylation is processed by three ten-eleven translocation enzymes TET1, TET2 and TET3 \u003csup\u003e28\u003c/sup\u003e. DNA methylation can occur on any CpG site along the genome, however its preferential modifications of CpG islands in gene promoters/enhancers attract DNA methylation readers, transcriptional repressors/cofactors and histone deacetylases to form a transcriptional repressive complex, resulting in silencing of the downstream gene transcription \u003csup\u003e28\u003c/sup\u003e. DNA methylation-mediated suppressions of tumor suppressors, anti-aging and cellular protective proteins are common epigenetic features of tumorgenesis, aging and various degenerative and chronic diseases. Recent DNA methylation profiling investigations of OP bone tissues from animal models and OP patients detect a large number of genomic loci/genes that are modified by DNA methylations \u003csup\u003e29-31\u003c/sup\u003e. More pertinently, DNA methylation-incurred suppression of ferroptosis-associated genes \u003cem\u003eGPX4 \u003c/em\u003eand \u003cem\u003eCDH1\u003c/em\u003e increases the ferrotosis sensitivity \u003csup\u003e24\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e32\u003c/sup\u003e, strongly suggesting that epigenetic \u003cem\u003eGPX4 \u003c/em\u003esuppression due to DNA methylation aberration might mechanistically affect OP. \u003c/p\u003e\n\u003cp\u003eIn this study, we aimed to investigate the role, nature and regulatory network of ferroptosis in a mouse OP model of ovariectomy (Ovx). We discovered that GPX4 suppression and ferroptotic alterations in both Ovx mouse femurs and ferroptotic osteoblasts occurred substantially at mRNA levels that correlated with aberrant elevations of bioactive DNMT1/3a/3b. We then employed both pharmacological and genetic approaches to determine the critical role of the GPX4 suppression and ferroptosis in OP. Our study might provide molecular insights into the epigenetic mechanisms of ferroptosis in the OP pathologies with clinical prophylactic and therapeutic implications. \u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e1\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e．\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eMouse osteoporotic femurs induced by ovariectomy displays marked ferroptosis and GPX4 suppression \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insight into the possible epigenetic GPX4 suppression and ferroptosis in OP, we employed a well-established mouse OP model of ovariectomy \u003csup\u003e33\u003c/sup\u003e. As anticipated, mice receiving Ovx surgery for 6 weeks demonstrated thinned trabeculae with lost continuity and enlarged areolae in distal femurs as stained by H\u0026amp;E (Fig.1a). Microcomputed tomography (\u0026mu;CT) scanning revealed that the OP femurs had reduced trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), trabecular thickness (Tb,Th) and increased trabecular bone separation (Tb.Sp) (Fig.1a and b). Perls\u0026rsquo; Prussian blue staining recognizing the hemosiderin-associated Fe\u003csup\u003e3+\u003c/sup\u003e showed an increase of iron deposition (Fig.1c), and TUNEL assay, a sensitive way to catch both apoptotic and ferroptotic cells \u003csup\u003e20\u003c/sup\u003e, detected an increased numbers of positively-stained cells (Fig.1c). We further performed western blotting assays and detected reduced osteoblast marker type 1 collagen and enhanced osteoclast marker NFATc1 (Nuclear Factor Of Activated T Cells 1), the typical osteoporotic signs of reduced osteoblastogenesis and enhanced osteoclatsogenesis. Notably, GPX4, a core anti-ferroptosis enzyme, was repressed with concomitant elevation of a lipid peroxidation marker 4-hydroxynonenal (4-HNE), while the expression of another anti-ferroptosis protein FSP-1 (ferroptosis suppressor protein 1) whose reduced form ubiquinol supposedly traps lipid peroxyl radicals independent of GSH/GPX4 signaling \u003csup\u003e34\u003c/sup\u003e was not affected (Fig. 1d). We also analyzed a RNA-seq data from CNCB(China National Center for Bioinformation) database\u003csup\u003e35\u003c/sup\u003ewhich confirmed Gpx4 down-regulation in tibia of Ovx mice ((Log2 (FC)=-2.49906, Fig.1e). We further performed immunohistochemistry (IHC) staining of femur sections and found that GPX4 was broadly expressed in almost all visible cells around femoral trabecular, where both osteoblasts and osteoclasts resided, but drastically decreased in Ovx mice (Fig. 1f). Finally, we confirmed by electron microscopy that the mouse OP femurs displayed distinct mitochondrial characters of ferroptotic alterations, such as smaller mitochondria and diminished mitochondrial crista (Fig.1g). These results indicate that OP pathogenesis is associated with marked GPX4 suppression and ferroptosis. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2. The GPX4 suppression was mainly due to aberrant elevations of all three bioactive DNMT isoforms \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the potential role of DNA methylation that might account for the GPX4 suppression, we analyzed the human and mouse \u003cem\u003eGPX4\u003c/em\u003e/\u003cem\u003eGpx4\u003c/em\u003e promoters online (http://www.urogene.org/methprimer), and found that both contained conserved CpG islands at -253/47 (human, relative to the transcriptional starting site) and -210/170 loci (mouse) as depicted in Fig.2a, suggesting that GPX4 is sensitive to DNA methylation modification. We then assayed the expression of all three bioactive DNA methyltransferases DNMT1, DNMT3a and DNMT3b by western blotting and found that all three isoforms were relatively low in control femurs, but significantly upregulated in femurs of Ovx mice and OP patients (Fig.2b). We further confirmed by RT-PCR that the femoral \u003cem\u003eGpx4\u003c/em\u003e/\u003cem\u003eGPX4\u003c/em\u003e mRNA was substantially reduced in Ovx mice and patients with OP (Fig.2c). Since DNMTs negatively affect gene transcription via increasing the gene promoter methylation, We subsequently examined the femoral DNA methylation status of the promoters by MSP. The results showed that the OP bone tissues from both OP patients and Ovx mice exhibited\u003cem\u003e Gpx4\u003c/em\u003e/\u003cem\u003eGPX4\u003c/em\u003e promoter hypermethylation comparing to the controls (77.45 \u0026plusmn; 4.32 % of Ovx vs 20.15 \u0026plusmn; 2.74 % of Sham and 72.53 \u0026plusmn; 2.81 % of OP vs 21.89 \u0026plusmn; 2.63 % of Normal, respectively,\u003cem\u003e \u003c/em\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, Fig. 3d). However, administration of a DNMT inhibitor SGI-1027 to Ovx mice significantly reduced the methylation levels (43.07 \u0026plusmn; 3.44 % of SGI/Ovx vs 73.03 \u0026plusmn; 2.99 % of Ovx, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, Fig. 3e). To confirm the results, we performed BSP, the gold standard of DNA methylation measurement that detects individual CpG site. The results showed that Ovx caused an increase of \u003cem\u003eGpx4 \u003c/em\u003epromoter methylation from 3.19 \u0026plusmn; 1.57 % to 31.23 \u0026plusmn; 1.26 %, but SGI-1027 treatment lowered the level to 14.74 \u0026plusmn; 1.05 %, P \u0026lt; 0.05 (Fig. 3f). These results indicate that the GPX4 suppression was mainly caused by DNMT aberrations-incurred promoter hypermethylation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3. KLF5 is a potential co-regulator of the Gpx4 transcriptional inhibition\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo understand the regulatory mechanisms of the DNMT-incurred \u003cem\u003eGpx4 \u003c/em\u003etranscriptional inhibition, we analyzed the mouse \u003cem\u003eGpx4\u003c/em\u003e promoter by AnimalTFBD (http://bioinfo.life.hust.edu.cn/AnimalTFDB#!) that predicts the potential binding sites for both transcriptional and co-transcriptional regulators. The results showed that mouse \u003cem\u003eGpx4\u003c/em\u003e proximate promoter contained a numerous potential binding motifs for various transcriptional factors, including Sp1, C/EBP\u0026beta; and NF-1C, and transcriptional co-repressors known to participate in epigenetic gene transcriptional inhibition. Among them a Kruppel- like factor 5 (KLF5) motif was close to the transcriptional stating site with a very high binding score (-43/gccccgccca, score 19.303, Fig.3a). KLF5 plays critical roles in various cancers \u003csup\u003e36\u003c/sup\u003e and is capable of either positively or negatively regulate the downstream gene transcription \u003csup\u003e37\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e38\u003c/sup\u003e. However its regulations of ferroptosis or bone metabolisms are largely unknown. We found that the expressions of KLF5, but not KLF2 of similar binding specificity, as well as transcriptional co-repressor NCoR, SMRT and SnoN, were upregulated in Ovx femurs (Fig.3b). Subsequently, we performed chromatin immunoprecipitation assay (ChIP) and found that KLF5 together with NCoR and SnoN, but not SMRT, inducibly bound to the KLF5 motif region of the \u003cem\u003eGpx4 \u003c/em\u003epromoter in Ovx femurs, but SGI-1027 treatment significantly reduced the bindings (Fig.3c and d). Further, primary osteoblasts treated with ferric ammonium citrate (FAC) known to mimic iron overloading and induce ferroptosis \u003csup\u003e39\u003c/sup\u003e also exhibited KLF5 upregulation, GPX4 suppression and 4-HNE induction. A KLF5-selective inhibitor ML264, however, significantly reduced the alterations (Fig.3e and f). In addition, we also constructed a \u003cem\u003eGpx4\u003c/em\u003e promoter/luciferase reporter plasmid (Fig.3a) and found that the reporter transfected into osteoblastics displayed reduced luciferase activity upon FAC treatment, which was relieved partially by SGI-1027, coincidentally a KLF5-selective inhibitor ML264 partially blocked the reduction (Fig. 3g). Taken together, these results suggest that the DNMT-incurred \u003cem\u003eGpx4 \u003c/em\u003etranscriptional inhibition is at least partially mediated by KLF5 with NCoR and SnoN participations. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e4. DNMT inhibition by SGI-1027 derepresses GPX4 and protects Ovx mice from ferroptotic osteoporosis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain further insight into the functional relevance of the GPX4 suppressionand ferroptosis in OP pathogenesis, we treated the control and Ovx mice with or without SGI-1027 (6 weeks, 6 animals in each group), and found that Ovx-incurred osteoporotic alterations of trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), thickness (Tb,Th) and bone separation (Tb.Sp), as well as the TUNEL assays, were effectively corrected by SGI-1027 (Fig. 4a and b). Consistently, SGI-1027 also significantly reduced the Ovx-induced adverse expressions of GPX4 and the lipid peroxidation marker MDA (malondialdehyde), the osteoblast marker collagen 1 (Col1) and osteopontin (OPN) and the osteoclast marker NFATc1 and ACP5 (acid phosphatase 5, Fig. 4c and d). In addition, ferropstatin-1 (Fer-1), a lipophilic antioxidant that specifically inhibits ferroptosis by preventing lipid peroxidation without affecting other forms of regulated cell death \u003csup\u003e19\u003c/sup\u003e, also achieved similar, although less effective, anti-ferroptotic and osteoprotective effects (Fig. 4a-d). Together, these results indicate that the DNMT aberration and the GPX4 suppression-associated ferroptosis are central to the pathologies of OP. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e5. The GPX4 suppression and ferroptosis ocurr mainly in osteoblasts \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the cell nature of the GPX4 suppression and ferroptosis, we performed immunofluorescent double-staining of femurs with GPX4 plus osteoblast marker OCN (osteocalcin) or osteoclast marker CTSK, respectively. The results showed that GPX4 was co-expressed with OCN in osteoblasts, and both reduced in Ovx femurs (Fig. 5a, the left panel). In contrast, CTSK was barely detectable with discernable GPX4 co-expression in normal femurs but increased in Ovx femurs, in which GPX4 expression remained relatively high (Fig. 5a, the right panel), suggesting that GPX4 suppression mainly occurred in osteoblasts. We further isolated and cultured primary osteoblasts and osteoclasts (differentiated from bone marrow monocytes/macrophages induced by RANKL) and treated both cells with FAC, which induced the alkaline phosphatase activities in osteobalsts and increased TRAP activities in osteoclasts (Fig.5b). We found that FAC induced GPX4 suppression, 4-HNE induction and OPN reduction accompanied by the increases of all three DNMT isoforms in osteoblasts, but only DNMT1 elevation and NFATc1 induction in osteoclasts (Fig.5c and d). We also transfected the osteoblasts with individual siRNAs specifically knocking down DNMT1, DNMT3a and DNMT3b, respectively (Fig. 5e) and found that knockdown of DNMT1, DNMT3a and DNMT3b each reversed the FAC-induced GPX4 suppression (Fig.5f), suggesting all three DNMT isoforms contribute to the ferroptotic GPX4 suppression in osteoblasts. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e6. The GPX4 inactivation by RSL3 blunts the anti-ferroptosis effects of DNMT inhibition \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the critical role of GPX4 preservation by SGI-1027 in osteoblastic ferroptosis, we treated osteoblasts with FAC or RSL3 (RAS-selective lethal 3), a small molecule that induces ferroptosis via inactivating and degrading GPX4\u003cstrong\u003e\u003csup\u003e20\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e, and observed drastic GPX4 suppression and 4-HNE induction (Fig.6a). However, \u003c/strong\u003eSGI-1027 significantly corrected the abnormal GPX4 and 4-HNE alterations induced by FAC, but not by RSL3 (Fig.6a and 6b). To confirm the osteoblast ferroptosis, we performed TUNEL assay and found that FAC and RSL3 induced significant increase of TUNEL-positive osteoblasts, but not osteoclasts, and SGI-1027 treatment reduced the positive cell numbers of osteoblasts induced by FAC, but not that by RSL3 (Fig.6c, the upper two panels, and 6d). We further assessed the lipid peroxidation status of osteoblasts with C11-BODIPY, a fluorescent radio-probe that monitors lipid peroxidation in live cells \u003csup\u003e40\u003c/sup\u003e. The results showed that the resting osteoblasts displayed prominent non-oxidized BODIPY (N-BOD), but barely detectable oxidized BODIPY (O-BOD). FAC or RSL3 treatment caused an inversion of the O-BODIPY/N-BODIPY distributions; however, SGI-1027 effectively corrected the inversion conferred by FAC, but not that by RSL3 (Fig.6c, the middle three panels). Furthermore, we examined the osteoblasts by EM and found that FAC and RSL3 induced the typical ferroptotic alterations, such as smaller mitochondria and demolished crista; however, SGI-1027 lightened the alterations induced by FAC, but not by RSL3 (Fig.6c, the bottom panel). Collectively, these results suggest that osteoblasts, but not osteoclasts, undergo ferroptosis under OP condition that are regulated by DNMT1/3a/3b aberration and the GPX4 suppression. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e. \u003cstrong\u003e\u003cem\u003eOsteoblast Gpx4 deficiency potentiates ferroptotic osteoporosis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo directly test the role of osteoblast \u003cem\u003eGpx4\u003c/em\u003e suppression in the ferroptotic osteoporosis, we generated a strain of osteoblast-specific \u003cem\u003eGpx4\u003c/em\u003e knockout mice by crossing \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice with collagen 1 promoter-driven Cre mice (\u003cem\u003eCol1a1\u003c/em\u003e-Cre), in which the exons 2-4 of \u003cem\u003eGpx4 \u003c/em\u003egene were deleted in osteoblasts (Fig.7a). Previous study indicated that globe \u003cem\u003eGpx4\u003c/em\u003e gene knockout was embryonically lethal \u003csup\u003e41\u003c/sup\u003e. We found that the offsprings (more than 70 tested) were either wild type or heterozygous \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e mice, but none was homozygous \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e by genotyping (Fig.7b), indicating that osteoblast-specific \u003cem\u003eGpx4\u003c/em\u003e depletion is also lethal. These \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e mice at 8 weeks appeared smaller, displayed lighter weights, shorter femurs (Fig.7c), reduced femoral GPX4 and adverse expressions of osteoblastic markers OPN and collagen1, but not osteoclast markers NFATc1 and ACP5 comparing to \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl \u003c/sup\u003econtrols (Fig.7d). IHC staining of osteoblast marker OCN and TRAP staining confirmed the reduced OCN intensities and unchanged the numbers of TRAP-positive cells, respectively (Fig.7e). In addition, these mice displayed altered osteoporotic parameters of BV/TV, Tb.N, Tb,Th and Tb.Sp (Fig.7e and f) and increased TUNEL-positive cells (Fig.6e, the lower panel), supporting that GPX4 deficiency potentiates osteoblastic ferroptosis and OP pathologies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e8. GPX4 derepression is essential for the anti-ferroptotic and anti-osteoporotic effects of SGI-1027\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDNMT aberrations and the SGI-1027 intervention might affect the transcription of numerous genes. We assumed that if the GPX4 derepression by SGI-1027 was critical for its anti-ferroptotic and anti-osteoporotic effects, blocking the GPX4 reactivation would eliminate the protective effects. To test the idea, we compared the anti-ferroptotic and anti-osteoporotic effects of SGI-1017 between \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/- \u003c/sup\u003emice as well as RSL3-treated \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice. Both \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/- \u003c/sup\u003emice and RSL3-treated \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice displayed the adverse femoral osteoporotic alterations of trabecular bone volume versus tissue volume (BV/TV), trabecular bone number (Tb.N), trabecular thickness (Tb,Th) and trabecular bone separation (Tb.Sp), as well as increased TUNEL positive cell ratio under basal and Ovx-conditions (Fig.8a and b). SGI-1027 treatment significantly improved the bone microstructural and TUNE staining abnormalities in \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice; however the protective effects were largely abrogated in \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e and RSL3-\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice (Fig.8a and b). Similarly, SGI-1027 significantly reduced the abnormal protein levels of GPX4, MDA, collagen I, OPN, NFATc1 and ACP5 in \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice, but the beneficial effects were largely diminished in in \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e and RSL3-\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice (Fig.8c and d). Together, these results indicate that the GPX4 preservation is essential for the anti-ferroptotic and osteoprotective effects of SGI-1027. \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eStudy of epigenetic ferroptosis in OP represents a novel approach to better understand the OP pathogenesis and potentially leads to novel therapeutic strategies. In this study, we have discovered that (1) GPX4, a key anti-ferroptotic factor, was transcriptionally suppressed in Ovx mouse femurs due to DNMT1/3a/3b elevations and subsequent GPX4 promoter hypermethylation; (2) The GPX4 suppression was co-regulated by repressive KLF5 and likely by transcriptional co-repressor NCoR and SnoN; (3) A DNMT inhibitor SGI-1027 effectively reduced the GPX4 suppression and mitigated the ferroptotic bone loss in Ovx mice; (4) The GPX4 suppression and ferroptosis occurred mainly in osteoblasts and osteoblast-specific GPX4 semi-knockout (\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e-/+\u003c/sup\u003e) incurred spontaneous and exacerbated ferroptotic OP alterations in Ovx mice, and finally (5) GPX4 pharmacoligical inactivation or semi-knockout in osteoblasts significantly diminished the protective effect of SGI-1027 against DNMT-mediated ferroptotic bone loss. Thus, our data indicate that the DNMT1/3a/3b aberration-incurred GPX4 suppression and the consequential osteoblastic ferroptosis causally impact the development of OP, which can be effectively targeted by DNA demethylating agents for therapeutic benefits.\u003c/p\u003e\n\u003cp\u003eIdentification of DNMT1/3a/3b as the critical initiators of GPX4 suppression and ferroptosis critical for OP is an important discovery of study. It is well known that both ferroptosis and OP are affected by epigenetic DNA methylation aberration \u003csup\u003e29\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e42\u003c/sup\u003e, however the mechanistic linker of these two events has been missing. Recent studies suggest that GPX4 suppression due to aberrant DNA methylation might be a decisive event of ferroptosis under ferroptotic conditions \u003csup\u003e24\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e25\u003c/sup\u003e. The actual methylation status of a particular gene promoter is regulated by a number of regulators, including methyl donors, DNA insulators, DNA methylation \u0026ldquo;writer\u0026rdquo; NDMTs, \u0026ldquo;reader\u0026rdquo; methyl-CpG-binding domain (MBD) proteins and DNA demethylating TET enzymes \u003csup\u003e43-45\u003c/sup\u003e, and the initiative \u0026ldquo;drivers\u0026rdquo; of the DNA methylation alterations in OP are unclear. Previous studies from our and other labs have reported that aberrant DNMT elevations causally affected OP \u003csup\u003e46-49\u003c/sup\u003e. In this study, we detected that the GPX4 suppression occurred substantially at transcriptional level that correlated with increased expression of all three bioactive DNMT isoforms and GPX4\u003cem\u003e \u003c/em\u003epromoter hypermethylations in the distal femurs of both OP patients and Ovx mice. We further demonstrated that individual knockdown of DNMT1/3a/3b significantly reduced the GPX4 suppression and lipid peroxidation in osteoblasts, and a pan-DNMT inhibitor SGI-1027 effectively corrected the GPX4 promoter hypermethylation, GPX4 suppression and the ferroptotic OP alterations in Ovx mice, which were abrogated when GPX4 was genetically-deficient or pharmacologically-inactivated (Fig.8). These are strong evidence that DNMT1/3a/3b aberration-driven GPX4 suppression and ferroptosis contribute substantially to OP pathologies. \u003c/p\u003e\n\u003cp\u003eOsteo-ferroptosis has been reported in OP animals of various etiologies, including estrogen deficiency such as postmenopausal OP modeled by Ovx mice, glucocorticoid and diabetic OP, which affects bone marrow mesenchymal stem cells \u003csup\u003e50\u003c/sup\u003e, osteocytes \u003csup\u003e51\u003c/sup\u003e osteoblasts\u003csup\u003e52\u003c/sup\u003e and osteoclasts \u003csup\u003e53\u003c/sup\u003e. However the cell nature of ferroptosis involved in estrogen-deficient OP has been controversial. In this study, we showed that GPX4 suppression and ferroptotic alterations mainly occurred in osteoblasts as demonstrated by immunofluorescent double-staining of femoral sections and in primarily-cultured osteoblasts, which also displayed typical ferroptotic alterations such as GPX4 suppression, abnormal lipid peroxidation and mitochondrial morphological changes that were absent from osteoclasts. This is further confirmed by osteoblast-specific \u003cem\u003eGpx4\u003c/em\u003e deficient mice that developed spontaneous and worse ferroptotic OP alterations in Ovx mice. These are consistent with the consensus that the reduced osteoblastic cell numbers and activities break the balanced of osteoblastogenesis and osteoclastogenesis, leading to OP. \u003c/p\u003e\n\u003cp\u003eRevealing of KLF5 as a transcriptional co-regulator critically involved in DNA methylation-associated Gpx4 suppression has provided meaningful information regarding the DNA methuylation-incurred transcriptional silencing of the downstream genes. DNA methylation-incurred gene transcriptional inhibition is mediated by a transcriptional repressive complex containing multiple transcriptional repressors and co-regulators that might confer the gene specificity \u003csup\u003e28\u003c/sup\u003e. KLF5 is well documented for its regulation of multiple cellular processes, including the cell cycle and proliferation, apoptosis and autophagy, migration and invasion, and stemness and differentiation \u003csup\u003e36\u003c/sup\u003e, via either positively or negatively regulating the transcription of target genes \u003csup\u003e54\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e55\u003c/sup\u003e. We found that Gpx4 promoter contains a strong KLF5 motif and KLF5 together with transcriptional co-repressor NCoR and SnoN inducibly bound to the hypermethylated Gpx4 promoter in OP femurs that is sensitive to DNMT inhibition (Fig.3). We further showed that KLF5 inhibition by ML264 partially relieved the GPX4 suppression in osteoblasts. These data support that KLF5, NCoR and SnoN might be the core components of the transcriptional repressive complex that mediates the DNA methylation-incurred Gpx4 transcriptional suppression in OP. \u003c/p\u003e\n\u003cp\u003eIt is noteworthy that our study has revealed an important feature of epigenetic osteoblast ferroptosis in OP pathogenesis, but some important questions remain to be answered. For example, GPX4 suppression is affected by many known and unkonwn ferroptotic stimulations and it is unclear which upstream network actually induced the DNMT aberration. It is also unclear how epigenetic DNMT alterations differentially affect ferroptosis of osteoblasts versus osteocytes and osteoclasts under OP conditions and whether the DNMT aberration-incurred ferroptosis is unique to Ovx mice or a general OP character of all etiologies, which warrant further investigation. \u003c/p\u003e\n\u003cp\u003eIn conclusion, the results from our study demonstrate that aberrant DNMT1/3a/3b elevations and subsequent GPX4 suppression play a decisive role in osteoblastic ferroptosis that contributes significantly to OP. Since epigenetic modifications are reversible and DNA demethylating drugs such as 5-azacytidine and 5-aza-2-deoxycytidine (decitabine) have been approved for clinical treatment of myelodysplastic syndromes and chronic myelomonocytic leukemia \u003csup\u003e56\u003c/sup\u003e, our results also suggest that targeting epigenetic GPX4 suppression and ferroptosis by DNMT intervention might be a feasible and effective strategy to treat patients with OP and the related bone disorders. \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimal and treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe use of animals and the experimental protocols were approved by the Animal Care Committee of Nanjing University in accordance with the Institutional Animal Care and Use guidelines (2020AE01113). C57BL/6J mice were from Gempharmatech Co., Ltd., Nanjing, China. We intended to generate osteoblastic \u003cem\u003eGpx4\u003c/em\u003e knockout mice by crossing\u003cem\u003e \u003c/em\u003e\u003cem\u003eGpx4\u003c/em\u003e-flox mice (\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e, Strain NO. T050827) and \u003cem\u003eCol1a1\u003c/em\u003e-Cre mice (Strain NO. T004734, both were of C57BL/6J background, GemPharmatech, Nanjing, China), but only obtained \u003cem\u003eGpx4\u003c/em\u003e haplo-deficient (\u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e-/+\u003c/sup\u003e) progenies. The PCR genotyping was performed on mouse toe DNAs with primers F1: GTACTGCAACAGCTCCGAGTTC; R1: ACTTATCCAGGCAGACCATGTG; R2: AACTCCAATTCCCAGGACTCAC as depicted in figure 7A. All mice were housed under specific pathogen-free and standard 25 \u0026plusmn; 2 \u0026deg;C, 50 \u0026plusmn; 5% humidity and a 12 h/12 h light/dark cycle conditions.\u003c/p\u003e\n\u003cp\u003eA mouse OP model was established with a bilateral ovariectomy protocol \u003csup\u003e33\u003c/sup\u003e. Briefly, the experimental mice were anesthetized with isoflurane and the bilateral ovaries of Ovx mice were removed through a midline incision of the skin and flank incisions of the peritoneum. The skin incision was then closed with metallic clips. Sham operation was processed similarly without ovary removal. For intervention study, female C57BL/6J mice of around 10-12 weeks old were divided into four groups: (1) Sham surgery group; (2) SGI-1027 (2.5 mg/kg, HY-13962) or Ferrostatin-1 (Fer-1, 5 mg/kg, HY-100579) from MCE, USA, dissolved in 2% DMSO, 30% PEG 300 and 2% Tween 80 administered by daily intraperitoneal injection; (3) The Ovx group; (4) SGI-1027/Fer-1 intervention group. For assay to determine the role of GPX4 in SGI-1027 intervention, C57BL/6J mice treated with or without RSL3 (100 mg/kg, HY-100218A, MCE, USA), or \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003e-/+\u003c/sup\u003e mice and the control \u003cem\u003eGpx4\u003c/em\u003e\u003csup\u003efl/fl \u003c/sup\u003ewere subjected to sham, Ovx and SGI-1027 intervention described above. The experiments went for six weeks, and then mice were sacrificed by excessive isoflurane and the mouse femurs were collected and stored at -80\u003csup\u003eo\u003c/sup\u003eC or treated with paraformaldehyde for further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman samples were collected from the Northern Jiangsu People\u0026apos;s Hospital, the Teaching Hospital of Nanjing University Medical School. OP is defined as a T score of \u0026le;\u0026minus;2.5, and a T score of \u0026ge;\u0026minus;1 is considered normal bone density according to the National Osteoporosis Foundation. Osteoporotic lumbar were obtained from 6 female patients with lumbar fracture who received percutaneous vertebroplasty (62\u0026ndash;82 years old) with an average bone densitometry T score of \u0026minus;3.9 (\u0026minus;3.6, \u0026minus;4.8, \u0026minus;4.4, \u0026minus;4.5, \u0026minus;3.8 and \u0026minus;2.8). The control non-OP lumbar were from six age-matched patients receiving internal fixation treatment (58\u0026ndash;79 years old) with an average T score of \u0026minus;0.5 (\u0026minus;0.3, \u0026minus;0.6, \u0026minus;0.2, \u0026minus;0.6, -0.3 and \u0026minus;0.9). The T scores were determined by dual energy X-ray absorptiometry. The samples were stored at \u0026minus;80\u0026thinsp;\u0026deg;C before further protein, histology and MSP analyses. The study was approved by the ethics committee of the Northern Jiangsu People\u0026apos;s Hospital (2023ky232), and written informed consent was received from all subjects. Patients or members of the public are not involved in the design, conduct, reporting, or dissemination plans of the research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBone micro-CT analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTrabecular microstructure analysis was performed as described previously \u003csup\u003e57\u003c/sup\u003e with freshly-removed mouse right femurs fixed in 4% paraformaldehyde for 24\u0026thinsp;h. The micro-CT scanner (Scanco Medical, Bruettisellen, Switzerland) was set at 55 kV, 145 \u0026mu;A and 15.6 \u0026mu;m voxel with 250 ms integration time. Femoral mid-diaphysis above the growth plate and distal metaphysis were selected as the region of interest (ROI). For each sample, a total of 100 slices were evaluated to generate the three dimensional (3D) trabecular images, and ratio of the sectional trabecular volume to total bone tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp) were calculated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological, immunohistochemical (IHC), Perl\u0026apos;s Prussian blue, TUNEL and immunofluorescent staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mouse femural sections were processed with hematoxylin and eosin (H\u0026amp;E), Perl\u0026apos;s Prussian blue or IHC staining essentially as described before \u003csup\u003e58\u003c/sup\u003e. For IHC staining, the sectioned slides were incubated overnight at 4\u0026thinsp;\u0026deg;C with primary antibodies against GPX4 (A11243, Abclonal, China), osteocalcin (OCN, 23418-1-AP, proteintech, China), and then with HRP-conjugated secondary antibodies. Afterward, the slides were processed with a DAB horseradish peroxidase color development kit (PR30010, proteintech, china) and counterstained with hematin, the IHC Profiler plug-in in Image J was used to automatically score the staining status of samples (High positive (3), Positive (2), Low Positive (1) and Negative (0)). Perl\u0026apos;s Prussian blue staining (G1029, Servicebio, china) and TUNEL (TdT-mediated dUTP Nick-End Labeling, A111-01, Vazyme, China) followed the instructions in the kit. The percentages of TUNEL-positively-stained cells over total cells from 10 randomly-selected fields were counted in a double-blinded manner.\u003c/p\u003e\n\u003cp\u003eImmunofluorescent double-staining of murine femural sections were performed essentially as before \u003csup\u003e59\u003c/sup\u003e. The sections were first incubated overnight with primary antibody mouse anti-GPX4 (67763-1-Ig, proteintech, China) plus rabbit anti-OCN or rabbit anti-CTSK (11239-1-AP, proteintech, China), respectively. Next day, the sections were incubated with secondary antibody CoraLite488-conjugated Goat Anti-Rabbit IgG (SA00013-2, Proteintech, China) and CoraLite594-conjugated goat anti-mouse IgG (SA00013-3, Proteintech, China) followed by nuclear DAPI (C1005, Beyotime, China) staining. A laser confocal microscope (Olympus, Tokyo, Japan) was used for image capturing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA sequencing data analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe downloaded the transcriptome data of bone tissue from Sham and Ovx mice (https://ngdc.cncb.ac.cn/gsa/browse/CRA007214). The reads from mice data were aligned against mm10 genome assembly with hisat 2.1.0. SAM files were sorted and converted to BAM with samtools v1.4. Reads with QS \u0026lt; 20 were excluded. For each sample, unique map reads with map quality score \u0026ge;20 were reserved for subsequent analyses. HT Seq Python package (version 0.9.1) was used to count the number of reads of a unique map for each gene. The DESeq2 R package was used to perform differential expression analysis. Differentially expressed genes (DEGs) were assessed by |log2FC|\u0026ge;1 and P value \u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission Electron microscopy (TEM) examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFresh murine femurs were placed in a fixative containing 2% PFA and 2.5% glutaraldehyde (G5882, Sigma-Aldrich, USA), rinsed sequentially according to a conventional TEM sample preparation protocol, and fixed again in 1% osmium tetroxide. After dehydration and embedding in Epon812 (45345, Sigma-Aldrich,USA), the ultrathin sections were stained with lead citrate and uranyl acetate and observed under JEOL-1200EX microscope (Japan) at Shandong Weiya Laboratory, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary Cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary osteoblasts were extracted as previously described \u003csup\u003e60\u003c/sup\u003e from 3-day-young mice. Briefly, calvarial bones were dissected and digested with 0.1% collagenase type I (SCR103, Sigma, USA) for three rounds after periosteum removal, and the final cell pellets were collected and cultured in fresh \u0026alpha;-MEM media (SH30265.01B, HyClone, USA) containing 10% FBS(FSD500, ExCell, China) and 1% penicillin/ streptomycin(15140122, Gibco, USA). For osteoblast differentiation, the cells were changed the medium to osteogenic medium (PD-003; Procell, Wuhan, China)which contain 50 \u0026mu;g/mL ascorbic acid, 5 mM \u0026beta;-glycerophosphate, and 10 nM dexamethasone.\u003c/p\u003e\n\u003cp\u003eFor primary osteoclast culture, bone marrow monocytes (BMMs) were isolated from 3-week-old mice by flushing the bone marrow of long bones and cultured in complete \u0026alpha;-MEM medium containing 10% FBS and M-CSF (Macrophage colony-stimulating factor, 30 ng/mL, CB34, Novoprotein, China) as before \u003csup\u003e61\u003c/sup\u003e. Three days later, RANKL (Receptor activator for nuclear factor-\u0026kappa;B ligand, 50 ng/mL, CR06, Novoprotein, China) was added to induce osteoclast differentiation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e ALP or TRAP activity staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor osteoblast ALP activity assay, FAC was added for 48 hours, washed with phosphate-buffered saline (PBS) and then fixed with 4% formaldehyde for 15 min. After rinsing with PBS again, cells were stained for ALP activity with the BCIP/NBT ALP color development kit (Beyotime, Nanjing, China). Image J software was used to evaluate the positively stained areas over the total areas from 5 predetermined fixed locations.\u003c/p\u003e\n\u003cp\u003eFor osteoclast TRAP activity assay, the differentiated primary osteoclast treated with FAC for 48 h or mouse femoral sections were fixed with 4% paraformaldehyde and stained for TRAP activities with a commercial kit (Sigma, 387A-1 KT, USA) according to the manufacturer\u0026apos;s instructions. For primary osteoclast staining, the positively stained cell areas over the whole fields from 5 pre-set fixed locations were quantified using Image J software. For mouse femural staining, the sections were counterstained with methyl green and the average numbers of TRAP-positively stained cells in 10 randomly selected fields were calculated in a double-blind manner.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC11-BODIPY staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA fluorescent radioprobe C11-BODIPY(581/591, D3861, Thermo Fisher, USA) was used to assess lipid peroxidation in osteoblasts. Briefly, the primary osteoblasts inoculated in 6-well plates under various treatments were treated with C11-BODIPY dye (10 \u0026mu;M dissolved in DMSO) for 1 hour at 37\u003csup\u003eo\u003c/sup\u003eC in dark. After excess C11-BODIPY were removed by washing, the cells were observed under a confocal fluorescence microscope with excitation/emission wavelengths of 488/510 nm for oxidized BODIPY (green) and 581/591 nm for non-oxidized BODIPY (red). The average fluorescence intensities were based on six randomly-selected view fields, adjusted for the number of cells of view and.calculated using ImageJ software. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blot assays of mouse hind limb bones or cell homogenates were performed essentially as before \u003csup\u003e62\u003c/sup\u003e. The primary antibodies used were: NFATc1(AF06823) and DNMT3b (AF300068) from AiFangbiological, China; Col1 (Collagen I, GB114197) and OPN (Osteopontin, GB112328) from Servicebio, China; GPX4 (A1933), MeCP2 (A0707) and \u0026beta;-actin (AC026) from ABclonal, China; 4-HNE (4 Hydroxynonenal, ab46545, Abcam, Cambridge, UK); MDA (Malondialdehyde, abx445120, Abbexa, Cambridge, UK); CTSK (DF6614), KLF5 (AF7542), KFL2 (DF13602), NCoR (AF0270) SMRT (DF8896), SnoN (DF3088) from Affinity Biosciences, China. The horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from proteintech, China. Western blots were visualized with fully automated chemiluminescence image analysis system (5200, Tanon, China) and the protein quantities were analyzed by Image J software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethylated specific PCR (MSP) and bisulfite-sequencing PCR (BSP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrediction of CpG islands in \u003cem\u003eGpx4 \u003c/em\u003epromoters and primer design for methylation-specific PCR (MSP) and bisulfite-sequencing PCR (BSP) were performed with online software MethPrimer (www.urogene.org/methprimer). DNeasy Blood \u0026amp; Tissue Kit (69504, QIAGEN, Germany) was used to isolated total DNA, and DNA Bisulfite Conversion Kit (DP215, TIANGEN Biotech, China) was used to convert unmethylated cytosine to uracil according to manufacturer\u0026rsquo;s instructions. MSP and BSP were performed following previously-established protocols \u003csup\u003e63\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe mouse \u003cem\u003eGpx4 \u003c/em\u003epromoter methylation was assayed by MSP with methylated forward primer 5\u0026rsquo;-TTTTTTAAGGGGATGATTTTGATAC (-247/-223) and reverse primer 5\u0026rsquo;- ATACCCAATAATAAAAACGCGA A (-78/-100); unmethylated forward primer 5\u0026rsquo;-TTTTAAGGGGATGATTTTGATATGT (-245/-221) and reverse primer 5\u0026rsquo;-CATACC CAATAATAAAAACACAAA (-77/-100); and input DNA control forward primer 5\u0026rsquo;-CTCTTTAAGGGGATGACTTTGACAC and reverse primer 5\u0026rsquo;-ATGCCCAGTGAT AGGGACGCGGG. The human \u003cem\u003eGPX4\u003c/em\u003e promoter methylation was assayed by MSP with methylated forward primer 5\u0026rsquo;-AGTATTTTTAGGTTGTTTGGTTTGC (7/33) and reverse primer 5\u0026rsquo;-CGAACGTACGAACTTATTATTAACGA (152/179); unmethylated forward primer 5\u0026rsquo;-GTATTTTTAGGTTGTTTGGTTTGTG (8/34) and reverse primer 5\u0026rsquo;- CAAA CATACAAACTTATTATTAACAAC (152/180); and input DNA control forward primer 5\u0026rsquo;-TAGACACAAGCGA GCATGCGCAGTC and reverse primer 5\u0026rsquo;- CCAGAGCGCTCATTGGTCAGACG. The PCR products were analyzed on a 2% agarose gel and visualized under ultraviolet light, and densitometric analysis was performed using ImageJ software. The methylation status was assayed by BSP with forward primer 5\u0026rsquo;- GTTTTTTAAGGGGATGATTTTGATA (-248/-224) and reverse primer 5\u0026rsquo;- CCCTACAA CCAATAAA AAACTAAATA (5/-22). The PCR products were separated by electrophoresis, and the target DNA fragments were purified and cloned into pGEM T Easy Vector (A1360; Promega). Five colonies from each mouse/PCR reaction were randomly chosen for sequencing, and the percentages of methylated cytosines over total cytosines within the cloned fragment were calculated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription-polymerase chain reaction (RT-PCR) \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA from mouse and human bone tissues was extracted essentially as before \u003csup\u003e64\u003c/sup\u003e. After cDNA synthesis, PCR was performed with following mouse \u003cem\u003eGpx4\u003c/em\u003e primers \u003cem\u003eGpx4\u003c/em\u003eF: CCCATTCCTGAACCTTTCAA and \u003cem\u003eGpx4\u003c/em\u003eR: GCACACGAAACCCCT GTACT; \u003cem\u003eActb\u003c/em\u003eF: GATCATTGCTCC TCCTGAGC and \u003cem\u003eActb\u003c/em\u003eR: TGCACCGCAAGTGCT TCTA as internal control and human \u003cem\u003eGPX4\u003c/em\u003e primers \u003cem\u003eGpx4\u003c/em\u003eF: GAAGCAGGAGCCAG GGAGTA and \u003cem\u003eGpx4\u003c/em\u003eR: ATGGCATTTCCCAGGATGCC; \u003cem\u003eActb\u003c/em\u003e primers \u003cem\u003eActb\u003c/em\u003eF: GCCTT CCTTCCTGGGCAT and \u003cem\u003eActb\u003c/em\u003eR: CTTCATTGTGCTGGGTGCC, respectively. PCR products were resolved on a 1.5% agarose gel and visualized under UV light.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChromatin immunoprecipitation (ChIP)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChIP assay was performed with mouse bone tissues as before \u003csup\u003e65\u003c/sup\u003e. The immunoprecipitation was performed with ChIP quality antibodies to KLF5, NCoR , SMRT and SnoN. The starting (input) and immunoprecipitated DNAs were analyzed by PCR and quantitative real-time PCR (qRT-PCR) using primer sets for \u003cem\u003eGpx4\u003c/em\u003e promoter (Forward, 5\u0026rsquo;-GGGGATGACTTTGACACGC and Reverse, 5\u0026rsquo;-GCCTGAATGAAGGGA CGG, which covered the -239 to -14 locus containing a putative KLF5 binding motif (-43/gccccgccca). Regular PCR products were separated on 1.5% agarose gels and analysis of PCR product densitometry were performed with Image J Software. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary osteoblasts were transiently transfected (FuGENE\u0026reg; HD Transfection Reagent, Promega, USA) with \u003cem\u003eGpx4\u003c/em\u003e promoter reporter plasmid \u003cem\u003eGpx4\u003c/em\u003ep-luc (containing 2000 bp of the\u003cem\u003e Gpx4 \u003c/em\u003eproximal promoter, costumer-constructed by Genechem, China) plus a renilla luciferase reporter (Genechem, China) as internal control. After the cells received various treatments, the luciferase activities from cell lysates were assayed using a dual luciferase reporter assay kit (Promega, USA). The luciferase activities of \u003cem\u003eGpx4\u003c/em\u003ep-luc were normalized to renilla luciferase levels and expressed as relative fold changes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data normal distribution and assumption of homogeneity of variances were assessed by Shapiro-Wilk test and Levene\u0026rsquo;s test, respectively. The data quantitation and graphic plotting were accomplished with GraphpadPrism. Main effect P and effect size \u0026eta;\u003csup\u003e2\u003c/sup\u003e (large effect size, \u0026eta;\u003csup\u003e2\u003c/sup\u003e \u0026ge;0.1379; medium effect size, 0.0588 \u0026le; \u0026eta;\u003csup\u003e2\u003c/sup\u003e \u0026lt; 0.1379; small effect size, 0.0099 \u0026le; \u0026eta;\u003csup\u003e2\u003c/sup\u003e \u0026lt; 0.0588) were calculated by SPSS V22.0 software. Data were expressed as means \u0026plusmn; SEM for animal studies or \u0026plusmn; SD for cell assays. The Box-and-whisker plots were defined as follows: midline represents median, box is the 25\u003csup\u003eth\u003c/sup\u003e-75\u003csup\u003eth\u003c/sup\u003e percentiles, and whiskers are minimum and maximum. The group differences were analyzed by Student\u0026rsquo;s t test, two-way ANOVA, or two-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test. The thresholds of P \u0026lt; 0.05 were set as statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eContributions:\u0026nbsp;\u003c/strong\u003e BR, JD and FW conducted the assays, acquired and analyzed the data and drafted the manuscript. ZH, LZ and BY provided technical support and assistance. CL and HD contributed reagents and provided scientific insight and discussion. WC conceived, designed and supervised the study, arranged and interpreted the results, and wrote the manuscript. HW and YW provided supervision and research resources. All authors approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statements\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA-seq data: China National Center for Bioinformation CRA007214 (https://ngdc.cncb.ac.cn/gsa/browse/CRA007214)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eThis work was supported by the National Key Research and Development Program of China (2023YFB3810200, 2023YFB3810204), the National Natural Science Foundation of China (82272502, 82072423, 81970577)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests:\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eThe authors have declared that no conflict of interest exists.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMARCU, F., BOGDAN, F., MUŢIU, G. \u0026amp; LAZĂR, L. The histopathological study of osteoporosis \u003cem\u003eRom J Morphol Embryol\u003c/em\u003e\u003cstrong\u003e52\u003c/strong\u003e, 321-325 (2011).\u003c/li\u003e\n\u003cli\u003eSalari, N.\u003cem\u003e et al.\u003c/em\u003e The global prevalence of osteoporosis in the world: a comprehensive systematic review and meta-analysis. \u003cem\u003eJournal of Orthopaedic Surgery and Research\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, doi:10.1186/s13018-021-02772-0 (2021).\u003c/li\u003e\n\u003cli\u003eRouf, R. S. B., Qureshi, N. K., Afsana, F. \u0026amp; Ferdous, H. S. Osteoporosis: A Review. \u003cem\u003eBIRDEM Medical Journal\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e, 30-36, doi:10.3329/birdem.v5i1.28371 (2016).\u003c/li\u003e\n\u003cli\u003eWauquier, F., Leotoing, L., Coxam, V., Guicheux, J. \u0026amp; Wittrant, Y. Oxidative stress in bone remodelling and disease. \u003cem\u003eTrends in Molecular Medicine\u003c/em\u003e\u003cstrong\u003e15\u003c/strong\u003e, 468-477, doi:10.1016/j.molmed.2009.08.004 (2009).\u003c/li\u003e\n\u003cli\u003eHameister, R., Kaur, C., Dheen, S. T., Lohmann, C. H. \u0026amp; Singh, G. Reactive oxygen/nitrogen species (ROS/RNS) and oxidative stress in arthroplasty. \u003cem\u003eJournal of Biomedical Materials Research Part B: Applied Biomaterials\u003c/em\u003e\u003cstrong\u003e108\u003c/strong\u003e, 2073-2087, doi:10.1002/jbm.b.34546 (2020).\u003c/li\u003e\n\u003cli\u003eWang, Z.\u003cem\u003e et al.\u003c/em\u003e Autophagy mediated CoCrMo particle-induced peri-implant osteolysis by promoting osteoblast apoptosis. \u003cem\u003eAutophagy\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 2358-2369, doi:10.1080/15548627.2015.1106779 (2016).\u003c/li\u003e\n\u003cli\u003ePellegrini, G., Morales, C., Wallace, T., Plotkin, L. \u0026amp; Bellido, T. Avenanthramides Prevent Osteoblast and Osteocyte Apoptosis and Induce Osteoclast Apoptosis in Vitro in an Nrf2-Independent Manner. \u003cem\u003eNutrients\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 423, doi:10.3390/nu8070423 (2016).\u003c/li\u003e\n\u003cli\u003eKomori, T. Cell Death in Chondrocytes, Osteoblasts, and Osteocytes. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e\u003cstrong\u003e17\u003c/strong\u003e, 2045, doi:10.3390/ijms17122045 (2016).\u003c/li\u003e\n\u003cli\u003eCui, J.\u003cem\u003e et al.\u003c/em\u003e Regulated cell death: discovery, features and implications for neurodegenerative diseases. \u003cem\u003eCell Communication and Signaling\u003c/em\u003e\u003cstrong\u003e19\u003c/strong\u003e, doi:10.1186/s12964-021-00799-8 (2021).\u003c/li\u003e\n\u003cli\u003eZou, D.-B., Mou, Z., Wu, W. \u0026amp; Liu, H. TRIM33 protects osteoblasts from oxidative stress-induced apoptosis in osteoporosis by inhibiting FOXO3a ubiquitylation and degradation. \u003cem\u003eAging Cell\u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, e13367, doi:10.1111/acel.13367 (2021).\u003c/li\u003e\n\u003cli\u003eMa, Y.\u003cem\u003e et al.\u003c/em\u003e Autophagy controls mesenchymal stem cell properties and senescence during bone aging. \u003cem\u003eAging Cell\u003c/em\u003e\u003cstrong\u003e17\u003c/strong\u003e, doi:10.1111/acel.12709 (2018).\u003c/li\u003e\n\u003cli\u003eTao, Z.\u003cem\u003e et al.\u003c/em\u003e Pyroptosis in Osteoblasts: A Novel Hypothesis Underlying the Pathogenesis of Osteoporosis. \u003cem\u003eFrontiers in Endocrinology\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, doi:10.3389/fendo.2020.548812 (2021).\u003c/li\u003e\n\u003cli\u003eCui, H.\u003cem\u003e et al.\u003c/em\u003e Necrostatin-1 treatment inhibits osteocyte necroptosis and trabecular deterioration in ovariectomized rats. \u003cem\u003eSci Rep\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 33803, doi:10.1038/srep33803 (2016).\u003c/li\u003e\n\u003cli\u003eYan, C.\u003cem\u003e et al.\u003c/em\u003e Research Progress of Ferroptosis Regulatory Network and Bone Remodeling in Osteoporosis. \u003cem\u003eFrontiers in Public Health\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, doi:10.3389/fpubh.2022.910675 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, P.\u003cem\u003e et al.\u003c/em\u003e Ferroptosis: A New Regulatory Mechanism in Osteoporosis. \u003cem\u003eOxidative Medicine and Cellular Longevity\u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, 2634431, doi:10.1155/2022/2634431 (2022).\u003c/li\u003e\n\u003cli\u003eZhang, W., Wang, C., Zhu, W., Liu, F. \u0026amp; Liu, Y. Ferrostatin-1 alleviates cytotoxicity of cobalt nanoparticles by inhibiting ferroptosis. \u003cem\u003eBioengineered\u003c/em\u003e\u003cstrong\u003e13\u003c/strong\u003e, 6163-6172, doi:10.1080/21655979.2022.2042143 (2022).\u003c/li\u003e\n\u003cli\u003eLi, Y.\u003cem\u003e et al.\u003c/em\u003e Carnosol suppresses RANKL-induced osteoclastogenesis and attenuates titanium particles-induced osteolysis. \u003cem\u003eJournal of Cellular Physiology\u003c/em\u003e\u003cstrong\u003e236\u003c/strong\u003e, 1950-1966, doi:10.1002/jcp.29978 (2020).\u003c/li\u003e\n\u003cli\u003eXu, Y.\u003cem\u003e et al.\u003c/em\u003e CoCrMo-Nanoparticles induced peri-implant osteolysis by promoting osteoblast ferroptosis via regulating Nrf2-ARE signalling pathway. \u003cem\u003eCell Proliferation\u003c/em\u003e\u003cstrong\u003e54\u003c/strong\u003e, e13142., doi:10.1111/cpr.13142 (2021).\u003c/li\u003e\n\u003cli\u003eMiotto, G.\u003cem\u003e et al.\u003c/em\u003e Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. \u003cem\u003eRedox Biology\u003c/em\u003e\u003cstrong\u003e28\u003c/strong\u003e, 101328, doi:10.1016/j.redox.2019.101328 (2020).\u003c/li\u003e\n\u003cli\u003eFriedmann Angeli, J. P.\u003cem\u003e et al.\u003c/em\u003e Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. \u003cem\u003eNature Cell Biology\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, 1180-1191, doi:10.1038/ncb3064 (2014).\u003c/li\u003e\n\u003cli\u003eJiang, X., Stockwell, B. R. \u0026amp; Conrad, M. Ferroptosis: mechanisms, biology and role in disease. \u003cem\u003eNature Reviews Molecular Cell Biology\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 266-282, doi:10.1038/s41580-020-00324-8 (2021).\u003c/li\u003e\n\u003cli\u003eDixonl, S. J. \u0026amp; Stockwell, B. R. The Hallmarks of Ferroptosis. \u003cem\u003eAnnual Review of Cancer Biology\u003c/em\u003e\u003cstrong\u003e3\u003c/strong\u003e, 35-54, doi:10.1146/annurev-cancerbio030518-055844 (2019).\u003c/li\u003e\n\u003cli\u003eStockwell, B. R.\u003cem\u003e et al.\u003c/em\u003e Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. \u003cem\u003eCell\u003c/em\u003e\u003cstrong\u003e171\u003c/strong\u003e, 273-285, doi:10.1016/j.cell.2017.09.021 (2017).\u003c/li\u003e\n\u003cli\u003eZhang, X.\u003cem\u003e et al.\u003c/em\u003e Homocysteine induces oxidative stress and ferroptosis of nucleus pulposus via enhancing methylation of GPX4. \u003cem\u003eFree Radical Biology and Medicine\u003c/em\u003e\u003cstrong\u003e160\u003c/strong\u003e, 552-565, doi:10.1016/j.freeradbiomed.2020.08.029 (2020).\u003c/li\u003e\n\u003cli\u003eZeng, Z.\u003cem\u003e et al.\u003c/em\u003e DNA dioxygenases TET2 deficiency promotes cigarette smoke induced chronic obstructive pulmonary disease by inducing ferroptosis of lung epithelial cell. \u003cem\u003eRedox Biol\u003c/em\u003e\u003cstrong\u003e67\u003c/strong\u003e, 102916, doi:10.1016/j.redox.2023.102916 (2023).\u003c/li\u003e\n\u003cli\u003eOton-Gonzalez, L.\u003cem\u003e et al.\u003c/em\u003e Genetics and Epigenetics of Bone Remodeling and Metabolic Bone Diseases. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 1500, doi:10.3390/ijms23031500 (2022).\u003c/li\u003e\n\u003cli\u003eLudwig, A. K., Zhang, P. \u0026amp; Cardoso, M. C. Modifiers and Readers of DNA Modifications and Their Impact on Genome Structure, Expression, and Stability in Disease. \u003cem\u003eFrontiers in Genetics\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, doi:10.3389/fgene.2016.00115 (2016).\u003c/li\u003e\n\u003cli\u003eMoore, L. D., Le, T. \u0026amp; Fan, G. DNA Methylation and Its Basic Function. \u003cem\u003eNeuropsychopharmacology\u003c/em\u003e\u003cstrong\u003e38\u003c/strong\u003e, 23-38, doi:10.1038/npp.2012.112 (2012).\u003c/li\u003e\n\u003cli\u003eLetarouilly, J.-G., Broux, O. \u0026amp; Clabaut, A. New insights into the epigenetics of osteoporosis. \u003cem\u003eGenomics\u003c/em\u003e\u003cstrong\u003e111\u003c/strong\u003e, 793-798, doi:10.1016/j.ygeno.2018.05.001 (2019).\u003c/li\u003e\n\u003cli\u003eReppe, S.\u003cem\u003e et al.\u003c/em\u003e Distinct DNA methylation profiles in bone and blood of osteoporotic and healthy postmenopausal women. \u003cem\u003eEpigenetics\u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e, 674-687, doi:10.1080/15592294.2017.1345832 (2017).\u003c/li\u003e\n\u003cli\u003eVisconti, V. V.\u003cem\u003e et al.\u003c/em\u003e DNA Methylation Signatures of Bone Metabolism in Osteoporosis and Osteoarthritis Aging-Related Diseases: An Updated Review. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 4244, doi:10.3390/ijms22084244 (2021).\u003c/li\u003e\n\u003cli\u003eLee, J., You, J. H., Kim, M.-S. \u0026amp; Roh, J.-L. Epigenetic reprogramming of epithelial-mesenchymal transition promotes ferroptosis of head and neck cancer. \u003cem\u003eRedox Biology\u003c/em\u003e\u003cstrong\u003e37\u003c/strong\u003e, 101697, doi:10.1016/j.redox.2020.101697 (2020).\u003c/li\u003e\n\u003cli\u003eYu, B.\u003cem\u003e et al.\u003c/em\u003e PGC-1\u0026alpha; Controls Skeletal Stem Cell Fate and Bone-Fat Balance in Osteoporosis and Skeletal Aging by Inducing TAZ. \u003cem\u003eCell Stem Cell\u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 615-623, doi:10.1016/j.stem.2018.06.009 (2018).\u003c/li\u003e\n\u003cli\u003eDoll, S.\u003cem\u003e et al.\u003c/em\u003e FSP1 is a glutathione-independent ferroptosis suppressor. \u003cem\u003eNature\u003c/em\u003e\u003cstrong\u003e575\u003c/strong\u003e, 693-698, doi:10.1038/s41586-019-1707-0 (2019).\u003c/li\u003e\n\u003cli\u003eXu, Z.\u003cem\u003e et al.\u003c/em\u003e Mechanisms of estrogen deficiency-induced osteoporosis based on transcriptome and DNA methylation. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, 1011725, doi:10.3389/fcell.2022.1011725 (2022).\u003c/li\u003e\n\u003cli\u003eLuo, Y. \u0026amp; Chen, C. The roles and regulation of the KLF5 transcription factor in cancers. \u003cem\u003eCancer Science\u003c/em\u003e\u003cstrong\u003e112\u003c/strong\u003e, 2097-2117, doi:10.1111/cas.14910 (2021).\u003c/li\u003e\n\u003cli\u003eYang, Y., Goldstein, B. G., Chao, H.-H. \u0026amp; Katz, J. KLF4 and KLF5 regulate proliferation, Apoptosis and invasion in esophageal cancer cells. \u003cem\u003eCancer Biology \u0026amp; Therapy\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 1216-1221, doi:10.4161/cbt.4.11.2090 (2014).\u003c/li\u003e\n\u003cli\u003eLi, Y., Li, J., Hou, Z., Yu, Y. \u0026amp; Yu, B. KLF5 overexpression attenuates cardiomyocyte inflammation induced by oxygen-glucose deprivation/reperfusion through the PPAR\u0026gamma;/PGC-1\u0026alpha;/TNF-\u0026alpha; signaling pathway. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e\u003cstrong\u003e84\u003c/strong\u003e, 940-946, doi:10.1016/j.biopha.2016.09.100 (2016).\u003c/li\u003e\n\u003cli\u003eZhang, P.\u003cem\u003e et al.\u003c/em\u003e Ferroptosis was more initial in cell death caused by iron overload and its underlying mechanism in Parkinson\u0026apos;s disease. \u003cem\u003eFree Radical Biology and Medicine\u003c/em\u003e\u003cstrong\u003e152\u003c/strong\u003e, 227-234, doi:10.1016/j.freeradbiomed.2020.03.015 (2020).\u003c/li\u003e\n\u003cli\u003ePap, E. H. W.\u003cem\u003e et al.\u003c/em\u003e Ratio-fluorescence microscopy of lipid oxidation in living cells using C11-BODIPY581/591. \u003cem\u003eFEBS Letters\u003c/em\u003e\u003cstrong\u003e453\u003c/strong\u003e, 278-282, doi:10.1016/s0014-5793(99)00696-1 (1999).\u003c/li\u003e\n\u003cli\u003eYoo, S.-E.\u003cem\u003e et al.\u003c/em\u003e Gpx4 ablation in adult mice results in a lethal phenotype accompanied by neuronal loss in brain. \u003cem\u003eFree Radical Biology and Medicine\u003c/em\u003e\u003cstrong\u003e52\u003c/strong\u003e, 1820-1827, doi:10.1016/j.freeradbiomed.2012.02.043 (2012).\u003c/li\u003e\n\u003cli\u003ePei, Y., Qian, Y., Wang, H. \u0026amp; Tan, L. Epigenetic Regulation of Ferroptosis-Associated Genes and Its Implication in Cancer Therapy. \u003cem\u003eFrontiers in Oncology\u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e, doi:10.3389/fonc.2022.771870 (2022).\u003c/li\u003e\n\u003cli\u003eYu Shan, L. W., Guangfei Li, Guangsi Shen, Peng Zhang, Youjia Xu. Methylation of bone SOST impairs SP7, RUNX2, and ER\u0026alpha; transactivation in patients with postmenopausal osteoporosis \u003cem\u003eBiochemistry and Cell Biology\u003c/em\u003e\u003cstrong\u003e97\u003c/strong\u003e, 369-374 (2018).\u003c/li\u003e\n\u003cli\u003eGreally, J. M.\u003cem\u003e et al.\u003c/em\u003e A Six Months Exercise Intervention Influences the Genome-wide DNA Methylation Pattern in Human Adipose Tissue. \u003cem\u003ePLoS Genetics\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, e1003572, doi:10.1371/journal.pgen.1003572 (2013).\u003c/li\u003e\n\u003cli\u003eMann V, H. C., Kogianni G, Jones D, Noble B. The influence of mechanical stimulation on osteocyte apoptosis and bone viability in human trabecular bone. \u003cem\u003eJ Musculoskelet Neuronal Interact\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 408-417 (2006).\u003c/li\u003e\n\u003cli\u003eNishikawa, K.\u003cem\u003e et al.\u003c/em\u003e DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine\u0026ndash;producing metabolic pathway. \u003cem\u003eNature Medicine\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, 281-287, doi:10.1038/nm.3774 (2015).\u003c/li\u003e\n\u003cli\u003eGuan, H.\u003cem\u003e et al.\u003c/em\u003e Decitabine represses osteoclastogenesis through inhibition of RANK and NF-\u0026kappa;B. \u003cem\u003eCellular Signalling\u003c/em\u003e\u003cstrong\u003e27\u003c/strong\u003e, 969-977, doi:10.1016/j.cellsig.2015.02.006 (2015).\u003c/li\u003e\n\u003cli\u003eLi, B.\u003cem\u003e et al.\u003c/em\u003e Overexpression of DNMT1 leads to hypermethylation of H19 promoter and inhibition of Erk signaling pathway in disuse osteoporosis. \u003cem\u003eBone\u003c/em\u003e\u003cstrong\u003e111\u003c/strong\u003e, 82-91, doi:10.1016/j.bone.2018.03.017 (2018).\u003c/li\u003e\n\u003cli\u003eWang, C.\u003cem\u003e et al.\u003c/em\u003e Mechanical stimulation promote the osteogenic differentiation of bone marrow stromal cells through epigenetic regulation of Sonic Hedgehog. \u003cem\u003eExperimental Cell Research\u003c/em\u003e\u003cstrong\u003e352\u003c/strong\u003e, 346-356, doi:10.1016/j.yexcr.2017.02.021 (2017).\u003c/li\u003e\n\u003cli\u003eZhu, X., Zhang, Y., Yang, H., He, F. \u0026amp; Lin, J. Melatonin suppresses Ti-particle-induced inflammatory osteolysis via activation of the Nrf2/Catalase signaling pathway. \u003cem\u003eInternational Immunopharmacology\u003c/em\u003e\u003cstrong\u003e88\u003c/strong\u003e, 106847, doi:10.1016/j.intimp.2020.106847 (2020).\u003c/li\u003e\n\u003cli\u003eJiang, Z.\u003cem\u003e et al.\u003c/em\u003e Ferroptosis in Osteocytes as a Target for Protection Against Postmenopausal Osteoporosis. \u003cem\u003eAdvanced Science\u003c/em\u003e, doi:10.1002/advs.202307388 (2024).\u003c/li\u003e\n\u003cli\u003eWang, X.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial Ferritin Deficiency Promotes Osteoblastic Ferroptosis Via Mitophagy in Type 2 Diabetic Osteoporosis. \u003cem\u003eBiological Trace Element Research\u003c/em\u003e\u003cstrong\u003e200\u003c/strong\u003e, 298-307, doi:10.1007/s12011-021-02627-z (2021).\u003c/li\u003e\n\u003cli\u003eXue, C.\u003cem\u003e et al.\u003c/em\u003e Aconine attenuates osteoclast-mediated bone resorption and ferroptosis to improve osteoporosis via inhibiting NF-kappaB signaling. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 1234563, doi:10.3389/fendo.2023.1234563 (2023).\u003c/li\u003e\n\u003cli\u003eMa, J.-B.\u003cem\u003e et al.\u003c/em\u003e KLF5 inhibits STAT3 activity and tumor metastasis in prostate cancer by suppressing IGF1 transcription cooperatively with HDAC1. \u003cem\u003eCell Death \u0026amp; Disease\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, doi:10.1038/s41419-020-2671-1 (2020).\u003c/li\u003e\n\u003cli\u003eMeyer, S. E.\u003cem\u003e et al.\u003c/em\u003e Kr\u0026uuml;ppel-Like Factor 5 Is Not Required for K-RasG12D Lung Tumorigenesis, but Represses ABCG2 Expression and Is Associated with Better Disease-Specific Survival. \u003cem\u003eThe American Journal of Pathology\u003c/em\u003e\u003cstrong\u003e177\u003c/strong\u003e, 1503-1513, doi:10.2353/ajpath.2010.090651 (2010).\u003c/li\u003e\n\u003cli\u003eTsai, H.-C.\u003cem\u003e et al.\u003c/em\u003e Transient Low Doses of DNA-Demethylating Agents Exert Durable Antitumor Effects on Hematological and Epithelial Tumor Cells. \u003cem\u003eCancer Cell\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, 430-446, doi:10.1016/j.ccr.2011.12.029 (2012).\u003c/li\u003e\n\u003cli\u003eChen, X.\u003cem\u003e et al.\u003c/em\u003e Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. \u003cem\u003eBone Res\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, 15, doi:10.1038/s41413-020-00128-8 (2021).\u003c/li\u003e\n\u003cli\u003eZhu, X.\u003cem\u003e et al.\u003c/em\u003e PPAR\u0026gamma; preservation via promoter demethylation alleviates osteoarthritis in mice. \u003cem\u003eAnn Rheum Dis\u003c/em\u003e\u003cstrong\u003e78\u003c/strong\u003e, 1420-1429, doi:10.1136/annrheumdis-2018-214940 (2019).\u003c/li\u003e\n\u003cli\u003eDong, J.\u003cem\u003e et al.\u003c/em\u003e NRF2 is a critical regulator and therapeutic target of metal implant particle-incurred bone damage. \u003cem\u003eBiomaterials\u003c/em\u003e\u003cstrong\u003e288\u003c/strong\u003e, 121742, doi:10.1016/j.biomaterials.2022.121742 (2022).\u003c/li\u003e\n\u003cli\u003eXu, R.\u003cem\u003e et al.\u003c/em\u003e Targeting skeletal endothelium to ameliorate bone loss. \u003cem\u003eNat Med\u003c/em\u003e\u003cstrong\u003e24\u003c/strong\u003e, 823-833, doi:10.1038/s41591-018-0020-z (2018).\u003c/li\u003e\n\u003cli\u003eNishikawa, K.\u003cem\u003e et al.\u003c/em\u003e DNA methyltransferase 3a regulates osteoclast differentiation by coupling to an S-adenosylmethionine-producing metabolic pathway. \u003cem\u003eNat Med\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, 281-287, doi:10.1038/nm.3774 (2015).\u003c/li\u003e\n\u003cli\u003eChen, X.\u003cem\u003e et al.\u003c/em\u003e Reversal of Epigenetic Peroxisome Proliferator-Activated Receptor-\u0026gamma; Suppression by Diacerein Alleviates Oxidative Stress and Osteoarthritis in Mice. \u003cem\u003eAntioxid Redox Signal\u003c/em\u003e\u003cstrong\u003e37\u003c/strong\u003e, 40-53, doi:10.1089/ars.2021.0219 (2022).\u003c/li\u003e\n\u003cli\u003eGao, Q.\u003cem\u003e et al.\u003c/em\u003e Inhibition of DNA methyltransferase aberrations reinstates antioxidant aging suppressors and ameliorates renal aging. \u003cem\u003eAging Cell\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, e13526, doi:10.1111/acel.13526 (2022).\u003c/li\u003e\n\u003cli\u003eAli, D.\u003cem\u003e et al.\u003c/em\u003e High-fat diet-induced obesity augments the deleterious effects of estrogen deficiency on bone: Evidence from ovariectomized mice. \u003cem\u003eAging Cell\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, e13726, doi:10.1111/acel.13726 (2022).\u003c/li\u003e\n\u003cli\u003eChen, F.\u003cem\u003e et al.\u003c/em\u003e Histone deacetylase 3 aberration inhibits Klotho transcription and promotes renal fibrosis. \u003cem\u003eCell Death Differ\u003c/em\u003e\u003cstrong\u003e28\u003c/strong\u003e, 1001-1012, doi:10.1038/s41418-020-00631-9 (2021).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bone-research","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"boneres","sideBox":"Learn more about [Bone Research](http://www.nature.com/boneres/)","snPcode":"41413","submissionUrl":"https://mts-boneres.nature.com/cgi-bin/main.plex","title":"Bone Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"DNA methylation, Epigenetics, Ferroptosis, GPX4, Osteoporosis","lastPublishedDoi":"10.21203/rs.3.rs-4301039/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4301039/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Osteoporosis (OP) is a common and fracture-prone skeletal disease featured by deteriorated trabecular microstructure and pathologically involves various forms of regulated bone cell death. However, the role and regulatory mechanisms of ferroptosis in OP are not fully understood. Our study showed marked iron deposition, ferroptosis, and a core anti-ferroptotic factor GPX4 (glutathione peroxidase 4) suppression in OP femurs of ovariectomized (Ovx) mice, coinciding with Gpx4 promoter hypermethylation and elevated DNMT1/3a/3b levels. In addition, KLF5, along with the transcriptional corepressors NCoR and SnoN, induces binding to the hypermethylated GPX4 promoter in osteoporotic femurs sensitive to DNMT inhibition. Conversely, DNMT inhibition with SGI-1027 reversed hypermethylation and GPX4 suppression, reducing the ferroptotic and osteoporotic damage. In cultured primary bone cells, ferric ammonium citrate (FAC) mimicking iron loading similarly induced GPX4 suppression and ferroptosis in osteoblasts, but not in osteoclasts, which were rescued by siRNA-mediated individual knockdown of DNMT 1/3a/3b respectively. Intriguingly, SGI-1027 relieved the ferroptotic alterations induced by FAC, but not by a GPX4 inactivator RSL3. More importantly, we generated a strain of osteoblast-specific Gpx4 haplo-deficient mice (Gpx4+/-) that developed spontaneous ferroptotic OP alterations and further demonstrated that GPX4 inactivation by RSL3 or osteoblastic GPX4 haplo-deficiency largely abrogated the anti-ferroptotic and osteoprotective effects of SGI-1027. Together, our data suggest that the DNMT aberration-incurred epigenetic GPX4 suppression and the resultant osteoblastic ferroptosis contribute significantly to OP pathogenesis and the strategies preserving GPX4 by DNMT intervention is potentially effective to treat OP and the related bone disorders.","manuscriptTitle":"DNMT aberration-incurred GPX4 suppression prompts osteoblast ferroptosis and osteoporosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-07 16:09:20","doi":"10.21203/rs.3.rs-4301039/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-05-23T03:39:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-05-17T13:08:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-05-13T06:31:44+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-05-05T01:37:23+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-04-28T02:45:56+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-04-28T02:15:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-23T02:44:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Bone Research","date":"2024-04-21T13:55:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-21T13:55:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bone-research","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"boneres","sideBox":"Learn more about [Bone Research](http://www.nature.com/boneres/)","snPcode":"41413","submissionUrl":"https://mts-boneres.nature.com/cgi-bin/main.plex","title":"Bone Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1bf35649-5c21-4f52-8ee9-52350873fd32","owner":[],"postedDate":"May 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":31244707,"name":"Biological sciences/Physiology/Bone"},{"id":31244708,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic bone disease/Osteoporosis"},{"id":31244709,"name":"Health sciences/Pathogenesis"}],"tags":[],"updatedAt":"2024-12-02T08:05:58+00:00","versionOfRecord":{"articleIdentity":"rs-4301039","link":"https://doi.org/10.1038/s41413-024-00365-1","journal":{"identity":"bone-research","isVorOnly":false,"title":"Bone Research"},"publishedOn":"2024-12-02 05:00:00","publishedOnDateReadable":"December 2nd, 2024"},"versionCreatedAt":"2024-05-07 16:09:20","video":"","vorDoi":"10.1038/s41413-024-00365-1","vorDoiUrl":"https://doi.org/10.1038/s41413-024-00365-1","workflowStages":[]},"version":"v1","identity":"rs-4301039","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4301039","identity":"rs-4301039","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}