PSMB9 Exacerbates Chondrocyte Injury in Osteoarthritis via Activation of the NF-κB Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PSMB9 Exacerbates Chondrocyte Injury in Osteoarthritis via Activation of the NF-κB Pathway Lianhui Zhao, Jianliang Ou, Sijie Bian, Zhangwei Wu, Xu Wang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8216872/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Mar, 2026 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted 12 You are reading this latest preprint version Abstract Background: Osteoarthritis (OA) is a degenerative joint disease characterized by cartilage degradation and synovial inflammation, with its pathogenesis being incompletely understood. This study aimed to investigate the role and mechanism of PSMB9 in interleukin-1β (IL-1β)-induced chondrocyte injury. Methods: We identified OA-associated proteasome members by analyzing public datasets (including GSE215039). PSMB9 expression was assessed in clinical OA samples and OA model mouse tissues via immunohistochemistry. The functional roles of PSMB9 and its regulation of the NF-κB pathway in IL-1β-induced human C28/I2 chondrocytes were examined using Western blot, CCK-8, EdU, and flow cytometry assays. The effect of IL-6 knockdown on PSMB9 expression was also evaluated by Western blot. Results: (1) PSMB9 was a common differentially expressed gene in multiple human and mouse OA datasets. (2) Its expression was significantly upregulated in human OA cartilage, mouse OA models, and IL-1β-stimulated primary and C28/I2 chondrocytes. (3) Overexpression of PSMB9 promoted apoptosis, inhibited proliferation, increased levels of the pro-inflammatory cytokine IL-6 and the matrix-degrading enzyme MMP13, enhanced extracellular matrix (ECM) degradation, and reduced collagen type II alpha 1 (COL2A1) expression. (4) PSMB9 activated the NF-κB pathway by promoting IκBα degradation, and inhibition of NF-κB signaling alleviated the chondrocyte injury. (5) Silencing IL-6 reduced PSMB9 expression. Conclusion: PSMB9 exacerbates OA chondrocyte injury by activating the NF-κB pathway, suggesting its potential as a therapeutic target for OA. osteoarthritis PSMB9 NF-κB signaling pathway chondrocytes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Osteoarthritis (OA) is the most common degenerative joint disease, characterized by progressive destruction of articular cartilage, subchondral bone sclerosis, osteophyte formation, and synovial inflammation. Globally, OA affects millions of people and is a leading cause of pain, functional impairment, and disability among middle-aged and elderly individuals, imposing a heavy economic and healthcare burden on society [1]. Currently, the etiology and pathogenesis of OA have not been fully elucidated, but it is generally believed to be closely related to metabolic imbalances in joint tissues and chronic low-grade inflammatory responses caused by various factors such as mechanical stress, age, obesity, and genetic susceptibility [2-5]. In the complex pathological process of OA, the imbalance of chondrocyte homeostasis is a core element, manifested as a disruption between anabolic and catabolic metabolism, ultimately leading to extracellular matrix (ECM) degradation, cell apoptosis, and autophagy abnormalities, which accelerate cartilage destruction [6]. The proteasome is an important multi-subunit protein complex within the cell, responsible for degrading unnecessary or damaged proteins to maintain intracellular protein homeostasis[7, 8]. The 26S proteasome is a multi-protein complex composed of a 20S core particle and one or two 19S regulatory particles. The core particle of the 20S proteasome is a barrel-shaped structure made up of four stacked heptameric rings (αββα)。 The two outer rings, composed of α subunits (α1-7), serve as binding sites for regulatory complexes (including 19S, 11S, and PA 200 families), which facilitate peptidase activity and control the entry of cytosolic proteins into the proteasome chamber. The two inner rings consist of β subunits (β1-7), among which three (β1, β2, and β5) contain active sites that catalyze the hydrolysis of threonine residues[9]. In cells stimulated by interferon (IFNγ) or tumor necrosis factor (TNFα), these proteolytic active subunits are replaced by β1i (LMP2/PSMB9), β2i (MECL-1/PSMB10), and β5i (LMP7/PSMB8), forming the immunoproteasome[10, 11]. In addition to the standard proteasome, proteasome variants with inducible β subunits (immunoproteasomes) play significant roles in various pathological conditions, including autoimmune diseases, inflammatory diseases, and cancer[12-15]. Traditionally, PSMB9 has been considered to be primarily expressed in immune cells and involved in the process of antigen presentation. However, recent studies have shown that PSMB9 is also abnormally expressed in various non-immune cells, including tumor cells and endothelial cells, and may participate in the regulation of apoptosis, proliferation, and inflammatory responses[16-18]. Notably, some research has found that PSMB9 is highly expressed in the synovial tissue of rheumatoid arthritis and may be associated with the activation of the NF-κB pathway[16]. However, the expression, biological function, and specific molecular mechanisms of PSMB9 in chondrocytes of osteoarthritis remain unclear. The nuclear factor kappa-B (NF-κB) signaling pathway serves as a crucial hub linking inflammatory responses to cartilage degradation. In the context of osteoarthritis (OA), various inflammatory cytokines (such as IL-1β and TNF-α) or mechanical stress can activate the NF-κB pathway. The activated NF-κB (primarily the p65 subunit) translocate to the nucleus, initiating the transcription of a series of downstream target genes, including matrix metalloproteinases (MMPs) and various inflammatory factors (such as IL-6)[19, 20]. These factors collectively promote the degradation of the extracellular matrix (ECM), inhibit the synthesis of cartilage matrix components (such as type II collagen and aggrecan), and further amplify the inflammatory cascade, creating a vicious cycle that continuously exacerbates chondrocyte damage [21, 22]. PSMB9, as a component of the immunoproteasome, directly participates in the degradation of IκBα. Previous experiments have shown that the absence of PSMB9 leads to a delay in the degradation of IκBα, thereby inhibiting the activation of NFκB [23]. However, whether this regulatory relationship exists in chondrocytes of osteoarthritis remains unknown. This study identifies proteasome family members associated with osteoarthritis (OA) from multiple human datasets (such as GSE215039) and mouse data, determining that PSMB9 is expressed at elevated levels in chondrocytes of OA patients. Immunohistochemistry was employed to validate the increased expression of PSMB9 in human arthritis tissues and in mouse OA models. Subsequently, the role of PSMB9 in OA and its regulation of the NFκB pathway were investigated using an IL-1β induced chondrocyte model. The aim is to provide new insights and potential therapeutic approaches for OA. 2. Materials and Methods 2.1 Dataset Selection and Processing We obtained a high-throughput transcriptome dataset of human primary chondrocytes (GSE215039) from the Gene Expression Omnibus (GEO, URL: http://www.ncbi.nlm.nih.gov/geo/), which includes a calibrated and quality-controlled count matrix. First, we performed quantile normalization and log2 transformation on this matrix to ensure the accuracy and comparability of the data. The transcriptome count matrix contains samples of human primary chondrocytes from five osteoarthritis patients who underwent total knee arthroplasty and five non-osteoarthritis patients who underwent scoliosis surgery. All these samples were untreated, and there are significant pathological differences between the two groups, making this dataset of great value for studying the molecular differences of human primary chondrocytes in normal and inflammatory environments. Subsequently, we retrieved a multi-tissue, multi-species microarray dataset from the Gene Expression Omnibus. The expression profile data from GSE169077 includes knee cartilage samples from five healthy individuals and six osteoarthritis patients, all obtained from knee replacement surgeries. This dataset holds significant research value in exploring the molecular differences between knee cartilage of healthy individuals and those with osteoarthritis. The expression profile data from GSE55235 and GSE1919 comprises a total of 15 synovial tissue samples from normal individuals and 15 from osteoarthritis patients. After merging these two datasets and performing batch correction using the 'sva' package, we conducted differential analysis. Both datasets are crucial for studying the molecular differences in synovial tissues between normal individuals and osteoarthritis patients. The expression profile data from GSE53857 and GSE41342 covers relevant data from a mouse osteoarthritis model at postoperative weeks 2, 4, 8, and 16. These two datasets are also of significant value in investigating the molecular differences at different time points in the mouse osteoarthritis model. 2.2 Clinical Samples Three cases of patients with osteoarthritis due to knee joint replacement surgery were selected from the First Affiliated Hospital of Anhui Medical University. All patients were diagnosed with osteoarthritis according to the osteoarthritis diagnostic guidelines. All clinical data were obtained after approval and consent from the Clinical Management Committee of the hospital. According to Item 9 of the "Ethical Review Application/Report Guidelines" from the Clinical Medical Research Ethics Committee of Anhui Medical University, the risks posed to the subjects in this study do not exceed the minimum risk. The privacy of the subjects is protected, adhering to the principle that allows subjects to choose not to sign a written informed consent form, and the study was reviewed by the Biomedical Ethics Committee of Anhui Medical University. 2.3 Animal Experiments The C57BL/6 mice used in the experiments were provided by the Experimental Animal Center of Anhui Medical University and were housed in a specific pathogen-free (SPF) environment, maintaining constant temperature and humidity (23-25°C, 45-65%) and a regular light-dark cycle (12 hours). An osteoarthritis (OA) model was induced through a destabilization of the medial meniscus (DMM) surgery to simulate the pathological changes associated with post-traumatic OA. Eight-week-old male C57BL/6J mice underwent DMM surgery (meniscal injury) on their right hind knees (n=5) or were assigned to a control group (n=5). Knee joint samples were collected 8 weeks post-surgery. 2.4 Isolation of Chondrocytes Primary chondrocytes were extracted from normal articular cartilage as previously described [24]. Normal knee cartilage samples were obtained and washed three times with PBS. Subsequently, the cartilage samples were minced using ophthalmic scissors. The minced cartilage was digested with trypsin and collagenase II to isolate the digested chondrocytes. After digestion, the cell suspension was filtered through a 150-mesh stainless steel filter and centrifuged at 1000 rpm for 3-5 minutes. The chondrocytes were washed three times with PBS and then cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific Inc.) containing 10% fetal bovine serum (Thermo Fisher Scientific Inc.) and 1% penicillin/streptomycin (keygen biotech co. ltd) in a humidified incubator with 5% CO2. To establish an in vitro osteoarthritis model, the chondrocytes were co-cultured with 10 ng/ml IL-1β (Thermo Fisher Scientific Inc.) as previously reported [25]. 2.5 Cell Cultivation and Therapy The original chondrocytes and C28/I2 cell line (from the First Affiliated Hospital of Anhui Medical University) were cultured in high-glucose DMEM medium (Thermo Fisher Scientific Inc.), supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Inc.) and 1% penicillin/streptomycin (keygen biotech co. ltd). Human osteoarthritis articular chondrocytes were cultured in DMEM medium and used for research after 1-3 passages. All cells were maintained at 37°C in a 5% carbon dioxide environment. Recombinant human IL-1β used for cell treatment was provided by Thermo Fisher. According to the usage instructions for genechem lentivirus products, all lentiviruses are stored in a low-temperature environment at -70°C. The C28/I2 cell line is uniformly seeded in 6-well plates at a density of 2×10⁵ cells per well. When the cell density reaches 40%-50%, lentivirus is added for infection (MOI=80), along with polybrene (5 µg/mL) (MedChemExpress biotechnology co. ltd) to enhance infection efficiency. Twelve hours post-infection, the medium is discarded and replaced with fresh medium. According to the siRNA product instructions from OBiO Technology, siRNA transfection was performed. All siRNAs were stored at -20°C at a concentration of 20 μM. For transfection in a 6-well plate, 10 μL of siRNA was diluted in 250 μL of Opti-MEM® (Thermo Fisher Scientific Inc.) to a working concentration of 100 nM, and gently pipetted 3-5 times to ensure thorough mixing. 5 μL of the transfection reagent Lipo2000 (Thermo Fisher Scientific Inc.) was diluted in 250 μL of opti-MEM®, and then allowed to stand at room temperature for 5 minutes. Subsequently, the siRNA and transfection reagent were gently mixed 3-5 times to ensure thorough mixing and incubated at room temperature for 25 minutes. After incubation, 500 μL of the transfection complex was added to the 6-well plate, gently mixed, and the cell plate was placed in a 37°C, 5% CO2 incubator for culture. After 6 hours, fresh complete medium containing 10% serum was replaced, and culture continued for 24-48 hours. To further clarify the mechanism of action of PSMB9 in osteoarthritis, the NF-κB inhibitor JSH-23 (10 μM) (KKL MED Inc.) [26]was used to determine whether PSMB9 would affect the NF-κB signaling pathway. 2.6 Cell Counting Kit-8 (CCK)-8 Assay Method The CCK-8 kit from Beyotime Biotechnology was utilized to assess changes in cell proliferation ability following transfection. Chondrocytes were digested with trypsin to prepare a single-cell suspension at a density of 2×10^4 cells/mL, which was then seeded into a 96-well plate. CCK-8 solution was added to each well, and the cells were cultured for 2 hours. The optical density (OD) values were measured at 24 hours and 48 hours to plot the growth curve. 2.7 Hematoxylin-Eosin (HE) Staining Method After euthanizing the mice, the knee joints were harvested and surrounding muscles were excised. The samples were fixed in 4% paraformaldehyde at 4°C for 48 hours, followed by decalcification with 15% EDTA at 37°C for 2 weeks. Subsequently, the samples were embedded in paraffin and sectioned into 5-micron thick slices. Hematoxylin and eosin (HE) staining was performed according to the kit protocol (Solarbi Technology Co., Ltd.). In brief, the paraffin sections were first dewaxed and rehydrated, followed by staining with hematoxylin and eosin. 2.8 Safranin O-Fast Green Staining Method For small knee joint tissue sections or cartilage slices, staining is performed using the Safranin O-fast green staining kit from Solarbio Life Science, following the manufacturer's instructions. The severity of osteoarthritis is assessed using the Osteoarthritis Research Society International (OARSI) scoring system. 2.9 Immunohistochemical Staining Mouse or human knee joint tissue sections were digested in antigen retrieval solution (Boster biological technology co. ltd) at 37°C for 30 minutes. After adding 3% hydrogen peroxide at room temperature for 10 minutes, the sections were incubated overnight at 4°C with the corresponding primary antibodies ((Col2a1 (Abcam plc), MMP13 (Affinity Biosciences ltd.), PSMB9 (Immunoway Biotechnology co. ltd.), IL-6 (Affinity Biosciences ltd.)). Staining was detected using the streptavidin-biotin detection system (Beijing OriGene Technology Co., Ltd.). Color development was performed using DAB (Beijing OriGene Technology Co., Ltd.), followed by counterstaining with hematoxylin (Solarbi Technology Co., Ltd.). 2.10 Detection of Cell Apoptosis by Flow Cytometry Apoptosis of chondrocytes was quantitatively assessed using a "Annexin V - Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Apoptosis Detection Kit" (Keygen biotech co. ltd). Chondrocytes were incubated at 37°C and treated with 5 μl of Annexin V - FITC and 5 μl of Propidium Iodide (PI) for 10 minutes. After treatment, labeled cells were evaluated for apoptosis using a FACScan flow cytometer (Beckman Coulter, Inc.). The apoptosis level was assessed using the Annexin V - FITC/PI apoptosis detection kit via flow cytometry. Chondrocytes from different treatment groups were adjusted to a concentration of 5×10^6 cells per milliliter. Subsequently, 500 μl of binding buffer was added to terminate the digestion reaction. The chondrocytes were then mixed with 5 μl of Annexin V - FITC for 5 minutes and protected from light. After mixing, 5 μl of Propidium Iodide was added immediately and incubated for 20 minutes. Apoptosis rates were evaluated within 1 hour and analyzed using FlowJo software. 2.11 Western blot Total cellular proteins were lysed using an immunoprecipitation analysis (RIPA) solution containing protease inhibitors (Shanghai Beyotime Biotechnology Co., Ltd.). Subsequently, these proteins were separated on sodium dodecyl sulfate-polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane (Merck KGaA). The membrane was blocked at room temperature with either 5% non-fat dry milk or 5% BSA, followed by incubation with a diluted primary antibody at a dilution of 1:2000. After that, the membrane was treated with a secondary antibody at room temperature for 2 hours. Protein bands were visualized using ECL enhanced chemiluminescence reagent (Abbkine Scientific Co., Ltd.). The primary antibodies used in this study include anti-PSMB9 (Immunoway Biotechnology co. ltd.), anti-MMP-13 (Affinity Biosciences ltd.), anti-IL-6 (Affinity Biosciences ltd.), anti-Col2a1 (Abcam plc), anti-IκBα (Immunoway Biotechnology co. ltd.), anti-P65 (Immunoway Biotechnology co. ltd), anti-p65 (Phospho Ser536) (Immunoway Biotechnology co. ltd), anti-IκB-α (Phospho Ser36) (Immunoway Biotechnology co. ltd.), anti-β-actin (Bioworld Biotechnology Co., Ltd.), and anti-β-Tubulin (Bioworld Biotechnology Co., Ltd.). 2.12 RNA Extraction and Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) Total RNA was extracted from cells using TRIzol™ reagent (Thermo Fisher Scientific Inc.), and reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit from Vazym. Following the manufacturer's protocol, RT-qPCR was performed on a 7500 Real-Time PCR System (Thermo Fisher Scientific Inc.) using SYBR Premix Ex Taq from Vazym. Subsequently, relative mRNA levels were quantified using the -2−ΔΔCt method. The primers used are listed in Table 1. Table 1: Nucleotide sequences of primers used for qPCR Gene Sequence PSMB9(Human) Forward: GGAGGTCAGGTATATGGAACCC Reverse: CCTGGCTTATATGCTGCATCC PSMB9(Mouse) Forward: GAGGACTTGTTAGCGCATCTCA Reverse: CATATACCTGTCCCCCCTCACA GAPDH(Human) Forward: GGAGCGAGATCCCTCCAAAAT Reverse: GGCTGTTGTCATACTTCTCATGG GAPDH(Mouse) Forward: CAGTGGCAAAGTGGAGATTG Reverse: TGCCGTGAGTGGAGTCATAC 2.13 Statistical Analysis In this study, all tests were conducted using three samples. Data analysis was performed using Prism 8.0 (GraphPad Prism), employing t-tests or one-way ANOVA, with a significance level set at p < 0.05. 3. Results 3.1 Differential expression analysis of PSMB9 in human public datasets We first explored the expression differences of the proteasome family in the transcriptomic RNA of primary human chondrocytes from healthy individuals and those with osteoarthritis (OA) by analyzing the GSE215039 dataset. The waterfall plot reveals a significant ranking of differentially expressed genes, highlighting PSMB9 and PSMB8 as major candidate genes (Fig1.A). This figure illustrates the relationship between gene ranking and their corresponding log2 fold changes, with PSMB9 prominently marked, indicating that PSMB9 is not only a differentially expressed gene but also statistically relevant in the context of OA. Next, we analyzed the expression differences of the proteasome family in knee cartilage of healthy individuals and OA patients using the GSE169077 dataset. The volcano plot displays the distribution of differentially expressed genes, with PSMB9 located in the upregulated region (Fig1.B). The x-axis represents log2 fold changes, while the y-axis indicates the negative log10 of p-values, emphasizing the statistical significance of the expression changes. PSMB9, along with other proteasome subunits, shows significant upregulation, further reinforcing its potential role in the progression of OA. We further supported the differential expression of PSMB9 by comparing the scatter plots of human synovial tissue datasets GSE1919 and GSE5235 (Fig1.C). The clustering of genes reveals distinct expression patterns, with PSMB9 significantly located in the upregulated quadrant. This indicates a consistent trend across different datasets, highlighting the relevance of PSMB9 in the pathology of osteoarthritis (OA). The Venn diagram illustrates the overlap of differentially expressed genes among three human datasets: GSE215039, GSE1919, and GSE5235 (Fig1.D). PSMB9 was identified as a commonly upregulated gene in human primary chondrocytes, knee cartilage, and synovial tissue, suggesting its potential as a biomarker for OA. 3.2 Differential expression analysis of PSMB9 in mouse public datasets and comparison with human data In the public dataset of rodents, we selected the chip dataset of DMM model mice for differential expression analysis. The samples from 2 weeks post-DMM modeling were used as the control group to observe the differential expression of proteasome family genes during the DMM modeling process. In the GSE53857 dataset, we analyzed the differential expression between 2 weeks and 4 weeks post-DMM modeling, while in the GSE41342 dataset, we analyzed the differential expression between 2 weeks and 8 weeks, as well as 2 weeks and 16 weeks post-DMM modeling. The results showed that (Fig2.A), only PSMB9 exhibited a significant upregulation in the late-stage group compared to the early-stage group following DMM modeling. Next, we summarized the comparative analysis of the proteasome family differences in both mice and human OA. Since both GSE1919 and GSE5235 are human synovial tissue samples, batch correction is necessary prior to analysis. The box plot indicates that the expression profiles are more consistent after correction (Fig2.B), suggesting an improvement in data consistency. Further principal component analysis (PCA plot, Fig2.C) supports this, showing a clearer clustering of samples post-correction. Subsequently, we used a heatmap to represent the expression levels of proteasome family genes across five datasets from both humans and mice (Fig2.D), highlighting the expression relationship of PSMB9 with other proteasome subunits. The heatmap demonstrates that PSMB9 expression in OA samples is consistently higher than that in healthy controls, and the late-stage group post-DMM modeling also reflects this compared to the early-stage group. These results further illustrate the potential involvement of PSMB9 in the pathophysiology of OA. 3.3 The expression level of PSMB9 is significantly elevated in arthritic tissues and cells. First, we established a mouse OA model using the DMM method and examined the morphological structure of OA rat cartilage through HE staining. The results of HE staining showed that the chondrocytes in the control group were arranged neatly, with a uniform distribution of the matrix and no infiltration of inflammatory cells. In contrast, the OA group exhibited a significant reduction in normal chondrocytes, disordered arrangement of chondrocytes, and a marked increase in inflammatory cells (Fig3.A, B). The results of the Safranin O-fast green staining indicated that, compared to the control group, the OA model group displayed less positive staining in the cartilage layer, with severe cartilage degeneration. The OARSI score of the OA group was significantly higher than that of the control group (Figure 3.A). Immunohistochemical results showed that the levels of PSMB9, IL-6, and MMP13 were significantly elevated in the OA model group, while COL2A1 was significantly decreased. To further investigate, we collected cartilage tissues from 6 OA patients and amputee patients, and performed immunohistochemical staining, revealing significant differences between OA samples and control samples (Fig3.C). Subsequently, we extracted human primary chondrocytes and the mouse primary chondrocyte C28/I2 cell line, induced with IL-1β, to establish an in vitro OA cell model. The results of qPCR and Western blot indicated that PSMB9 was significantly upregulated in the OA model group (Fig3.D, E, F, G). 3.4 PSMB9 Promotes Apoptosis, Inflammatory Response, and ECM Degradation in IL-1β-Induced C28/I2 Chondrocytes Next, we infected C28/I2 cells with lentivirus to overexpress PSMB9 and induced them with IL-1β to establish an in vitro model of osteoarthritis (OA) to explore the regulatory role of PSMB9 in OA. Western blot results showed that the expression level of PSMB9 was significantly increased in the oe-PSMB9+IL-1β group compared to the oe-NC+IL-1β group (Fig4.A,B). EDU and CCK8 results indicated that IL-1β reduced the viability of C28/I2 chondrocytes, and overexpression of PSMB9 further decreased the viability of C28/I2 chondrocytes (Fig4.E,F). Flow cytometry demonstrated that IL-1β treatment increased chondrocyte apoptosis, and similarly, overexpression of PSMB9 further increased chondrocyte apoptosis(Fig4.G). Furthermore, Western blot analysis revealed that overexpression of PSMB9 led to increased expression of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and cartilage extracellular matrix synthesis marker (Col2a1). (Fig4.A, B). 3.5 Knockdown of the PSMB9 Gene Alleviates IL-1β-Induced Chondrocyte Degradation and Inflammatory Response Subsequently, we silenced the expression of PSMB9 in C28/I2 cells using siRNA and established an in vitro osteoarthritis (OA) model induced by IL-1β. The results of Western blot analysis showed that the expression of PSMB9 was significantly decreased in the si-PSMB9+IL-1β group compared to the si-NC+IL-1β group (Fig5.A,B). The results from EDU and CCK8 assays indicated that IL-1β reduced the viability of C28/I2 chondrocytes, while knockdown of PSMB9 restored the viability of C28/I2 chondrocytes (Fig5.E,F). Flow cytometry demonstrated that IL-1β treatment increased chondrocyte apoptosis, which was similarly reduced following PSMB9 knockdown(Fig5.G). Furthermore, Western blot analysis revealed that silencing PSMB9 affected the expression of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and markers of chondrocyte extracellular matrix synthesis (Col2a1). (Fig5.A, B). 3.6 Activation of the NF-κB Signaling Pathway in Chondrocytes Stimulated by IL-1β via PSMB9 Recent studies have shown that PSMB9 influences the inflammatory process by regulating the NF-κB signaling pathway; however, there has been no related research in the field of osteoarthritis (OA). Western blot analysis was employed to assess the levels of IκBα, p-IκBα, P65, and p-P65. The results indicated that, compared to the control group, IL-1β induction resulted in a significant decrease in IκBα and a significant increase in p-IκBα, while P65 showed no significant difference, and p-P65 was significantly increased. In the oe-PSMB9 + IL-1β group, IκBα and p-IκBα further significantly decreased, P65 showed no significant difference, and p-P65 significantly increased (Fig 4.C,D). Conversely, after knocking down PSMB9, the levels of IκBα and p-IκBα were restored, P65 showed no significant difference, while p-P65 significantly decreased (Fig 5.C,D). To further investigate the relationship between PSMB9 and the NF-κB signaling pathway, we utilized the NF-κB signaling pathway inhibitor (JSH-23) to inhibit this pathway. CCK-8 results indicated that, compared to the oe-PSMB9+IL-1β group, the cell viability in the oe-PSMB9+IL-1β+JSH-23 group was enhanced (Fig 6.D). Flow cytometry results showed that, compared to the oe-PSMB9+IL-1β group, apoptosis in the oe-PSMB9+IL-1β+JSH-23 group was significantly reduced (Fig 6.A). Additionally, Western blot analysis was conducted to assess the expression levels of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and markers of extracellular matrix synthesis in chondrocytes (Col2a1) after inhibition of the NF-κB signaling pathway. Compared to the oe-PSMB9+IL-1β group, the oe-PSMB9+IL-1β+JSH-23 group exhibited a significant reduction in inflammatory factors (IL-6) and extracellular matrix degradation-related proteins (MMP13), while markers of extracellular matrix synthesis (Col2a1) were significantly increased (Fig 6.B,C). 3.7 Silencing IL-6 can reduce the expression of PSMB9 in chondrocytes stimulated by IL-1β. Subsequently, we attempted to silence IL-6 in C28/I2 cells using si-RNA, followed by induction of C28/I2 cells with IL-1β to establish an in vitro model of osteoarthritis (OA). Western blot analysis was conducted to detect the expression of PSMB9. The results showed that, compared to the IL-1β induction group, the si-IL-6 + IL-1β group exhibited a significant reduction in PSMB9 expression (Fig6.E,F). 4. Discussion Osteoarthritis (OA) is a common factor associated with total body disability, often linked to osteophyte formation, degeneration of articular cartilage, degradation of ligaments and knee joints, as well as synovial inflammation[27]. Its onset is influenced by various factors, and the underlying mechanisms remain unclear. The immunoproteasome comprises three specific catalytic subunits: LMP 2, MECL-1, and LMP 7. LMP 2 (PSMB9) is generally considered a crucial component for proteasome activity, as it is essential for the proper assembly of the immunoproteasome[28]. Recent studies have indicated that although the immunoproteasome is primarily found in immune cells, it also exists in non-immune responses and may possess non-immune functions[29]. However, its role in the cartilage of arthritis has not been reported. This study systematically investigates the critical role of PSMB9 in the pathogenesis of osteoarthritis (OA) through the integration of clinical samples, animal models, and various cell line models. We found that PSMB9 is significantly activated in OA and forms a positive feedback loop by activating the NF-κB signaling pathway and upregulating the expression of IL-6. This loop exacerbates the degradation of cartilage extracellular matrix, inhibits the proliferation of chondrocytes, and promotes their apoptosis, ultimately driving the pathological process of OA. Firstly, we observed a significant upregulation of PSMB9 protein expression in both the cartilage tissues of human osteoarthritis (OA) patients and in the mouse DMM surgery-induced OA model. Subsequently, we successfully simulated the inflammatory environment of OA in vitro by stimulating human primary chondrocytes, mouse primary chondrocytes, and the C28/I2 chondrocyte cell line with IL-1β. This further confirmed that the expression of PSMB9 was induced at both transcriptional and translational levels. Collectively, these findings indicate that the upregulation of PSMB9 is a common response to OA-related inflammatory stimuli, such as IL-1β, suggesting that PSMB9 may serve as a potential disease biomarker and therapeutic target. To further investigate the role of PSMB9 in osteoarthritis (OA), we established both overexpression and knockdown cell lines using C28/I2 cells. Results indicate that the overexpression of PSMB9 significantly exacerbates IL-1β-induced chondrocyte damage. This is manifested by an increase in apoptosis, a decrease in proliferative capacity, a sharp rise in the expression of catabolic markers (MMP13) and inflammatory factors (IL-6), while the expression of key anabolic components (COL2A1) is suppressed. It is well known that inflammatory cytokine compounds play a crucial role in the pathogenesis of osteoarthritis (OA). Chondrocyte apoptosis, joint inflammation, and degradation of the cartilage extracellular matrix (ECM) are all regulated by inflammatory factors such as IL-1β[30, 31]. IL-6 is a major cytokine involved in the changes of the subchondral bone layer, detectable in synovial fluid and expressed in osteoarthritic cartilage, making its inhibition an attractive prospective target for OA treatment[32]. Additionally, both inflammatory cytokines and MMPs induce chondrocyte apoptosis[33, 34]. Furthermore, IL-1β can induce the production of IL-6, which can further enhance the inflammation and cartilage destruction triggered by IL-1β[35]. Matrix metalloproteinase-13 (MMP-13) plays a central role in the pathological process of osteoarthritis (OA). As a major collagenase, MMP-13 can specifically cleave type II collagen, the primary component of the cartilage matrix, leading to irreversible cartilage destruction[36, 37]. In OA patients, MMP-13 is expressed by chondrocytes and synovial cells, and is activated in an inflammatory hypoxic microenvironment[37, 38]. Notably, we observed that the overexpression of PSMB9 led to the activation of the NF-κB signaling pathway, characterized by a significant reduction in both total and phosphorylated IκBα protein levels, along with an increase in the phosphorylation level of the p65 subunit. This result exhibited an opposite trend following the silencing of PSMB9. The activation of NF-κB involves multiple signaling pathways, including the classical IKK/IκB/NF-κB pathway and the non-classical pathway. In the classical pathway, inflammatory factors activate the IKK complex, resulting in the phosphorylation and degradation of IκBα, which releases NF-κB dimers (such as p65/p50) and promotes their entry into the nucleus[20, 39]. In osteoarthritis (OA), the activation of NF-κB is typically triggered by inflammatory factors (such as IL-1β and TNF-α) or mechanical stress [40, 41]. Once activated, NF-κB translocate to the nucleus and binds to the promoter regions of target genes, upregulating the expression of pro-inflammatory and catabolic factors such as MMP13, IL-6, IL-8, and TNF-α[42, 43]. These factors further lead to the degradation of the extracellular matrix (ECM) in chondrocytes and amplify the inflammatory response [44, 45]. To validate this hypothesis, we utilized JSH-23 to inhibit the NFκB signaling pathway. The results indicated that JSH-23 treatment effectively reversed the OA phenotype induced by IL-1β, significantly reducing the expression of MMP13 and IL-6, restoring the levels of COL2A1, and improving cell survival and proliferation status. This not only demonstrates the central role of the NF-κB pathway in this model but, more importantly, suggests that PSMB9 is located upstream of the NF-κB pathway or within its activation process, exerting its destructive effects through the regulation of this pathway. This aligns with previous findings that the upregulation of FAT10 is closely associated with renal tubular interstitial inflammation in chronic kidney disease, and the restoration of PSMB9 expression can reactivate the NF-κB pathway, promoting the production of inflammatory factors[46]. Furthermore, in a myocarditis model induced by viral infection, the absence of the immunoproteasome (including PSMB9) led to impaired NFκB activation, further exacerbating the inflammatory response and tissue damage. This indicates that PSMB9 plays a protective role in suppressing excessive inflammatory responses [47]. Similarly, the immunoproteasome (PSMB9) can activate the NFκB pathway by degrading IκB, increasing the infarction volume and worsening the inflammatory response in a rat model of ischemic stroke[29]. Interestingly, when we knocked down IL-6 using siRNA, the expression of PSMB9 also decreased. This reveals a previously unreported positive feedback loop: PSMB9 upregulates the expression of IL-6 by activating NF-κB, while high levels of IL-6 further promote the expression of PSMB9. This self-amplifying cycle greatly exacerbates and maintains the chronic inflammatory state and cartilage degradation process in OA joints, providing a new molecular mechanism model to explain why OA progressively worsens. In summary, this study reveals for the first time the pathogenic role of PSMB9 in osteoarthritis (OA) and its potential working mechanism. Under the inflammatory environment of OA, such as IL-1β stimulation, PSMB9 expression is upregulated, which in turn activates the NF-κB signaling pathway. The activated NF-κB promotes the secretion of inflammatory cytokines such as IL-6, which can feedback to enhance PSMB9 expression, thereby forming a positive feedback loop of PSMB9/NF-κB/IL-6(Fig7). The continuous operation of this axis ultimately leads to chondrocyte dysfunction, extracellular matrix metabolic imbalance, and irreversible damage to cartilage structure. Therefore, targeting PSMB9 or breaking this positive feedback loop may provide a promising direction for developing novel strategies to delay or treat OA. Future research will focus on using PSMB9-specific inhibitors or conditionally knocking out the Psmb9 gene in animal models to further validate its therapeutic potential. Declarations Acknowledgements We would like to express our gratitude to all the participants for their support. Author contributions All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. All authors had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis. L.H.Z, J.L.O, and J.C. designed the study, carried out data analyses, interpreted the results, and drafted the manuscript. Z.W.W, S.J.B, X.W, S.S, X.L, K.D.B, were involved in collecting the data, helping with data analyses, interpreting the results, and revising the manuscript. All the authors took part in the experiment. Funding This work was supported by the general project of Anhui Province Outstanding Young Talents Support Program for Universities (Grant No. gxyq2022009); the Anhui Institute of translational medicine (Grant No. 2022zhyx-C90); the Foundation of Anhui Medical University (Grant No. 2020xkj209) and the Open Project of Anhui Province Key Laboratory of Occupational Health (Grant No. 2024ZYJKB003). Availability of data and materials The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate This study was approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University, and written consent was obtained from all individuals participating in the study. The Declaration of Helsinki was followed for all experiments. Consent for publication Not applicable. Competing interests The authors declare no competing interests References Sanchez-Lopez, E., et al., Synovial inflammation in osteoarthritis progression. Nat Rev Rheumatol, 2022. 18(5): p. 258-275. Jiang, W., et al., Mechanical stress abnormalities promote chondrocyte senescence - The pathogenesis of knee osteoarthritis. Biomed Pharmacother, 2023. 167: p. 115552. Wakale, S., et al., How are Aging and Osteoarthritis Related? Aging Dis, 2023. 14(3): p. 592-604. Henriques, J., F. Berenbaum and A. Mobasheri, Obesity-induced fibrosis in osteoarthritis: Pathogenesis, consequences and novel therapeutic opportunities. Osteoarthr Cartil Open, 2024. 6(4): p. 100511. Floramo, J.S., et al., An Integrated View of Stressors as Causative Agents in OA Pathogenesis. Biomolecules, 2023. 13(5): p. 721. Chang, Y., et al., TrkC protects against osteoarthritis progression by maintaining articular cartilage homeostasis. Int J Biol Sci, 2025. 21(8): p. 3597-3613. Bard, J.A.M., et al., Structure and Function of the 26S Proteasome. Annu Rev Biochem, 2018. 87: p. 697-724. Collins, G.A. and A.L. Goldberg, The Logic of the 26S Proteasome. Cell, 2017. 169(5): p. 792-806. Huber, E.M., et al., Immuno- and constitutive proteasome crystal structures reveal differences in substrate and inhibitor specificity. Cell, 2012. 148(4): p. 727-38. Groettrup, M., et al., Interferon-gamma inducible exchanges of 20S proteasome active site subunits: why? Biochimie, 2001. 83(3-4): p. 367-72. Groettrup, M., et al., Structural plasticity of the proteasome and its function in antigen processing. Crit Rev Immunol, 2001. 21(4): p. 339-58. Ettari, R., et al., Immunoproteasome-Selective Inhibitors: A Promising Strategy to Treat Hematologic Malignancies, Autoimmune and Inflammatory Diseases. Curr Med Chem, 2016. 23(12): p. 1217-38. Kast, J., Immunoproteasome deficiency in non-small cell lung cancer and its relevance to immunotherapy. J Thorac Dis, 2016. 8(9): p. E1082-E1086. Kaur, G. and S. Batra, Emerging role of immunoproteasomes in pathophysiology. Immunol Cell Biol, 2016. 94(9): p. 812-820. Mishto, M., et al., The immunoproteasome beta5i subunit is a key contributor to ictogenesis in a rat model of chronic epilepsy. Brain Behav Immun, 2015. 49: p. 188-96. Li, Z., et al., Identification of PSMB9 and CXCL13 as Immune-related Diagnostic Markers for Rheumatoid Arthritis by Machine Learning. Curr Pharm Des, 2022. 28(34): p. 2842-2854. Yeo, I.J., et al., A dual inhibitor of the proteasome catalytic subunits LMP2 and Y attenuates disease progression in mouse models of Alzheimer's disease. Sci Rep, 2019. 9(1): p. 18393. Geoffroy, K., et al., Increased expression of the immunoproteasome subunits PSMB8 and PSMB9 by cancer cells correlate with better outcomes for triple-negative breast cancers. Sci Rep, 2023. 13(1): p. 2129. Hou, Z., M. Wang and S. Cao, Inhibition of Toll-Like Receptor 3 Relieves Osteoarthritis by Suppression of Cartilage Degradation, Nuclear Factor Kappa B-Mediated Inflammation, and Activation of Autophagy. Cartilage, 2025. 251(3): p. 17713. Lu, J., et al., Chrysophanol prevents IL-1beta-Induced inflammation and ECM degradation in osteoarthritis via the Sirt6/NF-kappaB and Nrf2/NF-kappaB axis. Biochem Pharmacol, 2023. 208: p. 115402. Jia, Y., et al., Morusin Ameliorates IL-1beta-Induced Chondrocyte Inflammation and Osteoarthritis via NF-kappaB Signal Pathway. Drug Des Devel Ther, 2020. 14: p. 1227-1240. Lee, S., M.K. Shin and J. Sung, Tamarixetin Protects Chondrocytes against IL-1β-Induced Osteoarthritis Phenotype by Inhibiting NF-κB and Activating Nrf2 Signaling. Antioxidants, 2024. 13(10): p. 1166. Maldonado, M., et al., Immunoproteasome deficiency modifies the alternative pathway of NFkappaB signaling. PLoS One, 2013. 8(2): p. e56187. Cheng, A.W.M., et al., Selenomethionine inhibits IL-1beta inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX2) expression in primary human chondrocytes. Osteoarthritis Cartilage, 2011. 19(1): p. 118-25. Zhang, L., et al., Knockdown of hsa_circ_0134111 alleviates the symptom of osteoarthritis via sponging microRNA-224-5p. Cell Cycle, 2021. 20(11): p. 1052-1066. Ma, C., et al., The pro-inflammatory effect of NR4A3 in osteoarthritis. J Cell Mol Med, 2020. 24(1): p. 930-940. Yunus, M.H.M., A. Nordin and H. Kamal, Pathophysiological Perspective of Osteoarthritis. Medicina (Kaunas), 2020. 56(11): p. 614. Groettrup, M., et al., The subunits MECL-1 and LMP2 are mutually required for incorporation into the 20S proteasome. Proc Natl Acad Sci U S A, 1997. 94(17): p. 8970-5. Chen, X., et al., Inhibition of immunoproteasome reduces infarction volume and attenuates inflammatory reaction in a rat model of ischemic stroke. Cell Death Dis, 2015. 6(1): p. e1626. He, J. and J. He, Baicalin mitigated IL-1beta-Induced osteoarthritis chondrocytes damage through activating mitophagy. Chem Biol Drug Des, 2023. 101(6): p. 1322-1334. Lu, G., et al., LINC00623/miR-101/HRAS axis modulates IL-1beta-mediated ECM degradation, apoptosis and senescence of osteoarthritis chondrocytes. Aging (Albany NY), 2020. 12(4): p. 3218-3237. Chenoufi, H.L., et al., Increased mRNA expression and protein secretion of interleukin-6 in primary human osteoblasts differentiated in vitro from rheumatoid and osteoarthritic bone. J Cell Biochem, 2001. 81(4): p. 666-78. Wang, B., et al., Aucubin Protects Chondrocytes Against IL-1beta-Induced Apoptosis In Vitro And Inhibits Osteoarthritis In Mice Model. Drug Des Devel Ther, 2019. 13: p. 3529-3538. Kovacs, B., E. Vajda and E.E. Nagy, Regulatory Effects and Interactions of the Wnt and OPG-RANKL-RANK Signaling at the Bone-Cartilage Interface in Osteoarthritis. Int J Mol Sci, 2019. 20(18): p. 4653. Xiao, S., et al., The role of apoptosis in the pathogenesis of osteoarthritis. Int Orthop, 2023. 47(8): p. 1895-1919. Bendele, A.M., et al., Development of a selective matrix metalloproteinase 13 (MMP-13) inhibitor for the treatment of Osteoarthritis. Eur J Med Chem, 2021. 224: p. 113666. Wilkinson, D.J., et al., Matrix metalloproteinase-13 is fully activated by neutrophil elastase and inactivates its serpin inhibitor, alpha-1 antitrypsin: Implications for osteoarthritis. FEBS J, 2022. 289(1): p. 121-139. Zhou, T., et al., Hypoxia and Matrix Metalloproteinase 13-Responsive Hydrogel Microspheres Alleviate Osteoarthritis Progression In Vivo. Small, 2024. 20(19): p. e2308599. International, B.R., RETRACTION: "Platelet-Rich Plasma Combined with Alendronate Reduces Pain and Inflammation in Induced Osteoarthritis in Rats by Inhibiting the Nuclear Factor-Kappa B Signaling Pathway". Biomed Res Int, 2025. 2025: p. 9840675. Chen, X., et al., Sirtuin 2 regulates NOD-like receptor protein 3/nuclear factor kappa B axis to promote cartilage repair in osteoarthritis. J Cell Commun Signal, 2025. 19(3): p. e70031. Xia, W., et al., Orientin inhibits inflammation in chondrocytes and attenuates osteoarthritis through Nrf2/NF-kappaB and SIRT6/NF-kappaB pathway. J Orthop Res, 2023. 41(11): p. 2405-2417. Zeng, Z., et al., Pelargonidin ameliorates inflammatory response and cartilage degeneration in osteoarthritis via suppressing the NF-kappaB pathway. Arch Biochem Biophys, 2023. 743: p. 109668. Fukuda, Y., et al., Receptor activator of nuclear factor-kappa B ligand-derived microglia healing peptide 1-AcN inhibits osteoarthritis progression in mice. Arthritis Res Ther, 2025. 27(1): p. 142. Liao, Y., et al., NOX2-Deficient Neutrophils Facilitate Joint Inflammation Through Higher Pro-Inflammatory and Weakened Immune Checkpoint Activities. Front Immunol, 2021. 12: p. 743030. Sun, W., et al., Wedelolactone alleviates inflammation and cartilage degeneration by suppressing the NF-kappaB signaling pathway in osteoarthritis. Int Immunopharmacol, 2024. 143(Pt 1): p. 113359. Gong, P., et al., The ubiquitin-like protein FAT10 mediates NF-kappaB activation. J Am Soc Nephrol, 2010. 21(2): p. 316-26. Opitz, E., et al., Impairment of immunoproteasome function by beta5i/LMP7 subunit deficiency results in severe enterovirus myocarditis. PLoS Pathog, 2011. 7(9): p. e1002233. Additional Declarations No competing interests reported. Supplementary Files supplementary.pdf Cite Share Download PDF Status: Published Journal Publication published 14 Mar, 2026 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted Editorial decision: Revision requested 08 Jan, 2026 Reviews received at journal 06 Jan, 2026 Reviews received at journal 06 Jan, 2026 Reviews received at journal 13 Dec, 2025 Reviewers agreed at journal 11 Dec, 2025 Reviewers agreed at journal 10 Dec, 2025 Reviewers agreed at journal 10 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers invited by journal 08 Dec, 2025 Editor assigned by journal 04 Dec, 2025 Submission checks completed at journal 04 Dec, 2025 First submitted to journal 01 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8216872","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":557877327,"identity":"be27d6e5-fbc9-42af-a41b-7ca4c02d9025","order_by":0,"name":"Lianhui Zhao","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lianhui","middleName":"","lastName":"Zhao","suffix":""},{"id":557877328,"identity":"e67061c8-7af8-4180-91da-0d24009bb816","order_by":1,"name":"Jianliang Ou","email":"","orcid":"","institution":"The First Affiliated Hospital of Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jianliang","middleName":"","lastName":"Ou","suffix":""},{"id":557877331,"identity":"237f691a-2cce-4782-a51d-7547614f3141","order_by":2,"name":"Sijie Bian","email":"","orcid":"","institution":"The First Affiliated Hospital of Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Sijie","middleName":"","lastName":"Bian","suffix":""},{"id":557877332,"identity":"500e9c92-378e-4ea6-b08c-2016b0fb0ffa","order_by":3,"name":"Zhangwei Wu","email":"","orcid":"","institution":"The First Affiliated Hospital of Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhangwei","middleName":"","lastName":"Wu","suffix":""},{"id":557877333,"identity":"7d441796-c23e-46e5-87ec-4a3b6995f165","order_by":4,"name":"Xu Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Wang","suffix":""},{"id":557877334,"identity":"5d2bc85e-ac8b-4843-8d0d-540620f5b52c","order_by":5,"name":"Shuo Shi","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Shi","suffix":""},{"id":557877335,"identity":"f17cd07d-cf02-4947-851d-13a57a55c73c","order_by":6,"name":"Xin Liu","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Liu","suffix":""},{"id":557877336,"identity":"9f0c2270-7d5a-4b60-bffc-ff18fd67ddfa","order_by":7,"name":"Kaida Bo","email":"","orcid":"","institution":"The First Affiliated Hospital of Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kaida","middleName":"","lastName":"Bo","suffix":""},{"id":557877337,"identity":"2a4bbd30-948d-4482-849e-ccc54715249f","order_by":8,"name":"Daizhi Shi","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Daizhi","middleName":"","lastName":"Shi","suffix":""},{"id":557877340,"identity":"84fbfb9f-1c87-48a9-a492-6706faa9a537","order_by":9,"name":"Jun Chang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABH0lEQVRIiWNgGAWjYDAC5gNsDAkGNjz8zIyNDz7YAEUkIOK4tbAlsDE8KEiTk2xvPmw4I41ILYwPPhwyNjhzLE2YhxgtBsd4zB4kGBxInDkjx4zZJuEwA//s7jQJhgrrxAb2swdwaDE3SDC4k9gvkWP2OAeoReLO2W0SDGfSExt48hKwarnfYyaRYPAMZIu5ce6PwwwMN3K3STC2HU5skOAxwOUwoJbDiRtu5JhJWwBtkQdr+UdYC9j70gxALQZgLQ24tUgeYysH+gUayD0J6TyGN3I3WyQcSzdu48nBqoXvGPO2hz/+QKPyR4K1nNyN3I03PtRYy/azn8GqReEAB4p4Mw+YAgUVGzb1QCDfwP4AmV+HQ90oGAWjYBSMZAAAaGxo29uBHuYAAAAASUVORK5CYII=","orcid":"","institution":"Anhui Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jun","middleName":"","lastName":"Chang","suffix":""}],"badges":[],"createdAt":"2025-11-27 01:38:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8216872/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8216872/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13018-026-06796-2","type":"published","date":"2026-03-14T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":97911651,"identity":"f84a3065-80c0-4c05-a538-dd64368604e5","added_by":"auto","created_at":"2025-12-10 16:35:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":352745,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential expression analysis of PSMB9 in human public datasets. (A) The volcano plot of the GSE215039 dataset displays the ranking of differentially expressed genes. The color gradient indicates the significance of p-values, with red representing higher significance. (B) The volcano plot of the GSE169077 dataset shows the log2 fold changes of gene expression. Genes that are significantly upregulated (right side) and downregulated (left side) in the proteasome family are highlighted, with a p-value threshold set at 0.05. (C) A scatter plot compares the log2 fold changes of the GSE1919 and GSE55235 datasets, indicating their differential expression across different datasets. (D) A Venn diagram summarizes the overlap of differentially expressed genes among the GSE215039, GSE1919, and GSE55235 datasets. NS, no significant difference; **, p\u0026lt;0.01; ***, p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/43b328d95867dd131b67f306.png"},{"id":97911655,"identity":"60e7dd17-40bc-46a2-9315-3ae9d32ecd0a","added_by":"auto","created_at":"2025-12-10 16:35:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":642033,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential Expression Analysis of PSMB9 in Mouse Public Datasets and Comparison with Human Data. (A) The volcano plot illustrates the differential expression of PSMB9 at various time points (2, 4, 8, and 16 weeks post-DMM modeling) within the GSE38537 and GSE14342 datasets. (B) The box plots depict the variations in expression profile data from the GSE1919 and GSE5235 datasets before and after batch correction. The upper panel presents the raw expression data, while the lower panel displays the corrected data. (C) The principal component analysis (PCA) plot reveals the clustering of samples before and after batch correction. The left panel shows distinct clustering of the GSE1919 and GSE5235 datasets prior to correction, whereas the right panel illustrates the clustering post-correction. (D) A heatmap illustrates the expression of PSMB9 across multiple datasets. NS indicates no significant difference; ** denotes p\u0026lt;0.01; and *** indicates p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/6b23325a534237b07b201dc6.png"},{"id":97911652,"identity":"097a59ff-c830-439b-8721-66f31c627390","added_by":"auto","created_at":"2025-12-10 16:35:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":707965,"visible":true,"origin":"","legend":"\u003cp\u003eIncreased expression of PSMB9 in OA tissues. (A) Hematoxylin and eosin (H\u0026amp;E) staining and Safranin O-fast green (S\u0026amp;F) staining of joint cartilage in the control group (top) and DMM group (bottom). (B) Immunohistochemical analysis of PSMB9, IL-6, Col2a1, and MMP13 expression levels in the control and DMM groups. (C) Immunohistochemical detection of PSMB9 expression in human normal cartilage (top) and OA joint cartilage (bottom). (D) Detection of PSMB9 protein expression levels in mouse primary chondrocytes stimulated with IL-1β. (E) Detection of PSMB9 mRNA expression levels in mouse primary chondrocytes stimulated with IL-1β. (F) IL-1β induction of C28/I2 cells and detection of PSMB9, IL-6, Col2a1, and MMP13 protein expression levels. (G) IL-1β induction of the C28/I2 cell line and detection of PSMB9 mRNA levels. (H) IL-1β induction of human primary chondrocytes and detection of PSMB9 mRNA levels. NS, no significant difference; **, p\u0026lt;0.01; ***, p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/fda3ab391a1c63afa7f79dd2.png"},{"id":97911657,"identity":"2b7538ae-8d02-4c5c-9bae-14c2614b9a68","added_by":"auto","created_at":"2025-12-10 16:35:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":616581,"visible":true,"origin":"","legend":"\u003cp\u003ePSMB9 promotes apoptosis, inflammatory response, and extracellular matrix degradation in IL-1β induced C28/I2 chondrocytes. (A, B) Western blot analysis was performed to detect the expression of extracellular matrix degradation-related proteins and cytokines, including MMP13, Col2a1, and IL-6. (C, D) Western blot analysis was also conducted to assess the expression of key proteins in the NF-κB pathway, including IκB-α, Phospho-IκBα, P65, and Phospho-P65. (E) The OD values (450 nm) of chondrocytes in each group were measured using the CCK-8 method to evaluate cell viability. (F) The proliferation ability of chondrocytes in each group was assessed using the EDU method, with green indicating EDU-positive cells and the cell nuclei stained blue with Hoechst 33342. (G) The apoptosis rate was measured by flow cytometry. NS indicates no significant difference; **, p\u0026lt;0.01; ***, p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/4bf1b5481674866a7617897b.png"},{"id":97911654,"identity":"e9dbb4f9-993b-41c5-9cfb-984be06c5c20","added_by":"auto","created_at":"2025-12-10 16:35:50","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":613142,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of PSMB9 inhibits IL-1β-induced apoptosis, inflammatory response, and extracellular matrix degradation in C28/I2 chondrocytes. (A, B) Western blot analysis was performed to detect the expression of extracellular matrix degradation-related proteins and cytokines, including MMP13, Col2a1, and IL-6. (C, D) Western blot analysis was conducted to measure the expression of key proteins in the NF-κB pathway, including IκB-α, Phospho-IκBα, P65, and Phospho-P65. (E) The OD value (450 nm) of chondrocytes in each group was determined using the CCK-8 method to assess cell viability. (F) The proliferation capability of chondrocytes in each group was evaluated using the EDU method, with green indicating EDU-positive cells and cell nuclei stained blue with Hoechst 33342. (G) The apoptosis rate was measured using flow cytometry. NS, no significant difference; **, p\u0026lt;0.01; ***, p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/84c0b1b8bdddecf9717dc132.png"},{"id":98421478,"identity":"f2a44031-d8c3-4f9a-a44e-ae3dfc730864","added_by":"auto","created_at":"2025-12-17 16:27:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":427059,"visible":true,"origin":"","legend":"\u003cp\u003eJSH-23 alleviates chondrocyte injury following the inhibition of the NF-κB pathway. (A) Flow cytometry was employed to detect cell apoptosis and perform quantitative analysis after treating C28/I2 cells with IL-1β and JSH-23. (B, C) The protein expression levels of cartilage matrix metabolism and cytokines, as well as relative quantitative analysis, were assessed following treatment of C28/I2 cells with IL-1β and JSH-23. (D) The proliferation capacity of the C28/I2 cell line was measured using the CCK8 assay after treatment with IL-1β and JSH-23. (E, F) After silencing IL-6, the protein expression levels of PSMB9 and IL-6 in the C28/I2 cell line stimulated by IL-1β were analyzed, along with relative quantitative analysis. NS indicates no significant difference; **, p\u0026lt;0.01; ***, p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/7e354ccaf8cfd649e2ba4245.png"},{"id":98421084,"identity":"02f02ee0-eff3-4533-bdcf-c8685300e26b","added_by":"auto","created_at":"2025-12-17 16:23:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":379738,"visible":true,"origin":"","legend":"\u003cp\u003eIL-1β induces the replacement of the proteasome-specific subunit PSMB9 with the β1 subunit to form immunoproteasomes, while mediating the activation of the NF-κB pathway. Our study found that the overexpression of PSMB9 may accelerate the degradation of Phospho-IκB-α, thereby activating the NF-κB signaling pathway, which further exacerbates the expression of inflammatory factors in chondrocytes and the degradation of cartilage matrix induced by IL-1β, consequently worsening osteoarthritis. Additionally, we discovered that IL-6 may positively feedback to promote this process.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/1f7b517918785fda6a5217ea.png"},{"id":104739351,"identity":"9e540186-c331-412a-80a4-0a97d2cdc0f5","added_by":"auto","created_at":"2026-03-16 16:03:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4363557,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/814ad249-ce28-4fd8-85b6-8adbb229032e.pdf"},{"id":98421054,"identity":"4fe8430a-1457-4daa-8743-b080d83e7304","added_by":"auto","created_at":"2025-12-17 16:22:54","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1678553,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8216872/v1/8ba3ab6ecddb430a62d4c7b5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PSMB9 Exacerbates Chondrocyte Injury in Osteoarthritis via Activation of the NF-κB Pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eOsteoarthritis (OA) is the most common degenerative joint disease, characterized by progressive destruction of articular cartilage, subchondral bone sclerosis, osteophyte formation, and synovial inflammation. Globally, OA affects millions of people and is a leading cause of pain, functional impairment, and disability among middle-aged and elderly individuals, imposing a heavy economic and healthcare burden on society [1]. Currently, the etiology and pathogenesis of OA have not been fully elucidated, but it is generally believed to be closely related to metabolic imbalances in joint tissues and chronic low-grade inflammatory responses caused by various factors such as mechanical stress, age, obesity, and genetic susceptibility [2-5]. In the complex pathological process of OA, the imbalance of chondrocyte homeostasis is a core element, manifested as a disruption between anabolic and catabolic metabolism, ultimately leading to extracellular matrix (ECM) degradation, cell apoptosis, and autophagy abnormalities, which accelerate cartilage destruction [6].\u003c/p\u003e\n\u003cp\u003eThe proteasome is an important multi-subunit protein complex within the cell, responsible for degrading unnecessary or damaged proteins to maintain intracellular protein homeostasis[7, 8]. The 26S proteasome is a multi-protein complex composed of a 20S core particle and one or two 19S regulatory particles. The core particle of the 20S proteasome is a barrel-shaped structure made up of four stacked heptameric rings (\u0026alpha;\u0026beta;\u0026beta;\u0026alpha;)。 The two outer rings, composed of \u0026alpha; subunits (\u0026alpha;1-7), serve as binding sites for regulatory complexes (including 19S, 11S, and PA 200 families), which facilitate peptidase activity and control the entry of cytosolic proteins into the proteasome chamber. The two inner rings consist of \u0026beta; subunits (\u0026beta;1-7), among which three (\u0026beta;1, \u0026beta;2, and \u0026beta;5) contain active sites that catalyze the hydrolysis of threonine residues[9]. In cells stimulated by interferon (IFN\u0026gamma;) or tumor necrosis factor (TNF\u0026alpha;), these proteolytic active subunits are replaced by \u0026beta;1i (LMP2/PSMB9), \u0026beta;2i (MECL-1/PSMB10), and \u0026beta;5i (LMP7/PSMB8), forming the immunoproteasome[10, 11]. In addition to the standard proteasome, proteasome variants with inducible \u0026beta; subunits (immunoproteasomes) play significant roles in various pathological conditions, including autoimmune diseases, inflammatory diseases, and cancer[12-15].\u0026nbsp;Traditionally, PSMB9 has been considered to be primarily expressed in immune cells and involved in the process of antigen presentation. However, recent studies have shown that PSMB9 is also abnormally expressed in various non-immune cells, including tumor cells and endothelial cells, and may participate in the regulation of apoptosis, proliferation, and inflammatory responses[16-18]. Notably, some research has found that PSMB9 is highly expressed in the synovial tissue of rheumatoid arthritis and may be associated with the activation of the NF-\u0026kappa;B pathway[16]. However, the expression, biological function, and specific molecular mechanisms of PSMB9 in chondrocytes of osteoarthritis remain unclear.\u003c/p\u003e\n\u003cp\u003eThe nuclear factor kappa-B (NF-\u0026kappa;B) signaling pathway serves as a crucial hub linking inflammatory responses to cartilage degradation. In the context of osteoarthritis (OA), various inflammatory cytokines (such as IL-1\u0026beta; and TNF-\u0026alpha;) or mechanical stress can activate the NF-\u0026kappa;B pathway. The activated NF-\u0026kappa;B (primarily the p65 subunit)\u0026nbsp;translocate to the nucleus, initiating the transcription of a series of downstream target genes, including matrix metalloproteinases (MMPs) and various inflammatory factors (such as IL-6)[19, 20]. These factors collectively promote the degradation of the extracellular matrix (ECM), inhibit the synthesis of cartilage matrix components (such as type II collagen and aggrecan), and further amplify the inflammatory cascade, creating a vicious cycle that continuously exacerbates chondrocyte damage [21, 22]. PSMB9, as a component of the immunoproteasome, directly participates in the degradation of I\u0026kappa;B\u0026alpha;. Previous experiments have shown that the absence of PSMB9 leads to a delay in the degradation of I\u0026kappa;B\u0026alpha;, thereby inhibiting the activation of NF\u0026kappa;B \u0026nbsp;[23].\u0026nbsp;However, whether this regulatory relationship exists in chondrocytes of osteoarthritis remains unknown.\u003c/p\u003e\n\u003cp\u003eThis study identifies proteasome family members associated with osteoarthritis (OA) from multiple human datasets (such as GSE215039) and mouse data, determining that PSMB9 is expressed at elevated levels in chondrocytes of OA patients. Immunohistochemistry was employed to validate the increased expression of PSMB9 in human arthritis tissues and in mouse OA models. Subsequently, the role of PSMB9 in OA and its regulation of the NF\u0026kappa;B pathway were investigated using an IL-1\u0026beta; induced chondrocyte model. The aim is to provide new insights and potential therapeutic approaches for OA.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Dataset Selection and Processing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe obtained a high-throughput transcriptome dataset of human primary chondrocytes (GSE215039) from the Gene Expression Omnibus (GEO, URL: http://www.ncbi.nlm.nih.gov/geo/), which includes a calibrated and quality-controlled count matrix. First, we performed quantile normalization and log2 transformation on this matrix to ensure the accuracy and comparability of the data. The transcriptome count matrix contains samples of human primary chondrocytes from five osteoarthritis patients who underwent total knee arthroplasty and five non-osteoarthritis patients who underwent scoliosis surgery. All these samples were untreated, and there are significant pathological differences between the two groups, making this dataset of great value for studying the molecular differences of human primary chondrocytes in normal and inflammatory environments. Subsequently, we retrieved a multi-tissue, multi-species microarray dataset from the Gene Expression Omnibus.\u0026nbsp;The expression profile data from GSE169077 includes knee cartilage samples from five healthy individuals and six osteoarthritis patients, all obtained from knee replacement surgeries. This dataset holds significant research value in exploring the molecular differences between knee cartilage of healthy individuals and those with osteoarthritis. The expression profile data from GSE55235 and GSE1919 comprises a total of 15 synovial tissue samples from normal individuals and 15 from osteoarthritis patients. After merging these two datasets and performing batch correction using the \u0026apos;sva\u0026apos; package, we conducted differential analysis. Both datasets are crucial for studying the molecular differences in synovial tissues between normal individuals and osteoarthritis patients. The expression profile data from GSE53857 and GSE41342 covers relevant data from a mouse osteoarthritis model at postoperative weeks 2, 4, 8, and 16. These two datasets are also of significant value in investigating the molecular differences at different time points in the mouse osteoarthritis model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Clinical Samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThree cases of patients with osteoarthritis due to knee joint replacement surgery were selected from the First Affiliated Hospital of Anhui Medical University. All patients were diagnosed with osteoarthritis according to the osteoarthritis diagnostic guidelines. All clinical data were obtained after approval and consent from the Clinical Management Committee of the hospital. According to Item 9 of the \u0026quot;Ethical Review Application/Report Guidelines\u0026quot; from the Clinical Medical Research Ethics Committee of Anhui Medical University, the risks posed to the subjects in this study do not exceed the minimum risk. The privacy of the subjects is protected, adhering to the principle that allows subjects to choose not to sign a written informed consent form, and the study was reviewed by the Biomedical Ethics Committee of Anhui Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Animal Experiments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe C57BL/6 mice used in the experiments were provided by the Experimental Animal Center of Anhui Medical University and were housed in a specific pathogen-free (SPF) environment, maintaining constant temperature and humidity (23-25\u0026deg;C, 45-65%) and a regular light-dark cycle (12 hours). An osteoarthritis (OA) model was induced through a destabilization of the medial meniscus (DMM) surgery to simulate the pathological changes associated with post-traumatic OA. Eight-week-old male C57BL/6J mice underwent DMM surgery (meniscal injury) on their right hind knees (n=5) or were assigned to a control group (n=5). Knee joint samples were collected 8 weeks post-surgery.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Isolation of Chondrocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary chondrocytes were extracted from normal articular cartilage as previously described [24]. Normal knee cartilage samples were obtained and washed three times with PBS. Subsequently, the cartilage samples were minced using ophthalmic scissors. The minced cartilage was digested with trypsin and collagenase II to isolate the digested chondrocytes. After digestion, the cell suspension was filtered through a 150-mesh stainless steel filter and centrifuged at 1000 rpm for 3-5 minutes. The chondrocytes were washed three times with PBS and then cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) (Thermo Fisher Scientific Inc.) containing 10% fetal bovine serum (Thermo Fisher Scientific Inc.) and 1% penicillin/streptomycin (keygen biotech co. ltd) in a humidified incubator with 5% CO2. To establish an in vitro osteoarthritis model, the chondrocytes were co-cultured with 10 ng/ml IL-1\u0026beta; (Thermo Fisher Scientific Inc.) as previously reported [25].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Cell Cultivation and Therapy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original chondrocytes and C28/I2 cell line (from the First Affiliated Hospital of Anhui Medical University) were cultured in high-glucose DMEM medium (Thermo Fisher Scientific Inc.), supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Inc.) and 1% penicillin/streptomycin (keygen biotech co. ltd). Human osteoarthritis articular chondrocytes were cultured in DMEM medium and used for research after 1-3 passages. All cells were maintained at 37\u0026deg;C in a 5% carbon dioxide environment. Recombinant human IL-1\u0026beta; used for cell treatment was provided by Thermo Fisher.\u003c/p\u003e\n\u003cp\u003eAccording to the usage instructions for genechem lentivirus products, all lentiviruses are stored in a low-temperature environment at -70\u0026deg;C. The C28/I2 cell line is uniformly seeded in 6-well plates at a density of 2\u0026times;10⁵ cells per well. When the cell density reaches 40%-50%, lentivirus is added for infection (MOI=80), along with polybrene (5 \u0026micro;g/mL) (MedChemExpress biotechnology co. ltd) to enhance infection efficiency. Twelve hours post-infection, the medium is discarded and replaced with fresh medium.\u003c/p\u003e\n\u003cp\u003eAccording to the siRNA product instructions from OBiO Technology, siRNA transfection was performed. All siRNAs were stored at -20\u0026deg;C at a concentration of 20 \u0026mu;M. For transfection in a 6-well plate, 10 \u0026mu;L of siRNA was diluted in 250 \u0026mu;L of Opti-MEM\u0026reg; (Thermo Fisher Scientific Inc.) to a working concentration of 100 nM, and gently pipetted 3-5 times to ensure thorough mixing. 5 \u0026mu;L of the transfection reagent Lipo2000 (Thermo Fisher Scientific Inc.) was diluted in 250 \u0026mu;L of opti-MEM\u0026reg;, and then allowed to stand at room temperature for 5 minutes. Subsequently, the siRNA and transfection reagent were gently mixed 3-5 times to ensure thorough mixing and incubated at room temperature for 25 minutes. After incubation, 500 \u0026mu;L of the transfection complex was added to the 6-well plate, gently mixed, and the cell plate was placed in a 37\u0026deg;C, 5% CO2 incubator for culture. After 6 hours, fresh complete medium containing 10% serum was replaced, and culture continued for 24-48 hours. To further clarify the mechanism of action of PSMB9 in osteoarthritis, the NF-\u0026kappa;B inhibitor JSH-23 (10 \u0026mu;M) (KKL MED Inc.)\u0026nbsp;[26]was used to determine whether PSMB9 would affect the NF-\u0026kappa;B signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Cell Counting Kit-8 (CCK)-8 Assay Method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CCK-8 kit from Beyotime Biotechnology was utilized to assess changes in cell proliferation ability following transfection. Chondrocytes were digested with trypsin to prepare a single-cell suspension at a density of 2\u0026times;10^4 cells/mL, which was then seeded into a 96-well plate. CCK-8 solution was added to each well, and the cells were cultured for 2 hours. The optical density (OD) values were measured at 24 hours and 48 hours to plot the growth curve.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Hematoxylin-Eosin (HE) Staining Method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter euthanizing the mice, the knee joints were harvested and surrounding muscles were excised. The samples were fixed in 4% paraformaldehyde at 4\u0026deg;C for 48 hours, followed by decalcification with 15% EDTA at 37\u0026deg;C for 2 weeks. Subsequently, the samples were embedded in paraffin and sectioned into 5-micron thick slices. Hematoxylin and eosin (HE) staining was performed according to the kit protocol (Solarbi Technology Co., Ltd.). In brief, the paraffin sections were first dewaxed and rehydrated, followed by staining with hematoxylin and eosin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 Safranin O-Fast Green Staining Method\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor small knee joint tissue sections or cartilage slices, staining is performed using the Safranin O-fast green staining kit from Solarbio Life Science, following the manufacturer\u0026apos;s instructions. The severity of osteoarthritis is assessed using the Osteoarthritis Research Society International (OARSI) scoring system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Immunohistochemical Staining\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse or human knee joint tissue sections were digested in antigen retrieval solution (Boster biological technology co. ltd) at 37\u0026deg;C for 30 minutes. After adding 3% hydrogen peroxide at room temperature for 10 minutes, the sections were incubated overnight at 4\u0026deg;C with the corresponding primary antibodies ((Col2a1 (Abcam plc), MMP13 (Affinity Biosciences ltd.), PSMB9 (Immunoway Biotechnology co. ltd.), IL-6 (Affinity Biosciences ltd.)). Staining was detected using the streptavidin-biotin detection system (Beijing OriGene Technology Co., Ltd.). Color development was performed using DAB (Beijing OriGene Technology Co., Ltd.), followed by counterstaining with hematoxylin (Solarbi Technology Co., Ltd.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 Detection of Cell Apoptosis by Flow Cytometry\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApoptosis of chondrocytes was quantitatively assessed using a \u0026quot;Annexin V - Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Apoptosis Detection Kit\u0026quot; (Keygen biotech co. ltd). Chondrocytes were incubated at 37\u0026deg;C and treated with 5 \u0026mu;l of Annexin V - FITC and 5 \u0026mu;l of Propidium Iodide (PI) for 10 minutes. After treatment, labeled cells were evaluated for apoptosis using a FACScan flow cytometer (Beckman Coulter, Inc.). The apoptosis level was assessed using the Annexin V - FITC/PI apoptosis detection kit via flow cytometry. Chondrocytes from different treatment groups were adjusted to a concentration of 5\u0026times;10^6 cells per milliliter. Subsequently, 500 \u0026mu;l of binding buffer was added to terminate the digestion reaction. The chondrocytes were then mixed with 5 \u0026mu;l of Annexin V - FITC for 5 minutes and protected from light. After \u0026nbsp; \u0026nbsp;mixing, 5 \u0026mu;l of Propidium Iodide was added immediately and incubated for 20 minutes. Apoptosis rates were evaluated within 1 hour and analyzed using FlowJo software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11 Western blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal cellular proteins were lysed using an immunoprecipitation analysis (RIPA) solution containing protease inhibitors (Shanghai Beyotime Biotechnology Co., Ltd.). Subsequently, these proteins were separated on sodium dodecyl sulfate-polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane (Merck KGaA). The membrane was blocked at room temperature with either 5% non-fat dry milk or 5% BSA, followed by incubation with a diluted primary antibody at a dilution of 1:2000. After that, the membrane was treated with a secondary antibody at room temperature for 2 hours. Protein bands were visualized using ECL enhanced chemiluminescence reagent (Abbkine Scientific Co., Ltd.). The primary antibodies used in this study include anti-PSMB9 (Immunoway Biotechnology co. ltd.), anti-MMP-13 (Affinity Biosciences ltd.), anti-IL-6 (Affinity Biosciences ltd.), anti-Col2a1 (Abcam plc), anti-I\u0026kappa;B\u0026alpha; (Immunoway Biotechnology co. ltd.), anti-P65 (Immunoway Biotechnology co. ltd), anti-p65 (Phospho Ser536) (Immunoway Biotechnology co. ltd), anti-I\u0026kappa;B-\u0026alpha; (Phospho Ser36) (Immunoway Biotechnology co. ltd.), anti-\u0026beta;-actin (Bioworld Biotechnology Co., Ltd.), and anti-\u0026beta;-Tubulin (Bioworld Biotechnology Co., Ltd.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12 RNA Extraction and Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cells using TRIzol\u0026trade; reagent (Thermo Fisher Scientific Inc.), and reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit from Vazym. Following the manufacturer\u0026apos;s protocol, RT-qPCR was performed on a 7500 Real-Time PCR System (Thermo Fisher Scientific Inc.) using SYBR Premix Ex Taq from Vazym. Subsequently, relative mRNA levels were quantified using the -2\u0026minus;\u0026Delta;\u0026Delta;Ct method.\u0026nbsp;The primers used are listed in Table 1.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"461\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 461px;\"\u003e\n \u003cp\u003eTable 1: Nucleotide sequences of primers used for qPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 311px;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 150px;\"\u003e\n \u003cp\u003ePSMB9(Human)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 311px;\"\u003e\n \u003cp\u003eForward: GGAGGTCAGGTATATGGAACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 311px;\"\u003e\n \u003cp\u003e\u0026nbsp;Reverse: CCTGGCTTATATGCTGCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 150px;\"\u003e\n \u003cp\u003ePSMB9(Mouse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eForward: GAGGACTTGTTAGCGCATCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eReverse: CATATACCTGTCCCCCCTCACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 150px;\"\u003e\n \u003cp\u003eGAPDH(Human)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eForward: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eReverse: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 150px;\"\u003e\n \u003cp\u003eGAPDH(Mouse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eForward: CAGTGGCAAAGTGGAGATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 311px;\"\u003e\n \u003cp\u003eReverse: TGCCGTGAGTGGAGTCATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13 Statistical Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, all tests were conducted using three samples. Data analysis was performed using Prism 8.0 (GraphPad Prism), employing t-tests or one-way ANOVA, with a significance level set at p \u0026lt; 0.05.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Differential expression analysis of PSMB9 in human public datasets\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe first explored the expression differences of the proteasome family in the transcriptomic RNA of primary human chondrocytes from healthy individuals and those with osteoarthritis (OA) by analyzing the GSE215039 dataset. The waterfall plot reveals a significant ranking of differentially expressed genes, highlighting PSMB9 and PSMB8 as major candidate genes (Fig1.A). This figure illustrates the relationship between gene ranking and their corresponding log2 fold changes, with PSMB9 prominently marked, indicating that PSMB9 is not only a differentially expressed gene but also statistically relevant in the context of OA. Next, we analyzed the expression differences of the proteasome family in knee cartilage of healthy individuals and OA patients using the GSE169077 dataset. The volcano plot displays the distribution of differentially expressed genes, with PSMB9 located in the upregulated region (Fig1.B). The x-axis represents log2 fold changes, while the y-axis indicates the negative log10 of p-values, emphasizing the statistical significance of the expression changes. PSMB9, along with other proteasome subunits, shows significant upregulation, further reinforcing its potential role in the progression of OA. We further supported the differential expression of PSMB9 by comparing the scatter plots of human synovial tissue datasets GSE1919 and GSE5235 (Fig1.C). The clustering of genes reveals distinct expression patterns, with PSMB9 significantly located in the upregulated quadrant. This indicates a consistent trend across different datasets, highlighting the relevance of PSMB9 in the pathology of osteoarthritis (OA). The Venn diagram illustrates the overlap of differentially expressed genes among three human datasets: GSE215039, GSE1919, and GSE5235 (Fig1.D). PSMB9 was identified as a commonly upregulated gene in human primary chondrocytes, knee cartilage, and synovial tissue, suggesting its potential as a biomarker for OA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Differential expression analysis of PSMB9 in mouse public datasets and comparison with human data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the public dataset of rodents,\u0026nbsp;we selected the chip dataset of DMM model mice for differential expression analysis. The samples from 2 weeks post-DMM modeling were used as the control group to observe the differential expression of proteasome family genes during the DMM modeling process. In the GSE53857 dataset, we analyzed the differential expression between 2 weeks and 4 weeks post-DMM modeling, while in the GSE41342 dataset, we analyzed the differential expression between 2 weeks and 8 weeks, as well as 2 weeks and 16 weeks post-DMM modeling. The results showed that (Fig2.A), only PSMB9 exhibited a significant upregulation in the late-stage group compared to the early-stage group following DMM modeling. Next, we summarized the comparative analysis of the proteasome family differences in both mice and human OA. Since both GSE1919 and GSE5235 are human synovial tissue samples, batch correction is necessary prior to analysis. The box plot indicates that the expression profiles are more consistent after correction (Fig2.B), suggesting an improvement in data consistency. Further principal component analysis (PCA plot, Fig2.C) supports this, showing a clearer clustering of samples post-correction. Subsequently, we used a heatmap to represent the expression levels of proteasome family genes across five datasets from both humans and mice (Fig2.D), highlighting the expression relationship of PSMB9 with other proteasome subunits. The heatmap demonstrates that PSMB9 expression in OA samples is consistently higher than that in healthy controls, and the late-stage group post-DMM modeling also reflects this compared to the early-stage group. These results further illustrate the potential involvement of PSMB9 in the pathophysiology of OA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 The expression level of PSMB9 is significantly elevated in arthritic tissues and cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, we established a mouse OA model using the DMM method and examined the morphological structure of OA rat cartilage through HE staining. The results of HE staining showed that the chondrocytes in the control group were arranged neatly, with a uniform distribution of the matrix and no infiltration of inflammatory cells. In contrast, the OA group exhibited a significant reduction in normal chondrocytes, disordered arrangement of chondrocytes, and a marked increase in inflammatory cells (Fig3.A, B). The results of the Safranin O-fast green staining indicated that, compared to the control group, the OA model group displayed less positive staining in the cartilage layer, with severe cartilage degeneration. The OARSI score of the OA group was significantly higher than that of the control group (Figure 3.A). Immunohistochemical results showed that the levels of PSMB9, IL-6, and MMP13 were significantly elevated in the OA model group, while COL2A1 was significantly decreased. To further investigate, we collected cartilage tissues from 6 OA patients and amputee patients, and performed immunohistochemical staining, revealing significant differences between OA samples and control samples (Fig3.C). Subsequently, we extracted human primary chondrocytes and the mouse primary chondrocyte C28/I2 cell line, induced with IL-1\u0026beta;, to establish an in vitro OA cell model. The results of qPCR and Western blot indicated that PSMB9 was significantly upregulated in the OA model group (Fig3.D, E, F, G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 PSMB9 Promotes Apoptosis, Inflammatory Response, and ECM Degradation in IL-1\u0026beta;-Induced C28/I2 Chondrocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, we infected C28/I2 cells with lentivirus to overexpress PSMB9 and induced them with IL-1\u0026beta; to establish an in vitro model of osteoarthritis (OA) to explore the regulatory role of PSMB9 in OA. Western blot results showed that the expression level\u003c/p\u003e\n\u003cp\u003eof PSMB9 was significantly increased in the oe-PSMB9+IL-1\u0026beta; group compared to the oe-NC+IL-1\u0026beta; group (Fig4.A,B). EDU and CCK8 results indicated that IL-1\u0026beta; reduced the viability of C28/I2 chondrocytes, and overexpression of PSMB9 further decreased the viability of C28/I2 chondrocytes (Fig4.E,F). Flow cytometry demonstrated that IL-1\u0026beta; treatment increased chondrocyte apoptosis, and similarly, overexpression of PSMB9 further increased chondrocyte apoptosis(Fig4.G). Furthermore, Western blot analysis revealed that overexpression of PSMB9 led to increased expression of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and cartilage extracellular matrix synthesis marker (Col2a1). (Fig4.A, B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Knockdown of the PSMB9 Gene Alleviates IL-1\u0026beta;-Induced Chondrocyte Degradation and Inflammatory Response\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubsequently, we silenced the expression of PSMB9 in C28/I2 cells using siRNA and established an in vitro osteoarthritis (OA) model induced by IL-1\u0026beta;. The results of Western blot analysis showed that the expression of PSMB9 was significantly decreased in the si-PSMB9+IL-1\u0026beta; group compared to the si-NC+IL-1\u0026beta; group (Fig5.A,B). The results from EDU and CCK8 assays indicated that IL-1\u0026beta; reduced the viability of C28/I2 chondrocytes, while knockdown of PSMB9 restored the viability of C28/I2 chondrocytes (Fig5.E,F). Flow cytometry demonstrated that IL-1\u0026beta; treatment increased chondrocyte apoptosis, which was similarly reduced following PSMB9 knockdown(Fig5.G). Furthermore, Western blot analysis revealed that silencing PSMB9 affected the expression of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and markers of chondrocyte extracellular matrix synthesis (Col2a1).\u003c/p\u003e\n\u003cp\u003e(Fig5.A, B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 Activation of the NF-\u0026kappa;B Signaling Pathway in Chondrocytes Stimulated by IL-1\u0026beta; via PSMB9\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRecent studies have shown that PSMB9 influences the inflammatory process by regulating the NF-\u0026kappa;B signaling pathway; however, there has been no related research in the field of osteoarthritis (OA). Western blot analysis was employed to assess the levels of I\u0026kappa;B\u0026alpha;, p-I\u0026kappa;B\u0026alpha;, P65, and p-P65. The results indicated that, compared to the control group, IL-1\u0026beta; induction resulted in a significant decrease in I\u0026kappa;B\u0026alpha; and a significant increase in p-I\u0026kappa;B\u0026alpha;, while P65 showed no significant difference, and p-P65 was significantly increased. In the oe-PSMB9 + IL-1\u0026beta; group, I\u0026kappa;B\u0026alpha; and p-I\u0026kappa;B\u0026alpha; further significantly decreased, P65 showed no significant difference, and p-P65 significantly increased (Fig 4.C,D). Conversely, after knocking down PSMB9, the levels of I\u0026kappa;B\u0026alpha; and p-I\u0026kappa;B\u0026alpha; were restored, P65 showed no significant difference, while p-P65 significantly decreased (Fig 5.C,D). To further investigate the relationship between PSMB9 and the NF-\u0026kappa;B signaling pathway, we utilized the NF-\u0026kappa;B signaling pathway inhibitor (JSH-23) to inhibit this pathway. CCK-8 results indicated that, compared to the oe-PSMB9+IL-1\u0026beta; group, the cell viability in the oe-PSMB9+IL-1\u0026beta;+JSH-23 group was enhanced (Fig 6.D). Flow cytometry results showed that, compared to the oe-PSMB9+IL-1\u0026beta; group, apoptosis in the oe-PSMB9+IL-1\u0026beta;+JSH-23 group was significantly reduced (Fig 6.A).\u0026nbsp;Additionally, Western blot analysis was conducted to assess the expression levels of inflammatory factors (IL-6), extracellular matrix degradation-related proteins (MMP13), and markers of extracellular matrix synthesis in chondrocytes (Col2a1) after inhibition of the NF-\u0026kappa;B signaling pathway. Compared to the oe-PSMB9+IL-1\u0026beta; group, the oe-PSMB9+IL-1\u0026beta;+JSH-23 group exhibited a significant reduction in inflammatory factors (IL-6) and extracellular matrix degradation-related proteins (MMP13), while markers of extracellular matrix synthesis (Col2a1) were significantly increased (Fig 6.B,C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7 Silencing IL-6 can reduce the expression of PSMB9 in chondrocytes stimulated by IL-1\u0026beta;.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubsequently, we attempted to silence IL-6 in C28/I2 cells using si-RNA, followed by induction of C28/I2 cells with IL-1\u0026beta; to establish an in vitro model of osteoarthritis (OA). Western blot analysis was conducted to detect the expression of PSMB9. The results showed that, compared to the IL-1\u0026beta; induction group, the si-IL-6 + IL-1\u0026beta; group exhibited a significant reduction in PSMB9 expression (Fig6.E,F).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOsteoarthritis (OA) is a common factor associated with total body disability, often linked to osteophyte formation, degeneration of articular cartilage, degradation of ligaments and knee joints, as well as synovial inflammation[27]. Its onset is influenced by various factors, and the underlying mechanisms remain unclear. The immunoproteasome comprises three specific catalytic subunits: LMP 2, MECL-1, and LMP 7. LMP 2 (PSMB9) is generally considered a crucial component for proteasome activity, as it is essential for the proper assembly of the immunoproteasome[28]. Recent studies have indicated that although the immunoproteasome is primarily found in immune cells, it also exists in non-immune responses and may possess non-immune functions[29]. However, its role in the cartilage of arthritis has not been reported.\u003c/p\u003e\n\u003cp\u003eThis study systematically investigates the critical role of PSMB9 in the pathogenesis of osteoarthritis (OA) through the integration of clinical samples, animal models, and various cell line models. We found that PSMB9 is significantly activated in OA and forms a positive feedback loop by activating the NF-\u0026kappa;B signaling pathway and upregulating the expression of IL-6. This loop exacerbates the degradation of cartilage extracellular matrix, inhibits the proliferation of chondrocytes, and promotes their apoptosis, ultimately driving the pathological process of OA.\u003c/p\u003e\n\u003cp\u003eFirstly, we observed a significant upregulation of PSMB9 protein expression in both the cartilage tissues of human osteoarthritis (OA) patients and in the mouse DMM surgery-induced OA model. Subsequently, we successfully simulated the inflammatory environment of OA in vitro by stimulating human primary chondrocytes, mouse primary chondrocytes, and the C28/I2 chondrocyte cell line with IL-1\u0026beta;. This further confirmed that the expression of PSMB9 was induced at both transcriptional and translational levels. Collectively, these findings indicate that the upregulation of PSMB9 is a common response to OA-related inflammatory stimuli, such as IL-1\u0026beta;, suggesting that PSMB9 may serve as a potential disease biomarker and therapeutic target.\u003c/p\u003e\n\u003cp\u003eTo further investigate the role of PSMB9 in osteoarthritis (OA), we established both overexpression and knockdown cell lines using C28/I2 cells. Results indicate that the overexpression of PSMB9 significantly exacerbates IL-1\u0026beta;-induced chondrocyte damage. This is manifested by an increase in apoptosis, a decrease in proliferative capacity, a sharp rise in the expression of catabolic markers (MMP13) and inflammatory factors (IL-6), while the expression of key anabolic components (COL2A1) is suppressed. It is well known that inflammatory cytokine compounds play a crucial role in the pathogenesis of osteoarthritis (OA). Chondrocyte apoptosis, joint inflammation, and degradation of the cartilage extracellular matrix (ECM) are all regulated by inflammatory factors such as IL-1\u0026beta;[30, 31]. IL-6 is a major cytokine involved in the changes of the subchondral bone layer, detectable in synovial fluid and expressed in osteoarthritic cartilage, making its inhibition an attractive prospective target for OA treatment[32]. Additionally, both inflammatory cytokines and MMPs induce chondrocyte apoptosis[33, 34]. Furthermore, IL-1\u0026beta; can induce the production of IL-6, which can further enhance the inflammation and cartilage destruction triggered by IL-1\u0026beta;[35]. Matrix metalloproteinase-13 (MMP-13) plays a central role in the pathological process of osteoarthritis (OA). As a major collagenase, MMP-13 can specifically cleave type II collagen, the primary component of the cartilage matrix, leading to irreversible cartilage destruction[36, 37]. In OA patients, MMP-13 is expressed by chondrocytes and synovial cells, and is activated in an inflammatory hypoxic microenvironment[37, 38].\u003c/p\u003e\n\u003cp\u003eNotably, we observed that the overexpression of PSMB9 led to the activation of the NF-\u0026kappa;B signaling pathway, characterized by a significant reduction in both total and phosphorylated I\u0026kappa;B\u0026alpha; protein levels, along with an increase in the phosphorylation level of the p65 subunit. This result exhibited an opposite trend following the silencing of PSMB9. The activation of NF-\u0026kappa;B involves multiple signaling pathways, including the classical IKK/I\u0026kappa;B/NF-\u0026kappa;B pathway and the non-classical pathway. In the classical pathway, inflammatory factors activate the IKK complex, resulting in the phosphorylation and degradation of I\u0026kappa;B\u0026alpha;, which releases NF-\u0026kappa;B dimers (such as p65/p50) and promotes their entry into the nucleus[20, 39]. In osteoarthritis (OA), the activation of NF-\u0026kappa;B is typically triggered by inflammatory factors (such as IL-1\u0026beta; and TNF-\u0026alpha;) or mechanical stress [40, 41]. Once activated, NF-\u0026kappa;B translocate to the nucleus and binds to the promoter regions of target genes, upregulating the expression of pro-inflammatory and catabolic factors such as MMP13, IL-6, IL-8, and TNF-\u0026alpha;[42, 43]. These factors further lead to the degradation of the extracellular matrix (ECM) in chondrocytes and amplify the inflammatory response [44, 45].\u0026nbsp;To validate this hypothesis, we utilized JSH-23 to inhibit the NF\u0026kappa;B signaling pathway. The results indicated that JSH-23 treatment effectively reversed the OA phenotype induced by IL-1\u0026beta;, significantly reducing the expression of MMP13 and IL-6, restoring the levels of COL2A1, and improving cell survival and proliferation status. This not only demonstrates the central role of the NF-\u0026kappa;B pathway in this model but, more importantly, suggests that PSMB9 is located upstream of the NF-\u0026kappa;B pathway or within its activation process, exerting its destructive effects through the regulation of this pathway. This aligns with previous findings that the upregulation of FAT10 is closely associated with renal tubular interstitial inflammation in chronic kidney disease, and the restoration of PSMB9 expression can reactivate the NF-\u0026kappa;B pathway, promoting the production of inflammatory factors[46]. Furthermore, in a myocarditis model induced by viral infection, the absence of the immunoproteasome (including PSMB9) led to impaired NF\u0026kappa;B activation, further exacerbating the inflammatory response and tissue damage. This indicates that PSMB9 plays a protective role in suppressing excessive inflammatory responses [47]. Similarly, the immunoproteasome (PSMB9) can activate the NF\u0026kappa;B pathway by degrading I\u0026kappa;B, increasing the infarction volume and worsening the inflammatory response in a rat model of ischemic stroke[29].\u003c/p\u003e\n\u003cp\u003eInterestingly, when we knocked down IL-6 using siRNA, the expression of PSMB9 also decreased. This reveals a previously unreported positive feedback loop: PSMB9 upregulates the expression of IL-6 by activating NF-\u0026kappa;B, while high levels of IL-6 further promote the expression of PSMB9. This self-amplifying cycle greatly exacerbates and maintains the chronic inflammatory state and cartilage degradation process in OA joints, providing a new molecular mechanism model to explain why OA progressively worsens.\u003c/p\u003e\n\u003cp\u003eIn summary, this study reveals for the first time the pathogenic role of PSMB9 in osteoarthritis (OA) and its potential working mechanism. Under the inflammatory environment of OA, such as IL-1\u0026beta; stimulation, PSMB9 expression is upregulated, which in turn activates the NF-\u0026kappa;B signaling pathway. The activated NF-\u0026kappa;B promotes the secretion of inflammatory cytokines such as IL-6, which can feedback to enhance PSMB9 expression, thereby forming a positive feedback loop of PSMB9/NF-\u0026kappa;B/IL-6(Fig7). The continuous operation of this axis ultimately leads to chondrocyte dysfunction, extracellular matrix metabolic imbalance, and irreversible damage to cartilage structure. Therefore, targeting PSMB9 or breaking this positive feedback loop may provide a promising direction for developing novel strategies to delay or treat OA. Future research will focus on using PSMB9-specific inhibitors or conditionally knocking out the Psmb9 gene in animal models to further validate its therapeutic potential.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to express our gratitude to all the participants for their support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. All authors had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis. L.H.Z, J.L.O, and J.C. designed the study, carried out data analyses, interpreted the results, and drafted the manuscript. Z.W.W, S.J.B, X.W, S.S, X.L, K.D.B, were involved in collecting the data, helping with data analyses, interpreting the results, and revising the manuscript. All the authors took part in the experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the general project of Anhui Province Outstanding Young Talents Support Program for Universities (Grant No. gxyq2022009); the Anhui Institute of translational medicine (Grant No. 2022zhyx-C90); the Foundation of Anhui Medical University (Grant No. 2020xkj209) and the Open Project of Anhui Province Key Laboratory of Occupational Health (Grant No. 2024ZYJKB003).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University, and written consent was obtained from all individuals participating in the study. The Declaration of Helsinki was followed for all experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSanchez-Lopez, E., et al., Synovial inflammation in osteoarthritis progression. Nat Rev Rheumatol, 2022. 18(5): p. 258-275.\u003c/li\u003e\n\u003cli\u003eJiang, W., et al., Mechanical stress abnormalities promote chondrocyte senescence - The pathogenesis of knee osteoarthritis. Biomed Pharmacother, 2023. 167: p. 115552.\u003c/li\u003e\n\u003cli\u003eWakale, S., et al., How are Aging and Osteoarthritis Related? Aging Dis, 2023. 14(3): p. 592-604.\u003c/li\u003e\n\u003cli\u003eHenriques, J., F. Berenbaum and A. Mobasheri, Obesity-induced fibrosis in osteoarthritis: Pathogenesis, consequences and novel therapeutic opportunities. Osteoarthr Cartil Open, 2024. 6(4): p. 100511.\u003c/li\u003e\n\u003cli\u003eFloramo, J.S., et al., An Integrated View of Stressors as Causative Agents in OA Pathogenesis. Biomolecules, 2023. 13(5): p. 721.\u003c/li\u003e\n\u003cli\u003eChang, Y., et al., TrkC protects against osteoarthritis progression by maintaining articular cartilage homeostasis. Int J Biol Sci, 2025. 21(8): p. 3597-3613.\u003c/li\u003e\n\u003cli\u003eBard, J.A.M., et al., Structure and Function of the 26S Proteasome. Annu Rev Biochem, 2018. 87: p. 697-724.\u003c/li\u003e\n\u003cli\u003eCollins, G.A. and A.L. Goldberg, The Logic of the 26S Proteasome. Cell, 2017. 169(5): p. 792-806.\u003c/li\u003e\n\u003cli\u003eHuber, E.M., et al., Immuno- and constitutive proteasome crystal structures reveal differences in substrate and inhibitor specificity. Cell, 2012. 148(4): p. 727-38.\u003c/li\u003e\n\u003cli\u003eGroettrup, M., et al., Interferon-gamma inducible exchanges of 20S proteasome active site subunits: why? Biochimie, 2001. 83(3-4): p. 367-72.\u003c/li\u003e\n\u003cli\u003eGroettrup, M., et al., Structural plasticity of the proteasome and its function in antigen processing. Crit Rev Immunol, 2001. 21(4): p. 339-58.\u003c/li\u003e\n\u003cli\u003eEttari, R., et al., Immunoproteasome-Selective Inhibitors: A Promising Strategy to Treat Hematologic Malignancies, Autoimmune and Inflammatory Diseases. Curr Med Chem, 2016. 23(12): p. 1217-38.\u003c/li\u003e\n\u003cli\u003eKast, J., Immunoproteasome deficiency in non-small cell lung cancer and its relevance to immunotherapy. J Thorac Dis, 2016. 8(9): p. E1082-E1086.\u003c/li\u003e\n\u003cli\u003eKaur, G. and S. Batra, Emerging role of immunoproteasomes in pathophysiology. Immunol Cell Biol, 2016. 94(9): p. 812-820.\u003c/li\u003e\n\u003cli\u003eMishto, M., et al., The immunoproteasome beta5i subunit is a key contributor to ictogenesis in a rat model of chronic epilepsy. Brain Behav Immun, 2015. 49: p. 188-96.\u003c/li\u003e\n\u003cli\u003eLi, Z., et al., Identification of PSMB9 and CXCL13 as Immune-related Diagnostic Markers for Rheumatoid Arthritis by Machine Learning. Curr Pharm Des, 2022. 28(34): p. 2842-2854.\u003c/li\u003e\n\u003cli\u003eYeo, I.J., et al., A dual inhibitor of the proteasome catalytic subunits LMP2 and Y attenuates disease progression in mouse models of Alzheimer\u0026apos;s disease. Sci Rep, 2019. 9(1): p. 18393.\u003c/li\u003e\n\u003cli\u003eGeoffroy, K., et al., Increased expression of the immunoproteasome subunits PSMB8 and PSMB9 by cancer cells correlate with better outcomes for triple-negative breast cancers. Sci Rep, 2023. 13(1): p. 2129.\u003c/li\u003e\n\u003cli\u003eHou, Z., M. Wang and S. Cao, Inhibition of Toll-Like Receptor 3 Relieves Osteoarthritis by Suppression of Cartilage Degradation, Nuclear Factor Kappa B-Mediated Inflammation, and Activation of Autophagy. Cartilage, 2025. 251(3): p. 17713.\u003c/li\u003e\n\u003cli\u003eLu, J., et al., Chrysophanol prevents IL-1beta-Induced inflammation and ECM degradation in osteoarthritis via the Sirt6/NF-kappaB and Nrf2/NF-kappaB axis. Biochem Pharmacol, 2023. 208: p. 115402.\u003c/li\u003e\n\u003cli\u003eJia, Y., et al., Morusin Ameliorates IL-1beta-Induced Chondrocyte Inflammation and Osteoarthritis via NF-kappaB Signal Pathway. Drug Des Devel Ther, 2020. 14: p. 1227-1240.\u003c/li\u003e\n\u003cli\u003eLee, S., M.K. Shin and J. Sung, Tamarixetin Protects Chondrocytes against IL-1\u0026beta;-Induced Osteoarthritis Phenotype by Inhibiting NF-\u0026kappa;B and Activating Nrf2 Signaling. Antioxidants, 2024. 13(10): p. 1166.\u003c/li\u003e\n\u003cli\u003eMaldonado, M., et al., Immunoproteasome deficiency modifies the alternative pathway of NFkappaB signaling. PLoS One, 2013. 8(2): p. e56187.\u003c/li\u003e\n\u003cli\u003eCheng, A.W.M., et al., Selenomethionine inhibits IL-1beta inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX2) expression in primary human chondrocytes. Osteoarthritis Cartilage, 2011. 19(1): p. 118-25.\u003c/li\u003e\n\u003cli\u003eZhang, L., et al., Knockdown of hsa_circ_0134111 alleviates the symptom of osteoarthritis via sponging microRNA-224-5p. Cell Cycle, 2021. 20(11): p. 1052-1066.\u003c/li\u003e\n\u003cli\u003eMa, C., et al., The pro-inflammatory effect of NR4A3 in osteoarthritis. J Cell Mol Med, 2020. 24(1): p. 930-940.\u003c/li\u003e\n\u003cli\u003eYunus, M.H.M., A. Nordin and H. Kamal, Pathophysiological Perspective of Osteoarthritis. Medicina (Kaunas), 2020. 56(11): p. 614.\u003c/li\u003e\n\u003cli\u003eGroettrup, M., et al., The subunits MECL-1 and LMP2 are mutually required for incorporation into the 20S proteasome. Proc Natl Acad Sci U S A, 1997. 94(17): p. 8970-5.\u003c/li\u003e\n\u003cli\u003eChen, X., et al., Inhibition of immunoproteasome reduces infarction volume and attenuates inflammatory reaction in a rat model of ischemic stroke. Cell Death Dis, 2015. 6(1): p. e1626.\u003c/li\u003e\n\u003cli\u003eHe, J. and J. He, Baicalin mitigated IL-1beta-Induced osteoarthritis chondrocytes damage through activating mitophagy. Chem Biol Drug Des, 2023. 101(6): p. 1322-1334.\u003c/li\u003e\n\u003cli\u003eLu, G., et al., LINC00623/miR-101/HRAS axis modulates IL-1beta-mediated ECM degradation, apoptosis and senescence of osteoarthritis chondrocytes. Aging (Albany NY), 2020. 12(4): p. 3218-3237.\u003c/li\u003e\n\u003cli\u003eChenoufi, H.L., et al., Increased mRNA expression and protein secretion of interleukin-6 in primary human osteoblasts differentiated in vitro from rheumatoid and osteoarthritic bone. J Cell Biochem, 2001. 81(4): p. 666-78.\u003c/li\u003e\n\u003cli\u003eWang, B., et al., Aucubin Protects Chondrocytes Against IL-1beta-Induced Apoptosis In Vitro And Inhibits Osteoarthritis In Mice Model. Drug Des Devel Ther, 2019. 13: p. 3529-3538.\u003c/li\u003e\n\u003cli\u003eKovacs, B., E. Vajda and E.E. Nagy, Regulatory Effects and Interactions of the Wnt and OPG-RANKL-RANK Signaling at the Bone-Cartilage Interface in Osteoarthritis. Int J Mol Sci, 2019. 20(18): p. 4653.\u003c/li\u003e\n\u003cli\u003eXiao, S., et al., The role of apoptosis in the pathogenesis of osteoarthritis. Int Orthop, 2023. 47(8): p. 1895-1919.\u003c/li\u003e\n\u003cli\u003eBendele, A.M., et al., Development of a selective matrix metalloproteinase 13 (MMP-13) inhibitor for the treatment of Osteoarthritis. Eur J Med Chem, 2021. 224: p. 113666.\u003c/li\u003e\n\u003cli\u003eWilkinson, D.J., et al., Matrix metalloproteinase-13 is fully activated by neutrophil elastase and inactivates its serpin inhibitor, alpha-1 antitrypsin: Implications for osteoarthritis. FEBS J, 2022. 289(1): p. 121-139.\u003c/li\u003e\n\u003cli\u003eZhou, T., et al., Hypoxia and Matrix Metalloproteinase 13-Responsive Hydrogel Microspheres Alleviate Osteoarthritis Progression In Vivo. Small, 2024. 20(19): p. e2308599.\u003c/li\u003e\n\u003cli\u003eInternational, B.R., RETRACTION: \u0026quot;Platelet-Rich Plasma Combined with Alendronate Reduces Pain and Inflammation in Induced Osteoarthritis in Rats by Inhibiting the Nuclear Factor-Kappa B Signaling Pathway\u0026quot;. Biomed Res Int, 2025. 2025: p. 9840675.\u003c/li\u003e\n\u003cli\u003eChen, X., et al., Sirtuin 2 regulates NOD-like receptor protein 3/nuclear factor kappa B axis to promote cartilage repair in osteoarthritis. J Cell Commun Signal, 2025. 19(3): p. e70031.\u003c/li\u003e\n\u003cli\u003eXia, W., et al., Orientin inhibits inflammation in chondrocytes and attenuates osteoarthritis through Nrf2/NF-kappaB and SIRT6/NF-kappaB pathway. J Orthop Res, 2023. 41(11): p. 2405-2417.\u003c/li\u003e\n\u003cli\u003eZeng, Z., et al., Pelargonidin ameliorates inflammatory response and cartilage degeneration in osteoarthritis via suppressing the NF-kappaB pathway. Arch Biochem Biophys, 2023. 743: p. 109668.\u003c/li\u003e\n\u003cli\u003eFukuda, Y., et al., Receptor activator of nuclear factor-kappa B ligand-derived microglia healing peptide 1-AcN inhibits osteoarthritis progression in mice. Arthritis Res Ther, 2025. 27(1): p. 142.\u003c/li\u003e\n\u003cli\u003eLiao, Y., et al., NOX2-Deficient Neutrophils Facilitate Joint Inflammation Through Higher Pro-Inflammatory and Weakened Immune Checkpoint Activities. Front Immunol, 2021. 12: p. 743030.\u003c/li\u003e\n\u003cli\u003eSun, W., et al., Wedelolactone alleviates inflammation and cartilage degeneration by suppressing the NF-kappaB signaling pathway in osteoarthritis. Int Immunopharmacol, 2024. 143(Pt 1): p. 113359.\u003c/li\u003e\n\u003cli\u003eGong, P., et al., The ubiquitin-like protein FAT10 mediates NF-kappaB activation. J Am Soc Nephrol, 2010. 21(2): p. 316-26.\u003c/li\u003e\n\u003cli\u003eOpitz, E., et al., Impairment of immunoproteasome function by beta5i/LMP7 subunit deficiency results in severe enterovirus myocarditis. PLoS Pathog, 2011. 7(9): p. e1002233.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"osteoarthritis, PSMB9, NF-κB signaling pathway, chondrocytes","lastPublishedDoi":"10.21203/rs.3.rs-8216872/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8216872/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Osteoarthritis (OA) is a degenerative joint disease characterized by cartilage degradation and synovial inflammation, with its pathogenesis being incompletely understood. This study aimed to investigate the role and mechanism of PSMB9 in interleukin-1β (IL-1β)-induced chondrocyte injury.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e We identified OA-associated proteasome members by analyzing public datasets (including GSE215039). PSMB9 expression was assessed in clinical OA samples and OA model mouse tissues via immunohistochemistry. The functional roles of PSMB9 and its regulation of the NF-κB pathway in IL-1β-induced human C28/I2 chondrocytes were examined using Western blot, CCK-8, EdU, and flow cytometry assays. The effect of IL-6 knockdown on PSMB9 expression was also evaluated by Western blot.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e (1) PSMB9 was a common differentially expressed gene in multiple human and mouse OA datasets. (2) Its expression was significantly upregulated in human OA cartilage, mouse OA models, and IL-1β-stimulated primary and C28/I2 chondrocytes. (3) Overexpression of PSMB9 promoted apoptosis, inhibited proliferation, increased levels of the pro-inflammatory cytokine IL-6 and the matrix-degrading enzyme MMP13, enhanced extracellular matrix (ECM) degradation, and reduced collagen type II alpha 1 (COL2A1) expression. (4) PSMB9 activated the NF-κB pathway by promoting IκBα degradation, and inhibition of NF-κB signaling alleviated the chondrocyte injury. (5) Silencing IL-6 reduced PSMB9 expression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e PSMB9 exacerbates OA chondrocyte injury by activating the NF-κB pathway, suggesting its potential as a therapeutic target for OA.\u003c/p\u003e","manuscriptTitle":"PSMB9 Exacerbates Chondrocyte Injury in Osteoarthritis via Activation of the NF-κB Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-10 16:35:45","doi":"10.21203/rs.3.rs-8216872/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-08T09:13:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-06T14:21:14+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-06T11:01:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-13T10:37:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"124999779981113808287820625866903749640","date":"2025-12-11T08:10:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"151786534005568733182566039239565779828","date":"2025-12-10T13:55:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"294351085100077625257126344887267799008","date":"2025-12-10T13:17:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"247986604683557704324181869734148779462","date":"2025-12-08T14:51:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-08T09:41:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-04T11:13:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-04T10:38:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Orthopaedic Surgery and Research","date":"2025-12-01T13:00:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"911259bc-56a2-4eec-89a1-bf0f7544df3a","owner":[],"postedDate":"December 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:01:38+00:00","versionOfRecord":{"articleIdentity":"rs-8216872","link":"https://doi.org/10.1186/s13018-026-06796-2","journal":{"identity":"journal-of-orthopaedic-surgery-and-research","isVorOnly":false,"title":"Journal of Orthopaedic Surgery and Research"},"publishedOn":"2026-03-14 15:57:52","publishedOnDateReadable":"March 14th, 2026"},"versionCreatedAt":"2025-12-10 16:35:45","video":"","vorDoi":"10.1186/s13018-026-06796-2","vorDoiUrl":"https://doi.org/10.1186/s13018-026-06796-2","workflowStages":[]},"version":"v1","identity":"rs-8216872","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8216872","identity":"rs-8216872","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.