Maternal stress shapes offspring innate immunity via milk leptin

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Early-life stress (ELS) leaves a persistent inflammatory imprint, but how parental physiology shapes offspring immune development remains unclear. Using the limited bedding and nesting (LBN) mouse model of ELS, we show that maternal stress alters offspring immune homeostasis through changes in maternal milk composition, rather than reduced maternal care. Maternal stress decreases leptin levels in milk and pup circulation, blunting the neonatal leptin surge and leading to persistent neutrophilia and altered neutrophil function. Glucocorticoid administration to dams lowers pup plasma leptin and recapitulates the endocrine and immunological phenotype of LBN, without reproducing the associated maternal changes in behavior. Conversely, leptin administration to pups restores immune homeostasis, while biparental care normalizes maternal stress physiology, restores leptin levels and prevents offspring neutrophilia. These findings identify maternal milk leptin as a key mediator linking maternal stress to innate immune programming and provide a mechanism by which ELS shapes long-term inflammatory tone. *Ella L. Sommer & Niilo V. Valtakari contributed equally.
Full text 137,104 characters · extracted from preprint-html · click to expand
Maternal stress shapes offspring innate immunity via milk leptin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Maternal stress shapes offspring innate immunity via milk leptin Ella L. Sommer*, Niilo V. Valtakari*, Maes J. Holleman, Carmen S.D. Peters, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9587229/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Early-life stress (ELS) leaves a persistent inflammatory imprint, but how parental physiology shapes offspring immune development remains unclear. Using the limited bedding and nesting (LBN) mouse model of ELS, we show that maternal stress alters offspring immune homeostasis through changes in maternal milk composition, rather than reduced maternal care. Maternal stress decreases leptin levels in milk and pup circulation, blunting the neonatal leptin surge and leading to persistent neutrophilia and altered neutrophil function. Glucocorticoid administration to dams lowers pup plasma leptin and recapitulates the endocrine and immunological phenotype of LBN, without reproducing the associated maternal changes in behavior. Conversely, leptin administration to pups restores immune homeostasis, while biparental care normalizes maternal stress physiology, restores leptin levels and prevents offspring neutrophilia. These findings identify maternal milk leptin as a key mediator linking maternal stress to innate immune programming and provide a mechanism by which ELS shapes long-term inflammatory tone. *Ella L. Sommer & Niilo V. Valtakari contributed equally. Biological sciences/Immunology/Innate immunity Biological sciences/Developmental biology/Experimental organisms/Model vertebrates/Mouse Biological sciences/Physiology Early-life stress maternal milk leptin neutrophils paternal care Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION The early postnatal environment exerts a major influence on infant wellbeing by shaping the development of endocrine and immune systems. 1 Maternal care during this period is critical, providing sensory cues that support attachment as well as nutritional and hormonal signals that coordinate postnatal growth and neuroendocrine maturation. 2 Disruptions to the early-life environment, including adverse childhood events, are associated with altered immune function, such as increased circulating pro-inflammatory cytokines in adulthood. 3 These long-term alterations in immune and endocrine function are considered a hallmark of early-life stress (ELS) exposure. Persistent low-grade inflammation represents a key intermediate phenotype linking early-life adversity to increased risk for a range of chronic health conditions later in life. 4 , 5 The limited bedding and nesting (LBN) paradigm is a well-established model of ELS in rodents and is typically induced from postnatal day (P) 2-9. 6 The impoverished LBN conditions are stressful to the mouse mother and alter the maternal behavioral patterns, including increased nest exits. 7 Maternal care during LBN is often described as fragmented and unpredictable, a feature widely considered central to its effects on offspring development. 8 However, how maternal stress is transmitted to the offspring and impacts their metabolic and immune programming is incompletely understood. Although fragmented maternal care is often invoked as the explanatory mechanism in LBN studies, it is intrinsic to the model, complicating causal interpretation and highlighting the need to examine additional processes that may shape offspring development. In addition to altered maternal behavior, maternal stress may modify physiological outputs, including endocrine signals transferred via milk that may independently influence offspring programming. In humans, early postnatal maternal stress has been linked with alterations in human milk quality. 9 Maternal milk contains the key metabolic hormone leptin, which influences postnatal growth, hypothalamic development, and immune maturation. A transient postnatal leptin surge in the offspring is critical for the induction of these processes. 10 , 11 Because leptin in maternal milk contributes to blood leptin levels 12 , and LBN exposure reduces leptin 13 , we investigated how LBN affects milk leptin transfer and the immunological consequences for the offspring. Here, we combine continuous behavioral tracking with endocrine and immunological profiling to dissect how maternal stress under LBN conditions influences offspring development. We find that, despite intensified caregiving behavior, stressed mothers produce milk with reduced leptin levels, leading to a blunted leptin surge, persistent neutrophilia and long-term low-grade inflammation in the offspring. Leptin supplementation or biparental care rescue these effects, revealing a causal pathway linking maternal stress physiology to endocrine-immune programming. RESULTS Continuous behavioral tracking reveals intensified maternal care under LBN conditions Previous studies have suggested that fragmented maternal care under LBN conditions induces early-life stress (ELS) in offspring. However, these findings were limited by short observation windows and a lack of circadian analysis. To address this, we continuously tracked maternal behavior from P2–9 across both light and dark phases (Fig. 1 A). LBN mothers exited the nest more frequently than non-stressed control (CTRL) mothers (Fig. 1 B), but the duration of individual nest absences was markedly shorter (Fig. 1 C), as well as the average dam-nest distance (Figure S1 ). Consequently, despite more frequent nest exits, LBN mothers spent a greater total amount of time on the nest (Fig. 1 D). These findings suggest that LBN mothers increase the intensity rather than the continuity of maternal care, indicating a compensatory response to suboptimal environmental conditions. Consistent with elevated maternal strain, LBN mothers displayed overt stress phenotypes such as piloerection (Fig. 1 E) and elevated plasma corticosterone (CORT) levels (Fig. 1 F). LBN exposed pups receive milk with reduced leptin content and exhibit a blunted leptin surge Despite compensatory maternal care, LBN-exposed litters exhibited reduced P2-9 bodyweight gain (Fig. 2 A). Particularly affected at P9 was the white adipose tissue (WAT) mass, which showed a reduction, even after normalization to bodyweight (Fig. 2 B). Consistent with reduced WAT, plasma leptin levels at P9 were considerably lower for LBN exposed pups as compared to CTRL (Fig. 2 C) and relative WAT mass correlated to plasma leptin concentrations (Fig. 2 D). The developmental impact of LBN may reflect altered maternal milk production or composition. Because direct measurement of milk production is confounded by oxytocin-stimulation, we assessed maternal prolactin levels as a proxy. We also measured blood glucose and hepatic triglyceride concentrations at P9 to assess whether pups were in a catabolic state, owing to potential malnutrition. No differences were observed between LBN and CTRL (Figure S2A–C), suggesting that milk production is not substantially altered. In contrast, leptin levels in maternal milk, collected from pup stomachs, were reduced following LBN exposure (Fig. 2 E), whereas corticosterone levels were unchanged (Figure S3). In line with our previous work 14 , showing unaffected plasma corticosterone levels in P9 LBN pups, these findings argue against corticosterone transfer via milk and instead identify reduced milk leptin as a candidate mediator of LBN effects on the offspring. LBN induces persistent neutrophilia in pups Next, we examined the impact of LBN on the innate immune system in the context of reduced neonatal leptin levels. We found that LBN exposure elevated P9 plasma levels of myeloperoxidase (MPO) (Fig. 3 A), suggesting the involvement of neutrophils and/or monocytes. We then investigated leukocyte populations in peripheral blood after LBN exposure. While total leukocyte counts were unchanged by LBN at P9 in the blood of pups (Fig. 3 B), neutrophil numbers were significantly elevated at P9, P16 and P100 (Fig. 3 C), indicating persistent neutrophilia. Of note, other leukocyte populations—monocytes, lymphocytes and eosinophils—were not upregulated following LBN (Figure S4). Bone marrow analysis at P9 of LBN-exposed pups revealed a reduced Ly6G⁺ area (Fig. 3 D,E) and lower neutrophil counts (Fig. 3 F,G), both consistent with enhanced neutrophil mobilization from the bone marrow into circulation. We then assessed the neutrophil maturation profile, based on the number of nuclear indentations. At P9, we found no differences between LBN and CTRL (Figure S5). However, in adulthood (P100) LBN induced a left-shift, meaning that neutrophils exhibited fewer indentations and that the LBN neutrophilic population displayed a less mature phenotype (Fig. 3 H). We then compared neutrophil function between LBN and CTRL mice in adulthood. Neutrophils were isolated from whole blood using MACS, yielding purified neutrophil populations (99.1%, Figure S6), after which we measured oxidative burst. Under baseline conditions, neutrophils from LBN mice exhibited higher H 2 O 2 production compared to CTRL mice (Fig. 3 I,J). In contrast, PMA stimulation elicited comparable H 2 O 2 production in both groups (Figure S7), indicating intact maximal oxidative capacity in LBN neutrophils. To determine whether LBN-induced neutrophilia has sustained systemic effects, we examined markers of neutrophil activity and inflammation. At P100, plasma levels of neutrophil elastase (MMP8) were elevated in LBN mice (Fig. 3 K), consistent with sustained alterations in granulopoiesis and neutrophil homeostasis. Additionally, LBN-exposed pups displayed elevated plasma levels of the pan inflammatory cytokine CRP in adulthood (Fig. 3 L), indicative of low-grade systemic inflammation. Maternal glucocorticoid signaling suppresses offspring leptin and programs neutrophilia Maternal glucocorticoid signaling suppresses offspring leptin and programs neutrophilia To validate that the physiological stress response of the LBN-exposed mouse mothers drives the lowered leptin levels in the pups, we added CORT to the drinking water (100 µg/mL) of otherwise unstressed mouse mothers from P2-9, mimicking LBN stress exposure (Fig. 4 A). As expected, CORT treatment via the drinking water elevated maternal CORT in the peripheral blood (Fig. 4 B), and CORT-treated dams tended to drink slightly less (-6.4%, Figure S8A). Behavioral patterns, including number of nest exits, duration of nest exits, time spent on the nest, and average dam-nest distance did not differ (Fig. 4 C,D and Figure S8B,C). Although maternal CORT treatment did not impact maternal behavior, key hallmarks of the LBN pup phenotype at P9 were recapitulated, including a reduced bodyweight (Fig. 4 E), lowered leptin levels in pup plasma (Fig. 4 F), and neutrophilia (Fig. 4 G). These findings indicate that maternal glucocorticoid signaling is sufficient to recapitulate key features of the LBN-induced offspring phenotype. Reduced leptin signaling drives neutrophilia To test the roles of neutrophilia and reduced leptin levels in LBN-induced phenotypes, we performed loss- and gain-of-function experiments. We first treated P2 pups with a neutrophil depleting agent (anti-Ly6G [1A8]), which effectively depleted neutrophils during the LBN period (Fig. 5 A,B). However, at P100, plasma CRP levels for neutrophil-depleted LBN mice were not normalized (Fig. 5 C), indicating that blocking LBN-induced neutrophilia during development does not prevent long-term low-grade inflammation. Given that the postnatal leptin surge is essential for hypothalamic maturation, behavioral programming, and immune development 10 , 15 , 16 , we first confirmed that LBN-induced leptin deficiency recapitulates established phenotypes. LBN-exposed mice exhibited increased hypothalamic NPY transcription at P9 and increased locomotor activity in adulthood (Figure S9A,B). Importantly, both NPY transcription and hyperactivity were prevented by exogenous leptin supplementation during LBN (s.c. 80 ng/g body weight at P2, 4, 6, 8; Figure S9A,B). We next investigated whether exogenous leptin could also block the impact of LBN on bodyweight and innate immunology (Fig. 5 D). Neonatal leptin supplementation did not affect P2-9 bodyweight gain for LBN exposed pups (Fig. 5 E). Consistent with previous work 14 , LBN exposure elevated IL-6 plasma levels (Fig. 5 F), a cytokine known to promote the release of neutrophils from the bone marrow into circulation. Additionally, leptin treatment halted the LBN-associated increase in plasma IL-6 (Fig. 5 F). Other inflammatory mediators with the potential to mobilize neutrophils from the bone marrow, G-CSF, CXCL1 and CXCL12 were not affected (Figure S10). Leptin treatment also prevented blood neutrophilia in P9 pups (Fig. 5 F), with a similar trend observed at P120 (Figure S11). Biparental care buffers maternal stress and normalizes offspring development Next, we tested whether social buffering would mitigate maternal stress and its downstream effects. Mouse fathers were kept and co-housed with mothers and pups throughout the LBN period. Automated tracking revealed that LBN pups were rarely left alone (< 5%) under the biparental condition and for most of the time (~ 60%), both parents were present in the nest (Fig. 6 A,B). Interestingly, for episodes in which a single parent was present at the nest (~ 36%), we found that the father was the attending parent in at least half of the cases, regardless of circadian phase (Fig. 6 C). Of note, fathers actively participated in pup care—including grooming and retrieval—and also engaged in allogrooming of the mother (Supplementary Videos 1–3). Biparental housing normalized CORT levels for LBN housed mouse mothers and increased leptin concentrations in milk and plasma from P9 pups, compared to LBN maternal conditions (Fig. 6 D-F). However, P9 pup bodyweight and WAT mass were not altered by biparental housing (Fig. 6 G,H). In adulthood, biparental housing partially normalized relative neutrophil abundance for LBN exposed offspring (Fig. 6 I). These findings demonstrate that natural social buffering via biparental care can counteract maternal stress and rescue LBN induced endocrine and immune developmental trajectories. DISCUSSION Our findings identify maternal physiology as a key driver of ELS effects on offspring immunity, transmitted via maternal milk. Under LBN conditions, leptin levels are reduced in maternal milk and pup plasma and restoring leptin prevents offspring neutrophilia. Notably, paternal co-housing buffers maternal stress, restores milk leptin, and mitigates neutrophilia in the pups. Continuous tracking of mouse mothers revealed more frequent nest exits under LBN conditions, consistent with previous reports. 7 , 17 , 18 However, LBN nest exits were markedly shorter, resulting in a higher overall nest attendance under LBN conditions. This pattern suggests compensatory, high-effort caregiving, rather than disengagement. Elevated corticosterone levels and piloerection of the dam indicate that LBN care occurs under heightened physiological strain. Reduced P2-9 bodyweight in LBN exposed pups is in line with prior observations. 7 , 18 WAT emerges as a particularly vulnerable tissue with its mass remaining clearly diminished, even when adjusted for bodyweight. Given that neonatal leptin is largely adipocyte-derived, reduced WAT likely underlies the lowered levels of circulating leptin and disrupted leptin surge. Although maternal milk contributes to circulating leptin in the pups, stressed dams produce leptin-deficient milk. Introducing maternal stress via CORT to the drinking water recapitulated the reduced P2-9 bodyweight gain, decreased milk and pup plasma leptin, and offspring neutrophilia. Thus, maternal physiology and milk composition emerge as central mediators of the impact of LBN on the offspring. These data suggest that developmental leptin deficiency contributes to neutrophilia, at least in part, via IL-6 signaling. Consistent with prior work linking leptin deficiency to elevated peripheral levels of IL-6 19 , the reduced circulating leptin in LBN exposed pups is likely connected to their higher IL-6 concentrations. IL-6 promotes neutrophil mobilization from the bone marrow into circulation 20 , as reflected by reduced bone marrow neutrophils in LBN pups and increased circulating neutrophils at P9. Importantly, leptin supplementation normalized IL-6 levels and prevented neutrophilia. Since early neutrophil depletion did not prevent adult low-grade inflammation, leptin deficiency —rather than neutrophilia—likely programs long-term immune alterations. Together, these findings support a model in which maternal stress–induced leptin deficiency elevates IL-6 signaling and promotes neutrophil mobilization, while long-term inflammatory alterations are not driven by neutrophil expansion itself. Social housing can buffer the impact of stress 21 and we observed reduced CORT levels in LBN dams co-housed with the sire. Nest attendance was similar between maternal and paternal mice, with direct paternal care, including pup retrieval and pup grooming, as reported previously. 22 Affiliative behaviors were also evident, including paternal allogrooming and ‘forced baby-sitting’, as described for social voles. 23 Because relative WAT loss is not rescued under biparental LBN conditions, the normalized pup leptin levels are likely due to modulated maternal stress physiology and altered milk composition, and independent of pup WAT mass. Although the specific buffering mechanisms remain unresolved, the restoration of leptin concentrations in maternal milk and pup circulation, along with the attenuated neutrophilia, reinforces the central role of maternal physiology and leptin in shaping offspring immune development. While our data strongly implicate milk-borne leptin as a mediator of maternal stress effects on offspring immunity, we cannot exclude contributions of additional milk-borne or systemic factors regulated by maternal physiology. Moreover, although our findings indicate persistent alterations in innate immune homeostasis, broader immune compartments, including adaptive immune responses, remain to be explored. Future studies will be required to determine how maternal endocrine signals interact with other components of the early-life environment to shape long-term immune trajectories. Our findings have potential relevance for human ELS and immune development. Premature birth and low birth weight are associated with elevated CRP levels in young adulthood, while breastfeeding duration is inversely correlated with CRP levels. 24 Premature infants are exposed to substantial physiological stress early in life, including repeated clinical stressors during neonatal intensive care admission. 25 Notably, milk provided to premature infants is low in leptin. 26 Although a direct link between stress and milk leptin in humans remains to be established, these observations raise the possibility that restoring milk-borne leptin may support immune development in prematurely born infants and promote more balanced immune responses. Together, these findings identify maternal physiological state, rather than caregiving quantity, as a key determinant of offspring immune development. Milk from stressed mothers contains less leptin, contributing to a diminished neonatal leptin surge in the pups. This early-life leptin deficiency drives neutrophil mobilization and biases immune trajectories via IL-6 toward long-term inflammatory vulnerability. Importantly, social buffering of the mother interrupts this cascade, positioning early leptin as a key signal in immune development and reframing LBN as a model of maternal physiological stress, rather than altered caregiving alone. These findings highlight parental support as a tractable intervention to mitigate the enduring immune consequences of early-life adversity. A schematic overview of this maternal stress-milk-leptin axis is provided in Figure S12. MATERIALS AND METHODS Animals Adult female and male RjOrl:SWISS (CD-1) outbred mice (10-12 weeks of age) were obtained from Janvier Labs (France) and housed with ad libitum food and water in an air-conditioned (temperature: 23 ± 2°C, humidity: 50 ± 5 %) room with 12 h/12 h light-dark cycle (lights on at 07:00 am). Mice were habituated to the new environment ≥ 1 week before the start of breeding. A breeding pair consisted of 1 female and 1 male CD-1. Two weeks after mating, pregnant dams were single housed until delivery. However, for the paired housing conditions, the mouse father was kept with the mother and pups until P9. To precisely determine date of birth (P0), the pregnant dams were monitored daily from two weeks post-mating until delivery. From P2-9 the dams and litter were exposed to LBN procedure or control condition in a random fashion; both male and female pups were used. All experiments were performed in accordance with the European directive 2010/63/EU for animal experiments and were approved by the local authorities (Animal Ethics Committee of Utrecht University and the Dutch Central Authority for Scientific Procedures on Animals [CCD], AVD11500202316791) and were conducted in agreement with the Dutch law (Wet op de Dierproeven, 2014). Limited Bedding and Nesting procedure LBN was performed from P2-9, as described. 7 On P2, litters were culled to 10, weighed and randomly assigned to LBN or control conditions. Dams subjected to LBN conditions were moved to a cage equipped with an aluminum mesh grid (about 1.5 cm above cage floor) and limited nesting material (half square of a Nestlet, Plexx, Cat# 14010). Control litters were also moved to a new cage but kept under standard conditions and provided with sufficient bedding and two Nestlets. Mice were left undisturbed until P9. For the early effects of LBN, pups were weighed and decapitated at P9. For the long-term effects of LBN, mice were housed under standard conditions until weaning at P21. After weaning, offspring were group-housed with sex-matched littermates. Mice kept for the long-term were terminated at P100 or P120. Automated mouse tracking Each cage was filmed using a Raspberry Pi camera recording at a resolution of 1280 by 720 px and a frame rate of 25 fps. The camera was positioned at an angle on the long end of the cage, capturing a clear image of the cage with minimal lens reflection. Each light-dark cycle was captured in a separate 12-hour video recording. The automated tracking procedure consisted of three steps: 1) automatically detecting body landmarks in mice directly from the video recordings, 2) using body landmark data to compute mouse location and link it across frames, 3) assigning linked mice locations (i.e., tracks) to an on- or off-nest status, and 4) outcome evaluation. Mouse body landmark detection. DeepLabCut (http://deeplabcut.org/) was used 27,28 to label the location of 9 unique mouse body landmarks (i.e., nose, tail base, back, right front paw, left front paw, right hind paw, left hind paw, right ear, and left ear) in 400 frames from single-housing videos and 400 frames from paired-housing videos. With the labeled frames, we trained two separate mouse pose estimation models (one for each housing condition, based on the convolutional neural network ResNet-50). The models were then used to detect the location of the 9 mouse body landmarks for each frame of each video. Tracking mice across frames. A custom-built tracking algorithm was used to determine mouse location and link it across frames. Mouse location was defined using the nose, tail base, back, right ear, and left ear landmarks, as they were observed to be most stable. For the single-housing condition, linking mouse location across frames was relatively simple, as only the dam and the pups were present. The effects of occasional detection errors (e.g., wrongly assigning the location of a landmark to the body of a pup) were minimized by filtering out landmarks that had a confidence value lower than 0.75 or were over 200 px away from a recent (i.e., within 4 s) known mouse location. Accurately tracking mouse location across frames in the paired-housing condition was more challenging, mainly due to frequent occlusions (e.g., one mouse partly or completely behind the other). The two tracks were started at the first frame where two instances of the same landmark were present. Landmarks in later frames were then assigned to one of the two tracks based on distance to the previous known locations of the tracks. Landmarks with a confidence value lower than 0.75 or a distance greater than 150 px from the last known location of the tracks were filtered out. Finally, the tracks for both the single- and paired-housing conditions were smoothed using the Savitzky-Golay filter and gaps of data loss shorter than 50 frames were interpolated. Nest status assignment. Each mouse location sample was given an on- or off-nest status. Nest center was defined to coincide with the center location of the litter of pups as it appeared on each video recording. Nest area was defined as an ellipse with a width of 400 px, height of 300 px, and the nest center as midpoint. A mouse was labeled as being on or off nest if its location was either inside or outside of the nest area for a continuous period of at least 25 frames (i.e., 1 s), respectively. These data were then used to construct on- and off-nest episodes that were the basis for computing the continuous behavioral tracking measures. Outcome evaluation. To assess the quality of the automated tracking algorithms and on- and off-nest assignment, we manually annotated a random sample of 1840 frames (10 per video) in the single-housing condition and 5500 frames in the paired-housing condition (50 per video) for mouse center location. These annotations were further given an on- or off-nest status using the scheme described above. The manual annotations were compared with the automated tracking outcomes for both nest status and mouse location. For the single-housing condition, this yielded a nest status accuracy of 0.95 across nesting conditions (0.94 for LBN and 0.94 for CTRL), meaning that the manually annotated nest status matched the automated assignments 95% of the time, and a mouse location error of 44.6 px, translating to roughly 1.08 cm in physical distance. For the paired-housing condition, we observed an accuracy of 0.92 across nesting conditions (0.93 for LBN and 0.89 for CTRL) and a mouse location error of 48.8 px (1.19 cm in physical distance). These values were deemed sufficient for the behavioral tracking analyses detailed in the manuscript. Parental identification from video The sex of the parental mice could not be determined with automated tracking. To fully assess maternal/paternal nest attendance (paired condition), sex was determined manually annotated from video fragments in which a single parent was on the nest (‘single’). From P2-9, we annotated 20 randomly sampled ‘single’ fragments with a duration of at least 15s/video to calculate maternal/paternal nest attendance for five litters. The ‘single’ fragments were taken from 13-14 videos per litter (67 videos in total). Sex was determined by observing the genital area, nipples, and overall appearance and behavior (i.e. nursing position of the mother). White adipose tissue (WAT) dissection P9 mice were euthanized and placed in ice-cold phosphate buffer (pH 7.4) supplemented with sucrose and 0.05% sodium azide. Due to the small size of the animals, dissections were performed under a stereomicroscope. WAT was isolated in a standardized manner by dissecting epididymal and subcutaneous depots. Tissues were carefully cleared of surrounding structures and weighed using a precision balance. Leptin administration At P2, 4, 6 and 8 pups were s.c. injected with 80 ng/g b.w. of recombinant mouse leptin protein (Abcam, Cat# ab270069), this product has very low endotoxicity (<0.005 EU/µg endotoxin level). Neutrophil depletion Mouse pups were s.c. injected once at P2 with 25 ng of murinized anti-Ly6G [1A8] mouse IgG2a, kappa (Absolute Antibody, Cat# ab00295-2.0), to deplete neutrophils. 29 Corticosterone administration Throughout the LBN period (P2-9), opaque drinking bottles were filled with either a vehicle (0.45% hydroxypropyl-β-cyclodextrin, Merck, Cat# 332593) or CORT (100 µg/mL, Merck, Cat# 2505 in vehicle) solution. 30 Solutions were replenished after 4 d. ELISA Measurements were made in blood plasma and in maternal milk. Blood was obtained via the trunk (P9) or by tail cut (adult mice), collected in an EDTA tube and centrifuged for 10 min at 4°C at 3,000 rpm to obtain blood plasma. Blood plasma was measured by ELISA kits for IL-6 (Abcam, Cat# ab100712), corticosterone (Enzo, Cat# adi-900-097), CXCL1 (Thermo Fisher, Cat# EMCXCL1), CXCL12 (BioLegend, Cat# 444207), G-CSF (Thermo Fisher, Cat# EMCSF3), leptin (Crystal Chem, Cat# 90030), prolactin (Invitrogen, Cat# EMPRL), MPO (Abcam, Cat# ab155458), MMP8 (Abcam, Cat# ab206982) and CRP (Abcam, Cat# 222511), according to manufacturer’s instructions. Maternal milk was obtained from the P9 pup stomach and stored at -80°C. Milk samples were thawed, diluted 1:2 in PBS with protease inhibitor (Roche, Cat# 11836170001) and dissolved using a potter and pestle. Measurements in milk were performed using ELISA kits for leptin and corticosterone, according to manufacturer’s instructions. Peripheral glucose measurements Morning blood glucose levels were measured at P9, straight after decapitation, using an electronic handheld glucometer (AccuChek, Roche). Three consecutive measurements of glucose were taken and averaged to ensure reliable values. Automated leukocyte cell counts P9 trunk blood was collected in EDTA tubes, diluted 5x with 0.9% saline and measured for total leukocyte counts on an ADVIA 2129 hematology analyzer (Siemens Healthineers). Neutrophil counts on blood smear A drop of blood was collected to create a blood smear. The smear was fixed (100% methanol for 5’), stained with May-Grünwald (Merck, Cat# 1014240500, 1:1 in PBS), rinsed and stained with Giemsa (Merck, Cat# 1092040500, 1:9 in PBS, for 20’). In the monolayer of each smear 100 leukocytes were counted using light microscopy and percentages of neutrophils, monocytes, eosinophils, lymphocytes and basophils were determined. Neutrophil segmentations Neutrophil nuclear segmentation was evaluated on May-Grünwald–Giemsa–stained peripheral blood smears using a light microscope with a 63× oil-immersion objective. In the monolayer region of each smear, 100 consecutive neutrophils were examined, and the number of nuclear segments (lobes) was recorded for each cell. A nuclear lobe was defined as a discrete mass of condensed chromatin connected to adjacent lobes only by a thin chromatin filament; deep but broad indentations without a thin chromatin bridge were not considered separate lobes. Immunohistochemistry for neutrophils in bone marrow P9 pups were terminated by decapitation and bodies were fixed in 4% buffered formaldehyde (Klinipath, Cat# 4078.9020) for 48 h at 4°C. Following storage, bodies were placed in 15% sucrose + 0.05% sodium azide. Femurs were collected and paraffin embedded. P9 femurs were decalcified with 12.5% EDTA decalcifying solution. After 1 week, decalcified samples were rinsed twice with 70% ethanol rinse. Femurs were incubated o.n. at 70% ethanol and further dehydrated in ethanol. Tissues were cleared in xylene and embedded in paraffin. Paraffin blocks were sectioned at 5 mm thickness on a microtome. Slides were dried and fixed. Prior to immunohistochemical staining, sections were deparaffinized in xylene and 100% ethanol, rehydrated and rinsed in Milli-Q water. Sections were incubated in Tris/EDTA buffer (10 mM Trisbase, 1 mM EDTA, pH 9.0) for 5 min, followed by antigen retrieval in the same buffer at 80 °C for 40 min. After cooling, slides were washed in TBS-T (0.05 M, pH 7.6 + 0.05% Tween), and incubated with 5% Normal Mouse Serum (NMS) to block non-specific binding. Primary antibody incubation was performed for 1h using purified rat anti-mouse Ly6G antibody (BD Biosciences, Cat# 551459), diluted in TBS-T containing 5% BSA (Roche, Cat# 10735078001, 1:1,000). Following incubation, slides were washed and incubated with rabbit anti-rat IgG (H+L), biotinylated (Vector Labs, Cat# BA-4001, 1:500 in TBS-T + 1% BSA) for 30 min. After washing, BrightVision Poly-AP Goat anti-Rabbit reagent (Immunologic, Cat# DPV055-rHRP-mAP; undiluted) was applied for 30 min. Slides were washed and chromogen detection was performed using Liquid Permanent Red (LPR, Dako/Agilent, Cat# K0640). Counterstaining was performed with hematoxylin, followed by rinsing under running tap water for 5 min. Slides were dried on a heating plate and cover slipped. A negative control was obtained by omitting primary antibody. Bone marrow isolation and flow cytometric analysis Bone marrow (BM) was isolated from murine long bones immediately after sacrifice. Hind limbs were dissected and excess muscle tissue was removed. Bones were collected in RPMI 1640 medium (Thermo Fisher, Cat# 11875093) and maintained on ice until further processing. Both lower legs were used due to the fragility of femurs observed during optimization. The epiphyses were removed and BM was flushed from the bone cavity using RPMI 1640 medium with a 10 mL syringe fitted with a 25G needle. Flushed BM was collected into 50 mL tubes and passed through a 70 µm cell strainer to obtain a single-cell suspension, followed by rinsing with additional medium. Cells were centrifuged at 300 g for 5 min at 4°C, and the supernatant was discarded. Red blood cells were lysed using ammonium chloride-based lysis buffer for 5 min on ice, after which cells were diluted in RPMI 1640 supplemented with 10% fetal calf serum (FCS) and centrifuged again (300 g, 5 min, 4°C). The resulting cell pellet was resuspended in PBS and cell numbers were determined. For flow cytometry, BM cells were plated at approximately 5 × 10⁵ cells per well in 96-well plates. Cells were washed with PBS and stained with a fixable viability dye (LIVE/DEAD TM Fixable Near IR, Thermo Fisher, Cat# L3476) for 30 min at 4°C. After washing, Fc receptors were blocked (rat anti-mouse CD16/CD32 Fc block, Invitrogen, Cat# 553142) and cells were stained with a panel of fluorochrome-conjugated antibodies targeting CD11b, CD3e, CD45 (Thermo Fisher, Cat# 364-0112-80, Cat# 53-0031-80, Cat# 25-0451-81, respectively), CD45R (Bio-Rad, Cat# MCA1258SBV610) and Ly6G (Miltenyi Biotec, Cat# 130-128-232) for 45 min at 4°C. Fluorescence minus one (FMO) controls and single-stained compensation controls were included. Following staining, cells were washed, fixed (IC fixation buffer, Invitrogen, Cat# 00-8222-49), and resuspended in FACS buffer. Immediately prior to acquisition, samples were supplemented with Precision Counting Beads (BioLegend, Cat# 424902) to enable absolute quantification. Data were acquired on a CytoFLEX LX flow cytometer (Beckman Coulter), and compensation was performed using single-stained controls. Measuring oxidative burst from neutrophils Neutrophil isolation Fresh isolated blood from P100 mice was lysed for 10 min using a Red Blood Cell Lysis Solution (Miltenyi Biotec, Cat# 130-094-183). Cells were pelleted, washed and neutrophils were isolated using a mouse Neutrophil Isolation Kit (Miltenyi Biotec, Cat# 130-097-658), according to manufacturer’s instructions. Isolated neutrophils were pelleted and resuspended in Krebs-Ringer Solution, HEPES-buffered (Thermo Fisher, J67795.AP) at a concentration of 5*10 5 neutrophils/mL and stored on ice until further use. Validation of neutrophil isolation Neutrophil isolation was verified by immunohistochemistry. One 20 µL drop of isolated neutrophil suspension was airdried before methanol fixation. Cells were permeabilized using 0.1% Triton X-100 in PBS, washed, and blocked for 1h using 2% BSA (Mitenyi Biotec, Cat# 130-091-376). Cells were incubated o.n. at 4°C with rabbit anti-Purified human granulocytic MPO (1:200, Thermo Fisher) and rat anti-Mouse Ly6G (1:200, BD Biosciences, Cat# 551459), diluted in 0.1% BSA. The next day, the cells were washed and incubated with goat IgG (H+L) anti-rabbit Alexa Fluor 594 (1:500, Thermo Fisher, Cat# A11012) and goat IgG (H+L) anti-rat Alexa Fluor 488 (1:500, Thermo Fisher, Cat# A11006) for 45 min. Cells were washed, rinsed, and nuclei were counterstained with DAPI. Immunofluorescent images were acquired using a ZEISS fluorescence microscope (Axiovision Z1) equipped with a 10x NA 0.3 objective and an AXIOCAM MRr camera. Purity of isolated neutrophil fraction was verified using a customized script in ImageJ to count the amount of Ly6G + cells. Oxidative burst Neutrophil H 2 O 2 production was measured under baseline conditions and after stimulation using Amplex™ UltraRed (Thermo Fisher, Cat# A36006), as before. 31 Amplex UltraRed acts as a fluorogenic substrate for HRP that reacts with H 2 O 2 in a 1:1 stoichiometric ratio to produce fluorescent Amplex UltraRed (Ex/Em 568/581 nm). A reaction mixture containing 50 µM Amplex™ UltraRed and 0.1U/mL Pierce™ Horseradish Peroxidase (Thermo Fisher, Cat# 31491) was made in HEPES-buffered Krebs-Ringer Solution (Thermo Fisher, Cat# J67795.AP). To stimulate the neutrophils, 100 nM Phorbol 12-myristate 13-acetate, 95% (PMA, Thermo Fisher, Cat# J63916.MCR) was added to the reaction mixture. Wells (Microplate, Corning, Cat# 353376) were filled with 100 µL reaction mixture and prewarmed at 37°C for 10 min. To start the reaction, 20 µL of the isolated neutrophil suspension, containing 1*10 4 neutrophils, was added to each well. Accumulation of fluorescent Amplex UltraRed was measured at an excitation wavelength of 530 nm and an emission wavelength of 590 nm for 29 min at 1 cycle per minute using a preheated CLARIOstar Plus (BMG Labtech; Ortenberg, Germany). Fresh H 2 O 2 was used to generate a standard curve. RT-qPCR Total RNA was extracted from hypothalamus samples using TRIzol Reagent (Thermo Fisher, Cat# 15596018) according to manufacturer’s instructions, and 500 ng RNA was reverse-transcribed to cDNA using iScript™ Reverse Transcription Supermix (Bio-Rad, Cat# 1708841) according to manufacturer’s instructions. RT-qPCR was performed using the below specified primers and iQ SYBR Green Supermix (Bio-Rad, Cat# 1708880) in a CFX Opus 96 Real-Time PCR System (Bio-Rad). The cycling program consisted of 3 min denaturation at 95°C, followed by 39 cycles of 95°C for 10 s and 60°C for 30 s. Melt curve analysis was performed between 65°C and 95°C using 0.5°C step increases with a 5 s hold at each step. Primer specificity for each target gene was validated by test RT-qPCR followed by agarose gel electrophoresis prior to these experiments. Cq values of target genes were normalized to the mean of hypoxanthine phosphoribosyltransferase 1 ( HPRT ), beta-2 microglobulin ( B2M ) and beta-actin ( ActB ). Relative gene expression was calculated using the 2 − ΔΔ Cq method. Primers sequences used are: HRPT (Fwd: TCCTCCTCAGACCGCTTTT, Rev: CCTGGTTCATCATCGCTAATC), B2M (Fwd: ATTCACCCCCACTGAGACTG, Rev: TGCTATTTCTTTCTGCGTGC), Actb (Fwd: AGAGGGAAATCGTGCGTGAC, Rev: CAATAGTGATGACCTGGCCGT). Npy (Fwd: TCGCTCTATCTCTGCTCGTG, Rev: TGTCTCAGGGCTGGATCTCTT). Open Field test Mice were tested at 8 weeks of age. The open field consisted of a circular arena (diameter 78 cm) that was illuminated with dimmed lights (55 lx). Mice were introduced near the wall of the arena and allowed to explore for 10 min. Locomotor activity was analyzed during the open field test using EthoVision (Version XT, Noldus, The Netherlands). Data, statistical analyses, and reproducibility All experiments were randomized and blinded by an independent researcher. Researchers remained blinded during histological, biochemical or behavioral assessments. Data are expressed as mean ± s.e.m. Data were tested for normality and statistical tests were adjusted accordingly. Statistical analyses were performed using Prism 10 (GraphPad). Statistical tests, and additional details, are indicated in the figure legends. Declarations ACKNOWLEDGEMENTS We thank D. Evertse, B.A. Hendriks, R. Koot, M. Nederhof, M. Nijenhuis, M.L. van de Grint, and T. van Eldik for technical assistance. This publication is part of the project Dutch Brain Interface Initiative (DBI2) with project number 024.005.022 of the research programme Gravitation, which is financed by the Dutch Ministry of Education, Culture and Science (OCW) via the Dutch Research Council (NWO). This work was partly funded by a grant from Child Health (UMC Utrecht) and Dynamics of Youth (University Utrecht) to MAK. The funders had no role in study design, data collection, analysis, or decision to publish. Figures 1A, 4A, 5A, 5D and Figure S12 were created using BioRender.com. AUTHOR CONTRIBUTIONS Conceptualization, MAK ; formal analysis, ELS, NVV, MJH, CSDP, MZ, MAK ; funding acquisition, MAK; investigation, ELS, NVV, MJH, CSDP, SAML, MZ, NM, CM, ST, MAK; methodology, ELS, NVV, MJH, CM, LW, MAK; supervision, MAK, OP, CGJC ; visualization, MAK; writing – original draft, MAK; writing – review and editing, ELS, OP, LW, CGJC, MAK. DECLARATION OF INTERESTS MAK serves as an Associate Editor for Heliyon. The authors declare no other competing interests. RESOURCE AVAILABILITY Lead Contact Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Michael A. van der Kooij ( [email protected] ). Material Availability This study did not generate new unique reagents. Data and Code Availability The tracking algorithms were tailored to our dataset; all analysis scripts will be made publicly available upon publication. References Bale TL, Baram TZ, Brown AS, Goldstein JM, Insel TR, McCarthy MM, Nemeroff CB, Reyes TM, Simerly RB, Susser ES, Nestler EJ (2010) Early life programming and neurodevelopmental disorders. Biol Psychiatry 68:314–319 Curley JP, Champagne FA (2016) Influence of maternal care on the developing brain: mechanisms, temporal dynamics and sensitive periods. Front Neuroendocrinol 40:52–66 Baumeister D, Akhtar R, Ciufolini S, Pariante CM, Mondelli V (2016) Childhood trauma and adulthood inflammation: a meta-analysis of peripheral C-reactive protein, interleukin-6 and tumour necrosis factor-α. Mol Psychiatry 21:642–649 Danese A, Baldwin JR (2017) Hidden wounds? Inflammatory links between childhood trauma and psychopathology. Annu Rev Psychol 68:517–544 Miller GE, Chen E, Parker KJ (2011) Psychological stress in childhood and susceptibility to the chronic diseases of aging: moving toward a model of behavioral and biological mechanisms. Psychol Bull 137:959–997 Walker CD, Bath KG, Joels M, Korosi A, Larauche M, Lucassen PJ, Morris MJ, Raineki C, Roth TL, Sullivan RM, Taché Y, Baram TZ (2017) Chronic early life stress induced by limited bedding and nesting (LBN) material in rodents: critical considerations of methodology, outcomes and translational potential. Stress 20:421–448 Rice CJ, Sandman CA, Lenjavi MR, Baram TZ (2008) A novel mouse model for acute and long-lasting consequences of early life stress. Endocrinology 149:4892–4900 MacDowell Kaswan ZA, Bowers C, Teplyakov I, Sibtain A, Munoz-Martin J, Ahmed S, Kaffman L, Giuliano L, Dietrich MO, Kaffman A (2025) Erratic maternal care induces avoidant-like attachment deficits in a mouse model of early life adversity. eNeuro 12: ENEURO.0249-25.2025. Juncker HG, Jakobsen PR, Naninck EFG, Davids M, Herrema H, van Goudoever JB, de Rooij SR, Korosi A (2025) Maternal stress in the early postpartum period is associated with alterations in human milk microbiome composition. Brain Behav Immun 124:74–84 Bouret SG, Draper SJ, Simerly RB (2004) Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304:108–110 Hunsche C, Hernandez O, Mela V, Viveros MP, De la Fuente M (2022) The postnatal leptin surge supports immune cell function in rats. Immunol Invest 51:1347–1363 Casabiell X, Piñeiro V, Tomé MA, Peinó R, Diéguez C, Casanueva FF (1997) Presence of leptin in colostrum and/or breast milk from lactating mothers: a potential role in the regulation of neonatal food intake. J Clin Endocrinol Metab 82:4270–4273 Yam KY, Naninck EFG, Abbink MR, la Fleur SE, Schipper L, van den Beukel JC, Grefhorst A, Oosting A, van der Beek EM, Lucassen PJ, Korosi A (2017) Exposure to chronic early-life stress lastingly alters the adipose tissue, the leptin system and changes the vulnerability to western-style diet later in life in mice. Psychoneuroendocrinology 77:186–195 Evertse D, Sommer EL, Markus N, van der Jagt M, Hendrik BA, van de Grint ML, van der Kooij MA (2026) Early life stress in mice disrupts blood-brain barrier function and reduces claudin-5 expression in the lateral septum and striatum, with linked behavioral impairments. Brain Behav Immun 135:106530 Dexter BC, Rahmouni K, Cushman T, Hermann GM, Ni C, Nopoulos PC, Thedens DL, Roghair RD (2014) Neonatal leptin deficiency reduces frontal cortex volumes and programs adult hyperactivity in mice. Behav Brain Res 263:115–121 Kiernan K, MacIver NJ (2021) The role of the adipokine leptin in immune cell function in health and disease. Front Immunol 11:622468 Gallo S, Shleifer DG, Godoy L, Ofray D, Olaniyan A, Campbell T, Bath KG (2019) Limited bedding and nesting induces maternal behavior resembling both hypervigilance and abuse. Front Behav Neurosci 13:167 Treccani G, Yigit H, Lingner T, Schleuβner V, Mey F, van der Kooij MA, Wennström M, Herzog DP, Linke M, Fricke M, Schmeisser MJ, Wegener G, Mittmann T, Trotter J, Müller MB (2021) Early life adversity targets the transcriptional signature of hippocampal NG2 + glia and affects voltage gated sodium (Na v ) channels properties. Neurobiol Stress 15:100338 Hoffmann A, Ebert T, Klöting N, Kolb M, Gericke M, Jeromin F, Jessnitzer B, Lössner U, Burkhardt R, Stumvoll M, Fasshauer M, Kralish S (2019) Leptin decreases circulating inflammatory IL-6 and MCP-1 in mice. BioFactors 45:43–48 Florentin J, Zhao J, Tai Y, Babu Vasamsetti S, O’Neil SP, Kumar R, Arunkumar A, Watson A, Sembrat J, Bullock GC, Sanders L, Kassa B, Rojas M, Graham BB, Chan SY, Dutta P (2021) Interleukin-6 mediates neutrophil mobilization from bone marrow in pulmonary hypertension. Cell Mol Immunol 18:374–384 Beery AK, Kaufer D (2015) Stress, social behavior, and resilience: insights from rodents. Neurobiol Stress 1:116–127 Stagkourakis S, Smiley KO, Williams P, Kakadellis S, Ziegler K, Bakker J, Brown RSE, Harkany T, Grattan DR, Broberger C (2020) A neuro-hormonal circuit for paternal behavior controlled by a hypothalamic network oscillation. Cell 182:960–975 Libhaber N, Eilam D (2002) Social vole parents force their mates to baby-sit. Dev Psychobiol 41:236–240 McDade TW, Metzger MW, Chyu L, Duncan GJ, Garfield C, Adam EK (2014) Long-term effects of birth weight and breastfeeding duration on inflammation in early adulthood. Proc Biol Sci 281:20133116 Ten Barge JA, Meesters NJ, Benders M, van Kaam AH, van Zelst BD, van Zanten H, van Ganzewinkel CJ, Tataranno ML, Schuerman FABA, van den Akker CHP, Raets MMA, de Boode WP, Dijk PH, Muller KS, Reiss IKM, van den Berg SAA, Simons SHP, van den Bosch GE (2026) Stress exposure, stress responses, and short-term outcomes in very preterm neonates: a national cohort study. Eur J Pediatr 185:129 Bielicki J, Huch R, von Mandach U (2004) Time-course of leptin levels in term and preterm human milk. J Endocrinol 151:271–276 Mathis A, Mamidanna P, Cury KM, Abe T, Murthy VN, Mathis MW, Bethge M (2018) DeepLabCut: markerless pose estimation of user-defined body parts with deep learning. Nat Neurosci 21:1281–1289 Lauer J, Zhou M, Ye S, Menegas W, Schneider S, Nath T, Rahman MM, Di Santo V, Soberanes D, Feng G, Murthy VN, Lauder G, Dulac C, Mathis MW, Mathis A (2022) Multi-animal pose estimation, identification and tracking with DeepLabCut. Nat Methods 19:496–504 Olofsen PA, Stip MC, Jansen JHM, Chan C, Nederend M, Tieland RG, Tsioumpekou M, Leusen JHW (2022) Effective, long-term, neutrophil depletion using a murinized anti-Ly-6G 1A8 antibody. Cells 11:3406 Evertse D, Alves-Martinez P, Treccani G, Müller MB, Meye FJ, van der Kooij MA (2024) Transient impact of chronic social stress on effort-based reward motivation in non-food restricted mice: involvement of corticosterone. Neurobiol Stress 33:100690 Mohanty JG, Jaffe JS, Schulman ES, Raible DG (1997) A highly sensitive fluorescent micro-assay of H 2 O 2 release from activated human leukocytes using a dihydroxyphenoxazine derivative. J Immunol Methods 202:133–141 Additional Declarations There is NO Competing Interest. Supplementary Files SINatCommun.docx Supplementary Information VideoS2LBNbpSirepupretrieval.mp4 Video S2 VideoS1LBNbpSiregroomingpups.mp4 Video S1 VideoS3LBNbpSireallogroomingdam.mp4 Video S3 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9587229","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":633976114,"identity":"cc7773d7-ed82-4950-b4ad-62793f2290ee","order_by":0,"name":"Ella L. Sommer*","email":"","orcid":"","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Ella","middleName":"L.","lastName":"Sommer*","suffix":""},{"id":633976115,"identity":"18000128-04d0-4d8f-9e9a-07776ab7fccc","order_by":1,"name":"Niilo V. Valtakari*","email":"","orcid":"","institution":"Department of Information and Computing Sciences, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Niilo","middleName":"V.","lastName":"Valtakari*","suffix":""},{"id":633976116,"identity":"de5f2865-0797-422c-b29c-1c045bb94420","order_by":2,"name":"Maes J. Holleman","email":"","orcid":"https://orcid.org/0009-0006-8136-769X","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Maes","middleName":"J.","lastName":"Holleman","suffix":""},{"id":633976117,"identity":"ba8b0664-9307-4f47-b2ae-2951884a32ea","order_by":3,"name":"Carmen S.D. Peters","email":"","orcid":"","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Carmen","middleName":"S.D.","lastName":"Peters","suffix":""},{"id":633976118,"identity":"26d62e7e-e01e-4073-8606-7f54e5aa69a2","order_by":4,"name":"Sarah A.M. Linsen","email":"","orcid":"","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"A.M.","lastName":"Linsen","suffix":""},{"id":633976119,"identity":"d9f9d8df-a3c2-4f5c-b485-172621c43554","order_by":5,"name":"Martijn Zegelaar","email":"","orcid":"https://orcid.org/0009-0002-1206-6819","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Martijn","middleName":"","lastName":"Zegelaar","suffix":""},{"id":633976120,"identity":"e0277cee-40a3-4b24-b992-2bd7fa06042b","order_by":6,"name":"Nicky Markus","email":"","orcid":"","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Nicky","middleName":"","lastName":"Markus","suffix":""},{"id":633976121,"identity":"20f97b58-db87-4f08-a71f-2727bbba09c3","order_by":7,"name":"Claire Mackaaij","email":"","orcid":"","institution":"Department of Anatomy, Division of Surgical Specialties, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Claire","middleName":"","lastName":"Mackaaij","suffix":""},{"id":633976122,"identity":"65c8f486-0770-45c6-a341-c1ec25ab3d52","order_by":8,"name":"Suzan Thijssen","email":"","orcid":"","institution":"Division of Pharmacology, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Suzan","middleName":"","lastName":"Thijssen","suffix":""},{"id":633976123,"identity":"dfa12085-6dd1-4abb-a9b1-df49aeb105c9","order_by":9,"name":"Olaf Perdijk","email":"","orcid":"","institution":"Division of Pharmacology, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Olaf","middleName":"","lastName":"Perdijk","suffix":""},{"id":633976124,"identity":"46dc70e3-8844-480d-9bf9-b55ccc9be270","order_by":10,"name":"Laurens Witter","email":"","orcid":"https://orcid.org/0000-0003-2357-0578","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Laurens","middleName":"","lastName":"Witter","suffix":""},{"id":633976125,"identity":"9612d142-0aae-4ce4-a35f-027067e0425a","order_by":11,"name":"Cindy G.J. Cleypool","email":"","orcid":"","institution":"Department of Anatomy, Division of Surgical Specialties, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Cindy","middleName":"G.J.","lastName":"Cleypool","suffix":""},{"id":633976113,"identity":"417a4f1e-8ae4-44ed-9260-cb1d4fd7295a","order_by":12,"name":"Michael A. van der Kooij","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKklEQVRIie2RMUvDQBTH3xG4LIdxjJT6DYQXgkVB8KskCJ2KdupUMNN1iemafou6iJuBg3Q5nRPqkMnJIVlEoYiJrSAmNavg/YY77n/vx7vjASgUfxjiAS03pGDo3lfIquWoXdnzoyrASilTMFuUqjZxflcOPC3T2PixO+3EbpYPdwDT58P5G19dGPr9IiO3NaUXUdRY/GTPgr6wwuphy0EvveJ4PPPPXY/IBgWQhFS4c6nzDkN6GZTKknBETJjlEd6g6DkJ34V7t1EAUrlWTrcqDKHgZRdG409lN2GbLuYWRbBhVATCDiU9W//F749S/8FGUw6s0G1QFpPrzHkR3alPrSxfxeUoxU3yOtpHYyIxL/hJbSAaQPTtGP+4dmpCjXF7iUKhUPw7PgDj4mxRMbQ8GwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-7415-1379","institution":"Department for Developmental Origins of Disease (DDOD), Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":true,"prefix":"","firstName":"Michael","middleName":"A. van der","lastName":"Kooij","suffix":""}],"badges":[],"createdAt":"2026-05-01 15:06:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9587229/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9587229/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109204865,"identity":"cc63352d-164c-4e28-a994-d230b09efef7","added_by":"auto","created_at":"2026-05-13 15:02:39","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":540970,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLimited bedding and nesting (LBN) elevates maternal corticosterone and increases nest attendance.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Experimental design. Dams housed under control (CTRL) or LBN conditions were continuously video recorded from postnatal day (P)2-9, and behavior was quantified using DeepLabCut.\u003c/p\u003e\n\u003cp\u003e(B) Number of maternal nest exits from P2-9 (n= 6-8 cages/group).\u003c/p\u003e\n\u003cp\u003e(C) Duration of maternal nest exits from P2-9 (n= 6-8 cages/group).\u003c/p\u003e\n\u003cp\u003e(D) Relative time dam spent on the nest from P2-9 (n= 6-8 cages/group).\u003c/p\u003e\n\u003cp\u003e(E) Representative images showing pilo-erection in an LBN dam, but not in a CTRL dam.\u003c/p\u003e\n\u003cp\u003e(F) Maternal blood plasma corticosterone levels at P9 (CTRL: n= 12, LBN: n= 14).\u003c/p\u003e\n\u003cp\u003eData are presented as individual values or as mean + SEM. Grey shading indicates night phase; white indicates day phase. Statistical analyses was performed using a mixed-effects model (B-D) and an unpaired \u003cem\u003et\u003c/em\u003e-test with Welch’s correction (F), *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e\n\u003cp\u003eSee also Figure S1.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/6b3358d7af8c5709fe15d6d9.jpeg"},{"id":109121098,"identity":"06fca5a4-fb90-42d5-be74-9d79cbfa956a","added_by":"auto","created_at":"2026-05-12 17:19:40","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":541719,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEarly-life LBN exposure reduces leptin during a critical developmental window.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Bodyweight development from postnatal day (P)2-9 (n= 15-16 litters/group).\u003c/p\u003e\n\u003cp\u003e(B) Relative white adipose tissue (WAT) mass at P9 (n= 21 mice/group).\u003c/p\u003e\n\u003cp\u003e(C) Plasma leptin levels in P9 pups (n= 29-30 mice/group).\u003c/p\u003e\n\u003cp\u003e(D) Correlation between plasma leptin levels and relative WAT mass at P9 (n= 12 mice).\u003c/p\u003e\n\u003cp\u003e(E) Leptin levels in maternal milk at P9 (n= 13-16 mice/group).\u003c/p\u003e\n\u003cp\u003eData are presented as individual values or as mean + SEM. Statistical analyses were performed using a two-way ANOVA (A), Mann-Whitney tests (B,C), Spearman correlation (D) and unpaired \u003cem\u003et\u003c/em\u003e-test with Welch’s correction (E). **P\u0026lt;0.01, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003eSee also Figure S2 and S3.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/f94286af2bfef546aa8d345a.jpeg"},{"id":109121101,"identity":"ed57764d-94d3-4591-90d0-dff19d8bb307","added_by":"auto","created_at":"2026-05-12 17:19:40","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":740181,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEarly-life LBN exposure programs persistent neutrophil activation and low-grade systemic inflammation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)\u0026nbsp;\u0026nbsp; Plasma myeloperoxidase (MPO) levels in postnatal day (P)9 pups (n= 8 mice/group).\u003c/p\u003e\n\u003cp\u003e(B)\u0026nbsp;\u0026nbsp; Total blood leukocyte counts at P9 (n= 6 mice/group).\u003c/p\u003e\n\u003cp\u003e(C)\u0026nbsp; Relative neutrophil abundance in peripheral blood at P9, P16 and P100 (P9: n= 15-16 mice/group, P16: n= 7 mice/group; P100: n= 13-15 mice/group).\u003c/p\u003e\n\u003cp\u003e(D)\u0026nbsp; Representative images of femoral bone marrow showing Ly6G immunoreactivity (pink).\u003c/p\u003e\n\u003cp\u003e(E)\u0026nbsp;\u0026nbsp; Quantification of Ly6G-immunoreactive area in bone marrow at P9 (n= 7-10 mice/group).\u003c/p\u003e\n\u003cp\u003e(F)\u0026nbsp;\u0026nbsp; Representative flow cytometry plots of CD11b\u003csup\u003e+\u003c/sup\u003eLy6G\u003csup\u003e+\u003c/sup\u003e neutrophils from bone marrow at P9.\u003c/p\u003e\n\u003cp\u003e(G)\u0026nbsp; Quantification of bone marrow neutrophil numbers at P9 (n= 10 mice/group).\u003c/p\u003e\n\u003cp\u003e(H)\u0026nbsp; Neutrophil maturation state assessed by nuclear indentation at P100 (n= 10 mice/group).\u003c/p\u003e\n\u003cp\u003e(I)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Oxidative burst (ΔH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, 0-30 min) in unstimulated neutrophils at P100 (n= 4-5 mice/group).\u003c/p\u003e\n\u003cp\u003e(J)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Area under the curve (AUC) of ΔH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2 \u003c/sub\u003ein unstimulated neutrophils at P100 (n= 4-5 mice/group).\u003c/p\u003e\n\u003cp\u003e(K)\u0026nbsp;\u0026nbsp; Plasma matrix metalloproteinase (MMP) 8 levels at P9, P56 and P100 (n= 7-9 mice/group).\u003c/p\u003e\n\u003cp\u003e(L)\u0026nbsp;\u0026nbsp;\u0026nbsp; Plasma C-reactive protein (CRP) levels at P9, P56 and P100 (n= 5-8 mice/group).\u003c/p\u003e\n\u003cp\u003eData are presented as individual values or as mean ± SEM. Statistical analyses were performed using unpaired \u003cem\u003et\u003c/em\u003e-test (A,B,E,G,J,H) or 2-way ANOVA (C,K,L), \u0026nbsp;*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003eSee also Figures S4-S7.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/3d847013f5dafafd188688f7.jpeg"},{"id":109204841,"identity":"14b2b3ef-94f8-40e0-a3ee-c9018c61128c","added_by":"auto","created_at":"2026-05-13 15:02:34","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":591524,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElevated maternal corticosterone reproduces the LBN phenotype in pups.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Experimental design. Drinking water was replaced with a corticosterone- or vehicle solution from postnatal day (P)2-9.\u003c/p\u003e\n\u003cp\u003e(B) Plasma corticosterone levels in dams, when pups are P9 (n= 3 dams/group).\u003c/p\u003e\n\u003cp\u003e(C) Frequency of nest exits (n= 3-4 cages/group).\u003c/p\u003e\n\u003cp\u003e(D) Time on nest (n= 3-4 cages/group).\u003c/p\u003e\n\u003cp\u003e(E) Pup P9 bodyweight (n= 30 mice/group).\u003c/p\u003e\n\u003cp\u003e(F) Plasma leptin levels in P9 pups (n= 17 mice/group).\u003c/p\u003e\n\u003cp\u003e(G) Relative neutrophil abundance in peripheral blood from pups at P9 (n= 29-30 mice/group).\u003c/p\u003e\n\u003cp\u003eData are presented as individual values or as mean + SEM. Grey shading indicates night phase; white indicates day phase. Statistical analyses were performed using unpaired \u003cem\u003et\u003c/em\u003e-tests (B,E-G) or 2-way ANOVA (C-D). **P\u0026lt;0.01, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003eSee also Figure S8.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/8d6a552286bd68ac4687d0ff.jpeg"},{"id":109121105,"identity":"07d7c801-6b56-4f95-886a-6861a0b8ba51","added_by":"auto","created_at":"2026-05-12 17:19:40","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":357006,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLeptin, but not neutrophil depletion, normalizes LBN-induced immune alterations.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Experimental design. Pups were injected at postnatal day (P)2 with an anti-Ly6G antibody to deplete neutrophils.\u003c/p\u003e\n\u003cp\u003e(B) Relative neutrophil abundance in peripheral blood at P4 and P9 (n= 3-6 mice/group).\u003c/p\u003e\n\u003cp\u003e(C) Plasma C-reactive protein (CRP) levels at P100 (n= 5-7 mice/group).\u003c/p\u003e\n\u003cp\u003e(D) Experimental design. Pups were injected at P2, P4, P6 and P8 with leptin.\u003c/p\u003e\n\u003cp\u003e(E) Plasma IL-6 levels in P9 pups (n= 5-9 mice/group).\u003c/p\u003e\n\u003cp\u003e(F) Relative neutrophil abundance in peripheral blood at P120 (n= 10 mice/group).\u003c/p\u003e\n\u003cp\u003e(G) Bodyweight development from P2-9 (n= 19-20 mice/group).\u003c/p\u003e\n\u003cp\u003eData are presented as mean ± SEM. Statistical analyses were performed using one- (B,C,E,F) or two-way ANOVA (G). *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003eSee also Figures S9-S11.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/b71592e2c7b178ba3de5ee1e.jpeg"},{"id":109121102,"identity":"d198628f-6ae4-4350-9a33-3e2660db4192","added_by":"auto","created_at":"2026-05-12 17:19:40","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":681291,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiparental care buffers maternal stress and rescues endocrine and immune alterations induced by LBN.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Relative duration pups were left unattended from postnatal day (P)2-9 (n= 5-8 cages/group).\u003c/p\u003e\n\u003cp\u003e(B) Number of parents attending the nest during P2-9 (n= 5 cages).\u003c/p\u003e\n\u003cp\u003e(C) Relative paternal nest attendance during P2-9 (n= 5 cages).\u003c/p\u003e\n\u003cp\u003e(D) Maternal plasma corticosterone at P9 (CTRL-mat: n= 12, LBN-mat: n= 14, LBN-bp: n= 5 dams).\u003c/p\u003e\n\u003cp\u003e(E) Leptin levels in maternal milk from P9 pups (CTRL-mat: n=13, LBN-mat: n= 16; LBN-bp: n= 6 mice/group).\u003c/p\u003e\n\u003cp\u003e(F) Plasma leptin levels in P9 pups (CTRL-mat: n= 30, LBN-mat: n= 29, LBN-bp: n= 23 mice/group)\u003c/p\u003e\n\u003cp\u003e(G) Pup P9 bodyweight (n= 18-20 mice/group).\u003c/p\u003e\n\u003cp\u003e(H) Relative white adipose tissue (WAT) mass at P9 (n= 18-20 mice/group).\u003c/p\u003e\n\u003cp\u003e(I) Relative neutrophil abundance in peripheral blood at P56 (n= 6-7 mice/group).\u003c/p\u003e\n\u003cp\u003eData are presented as individual values or as mean + SEM. Grey shading indicates night phase; white indicates day phase. CTRL-mat, control-maternal; LBN-mat, limited bedding-nesting maternal; LBN-bp, limited bedding-nesting biparental conditions. Statistical analyses were performed using one-way ANOVA (D-I). *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001. Data in panels D-F and H include values previously shown in Figures 1F and 2B, C and E and are replotted here for direct comparison.\u003c/p\u003e\n\u003cp\u003eSee also Supplementary videos 1-3.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/be8f9315130908f826ca52d0.jpeg"},{"id":109405299,"identity":"1a83df28-2d20-457a-9aac-1de5f47db1b4","added_by":"auto","created_at":"2026-05-17 13:16:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3721590,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/acafea0b-dae1-4f06-adc9-8d7e6baff7ab.pdf"},{"id":109204976,"identity":"de338350-afd6-47c7-ac35-da699a05d6f9","added_by":"auto","created_at":"2026-05-13 15:03:04","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1159091,"visible":true,"origin":"","legend":"Supplementary Information","description":"","filename":"SINatCommun.docx","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/84d13c0d8bc8f367fc8977e8.docx"},{"id":109204758,"identity":"3272963e-9ad9-4ea2-b916-843d21cf9a1c","added_by":"auto","created_at":"2026-05-13 15:02:02","extension":"mp4","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4542007,"visible":true,"origin":"","legend":"Video S2","description":"","filename":"VideoS2LBNbpSirepupretrieval.mp4","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/00695f0aa9ce1a8816423d6b.mp4"},{"id":109205105,"identity":"bc217980-7989-4805-8eb9-35693153153e","added_by":"auto","created_at":"2026-05-13 15:03:23","extension":"mp4","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":8468915,"visible":true,"origin":"","legend":"Video S1","description":"","filename":"VideoS1LBNbpSiregroomingpups.mp4","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/898b5052922be4fe44fcfac3.mp4"},{"id":109204775,"identity":"f46746de-cfc7-4c33-be03-5b57088ff0b0","added_by":"auto","created_at":"2026-05-13 15:02:09","extension":"mp4","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":19085428,"visible":true,"origin":"","legend":"Video S3","description":"","filename":"VideoS3LBNbpSireallogroomingdam.mp4","url":"https://assets-eu.researchsquare.com/files/rs-9587229/v1/a2e7606a81f7ca5430ad0495.mp4"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Maternal stress shapes offspring innate immunity via milk leptin","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eThe early postnatal environment exerts a major influence on infant wellbeing by shaping the development of endocrine and immune systems.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e Maternal care during this period is critical, providing sensory cues that support attachment as well as nutritional and hormonal signals that coordinate postnatal growth and neuroendocrine maturation.\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e Disruptions to the early-life environment, including adverse childhood events, are associated with altered immune function, such as increased circulating pro-inflammatory cytokines in adulthood.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e These long-term alterations in immune and endocrine function are considered a hallmark of early-life stress (ELS) exposure. Persistent low-grade inflammation represents a key intermediate phenotype linking early-life adversity to increased risk for a range of chronic health conditions later in life.\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe limited bedding and nesting (LBN) paradigm is a well-established model of ELS in rodents and is typically induced from postnatal day (P) 2-9.\u003csup\u003e6\u003c/sup\u003e The impoverished LBN conditions are stressful to the mouse mother and alter the maternal behavioral patterns, including increased nest exits.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e Maternal care during LBN is often described as fragmented and unpredictable, a feature widely considered central to its effects on offspring development.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e However, how maternal stress is transmitted to the offspring and impacts their metabolic and immune programming is incompletely understood. Although fragmented maternal care is often invoked as the explanatory mechanism in LBN studies, it is intrinsic to the model, complicating causal interpretation and highlighting the need to examine additional processes that may shape offspring development.\u003c/p\u003e \u003cp\u003eIn addition to altered maternal behavior, maternal stress may modify physiological outputs, including endocrine signals transferred via milk that may independently influence offspring programming. In humans, early postnatal maternal stress has been linked with alterations in human milk quality.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e Maternal milk contains the key metabolic hormone leptin, which influences postnatal growth, hypothalamic development, and immune maturation. A transient postnatal leptin surge in the offspring is critical for the induction of these processes.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e Because leptin in maternal milk contributes to blood leptin levels\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, and LBN exposure reduces leptin\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, we investigated how LBN affects milk leptin transfer and the immunological consequences for the offspring.\u003c/p\u003e \u003cp\u003eHere, we combine continuous behavioral tracking with endocrine and immunological profiling to dissect how maternal stress under LBN conditions influences offspring development. We find that, despite intensified caregiving behavior, stressed mothers produce milk with reduced leptin levels, leading to a blunted leptin surge, persistent neutrophilia and long-term low-grade inflammation in the offspring. Leptin supplementation or biparental care rescue these effects, revealing a causal pathway linking maternal stress physiology to endocrine-immune programming.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eContinuous behavioral tracking reveals intensified maternal care under LBN conditions\u003c/h2\u003e \u003cp\u003ePrevious studies have suggested that fragmented maternal care under LBN conditions induces early-life stress (ELS) in offspring. However, these findings were limited by short observation windows and a lack of circadian analysis. To address this, we continuously tracked maternal behavior from P2\u0026ndash;9 across both light and dark phases (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLBN mothers exited the nest more frequently than non-stressed control (CTRL) mothers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), but the duration of individual nest absences was markedly shorter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), as well as the average dam-nest distance (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Consequently, despite more frequent nest exits, LBN mothers spent a greater total amount of time on the nest (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). These findings suggest that LBN mothers increase the \u003cem\u003eintensity\u003c/em\u003e rather than the \u003cem\u003econtinuity\u003c/em\u003e of maternal care, indicating a compensatory response to suboptimal environmental conditions. Consistent with elevated maternal strain, LBN mothers displayed overt stress phenotypes such as piloerection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) and elevated plasma corticosterone (CORT) levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLBN exposed pups receive milk with reduced leptin content and exhibit a blunted leptin surge\u003c/h3\u003e\n\u003cp\u003eDespite compensatory maternal care, LBN-exposed litters exhibited reduced P2-9 bodyweight gain (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Particularly affected at P9 was the white adipose tissue (WAT) mass, which showed a reduction, even after normalization to bodyweight (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Consistent with reduced WAT, plasma leptin levels at P9 were considerably lower for LBN exposed pups as compared to CTRL (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and relative WAT mass correlated to plasma leptin concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe developmental impact of LBN may reflect altered maternal milk production or composition. Because direct measurement of milk production is confounded by oxytocin-stimulation, we assessed maternal prolactin levels as a proxy. We also measured blood glucose and hepatic triglyceride concentrations at P9 to assess whether pups were in a catabolic state, owing to potential malnutrition. No differences were observed between LBN and CTRL (Figure S2A\u0026ndash;C), suggesting that milk production is not substantially altered. In contrast, leptin levels in maternal milk, collected from pup stomachs, were reduced following LBN exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), whereas corticosterone levels were unchanged (Figure S3). In line with our previous work\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, showing unaffected plasma corticosterone levels in P9 LBN pups, these findings argue against corticosterone transfer via milk and instead identify reduced milk leptin as a candidate mediator of LBN effects on the offspring.\u003c/p\u003e\n\u003ch3\u003eLBN induces persistent neutrophilia in pups\u003c/h3\u003e\n\u003cp\u003eNext, we examined the impact of LBN on the innate immune system in the context of reduced neonatal leptin levels. We found that LBN exposure elevated P9 plasma levels of myeloperoxidase (MPO) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), suggesting the involvement of neutrophils and/or monocytes. We then investigated leukocyte populations in peripheral blood after LBN exposure. While total leukocyte counts were unchanged by LBN at P9 in the blood of pups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), neutrophil numbers were significantly elevated at P9, P16 and P100 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), indicating persistent neutrophilia. Of note, other leukocyte populations\u0026mdash;monocytes, lymphocytes and eosinophils\u0026mdash;were not upregulated following LBN (Figure S4).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBone marrow analysis at P9 of LBN-exposed pups revealed a reduced Ly6G⁺ area (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD,E) and lower neutrophil counts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF,G), both consistent with enhanced neutrophil mobilization from the bone marrow into circulation. We then assessed the neutrophil maturation profile, based on the number of nuclear indentations. At P9, we found no differences between LBN and CTRL (Figure S5). However, in adulthood (P100) LBN induced a left-shift, meaning that neutrophils exhibited fewer indentations and that the LBN neutrophilic population displayed a less mature phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eWe then compared neutrophil function between LBN and CTRL mice in adulthood. Neutrophils were isolated from whole blood using MACS, yielding purified neutrophil populations (99.1%, Figure S6), after which we measured oxidative burst. Under baseline conditions, neutrophils from LBN mice exhibited higher H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e production compared to CTRL mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI,J). In contrast, PMA stimulation elicited comparable H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e production in both groups (Figure S7), indicating intact maximal oxidative capacity in LBN neutrophils. To determine whether LBN-induced neutrophilia has sustained systemic effects, we examined markers of neutrophil activity and inflammation. At P100, plasma levels of neutrophil elastase (MMP8) were elevated in LBN mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK), consistent with sustained alterations in granulopoiesis and neutrophil homeostasis. Additionally, LBN-exposed pups displayed elevated plasma levels of the pan inflammatory cytokine CRP in adulthood (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL), indicative of low-grade systemic inflammation.\u003c/p\u003e\n\u003ch3\u003eMaternal glucocorticoid signaling suppresses offspring leptin and programs neutrophilia\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eMaternal glucocorticoid signaling suppresses offspring leptin and programs neutrophilia\u003c/div\u003e \u003cp\u003eTo validate that the physiological stress response of the LBN-exposed mouse mothers drives the lowered leptin levels in the pups, we added CORT to the drinking water (100 \u0026micro;g/mL) of otherwise unstressed mouse mothers from P2-9, mimicking LBN stress exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). As expected, CORT treatment via the drinking water elevated maternal CORT in the peripheral blood (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and CORT-treated dams tended to drink slightly less (-6.4%, Figure S8A). Behavioral patterns, including number of nest exits, duration of nest exits, time spent on the nest, and average dam-nest distance did not differ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC,D and Figure S8B,C). Although maternal CORT treatment did not impact maternal behavior, key hallmarks of the LBN pup phenotype at P9 were recapitulated, including a reduced bodyweight (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), lowered leptin levels in pup plasma (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), and neutrophilia (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). These findings indicate that maternal glucocorticoid signaling is sufficient to recapitulate key features of the LBN-induced offspring phenotype.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eReduced leptin signaling drives neutrophilia\u003c/h3\u003e\n\u003cp\u003eTo test the roles of neutrophilia and reduced leptin levels in LBN-induced phenotypes, we performed loss- and gain-of-function experiments. We first treated P2 pups with a neutrophil depleting agent (anti-Ly6G [1A8]), which effectively depleted neutrophils during the LBN period (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA,B). However, at P100, plasma CRP levels for neutrophil-depleted LBN mice were not normalized (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), indicating that blocking LBN-induced neutrophilia during development does not prevent long-term low-grade inflammation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven that the postnatal leptin surge is essential for hypothalamic maturation, behavioral programming, and immune development\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, we first confirmed that LBN-induced leptin deficiency recapitulates established phenotypes. LBN-exposed mice exhibited increased hypothalamic NPY transcription at P9 and increased locomotor activity in adulthood (Figure S9A,B). Importantly, both NPY transcription and hyperactivity were prevented by exogenous leptin supplementation during LBN (s.c. 80 ng/g body weight at P2, 4, 6, 8; Figure S9A,B).\u003c/p\u003e \u003cp\u003eWe next investigated whether exogenous leptin could also block the impact of LBN on bodyweight and innate immunology (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Neonatal leptin supplementation did not affect P2-9 bodyweight gain for LBN exposed pups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Consistent with previous work\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, LBN exposure elevated IL-6 plasma levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), a cytokine known to promote the release of neutrophils from the bone marrow into circulation. Additionally, leptin treatment halted the LBN-associated increase in plasma IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Other inflammatory mediators with the potential to mobilize neutrophils from the bone marrow, G-CSF, CXCL1 and CXCL12 were not affected (Figure S10). Leptin treatment also prevented blood neutrophilia in P9 pups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), with a similar trend observed at P120 (Figure S11).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBiparental care buffers maternal stress and normalizes offspring development\u003c/h2\u003e \u003cp\u003eNext, we tested whether social buffering would mitigate maternal stress and its downstream effects. Mouse fathers were kept and co-housed with mothers and pups throughout the LBN period. Automated tracking revealed that LBN pups were rarely left alone (\u0026lt;\u0026thinsp;5%) under the biparental condition and for most of the time (~\u0026thinsp;60%), both parents were present in the nest (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,B). Interestingly, for episodes in which a single parent was present at the nest (~\u0026thinsp;36%), we found that the father was the attending parent in at least half of the cases, regardless of circadian phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Of note, fathers actively participated in pup care\u0026mdash;including grooming and retrieval\u0026mdash;and also engaged in allogrooming of the mother (Supplementary Videos 1\u0026ndash;3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBiparental housing normalized CORT levels for LBN housed mouse mothers and increased leptin concentrations in milk and plasma from P9 pups, compared to LBN maternal conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-F). However, P9 pup bodyweight and WAT mass were not altered by biparental housing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG,H). In adulthood, biparental housing partially normalized relative neutrophil abundance for LBN exposed offspring (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI). These findings demonstrate that natural social buffering via biparental care can counteract maternal stress and rescue LBN induced endocrine and immune developmental trajectories.\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOur findings identify maternal physiology as a key driver of ELS effects on offspring immunity, transmitted via maternal milk. Under LBN conditions, leptin levels are reduced in maternal milk and pup plasma and restoring leptin prevents offspring neutrophilia. Notably, paternal co-housing buffers maternal stress, restores milk leptin, and mitigates neutrophilia in the pups.\u003c/p\u003e \u003cp\u003eContinuous tracking of mouse mothers revealed more frequent nest exits under LBN conditions, consistent with previous reports.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e However, LBN nest exits were markedly shorter, resulting in a higher overall nest attendance under LBN conditions. This pattern suggests compensatory, high-effort caregiving, rather than disengagement. Elevated corticosterone levels and piloerection of the dam indicate that LBN care occurs under heightened physiological strain.\u003c/p\u003e \u003cp\u003eReduced P2-9 bodyweight in LBN exposed pups is in line with prior observations.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e WAT emerges as a particularly vulnerable tissue with its mass remaining clearly diminished, even when adjusted for bodyweight. Given that neonatal leptin is largely adipocyte-derived, reduced WAT likely underlies the lowered levels of circulating leptin and disrupted leptin surge. Although maternal milk contributes to circulating leptin in the pups, stressed dams produce leptin-deficient milk. Introducing maternal stress via CORT to the drinking water recapitulated the reduced P2-9 bodyweight gain, decreased milk and pup plasma leptin, and offspring neutrophilia. Thus, maternal physiology and milk composition emerge as central mediators of the impact of LBN on the offspring.\u003c/p\u003e \u003cp\u003eThese data suggest that developmental leptin deficiency contributes to neutrophilia, at least in part, via IL-6 signaling. Consistent with prior work linking leptin deficiency to elevated peripheral levels of IL-6\u003csup\u003e19\u003c/sup\u003e, the reduced circulating leptin in LBN exposed pups is likely connected to their higher IL-6 concentrations. IL-6 promotes neutrophil mobilization from the bone marrow into circulation\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, as reflected by reduced bone marrow neutrophils in LBN pups and increased circulating neutrophils at P9. Importantly, leptin supplementation normalized IL-6 levels and prevented neutrophilia. Since early neutrophil depletion did not prevent adult low-grade inflammation, leptin deficiency \u0026mdash;rather than neutrophilia\u0026mdash;likely programs long-term immune alterations. Together, these findings support a model in which maternal stress\u0026ndash;induced leptin deficiency elevates IL-6 signaling and promotes neutrophil mobilization, while long-term inflammatory alterations are not driven by neutrophil expansion itself.\u003c/p\u003e \u003cp\u003eSocial housing can buffer the impact of stress\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and we observed reduced CORT levels in LBN dams co-housed with the sire. Nest attendance was similar between maternal and paternal mice, with direct paternal care, including pup retrieval and pup grooming, as reported previously.\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e Affiliative behaviors were also evident, including paternal allogrooming and \u0026lsquo;forced baby-sitting\u0026rsquo;, as described for social voles.\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e Because relative WAT loss is not rescued under biparental LBN conditions, the normalized pup leptin levels are likely due to modulated maternal stress physiology and altered milk composition, and independent of pup WAT mass. Although the specific buffering mechanisms remain unresolved, the restoration of leptin concentrations in maternal milk and pup circulation, along with the attenuated neutrophilia, reinforces the central role of maternal physiology and leptin in shaping offspring immune development.\u003c/p\u003e \u003cp\u003eWhile our data strongly implicate milk-borne leptin as a mediator of maternal stress effects on offspring immunity, we cannot exclude contributions of additional milk-borne or systemic factors regulated by maternal physiology. Moreover, although our findings indicate persistent alterations in innate immune homeostasis, broader immune compartments, including adaptive immune responses, remain to be explored. Future studies will be required to determine how maternal endocrine signals interact with other components of the early-life environment to shape long-term immune trajectories.\u003c/p\u003e \u003cp\u003eOur findings have potential relevance for human ELS and immune development. Premature birth and low birth weight are associated with elevated CRP levels in young adulthood, while breastfeeding duration is inversely correlated with CRP levels.\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e Premature infants are exposed to substantial physiological stress early in life, including repeated clinical stressors during neonatal intensive care admission.\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e Notably, milk provided to premature infants is low in leptin.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e Although a direct link between stress and milk leptin in humans remains to be established, these observations raise the possibility that restoring milk-borne leptin may support immune development in prematurely born infants and promote more balanced immune responses.\u003c/p\u003e \u003cp\u003eTogether, these findings identify maternal physiological state, rather than caregiving quantity, as a key determinant of offspring immune development. Milk from stressed mothers contains less leptin, contributing to a diminished neonatal leptin surge in the pups. This early-life leptin deficiency drives neutrophil mobilization and biases immune trajectories via IL-6 toward long-term inflammatory vulnerability. Importantly, social buffering of the mother interrupts this cascade, positioning early leptin as a key signal in immune development and reframing LBN as a model of maternal physiological stress, rather than altered caregiving alone. These findings highlight parental support as a tractable intervention to mitigate the enduring immune consequences of early-life adversity. A schematic overview of this maternal stress-milk-leptin axis is provided in Figure S12.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdult female and male RjOrl:SWISS (CD-1) outbred mice (10-12 weeks of age) were obtained from Janvier Labs (France) and housed with \u003cem\u003ead libitum\u0026nbsp;\u003c/em\u003efood and water in an air-conditioned (temperature: 23 \u0026plusmn; 2\u0026deg;C, humidity: 50 \u0026plusmn; 5 %) room with 12 h/12 h light-dark cycle (lights on at 07:00 am). Mice were habituated to the new environment \u0026ge; 1 week before the start of breeding. A breeding pair consisted of 1 female and 1 male CD-1. Two weeks after mating, pregnant dams were single housed until delivery. However, for the paired housing conditions, the mouse father was kept with the mother and pups until P9. To precisely determine date of birth (P0), the pregnant dams were monitored daily from two weeks post-mating until delivery. From P2-9 the dams and litter were exposed to LBN procedure or control condition in a random fashion; both male and female pups were used. All experiments were performed in accordance with the European directive 2010/63/EU for animal experiments and were approved by the local authorities (Animal Ethics Committee of Utrecht University and the Dutch Central Authority for Scientific Procedures on Animals [CCD], AVD11500202316791) and were conducted in agreement with the Dutch law (Wet op de Dierproeven, 2014).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLimited Bedding and Nesting procedure\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLBN was performed from P2-9, as described.\u003csup\u003e7\u003c/sup\u003e On P2, litters were culled to 10, weighed and randomly assigned to LBN or control conditions. Dams subjected to LBN conditions were moved to a cage equipped with an aluminum mesh grid (about 1.5 cm above cage floor) and limited nesting material (half square of a Nestlet, Plexx, Cat# 14010). Control litters were also moved to a new cage but kept under standard conditions and provided with sufficient bedding and two Nestlets. Mice were left undisturbed until P9. For the early effects of LBN, pups were weighed and decapitated at P9. For the long-term effects of LBN, mice were housed under standard conditions until weaning at P21. After weaning, offspring were group-housed with sex-matched littermates. Mice kept for the long-term were terminated at P100 or P120.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAutomated mouse tracking\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEach cage was filmed using a Raspberry Pi camera recording at a resolution of 1280 by 720 px and a frame rate of 25 fps. The camera was positioned at an angle on the long end of the cage, capturing a clear image of the cage with minimal lens reflection. Each light-dark cycle was captured in a separate 12-hour video recording. The automated tracking procedure consisted of three steps: 1) automatically detecting body landmarks in mice directly from the video recordings, 2) using body landmark data to compute mouse location and link it across frames, 3) assigning linked mice locations (i.e., tracks) to an on- or off-nest status, and 4) outcome evaluation.\u003c/p\u003e\n\u003cp\u003eMouse body landmark detection. DeepLabCut (http://deeplabcut.org/) was used\u003csup\u003e27,28\u003c/sup\u003e to label the location of 9 unique mouse body landmarks (i.e., nose, tail base, back, right front paw, left front paw, right hind paw, left hind paw, right ear, and left ear) in 400 frames from single-housing videos and 400 frames from paired-housing videos. With the labeled frames, we trained two separate mouse pose estimation models (one for each housing condition, based on the convolutional neural network ResNet-50). The models were then used to detect the location of the 9 mouse body landmarks for each frame of each video.\u003c/p\u003e\n\u003cp\u003eTracking mice across frames. A custom-built tracking algorithm was used to determine mouse location and link it across frames. Mouse location was defined using the \u0026nbsp;nose, tail base, back, right ear, and left ear landmarks, as they were observed to be most stable. For the single-housing condition, linking mouse location across frames was relatively simple, as only the dam and the pups were present. The effects of occasional detection errors (e.g., wrongly assigning the location of a landmark to the body of a pup) were minimized by filtering out landmarks that had a confidence value lower than 0.75 or were over 200 px away from a recent (i.e., within 4 s) known mouse location. Accurately tracking mouse location across frames in the paired-housing condition was more challenging, mainly due to frequent occlusions (e.g., one mouse partly or completely behind the other). The two tracks were started at the first frame where two instances of the same landmark were present. Landmarks in later frames were then assigned to one of the two tracks based on distance to the previous known locations of the tracks. Landmarks with a confidence value lower than 0.75 or a distance greater than 150 px from the last known location of the tracks were filtered out. Finally, the tracks for both the single- and paired-housing conditions were smoothed using the Savitzky-Golay filter and gaps of data loss shorter than 50 frames were interpolated.\u003c/p\u003e\n\u003cp\u003eNest status assignment. Each mouse location sample was given an on- or off-nest status. Nest center was defined to coincide with the center location of the litter of pups as it appeared on each video recording. Nest area was defined as an ellipse with a width of 400 px, height of 300 px, and the nest center as midpoint. A mouse was labeled as being on or off nest if its location was either inside or outside of the nest area for a continuous period of at least 25 frames (i.e., 1 s), respectively. These data were then used to construct on- and off-nest episodes that were the basis for computing the continuous behavioral tracking measures.\u003c/p\u003e\n\u003cp\u003eOutcome evaluation. To assess the quality of the automated tracking algorithms and on- and off-nest assignment, we manually annotated a random sample of 1840 frames (10 per video) in the single-housing condition and 5500 frames in the paired-housing condition (50 per video) for mouse center location. These annotations were further given an on- or off-nest status using the scheme described above. The manual annotations were compared with the automated tracking outcomes for both nest status and mouse location. For the single-housing condition, this yielded a nest status accuracy of 0.95 across nesting conditions (0.94 for LBN and 0.94 for CTRL), meaning that the manually annotated nest status matched the automated assignments 95% of the time, and a mouse location error of 44.6 px, translating to roughly 1.08 cm in physical distance. For the paired-housing condition, we observed an accuracy of 0.92 across nesting conditions (0.93 for LBN and 0.89 for CTRL) and a mouse location error of 48.8 px (1.19 cm in physical distance). These values were deemed sufficient for the behavioral tracking analyses detailed in the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eParental identification from video\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe sex of the parental mice could not be determined with automated tracking. To fully assess maternal/paternal nest attendance (paired condition), sex was determined manually annotated from video fragments in which a single parent was on the nest (\u0026lsquo;single\u0026rsquo;). From P2-9, we annotated 20 randomly sampled \u0026lsquo;single\u0026rsquo; fragments with a duration of at least 15s/video to calculate maternal/paternal nest attendance for five litters. The \u0026lsquo;single\u0026rsquo; fragments were taken from 13-14 videos per litter (67 videos in total). Sex was determined by observing the genital area, nipples, and overall appearance and behavior (i.e. nursing position of the mother).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWhite adipose tissue (WAT) dissection\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP9 mice were euthanized and placed in ice-cold phosphate buffer (pH 7.4) supplemented with sucrose and 0.05% sodium azide. Due to the small size of the animals, dissections were performed under a stereomicroscope. WAT was isolated in a standardized manner by dissecting epididymal and subcutaneous depots. Tissues were carefully cleared of surrounding structures and weighed using a precision balance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLeptin administration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt P2, 4, 6 and 8 pups were s.c. injected with 80 ng/g b.w. of recombinant mouse leptin protein (Abcam, Cat# ab270069), this product has very low endotoxicity (\u0026lt;0.005 EU/\u0026micro;g endotoxin level).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNeutrophil depletion\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse pups were s.c. injected once at P2 with 25 ng of murinized anti-Ly6G [1A8] mouse IgG2a, kappa (Absolute Antibody, Cat# ab00295-2.0), to deplete neutrophils.\u003csup\u003e29\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorticosterone administration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThroughout the LBN period (P2-9), opaque drinking bottles were filled with either a vehicle (0.45% hydroxypropyl-\u0026beta;-cyclodextrin, Merck, Cat# 332593) or CORT (100 \u0026micro;g/mL, Merck, Cat# 2505 in vehicle) solution.\u003csup\u003e30\u003c/sup\u003e Solutions were replenished after 4 d.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMeasurements were made in blood plasma and in maternal milk.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eBlood was obtained via the trunk (P9) or by tail cut (adult mice), collected in an EDTA tube and centrifuged for 10 min at 4\u0026deg;C at 3,000 rpm to obtain blood plasma. Blood plasma was measured by ELISA kits for IL-6 (Abcam, Cat# ab100712), corticosterone (Enzo, Cat# adi-900-097), CXCL1 (Thermo Fisher, Cat# EMCXCL1), CXCL12 (BioLegend, Cat# 444207), G-CSF (Thermo Fisher, Cat# EMCSF3), leptin (Crystal Chem, Cat# 90030), prolactin (Invitrogen, Cat# EMPRL), MPO (Abcam, Cat# ab155458), MMP8 (Abcam, Cat# ab206982) and CRP (Abcam, Cat# 222511), according to manufacturer\u0026rsquo;s instructions. Maternal milk was obtained from the P9 pup stomach and stored at -80\u0026deg;C. Milk samples were thawed, diluted 1:2 in PBS with protease inhibitor (Roche, Cat# 11836170001) and dissolved using a potter and pestle. Measurements in milk were performed using ELISA kits for leptin and corticosterone, according to manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePeripheral glucose measurements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMorning blood glucose levels were measured at P9, straight after decapitation, using an electronic handheld glucometer (AccuChek, Roche). Three consecutive measurements of glucose were taken and averaged to ensure reliable values.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAutomated leukocyte cell counts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP9 trunk blood was collected in EDTA tubes, diluted 5x with 0.9% saline and measured for total leukocyte counts on an ADVIA 2129 hematology analyzer (Siemens Healthineers).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNeutrophil counts on blood smear\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA drop of blood was collected to create a blood smear. The smear was fixed (100% methanol for 5\u0026rsquo;), stained with May-Gr\u0026uuml;nwald (Merck, Cat# 1014240500, 1:1 in PBS), rinsed and stained with Giemsa (Merck, Cat# 1092040500, 1:9 in PBS, for 20\u0026rsquo;). In the monolayer of each smear 100 leukocytes were counted using light microscopy and percentages of neutrophils, monocytes, eosinophils, lymphocytes and basophils were determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNeutrophil segmentations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeutrophil nuclear segmentation was evaluated on May-Gr\u0026uuml;nwald\u0026ndash;Giemsa\u0026ndash;stained peripheral blood smears using a light microscope with a 63\u0026times; oil-immersion objective. In the monolayer region of each smear, 100 consecutive neutrophils were examined, and the number of nuclear segments (lobes) was recorded for each cell. A nuclear lobe was defined as a discrete mass of condensed chromatin connected to adjacent lobes only by a thin chromatin filament; deep but broad indentations without a thin chromatin bridge were not considered separate lobes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry for neutrophils in bone marrow\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eP9 pups were terminated by decapitation and bodies were fixed in 4% buffered formaldehyde (Klinipath, Cat# 4078.9020) for 48 h at 4\u0026deg;C. Following storage, bodies were placed in 15% sucrose + 0.05% sodium azide. Femurs were collected and paraffin embedded. P9 femurs were decalcified with 12.5% EDTA decalcifying solution. After 1 week, decalcified samples were rinsed twice with 70% ethanol rinse. Femurs were incubated o.n. at 70% ethanol and further dehydrated in ethanol. Tissues were cleared in xylene and embedded in paraffin. Paraffin blocks were sectioned at 5\u0026nbsp;mm thickness on a microtome. Slides were dried and fixed. Prior to immunohistochemical staining, sections were deparaffinized in xylene and 100% ethanol, rehydrated and rinsed in Milli-Q water. Sections were incubated in Tris/EDTA buffer (10 mM Trisbase, 1 mM EDTA, pH 9.0) for 5 min, followed by antigen retrieval in the same buffer at 80 \u0026deg;C for 40 min. After cooling, slides were washed in TBS-T (0.05 M, pH 7.6 + 0.05% Tween), and incubated with 5% Normal Mouse Serum (NMS) to block non-specific binding. Primary antibody incubation was performed for 1h using purified rat anti-mouse Ly6G antibody (BD Biosciences, Cat# 551459), diluted in TBS-T containing 5% BSA (Roche, Cat# 10735078001, 1:1,000). Following incubation, slides were washed and incubated with rabbit anti-rat IgG (H+L), biotinylated (Vector Labs, Cat# BA-4001, 1:500 in TBS-T + 1% BSA) for 30 min. After washing, BrightVision Poly-AP Goat anti-Rabbit reagent (Immunologic, Cat# DPV055-rHRP-mAP; undiluted) was applied for 30 min. Slides were washed and chromogen detection was performed using Liquid Permanent Red (LPR, Dako/Agilent, Cat# K0640). Counterstaining was performed with hematoxylin, followed by rinsing under running tap water for 5 min. Slides were dried on a heating plate and cover slipped. A negative control was obtained by omitting primary antibody.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBone marrow isolation and flow cytometric analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBone marrow (BM) was isolated from murine long bones immediately after sacrifice. Hind limbs were dissected and excess muscle tissue was removed. Bones were collected in RPMI 1640 medium (Thermo Fisher, Cat# 11875093) and maintained on ice until further processing. Both lower legs were used due to the fragility of femurs observed during optimization.\u003c/p\u003e\n\u003cp\u003eThe epiphyses were removed and BM was flushed from the bone cavity using RPMI 1640 medium with a 10 mL syringe fitted with a 25G needle. Flushed BM was collected into 50 mL tubes and passed through a 70 \u0026micro;m cell strainer to obtain a single-cell suspension, followed by rinsing with additional medium. Cells were centrifuged at 300 g for 5 min at 4\u0026deg;C, and the supernatant was discarded. Red blood cells were lysed using ammonium chloride-based lysis buffer for 5 min on ice, after which cells were diluted in RPMI 1640 supplemented with 10% fetal calf serum (FCS) and centrifuged again (300 g, 5 min, 4\u0026deg;C). The resulting cell pellet was resuspended in PBS and cell numbers were determined.\u003c/p\u003e\n\u003cp\u003eFor flow cytometry, BM cells were plated at approximately 5 \u0026times; 10⁵ cells per well in 96-well plates. Cells were washed with PBS and stained with a fixable viability dye (LIVE/DEAD\u003csup\u003eTM\u003c/sup\u003e Fixable Near IR, Thermo Fisher, Cat# L3476) for 30 min at 4\u0026deg;C. After washing, Fc receptors were blocked (rat anti-mouse CD16/CD32 Fc block, Invitrogen, Cat# 553142) and cells were stained with a panel of fluorochrome-conjugated antibodies targeting CD11b, CD3e, CD45 (Thermo Fisher, Cat# 364-0112-80, Cat# 53-0031-80, Cat# 25-0451-81, respectively), CD45R (Bio-Rad, Cat# MCA1258SBV610) and Ly6G (Miltenyi Biotec, Cat# 130-128-232) for 45 min at 4\u0026deg;C. Fluorescence minus one (FMO) controls and single-stained compensation controls were included.\u003c/p\u003e\n\u003cp\u003eFollowing staining, cells were washed, fixed (IC fixation buffer, Invitrogen, Cat# 00-8222-49), and resuspended in FACS buffer. Immediately prior to acquisition, samples were supplemented with Precision Counting Beads (BioLegend, Cat# 424902) to enable absolute quantification. Data were acquired on a CytoFLEX LX flow cytometer (Beckman Coulter), and compensation was performed using single-stained controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasuring oxidative burst from neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeutrophil isolation\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFresh isolated blood from P100 mice was lysed for 10 min using a Red Blood Cell Lysis Solution (Miltenyi Biotec, Cat# 130-094-183). Cells were pelleted, washed and neutrophils were isolated using a mouse Neutrophil Isolation Kit (Miltenyi Biotec, Cat# 130-097-658), according to manufacturer\u0026rsquo;s instructions. Isolated neutrophils were pelleted and resuspended in Krebs-Ringer Solution, HEPES-buffered (Thermo Fisher, J67795.AP) at a concentration of 5*10\u003csup\u003e5\u003c/sup\u003e neutrophils/mL and stored on ice until further use.\u003c/p\u003e\n\u003cp\u003eValidation of neutrophil isolation\u003c/p\u003e\n\u003cp\u003eNeutrophil isolation was verified by immunohistochemistry. One 20 \u0026micro;L drop of isolated neutrophil suspension was airdried before methanol fixation. Cells were permeabilized using 0.1% Triton X-100 in PBS, washed, and blocked for 1h using 2% BSA (Mitenyi Biotec, Cat# 130-091-376). Cells were incubated o.n. at 4\u0026deg;C with rabbit anti-Purified human granulocytic MPO (1:200, Thermo Fisher) and rat anti-Mouse Ly6G (1:200, BD Biosciences, Cat# 551459), diluted in 0.1% BSA. The next day, the cells were washed and incubated with goat IgG (H+L) anti-rabbit Alexa Fluor 594 (1:500, Thermo Fisher, Cat# A11012) and goat IgG (H+L) anti-rat Alexa Fluor 488 (1:500, Thermo Fisher, Cat# A11006) for 45 min. Cells were washed, rinsed, and nuclei were counterstained with DAPI. Immunofluorescent images were acquired using a ZEISS fluorescence microscope (Axiovision Z1) equipped with a 10x NA 0.3 objective and an AXIOCAM MRr camera. Purity of isolated neutrophil fraction was verified using a customized script in ImageJ to count the amount of Ly6G\u003csup\u003e+\u0026nbsp;\u003c/sup\u003ecells.\u003c/p\u003e\n\u003cp\u003eOxidative burst\u003c/p\u003e\n\u003cp\u003eNeutrophil H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e production was measured under baseline conditions and after \u0026nbsp; stimulation using Amplex\u0026trade; UltraRed (Thermo Fisher, Cat# A36006), as before.\u003csup\u003e31\u003c/sup\u003e Amplex UltraRed acts as a fluorogenic substrate for HRP that reacts with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in a 1:1 stoichiometric ratio to produce fluorescent Amplex UltraRed (Ex/Em 568/581 nm). A reaction mixture containing 50 \u0026micro;M Amplex\u0026trade; UltraRed and 0.1U/mL Pierce\u0026trade; Horseradish Peroxidase (Thermo Fisher, Cat# 31491) was made in HEPES-buffered Krebs-Ringer Solution (Thermo Fisher, Cat# J67795.AP). To stimulate the neutrophils, 100 nM Phorbol 12-myristate 13-acetate, 95% (PMA, Thermo Fisher, Cat# J63916.MCR) was added to the reaction mixture. Wells (Microplate, Corning, Cat# 353376) were filled with 100 \u0026micro;L reaction mixture and prewarmed at 37\u0026deg;C for 10 min. To start the reaction, 20 \u0026micro;L of the isolated neutrophil suspension, containing 1*10\u003csup\u003e4\u0026nbsp;\u003c/sup\u003eneutrophils, was added to each well. Accumulation of fluorescent Amplex UltraRed was measured at an excitation wavelength of 530 nm and an emission wavelength of 590 nm for 29 min at 1 cycle per minute using a preheated CLARIOstar Plus (BMG Labtech; Ortenberg, Germany). Fresh H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was used to generate a standard curve.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from hypothalamus samples using TRIzol Reagent (Thermo Fisher, Cat# 15596018) according to manufacturer\u0026rsquo;s instructions, and 500 ng RNA was reverse-transcribed to cDNA using iScript\u0026trade; Reverse Transcription Supermix (Bio-Rad, \u0026nbsp;Cat# 1708841) according to manufacturer\u0026rsquo;s instructions. RT-qPCR was performed using the below specified primers and iQ SYBR Green Supermix (Bio-Rad, Cat# 1708880) in a CFX Opus 96 Real-Time PCR System (Bio-Rad). The cycling program consisted of 3 min denaturation at 95\u0026deg;C, followed by 39 cycles of 95\u0026deg;C for 10 s and 60\u0026deg;C for 30 s. Melt curve analysis was performed between 65\u0026deg;C and 95\u0026deg;C using 0.5\u0026deg;C step increases with a 5 s hold at each step. Primer specificity for each target gene was validated by test RT-qPCR followed by agarose gel electrophoresis prior to these experiments. Cq values of target genes were normalized to the mean of \u003cem\u003ehypoxanthine phosphoribosyltransferase 1\u003c/em\u003e (\u003cem\u003eHPRT\u003c/em\u003e), \u003cem\u003ebeta-2 microglobulin\u003c/em\u003e (\u003cem\u003eB2M\u003c/em\u003e) and \u003cem\u003ebeta-actin\u003c/em\u003e (\u003cem\u003eActB\u003c/em\u003e). Relative gene expression was calculated using the 2\u003csup\u003e\u0026minus;\u003c/sup\u003e\u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003e\u003csup\u003eCq\u003c/sup\u003e method. Primers sequences used are: \u003cem\u003eHRPT\u003c/em\u003e (Fwd: TCCTCCTCAGACCGCTTTT, Rev: CCTGGTTCATCATCGCTAATC), \u003cem\u003eB2M\u0026nbsp;\u003c/em\u003e(Fwd: ATTCACCCCCACTGAGACTG, Rev: TGCTATTTCTTTCTGCGTGC), \u003cem\u003eActb\u003c/em\u003e (Fwd: AGAGGGAAATCGTGCGTGAC, Rev: CAATAGTGATGACCTGGCCGT). \u003cem\u003eNpy\u0026nbsp;\u003c/em\u003e(Fwd: TCGCTCTATCTCTGCTCGTG, Rev: TGTCTCAGGGCTGGATCTCTT).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOpen Field test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were tested at 8 weeks of age. The open field consisted of a circular arena (diameter 78 cm) that was illuminated with dimmed lights (55 lx). Mice were introduced near the wall of the arena and allowed to explore for 10 min. Locomotor activity was analyzed during the open field test using EthoVision (Version XT, Noldus, The Netherlands).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData, statistical analyses, and reproducibility\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were randomized and blinded by an independent researcher. Researchers remained blinded during histological, biochemical or behavioral assessments. Data are expressed as mean \u0026plusmn; s.e.m. Data were tested for normality and statistical tests were adjusted accordingly. Statistical analyses were performed using Prism 10 (GraphPad). Statistical tests, and additional details, are indicated in the figure legends. \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank D. Evertse, B.A. Hendriks, R. Koot, M. Nederhof, M. Nijenhuis, M.L. van de Grint, and T. van Eldik for technical assistance. This publication is part of the project Dutch Brain Interface Initiative (DBI2) with project number 024.005.022 of the research programme Gravitation, which is financed by the Dutch Ministry of Education, Culture and Science (OCW) via the Dutch Research Council (NWO). This work was partly funded by a grant from Child Health (UMC Utrecht) and Dynamics of Youth (University Utrecht) to MAK. The funders had no role in study design, data collection, analysis, or decision to publish. Figures 1A, 4A, 5A, 5D and Figure S12 were created using BioRender.com.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, MAK ; formal analysis, ELS, NVV, MJH, CSDP, MZ, MAK ; funding acquisition, MAK; investigation, ELS, NVV, MJH, CSDP, SAML, MZ, NM, CM, ST, MAK; methodology, ELS, NVV, MJH, CM, LW, MAK; supervision, MAK, OP, CGJC ; visualization, MAK; writing \u0026ndash; original draft, MAK; writing \u0026ndash; review and editing, ELS, OP, LW, CGJC, MAK. \u003cstrong\u003e\u003cbr clear=\"all\"\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDECLARATION OF INTERESTS\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMAK serves as an Associate Editor for Heliyon. The authors declare no other competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRESOURCE AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLead Contact\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFurther information and requests for resources should be directed to and will be fulfilled by the lead contact, Michael A. van der Kooij ([email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterial Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not generate new unique reagents.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and Code Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe tracking algorithms were tailored to our dataset; all analysis scripts will be made publicly available upon publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBale TL, Baram TZ, Brown AS, Goldstein JM, Insel TR, McCarthy MM, Nemeroff CB, Reyes TM, Simerly RB, Susser ES, Nestler EJ (2010) Early life programming and neurodevelopmental disorders. Biol Psychiatry 68:314\u0026ndash;319\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCurley JP, Champagne FA (2016) Influence of maternal care on the developing brain: mechanisms, temporal dynamics and sensitive periods. Front Neuroendocrinol 40:52\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaumeister D, Akhtar R, Ciufolini S, Pariante CM, Mondelli V (2016) Childhood trauma and adulthood inflammation: a meta-analysis of peripheral C-reactive protein, interleukin-6 and tumour necrosis factor-α. Mol Psychiatry 21:642\u0026ndash;649\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanese A, Baldwin JR (2017) Hidden wounds? Inflammatory links between childhood trauma and psychopathology. Annu Rev Psychol 68:517\u0026ndash;544\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller GE, Chen E, Parker KJ (2011) Psychological stress in childhood and susceptibility to the chronic diseases of aging: moving toward a model of behavioral and biological mechanisms. Psychol Bull 137:959\u0026ndash;997\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker CD, Bath KG, Joels M, Korosi A, Larauche M, Lucassen PJ, Morris MJ, Raineki C, Roth TL, Sullivan RM, Tach\u0026eacute; Y, Baram TZ (2017) Chronic early life stress induced by limited bedding and nesting (LBN) material in rodents: critical considerations of methodology, outcomes and translational potential. Stress 20:421\u0026ndash;448\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRice CJ, Sandman CA, Lenjavi MR, Baram TZ (2008) A novel mouse model for acute and long-lasting consequences of early life stress. Endocrinology 149:4892\u0026ndash;4900\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacDowell Kaswan ZA, Bowers C, Teplyakov I, Sibtain A, Munoz-Martin J, Ahmed S, Kaffman L, Giuliano L, Dietrich MO, Kaffman A (2025) Erratic maternal care induces avoidant-like attachment deficits in a mouse model of early life adversity. eNeuro 12: ENEURO.0249-25.2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuncker HG, Jakobsen PR, Naninck EFG, Davids M, Herrema H, van Goudoever JB, de Rooij SR, Korosi A (2025) Maternal stress in the early postpartum period is associated with alterations in human milk microbiome composition. Brain Behav Immun 124:74\u0026ndash;84\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBouret SG, Draper SJ, Simerly RB (2004) Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304:108\u0026ndash;110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHunsche C, Hernandez O, Mela V, Viveros MP, De la Fuente M (2022) The postnatal leptin surge supports immune cell function in rats. Immunol Invest 51:1347\u0026ndash;1363\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasabiell X, Pi\u0026ntilde;eiro V, Tom\u0026eacute; MA, Pein\u0026oacute; R, Di\u0026eacute;guez C, Casanueva FF (1997) Presence of leptin in colostrum and/or breast milk from lactating mothers: a potential role in the regulation of neonatal food intake. J Clin Endocrinol Metab 82:4270\u0026ndash;4273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYam KY, Naninck EFG, Abbink MR, la Fleur SE, Schipper L, van den Beukel JC, Grefhorst A, Oosting A, van der Beek EM, Lucassen PJ, Korosi A (2017) Exposure to chronic early-life stress lastingly alters the adipose tissue, the leptin system and changes the vulnerability to western-style diet later in life in mice. Psychoneuroendocrinology 77:186\u0026ndash;195\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvertse D, Sommer EL, Markus N, van der Jagt M, Hendrik BA, van de Grint ML, van der Kooij MA (2026) Early life stress in mice disrupts blood-brain barrier function and reduces claudin-5 expression in the lateral septum and striatum, with linked behavioral impairments. Brain Behav Immun 135:106530\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDexter BC, Rahmouni K, Cushman T, Hermann GM, Ni C, Nopoulos PC, Thedens DL, Roghair RD (2014) Neonatal leptin deficiency reduces frontal cortex volumes and programs adult hyperactivity in mice. Behav Brain Res 263:115\u0026ndash;121\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKiernan K, MacIver NJ (2021) The role of the adipokine leptin in immune cell function in health and disease. Front Immunol 11:622468\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallo S, Shleifer DG, Godoy L, Ofray D, Olaniyan A, Campbell T, Bath KG (2019) Limited bedding and nesting induces maternal behavior resembling both hypervigilance and abuse. Front Behav Neurosci 13:167\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTreccani G, Yigit H, Lingner T, Schleuβner V, Mey F, van der Kooij MA, Wennstr\u0026ouml;m M, Herzog DP, Linke M, Fricke M, Schmeisser MJ, Wegener G, Mittmann T, Trotter J, M\u0026uuml;ller MB (2021) Early life adversity targets the transcriptional signature of hippocampal NG2\u0026thinsp;+\u0026thinsp;glia and affects voltage gated sodium (Na\u003csub\u003ev\u003c/sub\u003e) channels properties. Neurobiol Stress 15:100338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann A, Ebert T, Kl\u0026ouml;ting N, Kolb M, Gericke M, Jeromin F, Jessnitzer B, L\u0026ouml;ssner U, Burkhardt R, Stumvoll M, Fasshauer M, Kralish S (2019) Leptin decreases circulating inflammatory IL-6 and MCP-1 in mice. BioFactors 45:43\u0026ndash;48\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlorentin J, Zhao J, Tai Y, Babu Vasamsetti S, O\u0026rsquo;Neil SP, Kumar R, Arunkumar A, Watson A, Sembrat J, Bullock GC, Sanders L, Kassa B, Rojas M, Graham BB, Chan SY, Dutta P (2021) Interleukin-6 mediates neutrophil mobilization from bone marrow in pulmonary hypertension. Cell Mol Immunol 18:374\u0026ndash;384\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeery AK, Kaufer D (2015) Stress, social behavior, and resilience: insights from rodents. Neurobiol Stress 1:116\u0026ndash;127\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStagkourakis S, Smiley KO, Williams P, Kakadellis S, Ziegler K, Bakker J, Brown RSE, Harkany T, Grattan DR, Broberger C (2020) A neuro-hormonal circuit for paternal behavior controlled by a hypothalamic network oscillation. Cell 182:960\u0026ndash;975\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLibhaber N, Eilam D (2002) Social vole parents force their mates to baby-sit. Dev Psychobiol 41:236\u0026ndash;240\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDade TW, Metzger MW, Chyu L, Duncan GJ, Garfield C, Adam EK (2014) Long-term effects of birth weight and breastfeeding duration on inflammation in early adulthood. Proc Biol Sci 281:20133116\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTen Barge JA, Meesters NJ, Benders M, van Kaam AH, van Zelst BD, van Zanten H, van Ganzewinkel CJ, Tataranno ML, Schuerman FABA, van den Akker CHP, Raets MMA, de Boode WP, Dijk PH, Muller KS, Reiss IKM, van den Berg SAA, Simons SHP, van den Bosch GE (2026) Stress exposure, stress responses, and short-term outcomes in very preterm neonates: a national cohort study. Eur J Pediatr 185:129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBielicki J, Huch R, von Mandach U (2004) Time-course of leptin levels in term and preterm human milk. J Endocrinol 151:271\u0026ndash;276\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMathis A, Mamidanna P, Cury KM, Abe T, Murthy VN, Mathis MW, Bethge M (2018) DeepLabCut: markerless pose estimation of user-defined body parts with deep learning. Nat Neurosci 21:1281\u0026ndash;1289\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLauer J, Zhou M, Ye S, Menegas W, Schneider S, Nath T, Rahman MM, Di Santo V, Soberanes D, Feng G, Murthy VN, Lauder G, Dulac C, Mathis MW, Mathis A (2022) Multi-animal pose estimation, identification and tracking with DeepLabCut. Nat Methods 19:496\u0026ndash;504\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlofsen PA, Stip MC, Jansen JHM, Chan C, Nederend M, Tieland RG, Tsioumpekou M, Leusen JHW (2022) Effective, long-term, neutrophil depletion using a murinized anti-Ly-6G 1A8 antibody. Cells 11:3406\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvertse D, Alves-Martinez P, Treccani G, M\u0026uuml;ller MB, Meye FJ, van der Kooij MA (2024) Transient impact of chronic social stress on effort-based reward motivation in non-food restricted mice: involvement of corticosterone. Neurobiol Stress 33:100690\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohanty JG, Jaffe JS, Schulman ES, Raible DG (1997) A highly sensitive fluorescent micro-assay of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e release from activated human leukocytes using a dihydroxyphenoxazine derivative. J Immunol Methods 202:133\u0026ndash;141\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Early-life stress, maternal milk, leptin, neutrophils, paternal care","lastPublishedDoi":"10.21203/rs.3.rs-9587229/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9587229/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEarly-life stress (ELS) leaves a persistent inflammatory imprint, but how parental physiology shapes offspring immune development remains unclear. Using the limited bedding and nesting (LBN) mouse model of ELS, we show that maternal stress alters offspring immune homeostasis through changes in maternal milk composition, rather than reduced maternal care. Maternal stress decreases leptin levels in milk and pup circulation, blunting the neonatal leptin surge and leading to persistent neutrophilia and altered neutrophil function. Glucocorticoid administration to dams lowers pup plasma leptin and recapitulates the endocrine and immunological phenotype of LBN, without reproducing the associated maternal changes in behavior. Conversely, leptin administration to pups restores immune homeostasis, while biparental care normalizes maternal stress physiology, restores leptin levels and prevents offspring neutrophilia. These findings identify maternal milk leptin as a key mediator linking maternal stress to innate immune programming and provide a mechanism by which ELS shapes long-term inflammatory tone.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e*Ella L. Sommer \u0026amp; Niilo V. Valtakari contributed equally.\u003c/strong\u003e\u003c/p\u003e","manuscriptTitle":"Maternal stress shapes offspring innate immunity via milk leptin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-12 17:19:34","doi":"10.21203/rs.3.rs-9587229/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b8ad79f8-db9f-4cc4-b0cc-11bf6c8e734b","owner":[],"postedDate":"May 12th, 2026","published":true,"recentEditorialEvents":[{"type":"editorAssigned","content":"","date":"2026-05-04T08:31:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-01T20:55:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Nature Communications","date":"2026-05-01T15:04:59+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":67465301,"name":"Biological sciences/Immunology/Innate immunity"},{"id":67465302,"name":"Biological sciences/Developmental biology/Experimental organisms/Model vertebrates/Mouse"},{"id":67465303,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2026-05-12T17:19:34+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-12 17:19:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9587229","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9587229","identity":"rs-9587229","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0