Discovery and structural characterization of chicoric acid as a SARS-CoV-2 nucleocapsid protein ligand and RNA binding disruptor

Discovery and structural characterization of chicoric acid as a SARS-CoV-2 nucleocapsid protein ligand and RNA binding disruptor | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Discovery and structural characterization of chicoric acid as a SARS-CoV-2 nucleocapsid protein ligand and RNA binding disruptor Gustavo Mercaldi, Eduardo Bezerra, Fernanda Aparecida Batista, and 22 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1720953/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract The nucleocapsid (N) protein plays critical roles in coronavirus genome transcription and packaging, representing a key target for the development of novel antivirals, and for which structural information on ligand binding is scarce. We used a novel fluorescence polarization assay to identify small molecules that disrupt the binding of the N protein to a target RNA derived from the SARS-CoV-2 genome packaging signal. Several phenolic compounds, including L-chicoric acid (CA), were identified as high-affinity N-protein ligands. The binding of CA to the N protein was confirmed by isothermal titration calorimetry, 1 H-STD NMR, and by the crystal structure of CA bound to the N protein C-terminal domain (CTD), further revealing a new modulatory site in the SARS-CoV-2 N protein. Moreover, CA reduced SARS-CoV-2 replication in cell cultures. These data thus open venues for the development of new antivirals targeting the N protein, an essential and yet underexplored coronavirus target. Nucleocapsid protein SARS-CoV-2 packaging signal chicoric acid phenolic acids protein-RNA disruptors HTS antivirals Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The historic COVID-19 pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has caused millions of deaths worldwide and affected the world’s economy in an unprecedented way 1 , 2 . Despite the enormous efforts of the scientific and medical community to find drugs to fight the disease since its emergence in late 2019, only three small molecule drugs are currently authorized for clinical use. Remdesivir 3 and Molnupiravir 4 are nucleoside analogues with limited efficacy 5 , whereas Nirmatrelvir 6 , a peptide inhibitor of the 3CL protease, developed by Pfizer, is used in combination with Ritonavir and sold under the brand name Paxlovid™. Although these are promising drugs, kidney and liver toxicity and the potential incompatibility of the Paxlovid combination with other drugs may limit their use to the broad population 7 . Moreover, the continued emergence of new, more contagious SARS-CoV-2 variants challenges the efficacy of vaccines currently in use 8 . Therefore, the development of new and specific drugs capable of treating SARS-CoV-2 infections is still an urgent medical need. To accelerate the discovery of novel anti-SARS-CoV-2 drug candidates, as well as the repurposing of existing drugs, several high-throughput screening (HTS) campaigns have been performed in the last two years. Such assays have explored the biological activities of several SARS-CoV-2 proteins, including the main 3C-like (3C-L) and papain-like (PL-Pro) proteases, the RNA polymerase and the spike (S) and envelope (E) structural proteins 9 – 14 . In addition, numerous cell-based screening assays with SARS-CoV-2 have also been recently reported 12,15−18 . Unlike the S and E proteins, however, the structural nucleocapsid (N) protein, the most abundantly expressed SARS-CoV-2 protein in infected cells, has not been fully exploited as a target for drug development against SARS-CoV-2 19 . The N protein is a phosphoprotein that plays fundamental roles in the virus life cycle, including transcription initiation and packaging of the viral genomic RNA 20 . This protein has a domain architecture comprising two structured RNA-binding modules, the N-terminal (NTD) and C-terminal (CTD) domains, connected by an intrinsically disordered serine and arginine-rich (SR) linker 21 – 23 . The NTD is implicated in the binding and melting of regulatory elements required for transcription initiation 24 , 25 , whereas the CTD drives protein dimerization and is thought to bind the RNA packaging signal (PS) during virus particle assembly 22 , 26 , 27 . Phosphorylation of the SR linker by host cell kinases, on the other hand, has been shown to modulate the RNA-binding activity of the protein and lead to liquid-liquid phase separation with the viral RNA 26 – 29 . Thus, given its importance in the various stages of the virus replication cycle, the N protein is considered a promising target for the development of SARS-CoV-2 replication inhibitors. We report here a novel fluorescence polarization-based HTS assay to identify small molecules that can disrupt the interaction of the N protein with an RNA probe derived from the putative SARS-CoV-2 PS sequence. After screening a customized compound library of approximately 3200 bioactive compounds, several phenolic compounds, including L-chicoric acid (CA), showing IC 50 values for RNA probe displacement in the low to sub-micromolar ranges, were identified as potential N protein ligands. Complementary orthogonal biophysical methods, including isothermal titration calorimetry (ITC) and 1 H-saturation transfer difference (STD) NMR further revealed that CA binds to the CTD. This was confirmed by the crystal structure of the CTD in complex with CA, determined at 1.7 Å resolution, which represents the first CTD structure bound to a small molecule. In addition, we show that CA inhibited SARS-CoV-2 replication in human lung cells, further suggesting that it may influence N protein-mediated RNA packing in vivo . Taken together, our data provide the first evidence of pharmacologically targeting the SARS-CoV-2 N protein with small molecules, thus paving the way for the rational design of new N protein modulators. Results Development of an HTS assay to find small molecules capable of inhibiting the RNA-binding activity of the N protein In order to establish an assay for the identification of potential inhibitors of the N protein RNA-binding activity, we first searched for an N protein target RNA, and the SARS-CoV-2 PS sequence was a candidate. The putative PS of the SARS-CoV-2/SP02/human/2020/BRA strain (nucleotides 19785-20364) was identified by sequence alignment to the SARS-CoV and MERS-CoV PS sequences 30,31 . Within this sequence, we selected the CACUCACUGUCUUUUUUGAUGGUAGAGU stem loop (RNA1) as an N protein target (Figure 1A) because this stem loop is conserved in all SARS-CoV-2 genomes and has an invariable ‘UUUUUU’ motif at the loop. The RNA-binding activity of the N protein was monitored by a fluorescence polarization (FP) assay using distinct 5’-FITC-labeled RNAs as probes. In addition to RNA1, four other probes were tested (Figure 1A). In the RNA2 probe (CACUCACUGUCAAAAAAGAUGGUAGAGU) the ‘UUUUUU’ motif was replaced by ‘AAAAAA’, whereas in RNA3 (CACUCACUGUCUUUUUU), the stem loop 5’ arm was deleted. RNA4 (CACUCACUGUC) also lacked the ‘UUUUUU’ motif, while RNA5 (AUAUAGCUAC) served as a scramble negative control (Figure 1A). As shown in Figure 1B, optimum binding was observed with the RNA probes 1 and 3 (K D = 124.2 ± 6.5 and 148.6 ± 7.1 nM), respectively, suggesting that the ‘UUUUUU’ motif, but not the hairpin structure, is critical for the interaction with the N protein. Therefore, RNA1 was chosen for the establishment of the protein-RNA dissociation assay used in our HTS trials. HTS campaigns reveal polyphenols as privileged scaffolds that disrupt the binding of the N protein to the target RNA Following the identification of RNA1 as a high-affinity N protein-binding probe, an FP assay was developed. After checking the assay performance under the screening conditions (Figure S1A), we conducted an HTS campaign testing a library of ~3200 approved drugs and bioactive molecules (Figure 1C). Differential values of approximately 170 mP were observed between the positive and negative controls (Figure S1B), resulting in Z’ scores greater than 0.7 for all tested plates (Figure 1D). Thus, the robustness of the HTS assay allowed us to reliably select hit candidates for concentration-response follow-up experiments. The first criterium for selecting hit candidates from the primary screening was to choose small molecules that reduced the binding of the N protein to RNA1 to less than 30% (Figure 1C), which resulted in a list of 78 compounds. From this preliminary list, 33 compounds were flagged due to autofluorescence, interference with the fluorescence or polarization of the free probe. These criteria led us to select 45 hit candidates, representing an overall hit rate of 1.4%. To confirm the activity of the hit candidates as inhibitors of the N protein-RNA1 interaction, the selected compounds were subjected to concentration-response experiments and 44 of them had their inhibitory activity confirmed (Table 1). Table 1 . List of selected hit molecules retrieved from the HTS campaign as potential N-protein ligands. Compounds are ranked by their IC 50 values for blocking the N protein-RNA1 interaction. Phenyl propanoids with dicaffeoyl motif are highlighted in bold. Compound IC 50 (µM) +Error* -Error* Chebulinic acid 0.2 0.0 0.0 L-Chicoric acid 0.5 0.1 0.1 Punicalagin 0.7 0.1 0.0 Punicalin 0.7 0.1 0.1 Suramin 0.8 0.1 0.1 Tannic acid 1.4 0.2 0.2 Chlorophyllin B 2.2 0.2 0.3 Corilagin 2.4 0.5 0.4 4,5-Dicaffeoylquinic acid 3.0 0.5 0.3 Methyl Blue 4.2 0.3 0.3 Embelin 5.0 0.9 0.7 Linaclotide 5.5 0.6 0.5 Isochlorogenic acid A 5.5 1.0 0.8 Sennoside A 5.7 0.8 0.7 Lusutrombopag 6.0 0.6 0.5 (R)-(-)-Gossypol acetic acid 6.4 0.4 0.4 Idasanutlin 6.5 0.7 0.6 Sulfamerazine 6.5 0.9 0.8 Eltrombopag 7.1 0.9 0.9 Gossypol acetic acid 7.1 0.5 0.4 IOWH-032 7.7 0.9 0.8 Anacardic Acid 7.7 0.9 0.7 Pranlukast (hemihydrate) 7.8 1.1 1.0 Eltrombopag 8.1 1.0 0.9 Succinobucol 8.1 0.6 0.5 RNPA1000 9.6 1.8 1.4 TMC647055 10.0 1.2 1.0 Montelukast 10.3 1.1 1.0 Micafungin 10.4 0.9 0.8 Zafirlukast 10.4 1.6 1.4 Resazurin 10.5 1.7 1.4 Verteporfin 10.8 3.4 2.6 Chlorophyllin A 10.8 1.2 1.0 Surfactin 11.1 1.5 1.3 Pentagalloylglucose 11.6 1.9 1.7 Hexachlorophene 13.0 1.6 1.3 Ertapenem sodium 13.8 1.4 1.3 MK 0893 14.4 1.1 0,9 Butenafine 15.7 1.3 1.2 Oleic acid 15.7 0.9 0.8 Simeprevir 16.5 0.9 0.9 Sofalcone 18.5 1.6 1.5 Bithionol 23.0 5.6 4.6 Gallic acid 23.3 3.3 2.9 *Reported errors are deviation from mean value for upper (+Error) and lower (-Error) limits of 95 % confidence intervals Many of the compounds that impaired the binding of the N protein to RNA1 are highly polar. Chebulinic acid (CI), CA, punicalagin (PG), punicalin (PL) and suramin (SU) are submicromolar N protein-RNA1 disruptors (Figure 2). When the N protein was titrated against RNA1 in the presence of CI, CA or PG, we observed that the binding affinity of the N protein to RNA1 was significantly reduced, as revealed by the higher K D values (Figure S2A), indicating that these compounds inhibit the formation of the N protein-RNA1 complex. CA binds the CTD and promotes dissociation of the N protein-RNA1 complex Because caffeic acid derivatives have been recently described as potential inhibitors of SARS-CoV-2 infection 32 and CA exhibits antiviral activity against HIV and hepatitis B virus (HBV) 33–35 , we decided to further investigate the properties of CA as an N protein ligand. First, the binding affinity of CA for the N protein was determined by ITC, which provided the thermodynamic signature of binding, including K D , stoichiometry and both the enthalpic and entropic contributions. The results confirmed that CA binds to the N protein with a K D of 250 ± 7.9 nM at a protein:ligand ratio of 2:1 (Figure 3A), this ratio indicating that there is one CA site per N protein dimer. In addition, the ITC results suggested that the CA binding to the N protein is enthalpy driven. Given that CA binds to the N protein at nanomolar concentrations, we decided to investigate whether CA could dissociate the N protein-RNA1 complex. In line with the results shown in Figure S2A, we found that CA promoted the dissociation of previously formed N protein-RNA1 complex with a K D value of 41.1 ± 11.7 µM (Figure 3B). Although this dissociation constant is much higher than the K D for the CA-N protein interaction, the results are consistent with the fact that RNA1 has a higher binding affinity for the N protein than CA (Figure 1B). Finally, the interaction of CA with the N protein was examined by the 1 H-STD NMR technique, which allows the identification of the binding epitopes of a ligand when bound to a receptor protein. The results confirmed that CA produces clear STD signals which were mapped to its chemical structure (Figure 3C). Judging by the signal intensity, hydrogen H1 (100% intensity), in CA’s tartaric acid unit, appears to be the most directly involved in N protein binding and thus in closer contact with the protein. In comparison, the H2, H3, H4, H7 and H8 hydrogens, which form the dicaffeoyl units, showed STD signal intensities varying from 70 to 90% (Figure 3C). Importantly, we found that the STD signals were observed with the full-length protein and CTD, but not with the NTD. This suggests the CA-binding site is located on the CTD of N protein. Together, these results show that CA is a nanomolar N-protein affinity ligand that binds to the CTD and displaces the RNA from the N protein at micromolar concentrations. The binding mode of CA to the CTD and structural consequences for N protein function To gain insights into the binding mode of CA to the N protein, we determined the crystal structure of the CTD in complex with this ligand. CTD crystals belonged to the space group P 2 1 2 1 2 1 , with Matthews coefficient 36 of 2.20 Å 3 Da −1 and solvent content of 44.2%. Datasets for the CTD alone (apo CTD – PDB entry: 7UXX) and in complex with CA (CTD-CA – PDB entry: 7UXZ) were scaled to resolutions of 1.85 and 1.73 Å, respectively. The phases were recovered by molecular replacement, using a previously described SARS-CoV-2 CTD crystal structure (PDB code: 7C22) as the search model 37 . The models were refined to R work /R free values of 17.2 / 20.3% (apo CTD) and 17.4 / 21.5% (CTD-CA). Data collection and refinement statistics are summarized in Table S1. Six molecules organized as three dimers were found in the asymmetric unit of the CTD. Each protomer in the structures is comprised of five α-helices, two 3 10 (η) helices and two antiparallel β-strands (Figure 4A). As reported previously 37 , the CTD dimer is stabilized by extensive hydrogen bonds connecting the β2 strands and the interaction of residues from the loop between α-helices 1-2 (Arg277, Gly278, Glu280, Gln283 and Asn285). β-strand 1 and α-helix 4 (Gly316, Arg319 and Ile320) also play an essential role in stabilizing the dimer. In addition, the β-hairpins (Leu331 – Leu339), α-helices 3-4 (Ile304, Ala305, Phe314 and Phen315) and α-helix 5 (Phe346 – Leu353) form a hydrophobic core stabilized by Van der Waals interactions across the amino acid side chains. CA binds to a shallow pocket (volume of ~190 A 3 ) formed between α-helices 1-2 and η-helix 2, close to the C-terminus (Figure 4B). In accordance to the ITC data, only one CA molecule bound to one of the CTD protomers was unambiguously found by inspecting the 2 F o - F c electron-density map. Nevertheless, this map only partially covers the CA aromatic ring most exposed to solvent (Figure 4B). A close inspection of the structural complex shows that the binding of CA to the CTD is stabilized mainly by polar contacts of the carboxylate and carbonyl groups from CA’s tartarate and caffeoyl units, involving Arg276/Arg277 and three structural water molecules (Figure 4C). The structure of the complex also shows one CA catechol ring laid inside a hydrophobic canyon formed by η-helix 2, α-helix 2 and the last two C-terminus residues (Phe363 and Pro364). When the apo and complexed structures were superposed, we observed no significant changes in the overall structures, as judged by the Cα RMSD (0.19 Å deviation). However, we noticed clear conformational changes in the side chains of Phe363, Pro364, Gln289 and Arg276, which contributed to the widening of the CA pocket (Figure 4D and Figure 4E). Arg276 had moved outwards, positioning its guanidine group at ideal distances to form electrostatic (NH1) and water-mediated (NH2) hydrogen-bond interactions with CA’s carboxylate group. Arg277’s main chain amine was already at ideal distances to engage in a hydrogen bond with CA’s other carboxylate group. Arg277 N ε atom could further form a water-bridged hydrogen bond with Thr271 (Figure 4D), which might probably contribute to stabilizing the polar contact network within the CA-N protein binding site. The catechol ring was also predicted to be important in ligand binding, since Gln289’s polar side chain was turned outwards the pocket, exposing its aliphatic region to the apolar pocket formed by Pro364, Phe363, thus favouring the accommodation of one of CA’s catechol rings, which in turn showed clear electron density (Figure 4E). The CTD structure in its apo form shows an electrostatic potential distribution that is conserved amongst all N proteins from the Coronaviridae family 21,37 , with a major positively charged groove located on one side of the dimer surface (Figure 5A). This region, which is composed by Lys256, Lys257, Lys259 Lys261 and Arg262, is thought to contribute to RNA binding 38–40 . We observed that the positively charged groove extended towards the CA-binding pocket through Arg259, Arg276, Arg277 and Arg293 (Figure 5B). Notably, the binding of CA to the CTD not only changes the topology of this region, but also disrupts the continuity of such potential RNA-binding region, with the possibility to affect N protein binding to RNA in a direct (Figure 5C) or indirect way (Figure 5D). CA displays anti-SARS-CoV-2 activity in in vitro cell assays After confirming CA as an N protein ligand with potential implication on its RNA binding function, we tested if CA could inhibit SARS-CoV-2 infection in vitro . For this, Calu-3 and Vero CCL81 cells were seeded into 24-well plates at 2x10 5 and 2.5x10 5 cells/well, respectively, and infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 1. CA was added to the cell culture medium after infection at 25 and 100 µM final concentrations, whereas DMSO at 0.2% was used as a vehicle control. Assessment of the viral load in the cell culture supernatants collected 48 h post-infection indicated that CA presented antiviral activity at 100 µM only, relative to untreated (vehicle) control. CA treatment caused 10-fold and 100-fold reductions in infectious viral load in Vero CCL81 (p<0.001 - Figure 6A) and Calu-3 (p<0.01 - Figure 6B), respectively. Both cell lines remained viable when treated with CA or DMSO at the tested concentrations (Figure S3). In addition, CA displayed only a slight virucidal activity against SARS-CoV-2 (p<0.05 - Figure 6C), indicating that the observed antiviral effect of CA cannot be attributed to direct action on viral particles. These results thus show that CA inhibits SARS-CoV-2 replication in cell culture at micromolar concentrations, which is consistent with the K D values for the N protein-RNA1 complex dissociation (Figure 4B). Discussion Despite the great success of newly developed vaccines to prevent contagion and severe forms of infection by SARS-CoV-2, infections are still present, and new waves of contamination by viral variants are recurrent. In this sense, antiviral drugs are needed to improve patient recovery and to prevent disease progression, especially to at-risk patients. The development of such antiviral drugs, in many cases, requires knowledge of the structure and function of potential viral targets and the discovery and characterization of small-molecule modulatory binding sites in these proteins, that afford for structure-based drug design (SBDD) approaches 41 . In this work, we describe a novel fluorescence-based high-throughput screening assay that allows the identification of small molecules that interfere with the RNA-binding activity of the SARS-CoV-2 N protein, the most abundant viral protein expressed in host cells, and which plays fundamental roles in transcriptional regulation and virus assembly 20 – 29 . We further characterized the top hits using a cascade of biophysical assays, and solved, for the first time, the crystal structure of the N protein CTD binding a non-endogenous ligand, chicoric acid, further revealing a new modulatory site in the SARS-CoV-2 N protein. By screening a customized library of bioactive small molecules (Fig. 1 ), highly polar compounds stood out, highlighting polyphenols (ellagitannins, CI, PG and PL), a diester of tartaric acid (chicoric acid, CA) and a polysulphonated naphthylurea (suramin, SUR) – Fig. 2 . The latter compounds were capable of disrupting the interaction of the full-length SARS-CoV-2 N protein with an RNA probe derived from the SARS-CoV-2 PS sequence (RNA1) in the submicromolar range (Figure S2). In accordance with the literature, the antiparasitic drug suramin is reported to inhibit SARS-CoV-2 infection in cell culture at 20 µM, by interfering with early steps of virus replication 42 . The natural ellagitannins CI, PG and PL have already been reported to exhibit diverse biological properties 43 , including antiviral activity against multiple human viruses with in vitro potencies in the low micromolar range 44 – 46 . Other polyphenols, like catechin gallate and gallocatechin gallate, have also been shown to reduce the binding affinity of an RNA oligonucleotide to the N protein of SARS-CoV, causative of the 2003 coranavirus outbreak, on a biochip assay 47 . Chicoric acid (CA), a symmetric dicaffeoyl ester of tartaric acid, was highlighted in the present study as a new class of N protein modulator and one of the most potent hit compounds identified in our HTS trials. Importantly, the binding of CA to the N protein could be fully characterized by biophysical methods (Fig. 3 ) and the crystal structure of CA binding to the SARS-CoV-2 N protein CTD could be determined at 1.7 Å resolution (Fig. 4 ). Although polyphenols have been shown to interfere with coronavirus N proteins before 47 and compound PJ34 (SARS-CoV NTD 48 ) and GTP (SARS-CoV-2 CTD) interacted with N proteins, our data show that CA is a new class of N protein ligand that binds to a new modulatory site on the SARS-CoV-2 N-protein CTD. Importantly, the CA-binding site is conserved in SARS-CoV and partially conserved in MERS N proteins (Figure S4). To our knowledge, this is the first description of a non-endogenous SARS-CoV-2 N protein ligand and the first report of this modulatory ligand binding site on a coronavirus N protein. We present evidence that the N protein CTD is sufficient for interaction with CA, as spotted by the 1 H-STD NMR experiment carried out with the full length, CTD and NTD SARS-CoV-2 N protein (Fig. 3 C). The crystallographic data further confirmed that CA binds to the SARS-CoV-2 N protein CTD in a shallow pocket located close to the CTD C-terminus and to the putative positively charged RNA binding groove (Fig. 5 ). CA binding to N protein is stabilized mainly by a polar contact network involving ionic interactions of CA’ symmetric carboxylates with the N protein’s arginines and water-mediated hydrogen bonds of its caffeoyl carbonyl groups. One of the catechol rings of CA is further involved in ligand binding and induces conformational changes in the N protein, by docking to a hydrophobic pocket formed in the CA-binding site upon ligand binding (Fig. 4 ). The two carboxylate and two caffeoyl ester moieties seem important for binding to the N protein and to induce conformational changes that affect its RNA binding function. In addition to the crystallographic observations, an initial structure-activity relationship (SAR) analysis could be performed based on 16 compounds assessed in our screening efforts containing caffeoyl substructures. Those bearing two caffeoyl esters clearly stand out (Figure S5A). In CA, the most potent derivative (IC50 = 0.5 µM), the dicaffeoyl units are bound to tartaric acid, whose carboxylate moieties’ contribution for protein binding have been established (Fig. 4 ). The other three dicaffeoyl derivatives are isomers of dicaffeoylquinic acid, showing at least 10-fold loss in IC50 values (Figure S5B). Assuming that they bind to the same site as CA, one can perceive that the caffeoyl esters could occupy similar positions, especially for 4,5-dicaffeoylquinic acid and isochlorogenic acid A. However, their single carboxylate moiety at C1 would be further way in comparison to CA, but still able to engage some of the polar contacts observed for CA. This observation can be extended to the other caffeoyl derivatives, such as rosmarinic acid and verbascoside which showed low N protein-RNA1 disruption, and which only contain one or two of the 4 key elements found in CA (Figure S5B). The functional effects of CA binding to the SARS-CoV-2 N protein could be further explored in the present work. The CA-binding site in N protein is located adjacent to the main positively charged groove thought to interact with the RNA 38 , 39 (Fig. 5 ). Notably, the binding of CA to the CTD not only alters the topology but also the charge distribution of this region, which might explain why CA disrupts the N protein-RNA1 complex in solution. This hypothesis is additionally supported by a structural model of the SARS-CoV-2 N protein complexed with an RNA molecule, which we have recently reported 40 . This structural model presupposes two possibilities: one in which the CA-binding site fully overlaps with the RNA interaction site (Fig. 5 C), and the second where the CA site is near the RNA site (Fig. 5 D). In both scenarios, however, it can be anticipated that the binding of CA to the CTD could preclude RNA interaction, therefore modulating the essential N protein functions related to SARS-CoV-2 genomic RNA binding. CA showed binding affinities for the N protein of 0.5 µM (Fig. 2 ); nevertheless, the CA equilibrium constant for the N protein-RNA1 complex dissociation was ~ 40 µM (Fig. 3 B). Such dissociation constant is consistent with the higher N protein binding affinity exhibited by RNA1, and with the notion that RNA1 has a much larger interaction surface than CA. These data, aligned with the reported low cell permeability of CA 49 , 50 , also help to explain the relatively high CA concentration required to significantly inhibit SARS-CoV-2 replication in human cells (Fig. 6 ). Although further optimization of CA as an antiviral agent is needed, our data offer the structural basis for the rational design and development of novel antiviral drugs targeting the SARS-CoV-2 N protein, an essential and yet underexplored target of coronaviruses. Methods Protein expression and purification The gene sequence corresponding to the full-length SARS-Cov-2 N protein (GenBank QIG56001.1) was amplified from SARS-CoV-2 RNA and cloned into a pET28a-TEV vector for the expression of a 6xHis-fusion protein, as previously described 51 . The NTD (residues Q43-E174) and CTD (residues S250-P364) fragments were amplified from the full-length N construct using primers forward (NTD-F 5’-AACGTGGATCCCAAGGTTTACCCAATAATACTG-3’, CTD-F 5’CTAAGGGATCCGCTGCTGAGGCTTCTAAGAAG3’) and reverse (NTD-R 5’-ACTGCCGCGGCCGCTTTATTCTGCGTAGAAGCCTTTTGG-3’, CTD-R 5’CTTTTTAGCGGCCGCTTATGGGAATGTTTTGTATGCGTC3’), respectively, and inserted into the BamH I/ Not I sites of a pET-SUMO vector (Invitrogen), carrying a SUMO sequence at the N-terminus. The expression vectors were used to transform Escherichia coli BL21 (DE3) cells (Novagen, USA). Freshly transformed cells were grown in LB-kanamycin (50 μg/mL) medium to OD600nm 0.8 at 37°C. The temperature of the cultures was lowered to 25°C (full-length N) or to 18°C (NTD and CTD), and protein expression was induced with 0.1 mM (full-length N) or 0.5 mM (NTD and CTD) IPTG for 16 h at the respective temperatures. Cells were harvested by centrifugation (4,000 x g, 10 min) and stored at -80°C. To remove nucleic acids of bacterial origin, the proteins were purified under denaturing conditions using urea and high salt concentration 26 . Frozen cell pellets were thawed and resuspended in buffer A (50 mM sodium phosphate, pH 7.6, 500 mM NaCl, 10% glycerol, 20 mM imidazole, 6 M urea) and lysed by sonication on ice. Lysed cells were centrifuged at 18,000 x g for 40 min at 4°C to remove cell debris and the supernatants were applied onto a HisTrap FF 5mL column (GE healthcare) pre-equilibrated with buffer A. After washings, proteins were eluted in ten column volumes of buffer B (50 mM sodium phosphate, pH 7.6, 500 mM NaCl, 10% glycerol, 500 mM imidazole, 3 M urea). Fractions containing the protein of interest were pooled and dialyzed against buffer C (50 mM sodium phosphate, pH7.6, 500 mM NaCl, 10% glycerol) overnight at 4°C. Except for the N-full construct, the recombinant proteins (NTD and CTD contructs) were cleaved with the appropriate TEV and SUMO proteases. Cleaved tags were removed by reverse affinity chromatography using buffer A and B without urea. Protein fractions were concentrated and fractionated on a size exclusion Superdex 200 16/600 (full-length N) or Superdex 75 16/600 (NTD and CTD) column, previously equilibrated with buffer C. For crystallization tests, the CTD was purified using Turbonuclease from Serratia marcescens (Sigma, USA). Briefly, bacterial cells after IPTG induction were suspended in lysis buffer (50 mM Tris HCl pH 8.0; 1 M NaCl, 5% glycerol, 1 mM β-mercaptoethanol) containing 200 units of Turbonuclease and lysed by sonication as described above. Lysed cells were centrifuged, and the supernatant was applied onto a HisTrap FF 5mL column pre-equilibrated with buffer D (50 mM Tris HCl pH 8.0, 500 mM NaCl, 5% glycerol, 1 mM β-mercaptoethanol). Bound proteins were eluted using the same buffer containing 500 mM imidazole. The eluate was dialyzed against buffer D overnight at 4°C. After SUMO cleavage and reverse affinity chromatography, the proteins were fractionated on a Superdex 75 16/600 column pre-equilibrated with buffer E (20 mM Tris HCl, pH 8.0, 100 mM NaCl, 1 mM β-mercaptoethanol). The quality of all protein preparations was verified by SDS-PAGE and dynamic light scattering (DLS). In addition, UV absorbance at 260/280 nm was used to estimate the amount of nucleic acid in the protein samples. Only protein samples with a monodisperse character and a 260/280 nm ratio of 0.5-0.6 were used in the experiments described below. Fluorescence polarization assay Chemically synthesized RNA probes 5’-labelled with fluorescein isothiocyanate (FITC) and purified by HPLC were obtained from Thermo Scientific (USA). Probe sequences were as follows: RNA1 (5’-CACUCACUGUCUUUUUUGAUGGUAGAGU-3’), RNA2 (5’-CACUCACUGUCAAAAAAGAUGGUAGAGU-3’), RNA3 (5’-CACUCACUGUCUUGUUUGAUGGUAGAGU-3’), RNA4 (5’-CACUCACUGUCUUUUUU-3’), RNA5 (5’-CACUCACUGUC-3’) and scramble control RNA6 (5’-AUAUAGCUAC-3’), Fluorescence polarization (FP) assays were used to determine the binding affinity of the N protein to the RNA probes, solubilized in 50 mM sodium phosphate buffer (pH, 7.6). Purified N protein from 2.5 nM to 15 µM in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6) was mixed with each RNA at 10 nM final concentration, in 384-well plates. FP data was acquired using a ClarioStar microplate reader (BMG LabTech), with excitation and emission wavelengths set to 485 and 530 nm, respectively. Affinity binding curves were fitted to a Hill1 model using the OriginPro software. Hight-throughput screening assays A customized library with 3215 nonredundant compounds from the collections ‘FDA-approved’, ‘anti-COVID’, ‘anti-infection’ and ‘anti-virus’, was purchased from MedChemExpress (NJ, USA). The library, in 384-well plates, was diluted to 1 mM concentration in dimethyl sulfoxide (DMSO) and stored at -20°C. Columns 1, 2, 23 and 24 of all microplates were filled with DMSO for screening controls as described below. Binding of RNA1 to the N protein was monitored by FP, as described above. Screenings were performed in 384-well, flat bottom, black polypropylene microplates (Greiner #781289), using the binding buffer supplemented with 0.01% triton X-100, in a final volume of 25 µL. The final concentration of RNA, N protein, library compound and DMSO were 10 nM, 500 nM, 20 µM and 2% (v/v) respectively. Initially, the assay plates were filled with the RNA probe solution (19.5 µl) using a MultiDrop dispenser (Thermo Fisher) and the compounds (0.5 µl) were transferred from the library to the assay plates in a Janus-MDT liquid handler platform (PerkinElmer). FP measurements were performed at this stage to detect possible interference from library compounds. The N protein (5 µl) was then transferred to all wells of the assay plates using the MultiDrop dispenser, except for columns 1 and 24 which received buffer, RNA and DMSO only, and were used as negative controls (low control, free probe). On the other hand, columns 2 and 23 received buffer, RNA, protein and DMSO, and were considered as positive controls (high control, bound probe). After adding the protein to the assay mix, the plates were incubated at room temperature for 30 min before FP was measured. mP values of positive (100% binding) and negative (0% binding) controls were used for sample data normalization. Concentration−response curves and IC 50 determination To confirm the activity and evaluate the potency of selected hit candidates, hit compounds were subjected to dose-response assays. Except for compound concentration, the assay conditions were as described above, where 0.5 µL of the compounds were transferred to the assay plates generating a concentration gradient from 1.8 nM to 50 µM. The concentration-response assays were performed in triplicates and after acquisition of the FP data, the percentage of inhibition for each test compound was calculated as follows: % inhibition = (high control average – read value)/(high control average – low control average) × 100. Normalized data was fit to the log4 parameters equation with variable slope to extract the IC 50 values with GraphPad Prism 9 (GraphPad LLC, v. 9.3.1). Biophysical analysis and hit confirmation Aggregation assays were performed with the full-length N protein diluted to 10 µM in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6), with subsequent addition of 20 µM of each test compounds or 1% DMSO used as diluent. The same assay was performed with the protein at 2.5 µM in the presence of 500 µM CA. Samples were evaluated by DLS in a ZetaSizer NanoS (Malvern) equipment, at 10°C, using default parameters set by the equipment. The affinity of RNA1 for the N protein in the presence of selected hit compounds was inspected by FP. Serial dilutions of the protein:compound mixtures at a 1:2 ratios were prepared in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6). RNA1 at 10 nM was added to the serial dilutions and FP measurements were performed as described above. To determine the amount of CA required for N protein-RNA1 dissociation, purified N protein at 2.5 µM in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6) was incubated 10 nM RNA1 at 4 °C for 60 min prior to the addition of increasing amounts of CA up to 500 µM. The FP data were acquired as described above and the affinity binding curves were fitted to a Hill1 model using the OriginPro software. The dissociation constant and thermodynamic parameters for the N protein-CA interaction were determined by ITC using a a VP-ITC calorimeter (Malvern). Purified N protein was dialyzed against 50 mM sodium phosphate buffer, 500 mM NaCl (pH, 7.6), overnight at 4 °C, and further diluted to 20 µM. The dialysis buffer was used to prepare CA at 250 µM. Both solutions, from cell and syringe, were prepared in the presence of 0.25% DMSO. CA was titrated against the protein solution (10 µL injections) at 20 °C with 300 s intervals. CA titrations against the buffer and buffer titrations against the protein solution were performed as controls. The isotherm curves, after subtracting the controls, were analyzed using the Microcal Origin software provided with the equipment, and the data were fitted to One Set of Sites model. Protein crystallization and X-ray data collection Freshly prepared CTD samples at 8 mg/mL were subjected to hanging-drop vapor diffusion crystallization trials performed in 24-well VDX plates at 18 o C using Hampton Crystal Screen HT™ solutions. After optimizing the crystallization conditions, CTD crystals were obtained within three days in 100 mM Tris -HCl (pH 8.3), 30% PEG 4000, 0.2 M sodium acetate, with 2 µL drops (1 µL protein /1 µL reservoir solution) and 300 µL reservoir solution. Protein-ligand crystals were grown within three weeks under the same crystallization condition with a reservoir solution containing 4 mM CA. Protein crystals were cryoprotected by rapid soaking in reservoir solution containing 25% glycerol and flash-cooled in liquid nitrogen. X-ray diffraction data were collected under cryogenic conditions (100 K) at 1.327 Å and 0.977 Å wavelength at the Manacá beamline ( ma cromolecular micro and na no c ryst a llography) 52 of Sirius, the Brazilian synchrotron light source (LNLS, Campinas, Brazil), using a PILATUS 2M detector placed 145 mm from the crystal. The X-ray data were collected using a fine ϕ-slicing strategy, rotated through 360° with a 0.1° oscillation range per frame. X-ray data processing and structural determination X-ray diffraction data were automatically processed with XDS 53 using the Manacá Automatic Processing Pipeline (ManacáAutoProc) and analyzed and scaled using Pointless, Matthews and Scala from CCP4 package 36,54,55 . The phases of the datasets were determined by molecular replacement with Molrep 56 and Phaser 57 using the SARS-CoV-2 CTD crystal structure (PDB code: 7C22) as the search model. The atomic structures were refined using REFMAC5 58 , ligands had their geometry restraint information generated for refinement by eLBOW 59 and then modelled using COOT 60 . All figures were generated using PyMOL. The volume of the CA binding site was estimated using parKVFinder software 61 using the box adjustment mode around the CA molecule with the following parameters: probe in of 1.4 Å, probe out of 12 Å and removal distance of 0.5 Å. NMR experiments All NMR spectra were obtained using an Agilent DD2 500 MHz spectrometer or Varian Inova 600 MHz spectrometer both equipped with a 5 mm triple-resonance probe and a Z pulse-field gradient unit at 298 K. The STD experiments were performed with 400 μM CA and 4 μM N protein samples dissolved in 80 mM sodium phosphate buffer, pH 7.4, prepared with deuterated water. The 1D 1 H-STD spectra were obtained by subtracting the saturated spectra (on- resonance) from the reference spectra (off-resonance), which was automatically performed by phase cycling using the dpfgse satzfer pulse sequence implemented in the VNMRJ software (Agilent). The spectra were acquired using 2048 scans with a selective irradiation frequency of the protein at -0.5 ppm (on-resonance) and 30 ppm (off-resonance). Forty G-shaped pulses of 50 ms separated by 1 ms delays were applied to the samples. The total length of the saturation train was 2.5 s. A T 2 filter was applied to eliminate all protein background. The off-resonance spectra were used as reference spectra and were acquired with 1024 scans keeping all other parameters equal to the 1D 1 H-STD-NMR spectra. For the group epitope mapping analysis, the STD enhancements (A STD ) were determined by the integrals of individual protons of the ligands in the 1D 1 H-STD-NMR spectrum (I STD ) divided by the integral of the same signals at the reference spectrum (I 0 ) and multiplied by the excess ratio of ligand to protein concentration ([L]/[P]) according to equation 1. In vitro anti-SARS-CoV-2 activity Vero CCL81 cells (African green monkey kidney cell line - BCRJ, # 0245) were cultivated in DMEM medium supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin. Calu-3 cells (Human lung cell line – ATCC, # HTB-55™) were cultivated in DMEM/F12 (1:1, v/v) medium supplemented with 20% FBS, 1% L-glutamine and 1% penicillin/streptomycin. Both cell lines were grown at 37°C with 5% CO 2 . Antiviral assays were performed with the HIAE-02 SARS-CoV-2/SP02/human/2020/BRA strain (GenBank accession MT126808.1) kindly provided by Prof. Edison Luiz Durigon (USP-SP, Brazil). Virus stocks were propagated in Vero CCL81 cells in 75 cm 2 flasks. After 30-36 h of growth, culture supernatants were centrifuged to remove cell debris and stored at -80°C. All assays involving infectious virus were performed in the BSL-3 unit of the Emerging Viruses Laboratory (LEVE) at the State University of Campinas, Brazil. Cell viability in Vero CCL-81 and Calu-3 after CA treatment was measured by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (Sigma–Aldrich, USA) method. Briefly, CA diluted in 10% DMEM at 25 and 100 µM final concentration was added to the confluent monolayer of cells grown in 24-well plates. After 48 h growth, the medium was replaced by fresh DMEM containing MTT (200 µg/mL) and cells were incubated for 3 h. DMSO was used to solubilize the formazan crystals and cell viability was measured by OD at 492 nm. The results were expressed according to the equation (T/C) × 100%, where T and C represented the mean optical density of treated and control, respectively. DMSO at 0.2% (v/v) in DMEM medium was used as the vehicle control. To evaluate the activity of CA on SARS-CoV-2 replication, Calu-3 and Vero CCL-81 cells were seeded into 24-well plates at 2x10 5 and 2.5x10 5 cells per well, respectively. The antiviral activity was determined at multiplicity of infection (MOI) of 1. The confluent monolayer of cells was incubated with the virus for 1 h, after which the culture medium was replaced by fresh medium containing CA at 25 and 100 µM final concentration. Culture supernatants were harvested 48 h after virus inoculation and viral load was determined by plaque assay. Plaque assay Vero cells were seeded into 24-well plates and incubated for 1h with the supernatants from the antiviral assays, serially diluted to 10 -6 . After virus incubation, cells were overlaid with semi-solid medium (1% w/v carboxymethylcellulose in DMEM supplemented with 5% FBS) and incubated for 4 days. After removal of semi-solid medium, cells were fixed with paraformaldehyde 4% and plaques were visualized after 1% methylene blue staining. Viral lysis plaques were counted and the results were expressed as viral plaque forming units (PFU) per mL of sample. Declarations Acknowledgements This work was supported by the Brazilian Funding Authority for Studies and Projects (FINEP, grant number 01.20.0003.00), the Brazilian Ministry of Sciences, Technology and Innovation (MCTI) and the National Fund for Scientific and Technological Development (FNDCT). This research used facilities of the Brazilian Synchrotron Light Laboratory (LNLS) and the Brazilian Biosciences National Laboratory (LNBio), which are part of the Brazilian Center for Research in Energy and Materials (CNPEM), a private non-profit organization under the supervision of the MCTI. The Manaca beamline (Sirius, LNLS, proposal 20200057) and the LNBio-CNPEM facilities LPP, LEC, ROBOLAB, NMR, LGC and LBE staff is acknowledged for the assistance during the experiments. We also wish to acknowledge all the scientists and staff participating on the CNPEM’s COVID-19 task-force. Author contributions Conceived and designed the analysis: GFM, ATC, REM, MLS, KGF, CEB, ACMF, DBBT. Collected the data: EHSB, FAHB, CCCT, ASS, JFS, AN, JCS, JNF, MLS. Contributed data or analysis tools: HVRF, MGC, ACMZ, AFZN, JLPM, MCB, SAR, PSLO. Performed the analysis: GFM, EHSB, FAHB, JFS, AN, HRF, SAR, PSLO, MB, MLS, CEB, ACMF, DBBT. Protein preparation: FAHB, CCCT, ASS, JCS, MCB, CEB. Biophysical assays: FAHB, SAR, MLS, CEB, ACMF. Protein crystallography, model interpretation and comparison: EHSB, CCCT, ACMZ, AFZN, DBBT, HVRF, PSLO. Virology: JFS, AN, JLPM, REM. HTS assay design and implementation: GFM, FAHB, JNF, MGC, ATC, CEB, ACMF, DBBT. SAR analysis: MB, DBBT. Project management and funding: KGF, DBBT. Designed the paper: ACMF, DBBT. Wrote the paper: GFM, EHSB, FAHB, CEB, ACMF, DBBT with contributions and revisions from all authors. Data availability The crystal structures generated during the current study are available in the Protein Data Bank (PDB) under the accession numbers 7UXX (apo CTD) and 7UXZ (CTD-CA), and through the links: https://www.rcsb.org/structure/7UXX and https://www.rcsb.org/structure/7UXZ, respectively. References Nicola, M. et al. The socio-economic implications of the coronavirus pandemic (COVID-19): A review. International Journal of Surgery 78 , 185–193 (2020). Das, S., Wingender, P., Barrett, P., Pugacheva, E. & Magistretti, G. After-Effects of the COVID-19 Pandemic: Prospects for Medium-Term Economic Damage. IMF Working Papers 2021 , 1 (2021). Beigel, J. H. et al. Remdesivir for the Treatment of Covid-19 — Final Report. New England Journal of Medicine 383 , 1813–1826 (2020). Jayk Bernal, A. et al. Molnupiravir for Oral Treatment of Covid-19 in Nonhospitalized Patients. New England Journal of Medicine 386 , 509–520 (2022). Kozlov, M. Merck’s COVID pill loses its lustre: what that means for the pandemic. Nature (2021) doi:10.1038/d41586-021-03667-0. Owen, D. R. et al. An oral SARS-CoV-2 M pro inhibitor clinical candidate for the treatment of COVID-19. Science (1979) 374 , 1586–1593 (2021). Heskin, J. et al. Caution required with use of ritonavir-boosted PF-07321332 in COVID-19 management. The Lancet 399 , 21–22 (2022). Shah, M. & Woo, H. G. Omicron: A Heavily Mutated SARS-CoV-2 Variant Exhibits Stronger Binding to ACE2 and Potently Escapes Approved COVID-19 Therapeutic Antibodies. Frontiers in Immunology 12 , (2022). Coelho, C., Gallo, G., Campos, C. B., Hardy, L. & Würtele, M. Biochemical screening for SARS-CoV-2 main protease inhibitors. PLOS ONE 15 , e0240079 (2020). Zhu, W. et al. Identification of SARS-CoV-2 3CL Protease Inhibitors by a Quantitative High-Throughput Screening. ACS Pharmacology & Translational Science 3 , 1008–1016 (2020). Lim, C. T. et al. Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Biochemical Journal 478 , 2517–2531 (2021). Xu, T., Zheng, W. & Huang, R. High‐throughput screening assays for SARS‐CoV‐2 drug development: Current status and future directions. Drug Discovery Today 26 , 2439–2444 (2021). Eydoux, C. et al. A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. Journal of Virological Methods 288 , (2021). Wang, Y. et al. Discovery of SARS-CoV-2-E channel inhibitors as antiviral candidates. Acta Pharmacologica Sinica (2021) doi:10.1038/s41401-021-00732-2. Smith, E. et al. High-Throughput Screening for Drugs That Inhibit Papain-Like Protease in SARS-CoV-2. SLAS DISCOVERY: Advancing the Science of Drug Discovery 25 , 1152–1161 (2020). Zhang, Z.-R. et al. A cell-based large-scale screening of natural compounds for inhibitors of SARS-CoV-2. Signal Transduction and Targeted Therapy 5 , 218 (2020). Rothan, H. A. & Teoh, T. C. Cell-Based High-Throughput Screening Protocol for Discovering Antiviral Inhibitors Against SARS-COV-2 Main Protease (3CLpro). Molecular Biotechnology 63 , 240–248 (2021). Zhao, T. et al. Warnings regarding the potential coronavirus disease 2019 (COVID-19) transmission risk: Vaccination is not enough. Infection Control & Hospital Epidemiology 1–1 (2021) doi:10.1017/ice.2021.63. Gorshkov, K. et al. SARS-CoV-2 Nucleocapsid Protein TR-FRET Assay Amenable to High Throughput Screening. ACS Pharmacology and Translational Science 5 , (2022). McBride, R., van Zyl, M. & Fielding, B. C. The coronavirus nucleocapsid is a multifunctional protein. Viruses vol. 6 (2014). Peng, Y. et al. Structures of the SARS‐CoV‐2 nucleocapsid and their perspectives for drug design. The EMBO Journal 39 , (2020). Dinesh, D. C. et al. Structural basis of RNA recognition by the SARS-CoV-2 nucleocapsid phosphoprotein. PLoS Pathogens 16 , (2020). Kang, S. et al. Crystal structure of SARS-CoV-2 nucleocapsid protein RNA binding domain reveals potential unique drug targeting sites. Acta Pharmaceutica Sinica B 10 , (2020). Grossoehme, N. E. et al. Coronavirus N Protein N-Terminal Domain (NTD) Specifically Binds the Transcriptional Regulatory Sequence (TRS) and Melts TRS-cTRS RNA Duplexes. Journal of Molecular Biology 394 , 544–557 (2009). Keane, S. C., Lius, P., Leibowitzs, J. L. & Giedroc, D. P. Functional Transcriptional Regulatory Sequence (TRS) RNA binding and helix destabilizing determinants of Murine Hepatitis Virus (MHV) Nucleocapsid (N) protein. Journal of Biological Chemistry 287 , (2012). Carlson, C. R. et al. Phosphoregulation of Phase Separation by the SARS-CoV-2 N Protein Suggests a Biophysical Basis for its Dual Functions. Molecular Cell 80 , 1092-1103.e4 (2020). Savastano, A., Ibáñez de Opakua, A., Rankovic, M. & Zweckstetter, M. Nucleocapsid protein of SARS-CoV-2 phase separates into RNA-rich polymerase-containing condensates. Nature Communications 11 , (2020). Perdikari, T. M. et al. SARS‐CoV‐2 nucleocapsid protein phase‐separates with RNA and with human hnRNPs. The EMBO Journal 39 , (2020). Lu, S. et al. The SARS-CoV-2 nucleocapsid phosphoprotein forms mutually exclusive condensates with RNA and the membrane-associated M protein. Nature Communications 12 , (2021). Hsieh, P.-K. et al. Assembly of Severe Acute Respiratory Syndrome Coronavirus RNA Packaging Signal into Virus-Like Particles Is Nucleocapsid Dependent. Journal of Virology 79 , 13848–13855 (2005). Hsin, W.-C. et al. Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus. Journal of Biomedical Science 25 , 47 (2018). Adem, Ş. et al. Caffeic acid derivatives (CAFDs) as inhibitors of SARS-CoV-2: CAFDs-based functional foods as a potential alternative approach to combat COVID-19. Phytomedicine 85 , 153310 (2021). King, P. J. & Robinson, W. E. Resistance to the Anti-Human Immunodeficiency Virus Type 1 Compound l -Chicoric Acid Results from a Single Mutation at Amino Acid 140 of Integrase. Journal of Virology 72 , 8420–8424 (1998). Reinke, R. A. et al. l-Chicoric acid inhibits human immunodeficiency virus type 1 integration in vivo and is a noncompetitive but reversible inhibitor of HIV-1 integrase in vitro. Virology 326 , 203–219 (2004). Zhang, H.-L. et al. Evaluation of Hepatocyteprotective and Anti-hepatitis B Virus Properties of Cichoric Acid from Cichorium intybus Leaves in Cell Culture. Biological and Pharmaceutical Bulletin 37 , 1214–1220 (2014). Matthews, B. W. Solvent content of protein crystals. J Mol Biol 33 , 491–497 (1968). Zhou, R., Zeng, R., von Brunn, A. & Lei, J. Structural characterization of the C-terminal domain of SARS-CoV-2 nucleocapsid protein. Molecular Biomedicine 1 , 2 (2020). Yang, M. et al. Structural Insight Into the SARS-CoV-2 Nucleocapsid Protein C-Terminal Domain Reveals a Novel Recognition Mechanism for Viral Transcriptional Regulatory Sequences. Frontiers in Chemistry 8 , (2021). Chang, C.-K. et al. Multiple Nucleic Acid Binding Sites and Intrinsic Disorder of Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein: Implications for Ribonucleocapsid Protein Packaging. Journal of Virology 83 , 2255–2264 (2009). Ribeiro-Filho, H. V. et al. Structural dynamics of SARS-CoV-2 nucleocapsid protein induced by RNA binding. PLOS Computational Biology 18 , e1010121 (2022). Douangamath, A. et al. Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease. Nature Communications 11 , (2020). Salgado-Benvindo, C. et al. Suramin inhibits SARS-CoV-2 infection in cell culture by interfering with early steps of the replication cycle. Antimicrobial Agents and Chemotherapy 64 , (2020). Landete, J. M. Ellagitannins, ellagic acid and their derived metabolites: A review about source, metabolism, functions and health. Food Research International 44 , 1150–1160 (2011). Li, P. et al. Identification of Chebulinic Acid and Chebulagic Acid as Novel Influenza Viral Neuraminidase Inhibitors. Frontiers in Microbiology 11 , (2020). Kesharwani, A. et al. Anti-HSV-2 activity of Terminalia chebula Retz extract and its constituents, chebulagic and chebulinic acids. BMC Complementary and Alternative Medicine 17 , (2017). Lin, L. T. et al. Broad-spectrum antiviral activity of chebulagic acid and punicalagin against viruses that use glycosaminoglycans for entry. BMC Microbiology 13 , (2013). Roh, C. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide. International Journal of Nanomedicine 2173 (2012) doi:10.2147/IJN.S31379. Lin, S.-Y. et al. Structural Basis for the Identification of the N-Terminal Domain of Coronavirus Nucleocapsid Protein as an Antiviral Target. Journal of Medicinal Chemistry 57 , 2247–2257 (2014). Matthias, A. et al. Permeability studies of alkylamides and caffeic acid conjugates from echinacea using a Caco-2 cell monolayer model. Journal of Clinical Pharmacy and Therapeutics 29 , (2004). Charvat, T. T., Lee, D. J., Robinson, W. E. & Chamberlin, A. R. Design, synthesis, and biological evaluation of chicoric acid analogs as inhibitors of HIV-1 integrase. Bioorganic and Medicinal Chemistry 14 , (2006). Peroni, L. A. et al. Serological Testing for COVID-19, Immunological Surveillance, and Exploration of Protective Antibodies. Frontiers in Immunology 12 , (2021). Nascimento, A. et al. Launch of the Manacá Beamline at Sirius: First Protein Crystallography Structures and New Opportunities for Pharmaceutical Development Using Synchrotrons. Synchrotron Radiation News 34 , 3–10 (2021). Kabsch, W. XDS. Acta Crystallographica Section D Biological Crystallography 66 , 125–132 (2010). Kantardjieff, K. A. & Rupp, B. Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals. Protein Science 12 , 1865–1871 (2003). Evans, P. R. An introduction to data reduction: Space-group determination, scaling and intensity statistics. Acta Crystallographica Section D: Biological Crystallography 67 , (2011). Vagin, A. & Teplyakov, A. Molecular replacement with MOLREP. Acta Crystallogr D Biol Crystallogr 66 , 22–5 (2010). McCoy, A. J. et al. Phaser crystallographic software. Journal of Applied Crystallography 40 , 658–674 (2007). Murshudov, G. N., Vagin, A. A. & Dodson, E. J. Refinement of Macromolecular Structures by the Maximum-Likelihood Method. Acta Crystallographica Section D Biological Crystallography 53 , 240–255 (1997). Moriarty, N. W., Grosse-Kunstleve, R. W. & Adams, P. D. electronic Ligand Builder and Optimization Workbench ( eLBOW ): a tool for ligand coordinate and restraint generation. Acta Crystallographica Section D Biological Crystallography 65 , 1074–1080 (2009). Emsley, P. & Cowtan, K. Coot : model-building tools for molecular graphics. Acta Crystallographica Section D Biological Crystallography 60 , 2126–2132 (2004). Guerra, J. V. da S. et al. ParKVFinder: A thread-level parallel approach in biomolecular cavity detection. SoftwareX 12 , (2020). Additional Declarations No competing interests reported. Supplementary Files 20220516SIMercaldiBezerraBatistaetalchicoricacidasNproteinligand.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 11 Jul, 2022 Reviews received at journal 06 Jul, 2022 Reviewers agreed at journal 26 Jun, 2022 Reviewers invited by journal 26 Jun, 2022 Editor assigned by journal 25 Jun, 2022 Editor invited by journal 24 Jun, 2022 Submission checks completed at journal 24 Jun, 2022 First submitted to journal 02 Jun, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1720953","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":116136960,"identity":"4f52beaa-f9fc-4df4-be72-4f2e2da71084","order_by":0,"name":"Gustavo Mercaldi","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gustavo","middleName":"","lastName":"Mercaldi","suffix":""},{"id":116136962,"identity":"7be76d04-4557-4094-8f0f-7a1d417a68e7","order_by":1,"name":"Eduardo Bezerra","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Eduardo","middleName":"","lastName":"Bezerra","suffix":""},{"id":116136964,"identity":"9dce603a-8c0a-4e9e-b73d-2e9748f56a2c","order_by":2,"name":"Fernanda Aparecida Batista","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"Aparecida","lastName":"Batista","suffix":""},{"id":116136966,"identity":"86295d6b-427e-4acc-8d6e-71c83050a4e6","order_by":3,"name":"Celisa Tonoli","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Celisa","middleName":"","lastName":"Tonoli","suffix":""},{"id":116136967,"identity":"90c6e151-8c64-489a-9ee7-0acce493b633","order_by":4,"name":"Adriana Soprano","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Adriana","middleName":"","lastName":"Soprano","suffix":""},{"id":116136968,"identity":"03dad80b-50a5-4e33-8a74-e7786c39bd34","order_by":5,"name":"Jacqueline Shimizu","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jacqueline","middleName":"","lastName":"Shimizu","suffix":""},{"id":116136969,"identity":"18bd794f-2796-4439-a2a5-41456c9f6be7","order_by":6,"name":"Alice Nagai","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alice","middleName":"","lastName":"Nagai","suffix":""},{"id":116136970,"identity":"b1bd085f-6612-4044-ab2b-feaf274722b7","order_by":7,"name":"Jaqueline da Silva","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jaqueline","middleName":"da","lastName":"Silva","suffix":""},{"id":116136971,"identity":"bcbe7de4-6fc5-4e03-9285-230971f99b1d","order_by":8,"name":"Helder Ribeiro-Filho","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Helder","middleName":"","lastName":"Ribeiro-Filho","suffix":""},{"id":116136972,"identity":"b94ec0e3-a520-4f74-bc3e-457eadf026c4","order_by":9,"name":"Jessica Faria","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jessica","middleName":"","lastName":"Faria","suffix":""},{"id":116136973,"identity":"94811b15-5bee-4e9e-9f86-851080832156","order_by":10,"name":"Marcos da Cunha","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Marcos","middleName":"da","lastName":"Cunha","suffix":""},{"id":116136974,"identity":"9467947a-3406-4690-a4ee-eb7fed6e8b90","order_by":11,"name":"Ana Zeri","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"","lastName":"Zeri","suffix":""},{"id":116136975,"identity":"72133d9c-85b1-4d49-8dc3-c8105a327de9","order_by":12,"name":"Andrey Fabricio Nascimento","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Andrey","middleName":"Fabricio","lastName":"Nascimento","suffix":""},{"id":116136976,"identity":"3a6848d4-a28e-4f0f-9ba2-faf4450d8dd0","order_by":13,"name":"Jose Luiz Proenca-Modena","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jose","middleName":"Luiz","lastName":"Proenca-Modena","suffix":""},{"id":116136977,"identity":"5949a8fa-efc4-4530-b8b7-e8d33668d116","order_by":14,"name":"Marcio Bajgelman","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Marcio","middleName":"","lastName":"Bajgelman","suffix":""},{"id":116136978,"identity":"04b1f096-755e-406e-80a0-df6c0898d710","order_by":15,"name":"Silvana Rocco","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Silvana","middleName":"","lastName":"Rocco","suffix":""},{"id":116136979,"identity":"83cbffb5-19f7-4e48-bcaa-be48c1c678c5","order_by":16,"name":"Paulo Lopes-de-Oliveira","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Paulo","middleName":"","lastName":"Lopes-de-Oliveira","suffix":""},{"id":116136980,"identity":"b493b0d0-d268-4087-9548-6d2b1ee241e8","order_by":17,"name":"Artur Cordeiro","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Artur","middleName":"","lastName":"Cordeiro","suffix":""},{"id":116136981,"identity":"63667796-1bd8-4ae8-9541-dde82ae19e9c","order_by":18,"name":"Marjorie Bruder","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Marjorie","middleName":"","lastName":"Bruder","suffix":""},{"id":116136982,"identity":"2a810070-155a-41f4-ba58-cbd2cd898269","order_by":19,"name":"Rafael Elias Marques","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rafael","middleName":"Elias","lastName":"Marques","suffix":""},{"id":116136983,"identity":"a6b4cee3-3f40-4de5-a7f9-0425d7c7ace4","order_by":20,"name":"Mauricio Sforca","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mauricio","middleName":"","lastName":"Sforca","suffix":""},{"id":116136984,"identity":"79486b4d-b320-4395-9031-e116383af776","order_by":21,"name":"Kleber Franchini","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kleber","middleName":"","lastName":"Franchini","suffix":""},{"id":116136985,"identity":"9b16321f-63b4-44d6-822d-3efb5df540fd","order_by":22,"name":"Celso Benedetti","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Celso","middleName":"","lastName":"Benedetti","suffix":""},{"id":116136987,"identity":"281dfbf6-8d1a-40dd-98eb-b1c88e2f470a","order_by":23,"name":"Ana Carolina Figueira","email":"","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Carolina","lastName":"Figueira","suffix":""},{"id":116136989,"identity":"4ebee894-866e-4937-8423-0e042f3b7683","order_by":24,"name":"Daniela Trivella","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABPElEQVRIie2RMUvDQBTH31FoljOuFwrmK7xSSB3UfpWEgi5BCy4FBy2BuARcM/ghAkKpW8Jhu0S6HiilRXDqUBfp0MFLSy00Qeomcj/e8Hjvfjz+HIBC8ReJs2plHbkBaB3CvgZlsNfrbFioIABdbpGB4e2gwEpZNgyQSwV+UPTBcxLP8AQaFe6zGTKzxvf643EbzHrFe4pIb7StGOm5nYTYBKo7vhEiq3a5foZ2CtXH+/6pIOnltoKxi5xiCSglXo0iI11OLeb4YKNwLUF8O6cMp8gXeL1SFsgaD963cvFZqAh5JYsslc6bjO9Epc2VcpFiiCkmAQ4oTUlnEiBrhpzWZRZWjV77lnDSnKIP3dps3r460AJtHM/bR8d3t4E1kY2JL967+OjllDV0e8CWtfnT3WC/e65QKBT/li+BrW6TD5J/ygAAAABJRU5ErkJggg==","orcid":"","institution":"Brazilian Center for Research in Energy and Materials","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Daniela","middleName":"","lastName":"Trivella","suffix":""}],"badges":[],"createdAt":"2022-06-03 00:14:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1720953/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1720953/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":23467032,"identity":"f6748c6f-b366-4cf2-8fd6-03d6d8856292","added_by":"auto","created_at":"2022-07-05 16:48:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":115807,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDevelopment of a biochemical assay for the identification of compounds that disrupt the SARS-CoV-2 N protein-RNA interaction\u003c/strong\u003e. A) Nucleotide sequences of the RNA molecules used as N-protein ligands. B) FP assay showing the binding affinity curves of the N protein with the FITC-labelled RNA probes 1 to 5 and the corresponding binding equilibrium constants (K\u003csub\u003eD\u003c/sub\u003e) determined by FP. High-affinity binding was observed with RNAs 1 and 3 derived from the putative SARS-CoV-2 PS sequence. The mutated RNA sequences 2 and 4, and RNA5, used as a negative control, show, in comparison, much lower binding affinities. Error bars represent standard deviation of the means from triplicate experiments. C) Scatterplot of HTS results showing the binding percentage of each compound in the library calculated using polarization data from negative (RNA alone) and positive (RNA plus protein) controls. Seventy-eight compounds reduced the binding of the N protein to RNA1 to less than 30%, of which 46 were selected for concentration-dependent assays. D) Z' values obtained for each assay plate confirming the robustness of the HTS trials.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/c3c5b8dcdc276eb740e225e5.png"},{"id":23467033,"identity":"35f4f07a-9715-45cf-9ff5-739e6e54fa9a","added_by":"auto","created_at":"2022-07-05 16:48:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":124978,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConcentration-response curves and chemical structures of compounds identified as submicromolar N-protein-RNA1 disruptors in the HTS trials\u003c/strong\u003e. Curves were measured in triplicates, normalized to positive and negative controls and fitted with the log 4-parameter curve in GraphPad Prism.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/ab880e3ef983a2699b52694b.png"},{"id":23465497,"identity":"b1b97e83-6b65-4930-a021-c6d7b1856545","added_by":"auto","created_at":"2022-07-05 16:43:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":85141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChicoric acid (CA) is a nanomolar N-protein affinity ligand that binds the CTD and promotes dissociation of the N protein-RNA1 complex\u003c/strong\u003e. A) ITC assay showing the thermodynamic parameters of interaction between the N protein and CA. The N protein (20 µM) was titrated against AC (250 µM). The data were fitted to a One Set of Site model to determine the binding stoichiometry (n), binding enthalpy change (ΔH) and association constant (K\u003csub\u003eA\u003c/sub\u003e). The results are expressed as an average of three replicates. B) Dissociation curve showing that CA promotes the dissociation of previously formed N protein-RNA1 complex with a K\u003csub\u003eD\u003c/sub\u003e value of 41.1 ± 11.7 µM. C) One-dimension \u003csup\u003e1\u003c/sup\u003eH-STD NMR spectra of CA in the presence of N protein (full-length), CTD or NTD. The relative degree of saturation of each hydrogen atom of CA is mapped onto each spectrum and normalized by hydrogen H1.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/4d3e7b25fe2f8fadc6ab7b54.png"},{"id":23465496,"identity":"60d781f6-03f3-48ba-8705-ba9c3679f6e4","added_by":"auto","created_at":"2022-07-05 16:43:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":317725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe crystal structure of SARS-CoV-2 N protein CTD binding chicoric acid (CA) reveals a network of polar contacts and structural readjustments to accommodate the symmetric ligand in the CA-N protein binding site. \u003c/strong\u003eA) Cartoon representation of the N protein CTD dimer crystal structure\u0026nbsp;depicting its secondary structure elements (in blue), including two 3\u003csub\u003e10\u003c/sub\u003e (η) helices, five α-helices and two antiparallel β-strands and the CA binding site (inset highlighted by the blue dashed square). B) Detailed CA-binding site from the inset of panel A. The CA molecule is represented as sticks (orange) with its electron-density map in blue. CA binds to a shallow pocket formed between α-helices 1-2 and η-helix 2, close to the C-terminus (C-Ter). C) CA atomic interactions with the N protein residues. The CA carboxyl groups are at ideal distances to engage electrostatic interactions and hydrogen bonds with Arg276 side chain (NH1 atom), Arg277 main chain amine and a structural water molecule (W288) stabilized by Arg276 NH2. Thr271 and Gln289 can further position hydrogen bond donors (Thr271O\u003csup\u003e𝛾\u003c/sup\u003e and a structural water molecule, W478, stabilized by the Gln289 carbonyl) to engage a symmetric interaction with the carbonyl groups from both caffeoyl units of CA. One of the catechol motifs of CA is well accommodated near the C-terminal Pro364, showing a well-defined electron density (vide panel B). D, E) Superposition of the CA-binding site in the native N protein CTD (blue sticks, PDB ID 7UXX) and CA-N protein CTD complex (grey sticks (PDB ID 7UXZ)) highlighting structural readjustments induced by CA binding (highlighted by red arrows). Figures were generated with Pymol (Schroedinger Inc.). Polar contacts are indicated by dashed lines with the measured distances in Angstroms. Oxygen atoms are shown in red, nitrogen atoms in blue. Water molecules are represented as red spheres.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/d242ed11a108c672c02796a5.png"},{"id":23467734,"identity":"dc7a9608-0cbf-4be4-9c11-922e8dc8168b","added_by":"auto","created_at":"2022-07-05 16:53:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":465484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChicoric acid (CA) binding to SARS-CoV-2 N protein CTD changes the topology and electrostatic character of the putative RNA-binding region with implications to RNA binding.\u0026nbsp;\u003c/strong\u003e A) N protein CTD electrostatic potential with red and blue colors indicating negative and positive potentials, respectively (please refer to the electrostatic scale bar). The positively charged groove, formed by Lys256, Lys257, Lys259 Lys261 and Arg262, is thought to contribute for RNA binding. G) The positively charged groove depicted in panel A extends towards the CA-binding pocket through Arg259, Arg276, Arg277 and Arg293. The eletrostacic potentials calculated from the CA-N protein CTD (PDB ID 7UXZ) and native N protein CTD (PDB ID 7UXX) crystal structures are shown. Figures and electrostatic potential were generated with Pymol (Schroedinger Inc.). C,D) Structural alignment between the CTD-CA complex and a model of the N protein complexed with an RNA.\u003cstrong\u003e \u003c/strong\u003eThe CTD chain (grey\u0026nbsp;cartoon) complexed with CA (orange sticks) was superposed to two CTD chains from a N protein model complexed with RNA (cyan), which shows two distinct RNA-binding modes\u003csup\u003e40\u003c/sup\u003e. In the first alignment (C), the CA molecule fully occupies the predicted RNA-binding site, whereas in the second alignment (D), the CA site is near the RNA-binding site.\u0026nbsp;In both scenarios CA should interfere in N protein binding to RNA.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/9fedabf3fe72fb81e0cdbca0.png"},{"id":23467030,"identity":"92524522-a8ee-4012-a34a-9bbbcde8ba6a","added_by":"auto","created_at":"2022-07-05 16:48:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":49644,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-SARS-CoV-2 activity of CA in cell assays\u003c/strong\u003e. \u003cem\u003eIn vitro\u003c/em\u003e replication assays performed in Vero CCL81 (A) and Calu-3 (B) cells. Cells were infected with SARS-CoV-2 for 1h and later incubated with fresh media containing CA at 25 µM or 100 µM. The viral load was quantified by the plaque assay (PFU/ml) in the cell supernatants collected 48 h post-infection. C) Virucidal assays performed in Vero CCL-81 cells, where SARS-CoV-2 particles were incubated with CA at 25 µM or 100 µM for 1h and then used to infect the cells for 1h. The viral load was quantified using the plaque assay to assess the infectious viral progeny. DMSO at 0.2% final concentration was used as control. P ≤ 0.05 (*), P ≤ 0.01 (**), P ≤ 0.001 (***). Results are expressed as individual values (n=8 for replication assay and n=4 for virucidal assay) with mean +/- standard deviation.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/0827856704df96c41a710e43.png"},{"id":23467756,"identity":"7e4151ab-f440-4ea2-9ddc-3320fbd02f0c","added_by":"auto","created_at":"2022-07-05 16:53:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1796697,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/95ce59a8-49dc-42f3-b130-0d600881bd82.pdf"},{"id":23465501,"identity":"f595ccff-6aac-4d2d-bf1e-39101f70a94e","added_by":"auto","created_at":"2022-07-05 16:43:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4230806,"visible":true,"origin":"","legend":"","description":"","filename":"20220516SIMercaldiBezerraBatistaetalchicoricacidasNproteinligand.docx","url":"https://assets-eu.researchsquare.com/files/rs-1720953/v1/1650aa209df812f2e6f52463.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Discovery and structural characterization of chicoric acid as a SARS-CoV-2 nucleocapsid protein ligand and RNA binding disruptor","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe historic COVID-19 pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has caused millions of deaths worldwide and affected the world\u0026rsquo;s economy in an unprecedented way\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Despite the enormous efforts of the scientific and medical community to find drugs to fight the disease since its emergence in late 2019, only three small molecule drugs are currently authorized for clinical use. Remdesivir\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e and Molnupiravir\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e are nucleoside analogues with limited efficacy\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, whereas Nirmatrelvir\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, a peptide inhibitor of the 3CL protease, developed by Pfizer, is used in combination with Ritonavir and sold under the brand name Paxlovid\u0026trade;. Although these are promising drugs, kidney and liver toxicity and the potential incompatibility of the Paxlovid combination with other drugs may limit their use to the broad population\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Moreover, the continued emergence of new, more contagious SARS-CoV-2 variants challenges the efficacy of vaccines currently in use\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Therefore, the development of new and specific drugs capable of treating SARS-CoV-2 infections is still an urgent medical need.\u003c/p\u003e \u003cp\u003eTo accelerate the discovery of novel anti-SARS-CoV-2 drug candidates, as well as the repurposing of existing drugs, several high-throughput screening (HTS) campaigns have been performed in the last two years. Such assays have explored the biological activities of several SARS-CoV-2 proteins, including the main 3C-like (3C-L) and papain-like (PL-Pro) proteases, the RNA polymerase and the spike (S) and envelope (E) structural proteins\u003csup\u003e\u003cspan additionalcitationids=\"CR10 CR11 CR12 CR13\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In addition, numerous cell-based screening assays with SARS-CoV-2 have also been recently reported\u003csup\u003e12,15\u0026minus;18\u003c/sup\u003e. Unlike the S and E proteins, however, the structural nucleocapsid (N) protein, the most abundantly expressed SARS-CoV-2 protein in infected cells, has not been fully exploited as a target for drug development against SARS-CoV-2\u003csup\u003e19\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe N protein is a phosphoprotein that plays fundamental roles in the virus life cycle, including transcription initiation and packaging of the viral genomic RNA\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. This protein has a domain architecture comprising two structured RNA-binding modules, the N-terminal (NTD) and C-terminal (CTD) domains, connected by an intrinsically disordered serine and arginine-rich (SR) linker\u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The NTD is implicated in the binding and melting of regulatory elements required for transcription initiation\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, whereas the CTD drives protein dimerization and is thought to bind the RNA packaging signal (PS) during virus particle assembly\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Phosphorylation of the SR linker by host cell kinases, on the other hand, has been shown to modulate the RNA-binding activity of the protein and lead to liquid-liquid phase separation with the viral RNA\u003csup\u003e\u003cspan additionalcitationids=\"CR27 CR28\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Thus, given its importance in the various stages of the virus replication cycle, the N protein is considered a promising target for the development of SARS-CoV-2 replication inhibitors.\u003c/p\u003e \u003cp\u003eWe report here a novel fluorescence polarization-based HTS assay to identify small molecules that can disrupt the interaction of the N protein with an RNA probe derived from the putative SARS-CoV-2 PS sequence. After screening a customized compound library of approximately 3200 bioactive compounds, several phenolic compounds, including L-chicoric acid (CA), showing \u003cem\u003eIC\u003c/em\u003e\u003csub\u003e50\u003c/sub\u003e values for RNA probe displacement in the low to sub-micromolar ranges, were identified as potential N protein ligands. Complementary orthogonal biophysical methods, including isothermal titration calorimetry (ITC) and \u003csup\u003e1\u003c/sup\u003eH-saturation transfer difference (STD) NMR further revealed that CA binds to the CTD. This was confirmed by the crystal structure of the CTD in complex with CA, determined at 1.7 \u0026Aring; resolution, which represents the first CTD structure bound to a small molecule. In addition, we show that CA inhibited SARS-CoV-2 replication in human lung cells, further suggesting that it may influence N protein-mediated RNA packing \u003cem\u003ein vivo\u003c/em\u003e. Taken together, our data provide the first evidence of pharmacologically targeting the SARS-CoV-2 N protein with small molecules, thus paving the way for the rational design of new N protein modulators.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDevelopment of an HTS assay to find small molecules capable of inhibiting the RNA-binding activity of the N protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to establish an assay for the identification of potential inhibitors of the N protein RNA-binding activity, we\u0026nbsp;first searched for an N protein target RNA, and the SARS-CoV-2 PS sequence was a candidate. The putative PS of the SARS-CoV-2/SP02/human/2020/BRA strain (nucleotides 19785-20364) was identified by sequence alignment to the SARS-CoV and MERS-CoV PS sequences\u003csup\u003e30,31\u003c/sup\u003e. Within this sequence, we selected the CACUCACUGUCUUUUUUGAUGGUAGAGU stem loop (RNA1) as an N protein target (Figure 1A) because this stem loop is conserved in all SARS-CoV-2 genomes and has an invariable \u0026lsquo;UUUUUU\u0026rsquo; motif at the loop.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe RNA-binding activity of the N protein was monitored by a fluorescence polarization (FP) assay using distinct 5\u0026rsquo;-FITC-labeled RNAs as probes. In addition to RNA1, four other probes were tested (Figure 1A). In the RNA2 probe (CACUCACUGUCAAAAAAGAUGGUAGAGU) the \u0026lsquo;UUUUUU\u0026rsquo; motif was replaced by \u0026lsquo;AAAAAA\u0026rsquo;, whereas in RNA3 (CACUCACUGUCUUUUUU), the stem loop 5\u0026rsquo; arm was deleted. RNA4 (CACUCACUGUC) also lacked the \u0026lsquo;UUUUUU\u0026rsquo; motif, while RNA5\u0026nbsp;(AUAUAGCUAC) served as a scramble negative control (Figure 1A). As shown in Figure 1B, optimum binding was observed with the RNA probes 1 and 3 (K\u003csub\u003eD\u003c/sub\u003e= 124.2 \u0026plusmn; 6.5 and 148.6 \u0026plusmn; 7.1 nM), respectively, suggesting that the \u0026lsquo;UUUUUU\u0026rsquo; motif, but not the hairpin structure, is critical for the interaction with the N protein. Therefore, RNA1 was chosen for the establishment of the protein-RNA dissociation assay used in our HTS trials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHTS campaigns reveal polyphenols as privileged scaffolds that disrupt the binding of the N protein to the target RNA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing the identification of RNA1 as a high-affinity N protein-binding probe, an FP assay was developed. After checking the assay performance under the screening conditions (Figure S1A), we conducted an HTS campaign testing a library of ~3200 approved drugs and bioactive molecules (Figure 1C). Differential values of approximately 170 mP were observed between the positive and negative controls (Figure S1B), resulting in Z\u0026rsquo; scores greater than 0.7 for all tested plates (Figure 1D). Thus, the robustness of the HTS assay allowed us to reliably select hit candidates for concentration-response follow-up experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe first criterium for selecting hit candidates from the primary screening was to choose small molecules that reduced the binding of the N protein to RNA1 to less than 30% (Figure 1C), which resulted in a list of 78 compounds. From this preliminary list, 33 compounds were flagged due to autofluorescence, interference with the fluorescence or polarization of the free probe. These criteria led us to select 45 hit candidates, representing an overall hit rate of 1.4%.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo confirm the activity of the hit candidates as inhibitors of the N protein-RNA1 interaction, the selected compounds were subjected to concentration-response experiments and 44 of them had their inhibitory activity confirmed (Table 1). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e. List of selected hit molecules retrieved from the HTS campaign as potential N-protein ligands. Compounds are ranked by their IC\u003csub\u003e50\u003c/sub\u003e values for blocking the N protein-RNA1 interaction. Phenyl propanoids with dicaffeoyl motif are highlighted in bold.\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"44%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompound\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIC\u003csub\u003e50\u003c/sub\u003e (\u0026micro;M)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+Error*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.5%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-Error*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eChebulinic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003e\u003cstrong\u003eL-Chicoric acid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003ePunicalagin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003ePunicalin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSuramin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eTannic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eChlorophyllin B\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e2.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eCorilagin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e2.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003e\u003cstrong\u003e4,5-Dicaffeoylquinic acid\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eMethyl Blue\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e4.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eEmbelin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e5.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eLinaclotide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e5.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIsochlorogenic acid A\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e5.5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSennoside A\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e5.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eLusutrombopag\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e6.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003e(R)-(-)-Gossypol acetic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e6.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eIdasanutlin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e6.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSulfamerazine\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e6.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eEltrombopag\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e7.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eGossypol acetic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e7.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eIOWH-032\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e7.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eAnacardic Acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e7.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003ePranlukast (hemihydrate)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e7.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eEltrombopag\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e8.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSuccinobucol\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e8.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eRNPA1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e9.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eTMC647055\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eMontelukast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eMicafungin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eZafirlukast\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eResazurin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eVerteporfin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e3.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e2.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eChlorophyllin A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e10.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSurfactin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e11.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003ePentagalloylglucose\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e11.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eHexachlorophene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e13.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eErtapenem sodium\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e13.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eMK 0893\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e14.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0,9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eButenafine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e15.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eOleic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e15.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSimeprevir\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e16.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eSofalcone\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e18.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e1.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eBithionol\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e23.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e5.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e4.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"44%\"\u003e\n \u003cp\u003eGallic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.75%\"\u003e\n \u003cp\u003e23.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.75%\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.5%\"\u003e\n \u003cp\u003e2.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*Reported errors are deviation from mean value for upper (+Error) and lower (-Error) limits of 95 %\u0026nbsp;confidence intervals\u003c/p\u003e\n\u003cp\u003eMany of the compounds that impaired the binding of the N protein to RNA1 are highly polar. Chebulinic acid (CI), CA, punicalagin (PG), punicalin (PL) and suramin (SU) are submicromolar N protein-RNA1 disruptors (Figure 2). When the N protein was titrated against RNA1 in the presence of CI, CA or PG, we observed that the binding affinity of the N protein to RNA1 was significantly reduced, as revealed by the higher K\u003csub\u003eD\u003c/sub\u003e values (Figure S2A), indicating that these compounds inhibit the formation of the N protein-RNA1 complex.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCA binds the CTD and promotes dissociation of the N protein-RNA1 complex\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBecause caffeic acid derivatives have been recently described as potential inhibitors of SARS-CoV-2 infection\u003csup\u003e32\u003c/sup\u003e and CA exhibits antiviral activity against HIV and hepatitis B virus (HBV)\u003csup\u003e33\u0026ndash;35\u003c/sup\u003e, we decided to further investigate the properties of CA as an N protein ligand. First, the binding affinity of CA for the N protein was determined by ITC, which provided the thermodynamic signature of binding, including K\u003csub\u003eD\u003c/sub\u003e, stoichiometry and both the enthalpic and entropic contributions. The results confirmed that CA binds to the N protein with a K\u003csub\u003eD\u003c/sub\u003e of 250 \u0026plusmn; 7.9 nM at a protein:ligand ratio of 2:1 (Figure 3A), this ratio indicating that there is one CA site per N protein dimer. In addition, the ITC results suggested that the CA binding to the N protein is enthalpy driven.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGiven that CA binds to the N protein at nanomolar concentrations, we decided to investigate whether CA could dissociate the N protein-RNA1 complex. In line with the results shown in Figure S2A, we found that CA promoted the dissociation of previously formed N protein-RNA1 complex with a K\u003csub\u003eD\u003c/sub\u003e value of 41.1 \u0026plusmn; 11.7 \u0026micro;M\u0026nbsp;(Figure 3B). Although this dissociation constant is much higher than the K\u003csub\u003eD\u003c/sub\u003e for the CA-N protein interaction, the results are consistent with\u0026nbsp;the fact that RNA1 has a higher binding affinity for the N protein than CA (Figure 1B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFinally,\u0026nbsp;the interaction of CA with the N protein was examined by the \u003csup\u003e1\u003c/sup\u003eH-STD NMR technique, which allows the identification of the binding epitopes of a ligand when bound to a receptor protein. The results confirmed that CA produces clear STD signals which were mapped to its chemical structure (Figure 3C). Judging by the signal intensity, hydrogen H1 (100% intensity), in CA\u0026rsquo;s tartaric acid unit, appears to be the most directly involved in N protein binding and thus in closer contact with the protein. In comparison, the H2, H3, H4, H7 and H8 hydrogens, which form the dicaffeoyl units, showed STD signal intensities varying from 70 to 90% (Figure 3C). Importantly, we found that the STD signals were observed with the full-length protein and CTD, but not with the NTD. This suggests the CA-binding site is located on the CTD of N protein.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTogether, these results show that CA is a nanomolar N-protein affinity ligand that binds to the CTD and displaces the RNA from the N protein at micromolar concentrations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe binding mode of CA to the CTD and structural consequences for N protein function\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insights into the binding mode of CA to the N protein, we determined the crystal structure of the CTD in complex with this ligand. CTD crystals belonged to the space group\u003cem\u003e\u0026nbsp;P\u003c/em\u003e 2\u003csub\u003e1\u003c/sub\u003e2\u003csub\u003e1\u003c/sub\u003e2\u003csub\u003e1\u003c/sub\u003e, with Matthews coefficient\u003csup\u003e36\u003c/sup\u003e of 2.20 \u0026Aring;\u003csup\u003e3\u003c/sup\u003e Da\u003csup\u003e\u0026minus;1\u003c/sup\u003e and solvent content of 44.2%. Datasets for the CTD alone (apo CTD \u0026ndash; PDB entry: 7UXX) and in complex with CA (CTD-CA \u0026ndash; PDB entry: 7UXZ) were scaled to resolutions of 1.85 and 1.73 \u0026Aring;, respectively. The phases were recovered by molecular replacement, using a previously described SARS-CoV-2 CTD crystal structure (PDB code: 7C22) as the search model\u003csup\u003e37\u003c/sup\u003e. The models were refined to R\u003csub\u003ework\u003c/sub\u003e/R\u003csub\u003efree\u003c/sub\u003e values of 17.2 / 20.3% (apo CTD) and 17.4 / 21.5% (CTD-CA). Data collection and refinement statistics are summarized in Table S1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSix molecules organized as three dimers were found in the asymmetric unit of the CTD. Each protomer in the structures is comprised of five \u0026alpha;-helices, two 3\u003csub\u003e10\u003c/sub\u003e (\u0026eta;) helices and two antiparallel \u0026beta;-strands (Figure 4A). As reported previously\u003csup\u003e37\u003c/sup\u003e, the CTD dimer is stabilized by extensive hydrogen bonds connecting the \u0026beta;2 strands and the interaction of residues from the loop between \u0026alpha;-helices 1-2 (Arg277, Gly278, Glu280, Gln283 and Asn285). \u0026beta;-strand 1 and \u0026alpha;-helix 4 (Gly316, Arg319 and Ile320) also play an essential role in stabilizing the dimer. In addition, the \u0026beta;-hairpins (Leu331 \u0026ndash; Leu339), \u0026alpha;-helices 3-4 (Ile304, Ala305, Phe314 and Phen315) and \u0026alpha;-helix 5 (Phe346 \u0026ndash; Leu353) form a hydrophobic core stabilized by Van der Waals interactions across the amino acid side chains.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCA binds to a shallow pocket (volume of ~190 A\u003csup\u003e3\u0026nbsp;\u003c/sup\u003e) formed between \u0026alpha;-helices 1-2 and \u0026eta;-helix 2,\u0026nbsp;close to the C-terminus (Figure 4B). In accordance to the ITC data, only one CA molecule bound to one of the CTD protomers was unambiguously found by inspecting the 2\u003cem\u003eF\u003c/em\u003e\u003csub\u003eo\u003c/sub\u003e-\u003cem\u003eF\u003c/em\u003e\u003csub\u003ec\u003c/sub\u003e electron-density map. Nevertheless, this map only partially covers the CA aromatic ring most exposed to solvent (Figure 4B).\u003c/p\u003e\n\u003cp\u003eA close inspection of the structural complex shows that the binding of CA to the CTD is stabilized mainly by polar contacts of the carboxylate and carbonyl groups from CA\u0026rsquo;s tartarate and caffeoyl units, involving Arg276/Arg277 and three structural water molecules (Figure 4C). \u0026nbsp;The structure of the complex also shows one CA catechol ring laid inside a hydrophobic canyon formed by \u0026eta;-helix 2, \u0026alpha;-helix 2 and the last two C-terminus residues (Phe363 and Pro364).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWhen the apo and complexed structures were superposed, we observed no significant changes in the overall structures, as judged by the C\u0026alpha; RMSD (0.19 \u0026Aring; deviation). However, we noticed clear conformational changes in the side chains of Phe363, Pro364, Gln289 and Arg276, which contributed to the widening of the CA pocket (Figure 4D and Figure 4E). Arg276 had moved outwards, positioning its guanidine group at ideal distances to form electrostatic (NH1) and water-mediated (NH2) hydrogen-bond interactions with CA\u0026rsquo;s carboxylate group. Arg277\u0026rsquo;s main chain amine was already at ideal distances to engage in a hydrogen bond with CA\u0026rsquo;s other carboxylate group. Arg277 N\u003csup\u003e\u0026epsilon;\u003c/sup\u003e atom could further form a water-bridged hydrogen bond with Thr271 (Figure 4D), which might probably contribute to stabilizing the polar contact network within the CA-N protein binding site. The catechol ring was also predicted to be important in ligand binding, since Gln289\u0026rsquo;s polar side chain was turned outwards the pocket, exposing its aliphatic region to the apolar pocket formed by Pro364, Phe363, thus favouring the accommodation of one of CA\u0026rsquo;s catechol rings, which in turn showed clear electron density (Figure 4E).\u003c/p\u003e\n\u003cp\u003eThe CTD structure in its apo form shows an electrostatic potential distribution that is conserved amongst all N proteins from the \u003cem\u003eCoronaviridae\u0026nbsp;\u003c/em\u003efamily\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e21,37\u003c/sup\u003e,\u0026nbsp;with a major positively charged groove located on one side of the dimer surface (Figure 5A). This region, which is composed by Lys256, Lys257, Lys259 Lys261 and Arg262, is thought to contribute to RNA binding\u003csup\u003e38\u0026ndash;40\u003c/sup\u003e. We observed that the positively charged groove extended towards the CA-binding pocket through Arg259, Arg276, Arg277 and Arg293 (Figure 5B). Notably, the binding of CA to the CTD not only changes the topology of this region, but also disrupts the continuity of such potential RNA-binding region, with the possibility to affect N protein binding to RNA in a direct (Figure 5C) or indirect way (Figure 5D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCA displays anti-SARS-CoV-2 activity in \u003cem\u003ein vitro\u003c/em\u003e cell assays\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter confirming CA as an N protein ligand with potential implication on its RNA binding function, we tested if CA could inhibit SARS-CoV-2 infection \u003cem\u003ein vitro\u003c/em\u003e. For this,\u0026nbsp;Calu-3 and Vero CCL81 cells were seeded into 24-well plates at 2x10\u003csup\u003e5\u003c/sup\u003e and 2.5x10\u003csup\u003e5\u003c/sup\u003e cells/well, respectively, and infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 1. CA was added to the cell culture medium after infection at 25 and 100 \u0026micro;M final concentrations, whereas DMSO at 0.2% was used as a vehicle control. Assessment of the viral load in the cell culture supernatants collected 48 h post-infection indicated that CA presented antiviral activity at 100 \u0026micro;M only, relative to untreated (vehicle) control. CA treatment caused 10-fold and 100-fold reductions in infectious viral load in Vero CCL81 (p\u0026lt;0.001 - Figure 6A) and Calu-3 (p\u0026lt;0.01 - Figure 6B), respectively. Both cell lines remained viable when treated with CA or DMSO at the tested concentrations (Figure S3). In addition, CA displayed only a slight virucidal activity against SARS-CoV-2 (p\u0026lt;0.05 - Figure 6C), indicating that the observed antiviral effect of CA cannot be attributed to direct action on viral particles. These results thus show that CA inhibits SARS-CoV-2 replication in cell culture at micromolar concentrations, which is consistent with the K\u003csub\u003eD\u003c/sub\u003e values for the N protein-RNA1 complex dissociation (Figure 4B).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite the great success of newly developed vaccines to prevent contagion and severe forms of infection by SARS-CoV-2, infections are still present, and new waves of contamination by viral variants are recurrent. In this sense, antiviral drugs are needed to improve patient recovery and to prevent disease progression, especially to at-risk patients. The development of such antiviral drugs, in many cases, requires knowledge of the structure and function of potential viral targets and the discovery and characterization of small-molecule modulatory binding sites in these proteins, that afford for structure-based drug design (SBDD) approaches\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this work, we describe a novel fluorescence-based high-throughput screening assay that allows the identification of small molecules that interfere with the RNA-binding activity of the SARS-CoV-2 N protein, the most abundant viral protein expressed in host cells, and which plays fundamental roles in transcriptional regulation and virus assembly\u003csup\u003e\u003cspan additionalcitationids=\"CR21 CR22 CR23 CR24 CR25 CR26 CR27 CR28\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. We further characterized the top hits using a cascade of biophysical assays, and solved, for the first time, the crystal structure of the N protein CTD binding a non-endogenous ligand, chicoric acid, further revealing a new modulatory site in the SARS-CoV-2 N protein.\u003c/p\u003e \u003cp\u003eBy screening a customized library of bioactive small molecules (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), highly polar compounds stood out, highlighting polyphenols (ellagitannins, CI, PG and PL), a diester of tartaric acid (chicoric acid, CA) and a polysulphonated naphthylurea (suramin, SUR) \u0026ndash; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The latter compounds were capable of disrupting the interaction of the full-length SARS-CoV-2 N protein with an RNA probe derived from the SARS-CoV-2 PS sequence (RNA1) in the submicromolar range (Figure S2).\u003c/p\u003e \u003cp\u003eIn accordance with the literature, the antiparasitic drug suramin is reported to inhibit SARS-CoV-2 infection in cell culture at 20 \u0026micro;M, by interfering with early steps of virus replication\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. The natural ellagitannins CI, PG and PL have already been reported to exhibit diverse biological properties\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, including antiviral activity against multiple human viruses with \u003cem\u003ein vitro\u003c/em\u003e potencies in the low micromolar range \u003csup\u003e\u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Other polyphenols, like catechin gallate and gallocatechin gallate, have also been shown to reduce the binding affinity of an RNA oligonucleotide to the N protein of SARS-CoV, causative of the 2003 coranavirus outbreak, on a biochip assay\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eChicoric acid (CA), a symmetric dicaffeoyl ester of tartaric acid, was highlighted in the present study as a new class of N protein modulator and one of the most potent hit compounds identified in our HTS trials. Importantly, the binding of CA to the N protein could be fully characterized by biophysical methods (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and the crystal structure of CA binding to the SARS-CoV-2 N protein CTD could be determined at 1.7 \u0026Aring; resolution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Although polyphenols have been shown to interfere with coronavirus N proteins before\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e and compound PJ34 (SARS-CoV NTD \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e) and GTP (SARS-CoV-2 CTD) interacted with N proteins, our data show that CA is a new class of N protein ligand that binds to a new modulatory site on the SARS-CoV-2 N-protein CTD. Importantly, the CA-binding site is conserved in SARS-CoV and partially conserved in MERS N proteins (Figure S4). To our knowledge, this is the first description of a non-endogenous SARS-CoV-2 N protein ligand and the first report of this modulatory ligand binding site on a coronavirus N protein.\u003c/p\u003e \u003cp\u003eWe present evidence that the N protein CTD is sufficient for interaction with CA, as spotted by the \u003csup\u003e1\u003c/sup\u003eH-STD NMR experiment carried out with the full length, CTD and NTD SARS-CoV-2 N protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The crystallographic data further confirmed that CA binds to the SARS-CoV-2 N protein CTD in a shallow pocket located close to the CTD C-terminus and to the putative positively charged RNA binding groove (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). CA binding to N protein is stabilized mainly by a polar contact network involving ionic interactions of CA\u0026rsquo; symmetric carboxylates with the N protein\u0026rsquo;s arginines and water-mediated hydrogen bonds of its caffeoyl carbonyl groups. One of the catechol rings of CA is further involved in ligand binding and induces conformational changes in the N protein, by docking to a hydrophobic pocket formed in the CA-binding site upon ligand binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe two carboxylate and two caffeoyl ester moieties seem important for binding to the N protein and to induce conformational changes that affect its RNA binding function. In addition to the crystallographic observations, an initial structure-activity relationship (SAR) analysis could be performed based on 16 compounds assessed in our screening efforts containing caffeoyl substructures. Those bearing two caffeoyl esters clearly stand out (Figure S5A). In CA, the most potent derivative (IC50\u0026thinsp;=\u0026thinsp;0.5 \u0026micro;M), the dicaffeoyl units are bound to tartaric acid, whose carboxylate moieties\u0026rsquo; contribution for protein binding have been established (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The other three dicaffeoyl derivatives are isomers of dicaffeoylquinic acid, showing at least 10-fold loss in IC50 values (Figure S5B). Assuming that they bind to the same site as CA, one can perceive that the caffeoyl esters could occupy similar positions, especially for 4,5-dicaffeoylquinic acid and isochlorogenic acid A. However, their single carboxylate moiety at C1 would be further way in comparison to CA, but still able to engage some of the polar contacts observed for CA. This observation can be extended to the other caffeoyl derivatives, such as rosmarinic acid and verbascoside which showed low N protein-RNA1 disruption, and which only contain one or two of the 4 key elements found in CA (Figure S5B).\u003c/p\u003e \u003cp\u003eThe functional effects of CA binding to the SARS-CoV-2 N protein could be further explored in the present work. The CA-binding site in N protein is located adjacent to the main positively charged groove thought to interact with the RNA\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Notably, the binding of CA to the CTD not only alters the topology but also the charge distribution of this region, which might explain why CA disrupts the N protein-RNA1 complex in solution. This hypothesis is additionally supported by a structural model of the SARS-CoV-2 N protein complexed with an RNA molecule, which we have recently reported\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. This structural model presupposes two possibilities: one in which the CA-binding site fully overlaps with the RNA interaction site (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), and the second where the CA site is near the RNA site (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In both scenarios, however, it can be anticipated that the binding of CA to the CTD could preclude RNA interaction, therefore modulating the essential N protein functions related to SARS-CoV-2 genomic RNA binding.\u003c/p\u003e \u003cp\u003eCA showed binding affinities for the N protein of 0.5 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e); nevertheless, the CA equilibrium constant for the N protein-RNA1 complex dissociation was ~\u0026thinsp;40 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Such dissociation constant is consistent with the higher N protein binding affinity exhibited by RNA1, and with the notion that RNA1 has a much larger interaction surface than CA. These data, aligned with the reported low cell permeability of CA\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, also help to explain the relatively high CA concentration required to significantly inhibit SARS-CoV-2 replication in human cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Although further optimization of CA as an antiviral agent is needed, our data offer the structural basis for the rational design and development of novel antiviral drugs targeting the SARS-CoV-2 N protein, an essential and yet underexplored target of coronaviruses.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eProtein expression and purification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe gene sequence corresponding to the full-length\u0026nbsp;SARS-Cov-2\u0026nbsp;N protein (GenBank QIG56001.1) was amplified from SARS-CoV-2 RNA and cloned into a pET28a-TEV vector for the expression of a 6xHis-fusion protein, as previously described\u003csup\u003e51\u003c/sup\u003e. The NTD (residues Q43-E174) and CTD\u0026nbsp;(residues S250-P364)\u0026nbsp;fragments were amplified from the full-length N construct using primers forward (NTD-F 5\u0026rsquo;-AACGTGGATCCCAAGGTTTACCCAATAATACTG-3\u0026rsquo;,\u0026nbsp;CTD-F 5\u0026rsquo;CTAAGGGATCCGCTGCTGAGGCTTCTAAGAAG3\u0026rsquo;) and\u0026nbsp;reverse (NTD-R 5\u0026rsquo;-ACTGCCGCGGCCGCTTTATTCTGCGTAGAAGCCTTTTGG-3\u0026rsquo;, CTD-R 5\u0026rsquo;CTTTTTAGCGGCCGCTTATGGGAATGTTTTGTATGCGTC3\u0026rsquo;), respectively, and inserted into the \u003cem\u003eBamH\u003c/em\u003eI/\u003cem\u003eNot\u003c/em\u003eI sites of a pET-SUMO vector (Invitrogen), carrying a SUMO sequence at the N-terminus. The expression vectors were used to transform \u003cem\u003eEscherichia coli\u0026nbsp;\u003c/em\u003eBL21 (DE3) cells (Novagen, USA). Freshly transformed cells were grown in LB-kanamycin (50 \u0026mu;g/mL) medium to OD600nm\u0026nbsp;0.8 at 37\u0026deg;C. The temperature of the cultures was lowered to 25\u0026deg;C (full-length N) or to 18\u0026deg;C (NTD and CTD), and protein expression was induced with 0.1 mM (full-length N) or 0.5 mM (NTD and CTD) IPTG for 16 h at the respective temperatures. Cells were harvested by centrifugation (4,000 x g, 10 min) and stored at -80\u0026deg;C. To remove nucleic acids of bacterial origin, the proteins were purified under denaturing conditions using urea and high salt concentration\u003csup\u003e26\u003c/sup\u003e. Frozen cell pellets were thawed and resuspended in buffer A (50 mM sodium phosphate, pH 7.6, 500 mM NaCl, 10% glycerol, 20 mM imidazole, 6 M urea) and lysed by sonication on ice. Lysed cells were centrifuged at 18,000 x g for 40 min at 4\u0026deg;C to remove cell debris and the supernatants were applied onto a HisTrap FF 5mL column (GE healthcare) pre-equilibrated with buffer A. After washings, proteins were eluted in ten column volumes of buffer B (50 mM sodium phosphate, pH 7.6, 500 mM NaCl, 10% glycerol, 500 mM imidazole, 3 M urea). Fractions containing the protein of interest were pooled and dialyzed against buffer C (50 mM sodium phosphate, pH7.6, 500 mM NaCl, 10% glycerol) overnight at\u0026nbsp;4\u0026deg;C. Except for the N-full construct, the recombinant proteins (NTD and CTD contructs) were cleaved with the appropriate TEV and SUMO proteases. Cleaved tags were removed by reverse affinity chromatography using buffer A and B without urea. Protein fractions were concentrated and fractionated on a size exclusion Superdex 200 16/600 (full-length N) or Superdex \u0026nbsp;75 16/600 (NTD and CTD) column, previously equilibrated with buffer C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor crystallization tests, the CTD was purified using Turbonuclease from \u003cem\u003eSerratia marcescens\u0026nbsp;\u003c/em\u003e(Sigma, USA). Briefly, bacterial cells after IPTG induction were suspended in lysis buffer (50 mM Tris HCl pH 8.0; 1 M NaCl, 5% glycerol, 1 mM \u0026beta;-mercaptoethanol) containing 200 units of Turbonuclease and lysed by sonication as described above. Lysed cells were centrifuged, and the supernatant was applied onto a HisTrap FF 5mL column pre-equilibrated with buffer D (50 mM Tris HCl pH 8.0, 500 mM NaCl, 5% glycerol, 1 mM \u0026beta;-mercaptoethanol). Bound proteins were eluted using the same buffer containing 500 mM imidazole. The eluate was dialyzed against buffer D overnight at 4\u0026deg;C. After SUMO cleavage and reverse affinity chromatography, the proteins were fractionated on a Superdex \u0026nbsp;75 16/600 column pre-equilibrated with buffer E (20 mM Tris HCl, pH 8.0, 100 mM NaCl, 1 mM \u0026beta;-mercaptoethanol).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe quality of all protein preparations was verified by SDS-PAGE and dynamic light scattering (DLS). In addition, UV absorbance at 260/280 nm was used to estimate the amount of nucleic acid in the protein samples. Only protein samples with a monodisperse character and a 260/280 nm ratio of 0.5-0.6 were used in the experiments described below. \u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFluorescence polarization assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChemically synthesized RNA probes 5\u0026rsquo;-labelled with fluorescein isothiocyanate (FITC) and purified by HPLC were obtained from Thermo Scientific (USA). Probe sequences were as follows: RNA1 (5\u0026rsquo;-CACUCACUGUCUUUUUUGAUGGUAGAGU-3\u0026rsquo;), RNA2 (5\u0026rsquo;-CACUCACUGUCAAAAAAGAUGGUAGAGU-3\u0026rsquo;), RNA3 (5\u0026rsquo;-CACUCACUGUCUUGUUUGAUGGUAGAGU-3\u0026rsquo;), RNA4 (5\u0026rsquo;-CACUCACUGUCUUUUUU-3\u0026rsquo;), RNA5 (5\u0026rsquo;-CACUCACUGUC-3\u0026rsquo;) and scramble control RNA6 (5\u0026rsquo;-AUAUAGCUAC-3\u0026rsquo;),\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFluorescence polarization (FP) assays were used to determine the binding affinity of the N protein to the RNA probes, solubilized in 50 mM sodium phosphate buffer (pH, 7.6). Purified N protein from 2.5 nM to 15 \u0026micro;M in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6) was mixed with each RNA at 10 nM final concentration, in 384-well plates. FP data was acquired using a ClarioStar microplate reader (BMG LabTech), with excitation and emission wavelengths set to 485 and 530 nm, respectively. Affinity binding curves were fitted to a Hill1 model using the OriginPro software.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHight-throughput screening assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA customized library with 3215 nonredundant compounds from the collections \u0026lsquo;FDA-approved\u0026rsquo;, \u0026lsquo;anti-COVID\u0026rsquo;, \u0026lsquo;anti-infection\u0026rsquo; and \u0026lsquo;anti-virus\u0026rsquo;, was purchased from MedChemExpress (NJ, USA). The library, in 384-well plates, was diluted to 1 mM concentration in dimethyl sulfoxide (DMSO) and stored at -20\u0026deg;C. Columns 1, 2, 23 and 24 of all microplates were filled with DMSO for screening controls as described below.\u003c/p\u003e\n\u003cp\u003eBinding of RNA1 to the N protein was monitored by FP, as described above. Screenings were performed in 384-well, flat bottom, black polypropylene microplates (Greiner #781289), using the binding buffer supplemented with 0.01% triton X-100, in a final volume of 25 \u0026micro;L. The final concentration of RNA, N protein, library compound and DMSO were 10 nM, 500 nM, 20 \u0026micro;M and 2% (v/v) respectively. Initially, the assay plates were filled with the RNA probe solution (19.5 \u0026micro;l) using a MultiDrop dispenser (Thermo Fisher) and the compounds (0.5 \u0026micro;l) \u0026nbsp;were transferred from the library to the assay plates in a Janus-MDT liquid handler platform (PerkinElmer). FP measurements were performed at this stage to detect possible interference from library compounds. The N protein (5 \u0026micro;l) was then transferred to all wells of the assay plates using the MultiDrop dispenser, except for columns 1 and 24 which received buffer, RNA and DMSO only, and were used as negative controls (low control, free probe). On the other hand, columns 2 and 23 received buffer, RNA, protein and DMSO, and were considered as positive controls (high control, bound probe). After adding the protein to the assay mix, the plates were incubated at room temperature for 30 min before FP was measured. mP values of positive (100% binding) and negative (0% binding) controls were used for sample data normalization.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConcentration\u0026minus;response curves and IC\u003csub\u003e50\u003c/sub\u003e determination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the activity and evaluate the potency of selected hit candidates, hit compounds were subjected to dose-response assays. Except for compound concentration, the assay conditions were as described above, where 0.5 \u0026micro;L of the compounds were transferred to the assay plates generating a concentration gradient from 1.8 nM to 50 \u0026micro;M. The concentration-response assays were performed in triplicates and after acquisition of the FP data, the percentage of inhibition for each test compound was calculated as follows: % inhibition = (high control average \u0026ndash; read value)/(high control average \u0026ndash; low control average) \u0026times; 100. Normalized data was fit to the log4 parameters equation with variable slope to extract the \u003cem\u003eIC\u003c/em\u003e\u003csub\u003e50\u003c/sub\u003e values with GraphPad Prism 9 (GraphPad LLC, v. 9.3.1). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiophysical analysis and hit confirmation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAggregation assays were performed with the full-length N protein diluted to 10\u0026nbsp;\u0026micro;M in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6), with subsequent addition of 20\u0026nbsp;\u0026micro;M of each test compounds or 1% DMSO used as diluent. The same assay was performed with the protein at\u0026nbsp;2.5 \u0026micro;M in the presence of 500 \u0026micro;M CA.\u0026nbsp;Samples were evaluated by DLS in a ZetaSizer NanoS (Malvern) equipment, at 10\u0026deg;C, using default parameters set by the equipment.\u003c/p\u003e\n\u003cp\u003eThe affinity of RNA1 for the N protein in the presence of selected hit compounds was inspected by FP. Serial dilutions of the protein:compound mixtures at a 1:2 ratios were prepared\u0026nbsp;in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6). RNA1 at 10 nM was added to the serial dilutions and FP measurements were performed as described above.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo determine the amount of CA required for N protein-RNA1 dissociation, purified N protein at 2.5 \u0026micro;M in 50 mM sodium phosphate buffer, 100 mM NaCl (pH, 7.6) was incubated 10 nM RNA1 at 4 \u0026deg;C for 60 min prior to the addition of increasing amounts of CA up to 500 \u0026micro;M. The FP data were acquired as described above and the affinity binding curves were fitted to a Hill1 model using the OriginPro software.\u003c/p\u003e\n\u003cp\u003eThe dissociation constant and thermodynamic parameters for the N protein-CA interaction were determined by ITC using a a VP-ITC calorimeter (Malvern). Purified N protein was dialyzed against 50 mM sodium phosphate buffer, 500 mM NaCl (pH, 7.6), overnight at 4 \u0026deg;C, and further diluted to 20 \u0026micro;M. The dialysis buffer was used to prepare CA at 250 \u0026micro;M. Both solutions, from cell and syringe, were prepared in the presence of 0.25% DMSO. \u0026nbsp;CA was titrated against the protein solution (10 \u0026micro;L injections) at 20 \u0026deg;C with 300 s intervals. CA titrations against the buffer and buffer titrations against the protein solution were performed as controls. The isotherm curves, after subtracting the controls, were analyzed using the Microcal Origin software provided with the equipment, and the data were fitted to One Set of Sites model.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein crystallization and X-ray data collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFreshly prepared CTD\u003csup\u003e\u0026nbsp;\u003c/sup\u003esamples at 8 mg/mL were subjected to hanging-drop vapor diffusion crystallization trials performed in 24-well VDX plates at 18\u003csup\u003eo\u003c/sup\u003eC using\u0026nbsp;Hampton Crystal Screen HT\u0026trade; solutions. After optimizing the crystallization conditions, CTD crystals were obtained within three days in 100 mM Tris -HCl (pH 8.3), 30% PEG 4000, 0.2 M sodium acetate, with 2 \u0026micro;L drops (1 \u0026micro;L protein /1 \u0026micro;L reservoir solution) and 300 \u0026micro;L reservoir solution. Protein-ligand crystals were grown within three weeks under the same crystallization condition with a reservoir solution containing 4 mM CA. Protein crystals were cryoprotected by rapid soaking in reservoir solution containing 25% glycerol and flash-cooled in liquid nitrogen. X-ray diffraction data were collected under cryogenic conditions (100 K) at 1.327 \u0026Aring; and 0.977 \u0026Aring; wavelength at the Manac\u0026aacute; beamline (\u003cu\u003ema\u003c/u\u003ecromolecular micro and \u003cu\u003ena\u003c/u\u003eno \u003cu\u003ec\u003c/u\u003eryst\u003cu\u003ea\u003c/u\u003ellography)\u003csup\u003e52\u003c/sup\u003e of Sirius, the Brazilian synchrotron light source (LNLS, Campinas, Brazil), using a PILATUS 2M detector placed 145 mm from the crystal. The X-ray data were collected using a fine ϕ-slicing strategy, rotated through 360\u0026deg; with a 0.1\u0026deg; oscillation range per frame. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eX-ray data processing and structural determination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX-ray diffraction data were automatically processed with XDS\u003csup\u003e53\u003c/sup\u003e using the Manac\u0026aacute; Automatic Processing Pipeline (Manac\u0026aacute;AutoProc) and analyzed and scaled using Pointless, Matthews and Scala from CCP4 package\u003csup\u003e36,54,55\u003c/sup\u003e. The phases of the datasets were determined by molecular replacement with Molrep\u003csup\u003e56\u003c/sup\u003e and Phaser\u003csup\u003e57\u003c/sup\u003e\u0026nbsp; using the SARS-CoV-2 CTD crystal structure (PDB code: 7C22) as the search model. The atomic structures were refined using REFMAC5\u003csup\u003e58\u003c/sup\u003e, ligands had their geometry restraint information generated for refinement by eLBOW\u003csup\u003e59\u003c/sup\u003e\u0026nbsp; \u0026nbsp;and then modelled using COOT\u003csup\u003e60\u003c/sup\u003e. All figures were generated using PyMOL.\u003c/p\u003e\n\u003cp\u003eThe volume of the CA binding site was estimated using parKVFinder software\u003csup\u003e61\u003c/sup\u003e using the box adjustment mode around the CA molecule with the following parameters: probe in of 1.4 \u0026Aring;, probe out of 12 \u0026Aring; and removal distance of 0.5 \u0026Aring;. \u0026nbsp;\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNMR experiments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll NMR spectra were obtained using an Agilent DD2 500 MHz spectrometer\u0026nbsp;or Varian Inova 600 MHz spectrometer both\u0026nbsp;equipped with a 5 mm triple-resonance probe and a Z pulse-field gradient unit at 298 K.\u0026nbsp;The STD\u0026nbsp;experiments were performed with 400 \u0026mu;M CA and 4\u0026nbsp;\u0026mu;M N protein samples dissolved in 80 mM sodium phosphate buffer, pH 7.4, prepared with deuterated water. The 1D \u003csup\u003e1\u003c/sup\u003eH-STD spectra were obtained by subtracting the saturated spectra (on- resonance) from the reference spectra (off-resonance), which was automatically performed by phase cycling using the dpfgse satzfer pulse sequence implemented in the VNMRJ software (Agilent). \u0026nbsp;The spectra were acquired using 2048 scans with a selective irradiation frequency of the protein at -0.5 ppm (on-resonance) and 30 ppm (off-resonance). Forty G-shaped pulses of 50 ms separated by 1 ms delays were applied to the samples. The total length of the saturation train was 2.5 s. A T\u003csub\u003e2\u003c/sub\u003e filter was applied to eliminate all protein background. The off-resonance spectra were used as reference spectra and were acquired with 1024 scans keeping all other parameters equal to the 1D \u003csup\u003e1\u003c/sup\u003eH-STD-NMR spectra. For the group epitope mapping analysis, the STD enhancements (A\u003csub\u003eSTD\u003c/sub\u003e) were determined by the integrals of individual protons of the ligands in the 1D \u003csup\u003e1\u003c/sup\u003eH-STD-NMR spectrum (I\u003csub\u003eSTD\u003c/sub\u003e) divided by the integral of the same signals at the reference spectrum (I\u003csub\u003e0\u003c/sub\u003e) and multiplied by the excess ratio of ligand to protein concentration ([L]/[P]) according to equation 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cimg width=\"480\" src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABE4AAAB3CAMAAAAq2PXIAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAMAUExURf///+Hh4YODg6KiosjIyIiIiLe3t8LCwgEBAS8vL6WlpcrKyoaGhl1dXQoKCmtrawMDA1lZWfv7+6+vr/r6+rKyslxcXHd3d87OzvLy8qSkpHl5edvb2/z8/NHR0VdXVwAAABgYGISEhOfn5/n5+cPDw0dHRyMjI4yMjOnp6fb29pmZmTY2Nt/f33h4eNnZ2f39/fPz8319fQcHB19fX+jo6GdnZ+vr60NDQxYWFpOTk83NzUhISBcXF6ioqOPj4wYGBiQkJK6uriYmJjU1NcDAwLCwsDAwMO3t7Y2NjQICAlhYWPj4+IeHh/7+/snJyWhoaCAgIFRUVL6+vh8fHwgICBUVFVFRUaampu/v7+zs7HFxcfDw8PT09EpKShAQEImJiaenpygoKNDQ0E1NTQQEBAsLC+Li4p+fn8/Pz0RERFpaWnBwcMvLy1NTU0ZGRuDg4NPT0wkJCZWVlQ0NDRoaGry8vN3d3bq6usTExCUlJczMzGZmZm5ubiIiIjQ0NFVVVe7u7lJSUgwMDLi4uCsrKy0tLbW1tbu7uycnJ8XFxT09PbS0tLa2tuTk5Obm5nV1derq6jMzM5qamk5OTtLS0ktLS9ra2lZWVsfHx5GRkWNjY7+/v9fX18HBwZiYmL29vYKCgmlpaTk5OfHx8UFBQTc3Nzg4OJSUlBkZGZKSkiwsLB4eHvX19REREaurq6qqqpCQkDw8PPf3915eXhwcHGFhYdjY2N7e3rm5ueXl5Xx8fHNzc4CAgBISEtzc3FBQUB0dHZ2dnZeXl3p6eqGhoT4+PpycnAUFBSkpKampqUBAQE9PT4+Pj0lJSZaWlnJycg4ODtbW1mJiYoWFhWRkZIGBgaCgoH9/f8bGxpubm0JCQnR0dIuLixsbG29vb3Z2doqKip6enkxMTBQUFLGxsTs7O2xsbDIyMmBgYDExMY6OjltbW9TU1Do6Ont7e2VlZRMTEw8PD0VFRSEhIW1tbaysrCoqKrOzs62trWpqan5+fqOjoy4uLtXV1QAAAIGYgbMAAAEAdFJOU////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////wBT9wclAAAACXBIWXMAACHVAAAh1QEEnLSdAAAJI0lEQVR4Xu3dTXLjKhDAcW90Bm3ZczMuwAIVBTvWOgjFER9fkiUnM7HHduxn/X+ZepE9Tp4mFdpN00InAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPgAfhyGMfUHjRnyc6E/AIArGWGH4TKcDJOY+gMAuFIQrh9tJTH2IwAfLDjnRtMf3M30cOJT+ba6HpcgQ3YCHIBxIg6+P7jbmp0Elac9y7clOwGOQYp5ySLut2Qnp9Mo3PptyU6AQ/DjI8f6mp34SQztqMx8yE6AI/Aqyn74AGt2YlQ8L/CQnQCHoIV9WCF2k50kO597TchOgEMIwj6sELvJToZN6YTsBDgEP6xD3UxRiOiCEasyYXHtSKVros6SnfhRjOvrqZ0Ax6BiL5km68xJOyGlSCfvrDxppco8yJWAY5xQVywALdlJfvmmIkN2AhyBF7GVTrSypdgRrJlK9IhziS1TiSAuh5f8QndNirFkJ2FbOqF2AhxCELYlHWau4aQLQvlyPV+esPhZ1ICzvvJvluxEiprYnHSd8ZCd4AB0+22/4L999lW0eerpjEvtNE9znFn+T5uKyinEVqu9agmoZyelmaV8kbYyf6J2ggPI77ffXDifh4J75gC+jZ/EdtrwaF4t4eSUZjEPPf/w01JRyYlGbD+OHE5+PpGenRhVm9j80L6E7AQfL8eNnNF/FeKmA+vF8hv7M8NJzkL6rCQLU4y1WFKyinMmMvWiahLzz1G2ZSd+jHEMKY2x/YDJTvDxdDz3g3oT1oXQnPafFzlfLJ+LeGTX6gXvJufOP4Rk+7/cbK7jmWsl9sqkrWUnJn/Xpsx1yE5wAPJcW9RJCbHEEy+fOr+4hR+iEvZ54eSSjC0DkesU6BRsbBHG2itytrUrdofsBB9vFqod+JzmixxO2qM6gn5vBP+VmZ18Znay8qEVOWydnexKJ7b2m/jpqpRt7YrdITvBp9OiFwX8MAtrN+GkLHJcMXSeLw/rlMT50tznMbVjTU8tEzLneNraTXRwdt0M6W+CmIdxH/7COF7VsgL8jw1LA1ey1kkXz+Gk1Gh/XhP9BcFOPtjfGItmUm7K6o5HpWCj2nTPyyhU+YteBVl5ObU93Hwah/MPyw/ZflJkylNvMnkEnsSJVhQ4mVHq05jDyTpgfmeC8SPvbMiZwm+EE69DkjK1xhMty2F7Pj9bHoWL1CTnMTnk5Ff7wV6zgAx8tvy22w58GUMlnLSHWYrn2sELpZgDiZnvKTyUnWAvPGJjWD8oOZXpYcle3qZwDbyKF7t3/RxOzglJGcJrqvIy2paVpzzZueNchno58M4jcgnvgq8/wGDtMF1zbSDwycJSiW122YlR2906XmWoNdg82bnjXHz4Yu2kv0O9DmEWUasovSaa4Ojk13CyjjM9vUEt1sS5fnrmMpOdtx+bw+Vj0f9yV8UZRXS7/mFVv+Lrn/bJvsP8EXiKPA3YDoVddvIW4aTtC1CWWZ53Ln3+c7VdU0nO7+JuTyXbX/UH33WkAB8hZyfbUbqLLu+wUlwGa7W5qubh/E/08qfrX9eIiyJxf82FP3wx8EHWtpPm3bITP/f39Kz3gJz0UJ50gw6libcrXfE59NTD8RF1kav5KOp0DDi8byY761h8g+xECtsO8mRnbudirJiH2uYxlBXksaxMybY8lcprvLRf7uf3pJWdKs9tHrlrNfD/lbOTXSl2G12eWq+4irbL6eTQ1q+963uI2NlMypdzzOev2z9CtyuAw7wvZuRwE0XZT3r751FdIpMY69bUAL5ZKF5Hon75QvG0Fi7XcJKTk3KCfnRe5ogQ6maMpoYRv1wBPP1Ov4z35ZJA6UXp9qMmAph9IXFXOzHqxW1s4Xw2OZz0DMSKbYhL9pxA+anMfjJZdox+vlElVwKYFcp7+TabwwAvs65c5rdaX8KJrAdFuezulWNEz+dlpxzaWn0kPzltto3tu7FWftmL5JfCSbn1TrlgZ8qRbpi3SR5wTFbEdqDLZW550E75U3v/f+0lgL7eP2tqcUHnOCfmOg9Ls6g7OVfbW4qXbVz7iW82ZXwiJVrYymFX2G31tzXh9gcLXXtx+wPgI+VJRPsdT5v2qzr/8cNLr2rzo3L5owY0L+tx2xI6qJgTlHJUkpZzGdSnZcV2/JWaTz7BtvmJl87tar9BRKXavOssKWX7ZAz4UPlXv6UgZlJ1zJb/1ChS+tp/YVTermz01DZzPoV5M63JE5/6uex19NIT/34zthxR4h1XRQP/A/EPv/vlguJ3LS/mGNiiyLDmKTmKLJunpfnulVspB/nvE73QN33wKX+b/I36BipsFouPN/3htnZvtPX0me5lHdsCht/eUny5A47OWcq9yclQyjb9+HZLduKlFfM05nSvnW3duQX4YGZzY4wtPb3hXCf15pMeAs32Wt7UulP9sFk7/mfqnguYl+ykNNnlAOKH2G6w0Zt3gY9V7oD33ch5n43sN4aopDapdcaW6HI+Rz+VQazDOLvw75FgMe+6+2601k60q+fne3Mv2Qk+XorfLavmuc4bbi8m1TyrrK4U+zSL5Uqe08lFYSfnpqnPh+6ixa5Z7kZrdhLmOl/UVpRP3KQYn8+n9M3Q8UbeP2V4OG9MSmlp39D5eD33cpw95tboKfZunH+yZiepzReNbe14hBPggKY7CrGblZ3Ws+vHdrt0SrHAEal7SidrdqJrz65Za8P0nQDHo2ObnehR2bbIe5MlOzGziNYq17p5qZ0ARxRivZeZVyqYfofRWyzZSYpz8vpczCGcAMfT2vX9UJZ5k725/aZnJ37YL8FTOwEOqO/45soKulF924Pr9exETxfZCNkJcDi9T6RteOCnm7eV7dmJmfeNgNROgMPJkxxRti/xomQnOZz8W3biZd31cYNwAhzNYGMsGUnLTvTt4aRlJzJ/l909/6idAId1Z3byFX0nwFF51UqxN1+gvPSdXKB2AhyXjKM/pfnmTaSMmL9uC6tDGAgnwFFpp6R07tbk5GScU+5yXpOU6tsoATggLd3UO+QBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA4GVOp/8AzgHBfgrPPkQAAAAASUVORK5CYII=\" alt=\"image\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn vitro\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;anti-SARS-CoV-2 activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVero CCL81 cells (African green monkey kidney cell line - BCRJ, # 0245) were cultivated in DMEM medium supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin. Calu-3 cells (Human lung cell line \u0026ndash; ATCC, # HTB-55\u0026trade;) were cultivated in DMEM/F12 (1:1, v/v) medium supplemented with 20% FBS, 1% L-glutamine and 1% penicillin/streptomycin. \u0026nbsp;Both cell lines were grown at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003eAntiviral assays were performed with the HIAE-02 SARS-CoV-2/SP02/human/2020/BRA strain (GenBank accession MT126808.1) kindly provided by Prof. Edison Luiz Durigon (USP-SP, Brazil). Virus stocks were propagated in Vero CCL81 cells in 75 cm\u003csup\u003e2\u003c/sup\u003e flasks. After 30-36 h of growth, culture supernatants were centrifuged to remove cell debris and stored at -80\u0026deg;C. All assays involving infectious virus were performed in the BSL-3 unit of the Emerging Viruses Laboratory (LEVE) at the State University of Campinas, Brazil.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCell viability in Vero CCL-81 and Calu-3 after CA treatment was measured by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (Sigma\u0026ndash;Aldrich, USA) method. Briefly, CA diluted in 10% DMEM at 25 and 100 \u0026micro;M final concentration was added to the confluent monolayer of cells grown in 24-well plates. After 48 h growth, the medium was replaced by fresh DMEM containing MTT (200 \u0026micro;g/mL) and cells were incubated for 3 h. DMSO was used to solubilize the formazan crystals and cell viability was measured by OD at 492 nm. The results were expressed according to the equation (T/C) \u0026times; 100%, where T and C represented the mean optical density of treated and control, respectively. DMSO at 0.2% (v/v) in DMEM medium was used as the vehicle control. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo evaluate the activity of CA on SARS-CoV-2 replication, Calu-3 and Vero CCL-81 cells were seeded into 24-well plates at 2x10\u003csup\u003e5\u003c/sup\u003e and 2.5x10\u003csup\u003e5\u003c/sup\u003e cells per well, respectively. The antiviral activity was determined at multiplicity of infection (MOI) of 1. The confluent monolayer of cells was incubated with the virus for 1 h, after which the culture medium was replaced by fresh medium containing CA at 25 and 100 \u0026micro;M final concentration. Culture supernatants were harvested 48 h after virus inoculation and viral load was determined by plaque assay.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlaque assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVero cells were seeded into 24-well plates and incubated for 1h with the supernatants from the antiviral assays, serially diluted to 10\u003csup\u003e-6\u003c/sup\u003e. After virus incubation, cells were overlaid with semi-solid medium (1% w/v carboxymethylcellulose in DMEM supplemented with 5% FBS) and incubated for 4 days. After removal of semi-solid medium, cells were fixed with paraformaldehyde 4% and plaques were visualized after 1% methylene blue staining. Viral lysis plaques were counted and the results were expressed as viral plaque forming units (PFU) per mL of sample.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Brazilian Funding Authority for Studies and Projects (FINEP, grant number 01.20.0003.00), the Brazilian Ministry of Sciences, Technology and Innovation (MCTI) and the National Fund for Scientific and Technological Development (FNDCT). This research used facilities of the Brazilian Synchrotron Light Laboratory (LNLS) and the \u0026nbsp;Brazilian Biosciences National Laboratory (LNBio), which are part of the Brazilian Center for Research in Energy and Materials (CNPEM), a private non-profit organization under the supervision of the MCTI. The Manaca beamline (Sirius, LNLS, proposal 20200057) and the LNBio-CNPEM facilities LPP, LEC, ROBOLAB, NMR, LGC and LBE staff is acknowledged for the assistance during the experiments. We also wish to acknowledge all the scientists and staff participating on the CNPEM\u0026rsquo;s COVID-19 task-force.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceived and designed the analysis: GFM, ATC, REM, MLS, KGF, CEB, ACMF, DBBT. Collected the data: EHSB, FAHB, CCCT, ASS, JFS, AN, JCS, JNF, MLS. Contributed data or analysis tools: HVRF, MGC, ACMZ, AFZN, JLPM, MCB, SAR, PSLO. Performed the analysis: GFM, EHSB, FAHB, JFS, AN, HRF, SAR, PSLO, MB, MLS, CEB, ACMF, DBBT.\u003c/p\u003e\n\u003cp\u003eProtein preparation: FAHB, CCCT, ASS, JCS, MCB, CEB. Biophysical assays: FAHB, SAR, MLS, CEB, ACMF. Protein crystallography, model interpretation and comparison: EHSB, CCCT, ACMZ, AFZN, DBBT, HVRF, PSLO. Virology: JFS, AN, JLPM, REM. HTS assay design and implementation: GFM, FAHB, JNF, MGC, ATC, CEB, ACMF, DBBT. SAR analysis: MB, DBBT. Project management and funding: KGF, DBBT. Designed the paper: ACMF, DBBT. Wrote the paper: GFM, EHSB, FAHB, CEB, ACMF, DBBT with contributions and revisions from all authors.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe crystal structures generated during the current study are available in the Protein Data Bank (PDB) under the accession numbers 7UXX (apo CTD) and 7UXZ (CTD-CA), and through the links: https://www.rcsb.org/structure/7UXX and https://www.rcsb.org/structure/7UXZ, respectively.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNicola, M. \u003cem\u003eet al.\u003c/em\u003e The socio-economic implications of the coronavirus pandemic (COVID-19): A review. \u003cem\u003eInternational Journal of Surgery\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 185\u0026ndash;193 (2020).\u003c/li\u003e\n\u003cli\u003eDas, S., Wingender, P., Barrett, P., Pugacheva, E. \u0026amp; Magistretti, G. After-Effects of the COVID-19 Pandemic: Prospects for Medium-Term Economic Damage. \u003cem\u003eIMF Working Papers\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 1 (2021).\u003c/li\u003e\n\u003cli\u003eBeigel, J. H. \u003cem\u003eet al.\u003c/em\u003e Remdesivir for the Treatment of Covid-19 \u0026mdash; Final Report. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e \u003cstrong\u003e383\u003c/strong\u003e, 1813\u0026ndash;1826 (2020).\u003c/li\u003e\n\u003cli\u003eJayk Bernal, A. \u003cem\u003eet al.\u003c/em\u003e Molnupiravir for Oral Treatment of Covid-19 in Nonhospitalized Patients. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e \u003cstrong\u003e386\u003c/strong\u003e, 509\u0026ndash;520 (2022).\u003c/li\u003e\n\u003cli\u003eKozlov, M. Merck\u0026rsquo;s COVID pill loses its lustre: what that means for the pandemic. \u003cem\u003eNature\u003c/em\u003e (2021) doi:10.1038/d41586-021-03667-0.\u003c/li\u003e\n\u003cli\u003eOwen, D. R. \u003cem\u003eet al.\u003c/em\u003e An oral SARS-CoV-2 M pro inhibitor clinical candidate for the treatment of COVID-19. \u003cem\u003eScience (1979)\u003c/em\u003e \u003cstrong\u003e374\u003c/strong\u003e, 1586\u0026ndash;1593 (2021).\u003c/li\u003e\n\u003cli\u003eHeskin, J. \u003cem\u003eet al.\u003c/em\u003e Caution required with use of ritonavir-boosted PF-07321332 in COVID-19 management. \u003cem\u003eThe Lancet\u003c/em\u003e \u003cstrong\u003e399\u003c/strong\u003e, 21\u0026ndash;22 (2022).\u003c/li\u003e\n\u003cli\u003eShah, M. \u0026amp; Woo, H. G. Omicron: A Heavily Mutated SARS-CoV-2 Variant Exhibits Stronger Binding to ACE2 and Potently Escapes Approved COVID-19 Therapeutic Antibodies. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eCoelho, C., Gallo, G., Campos, C. B., Hardy, L. \u0026amp; W\u0026uuml;rtele, M. Biochemical screening for SARS-CoV-2 main protease inhibitors. \u003cem\u003ePLOS ONE\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e0240079 (2020).\u003c/li\u003e\n\u003cli\u003eZhu, W. \u003cem\u003eet al.\u003c/em\u003e Identification of SARS-CoV-2 3CL Protease Inhibitors by a Quantitative High-Throughput Screening. \u003cem\u003eACS Pharmacology \u0026amp; Translational Science\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 1008\u0026ndash;1016 (2020).\u003c/li\u003e\n\u003cli\u003eLim, C. T. \u003cem\u003eet al.\u003c/em\u003e Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. \u003cem\u003eBiochemical Journal\u003c/em\u003e \u003cstrong\u003e478\u003c/strong\u003e, 2517\u0026ndash;2531 (2021).\u003c/li\u003e\n\u003cli\u003eXu, T., Zheng, W. \u0026amp; Huang, R. High‐throughput screening assays for SARS‐CoV‐2 drug development: Current status and future directions. \u003cem\u003eDrug Discovery Today\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 2439\u0026ndash;2444 (2021).\u003c/li\u003e\n\u003cli\u003eEydoux, C. \u003cem\u003eet al.\u003c/em\u003e A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. \u003cem\u003eJournal of Virological Methods\u003c/em\u003e \u003cstrong\u003e288\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eWang, Y. \u003cem\u003eet al.\u003c/em\u003e Discovery of SARS-CoV-2-E channel inhibitors as antiviral candidates. \u003cem\u003eActa Pharmacologica Sinica\u003c/em\u003e (2021) doi:10.1038/s41401-021-00732-2.\u003c/li\u003e\n\u003cli\u003eSmith, E. \u003cem\u003eet al.\u003c/em\u003e High-Throughput Screening for Drugs That Inhibit Papain-Like Protease in SARS-CoV-2. \u003cem\u003eSLAS DISCOVERY: Advancing the Science of Drug Discovery\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 1152\u0026ndash;1161 (2020).\u003c/li\u003e\n\u003cli\u003eZhang, Z.-R. \u003cem\u003eet al.\u003c/em\u003e A cell-based large-scale screening of natural compounds for inhibitors of SARS-CoV-2. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 218 (2020).\u003c/li\u003e\n\u003cli\u003eRothan, H. A. \u0026amp; Teoh, T. C. Cell-Based High-Throughput Screening Protocol for Discovering Antiviral Inhibitors Against SARS-COV-2 Main Protease (3CLpro). \u003cem\u003eMolecular Biotechnology\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e, 240\u0026ndash;248 (2021).\u003c/li\u003e\n\u003cli\u003eZhao, T. \u003cem\u003eet al.\u003c/em\u003e Warnings regarding the potential coronavirus disease 2019 (COVID-19) transmission risk: Vaccination is not enough. \u003cem\u003eInfection Control \u0026amp; Hospital Epidemiology\u003c/em\u003e 1\u0026ndash;1 (2021) doi:10.1017/ice.2021.63.\u003c/li\u003e\n\u003cli\u003eGorshkov, K. \u003cem\u003eet al.\u003c/em\u003e SARS-CoV-2 Nucleocapsid Protein TR-FRET Assay Amenable to High Throughput Screening. \u003cem\u003eACS Pharmacology and Translational Science\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eMcBride, R., van Zyl, M. \u0026amp; Fielding, B. C. The coronavirus nucleocapsid is a multifunctional protein. \u003cem\u003eViruses\u003c/em\u003e vol. 6 (2014).\u003c/li\u003e\n\u003cli\u003ePeng, Y. \u003cem\u003eet al.\u003c/em\u003e Structures of the SARS‐CoV‐2 nucleocapsid and their perspectives for drug design. \u003cem\u003eThe EMBO Journal\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eDinesh, D. C. \u003cem\u003eet al.\u003c/em\u003e Structural basis of RNA recognition by the SARS-CoV-2 nucleocapsid phosphoprotein. \u003cem\u003ePLoS Pathogens\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eKang, S. \u003cem\u003eet al.\u003c/em\u003e Crystal structure of SARS-CoV-2 nucleocapsid protein RNA binding domain reveals potential unique drug targeting sites. \u003cem\u003eActa Pharmaceutica Sinica B\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eGrossoehme, N. E. \u003cem\u003eet al.\u003c/em\u003e Coronavirus N Protein N-Terminal Domain (NTD) Specifically Binds the Transcriptional Regulatory Sequence (TRS) and Melts TRS-cTRS RNA Duplexes. \u003cem\u003eJournal of Molecular Biology\u003c/em\u003e \u003cstrong\u003e394\u003c/strong\u003e, 544\u0026ndash;557 (2009).\u003c/li\u003e\n\u003cli\u003eKeane, S. C., Lius, P., Leibowitzs, J. L. \u0026amp; Giedroc, D. P. Functional Transcriptional Regulatory Sequence (TRS) RNA binding and helix destabilizing determinants of Murine Hepatitis Virus (MHV) Nucleocapsid (N) protein. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e \u003cstrong\u003e287\u003c/strong\u003e, (2012).\u003c/li\u003e\n\u003cli\u003eCarlson, C. R. \u003cem\u003eet al.\u003c/em\u003e Phosphoregulation of Phase Separation by the SARS-CoV-2 N Protein Suggests a Biophysical Basis for its Dual Functions. \u003cem\u003eMolecular Cell\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 1092-1103.e4 (2020).\u003c/li\u003e\n\u003cli\u003eSavastano, A., Ib\u0026aacute;\u0026ntilde;ez de Opakua, A., Rankovic, M. \u0026amp; Zweckstetter, M. Nucleocapsid protein of SARS-CoV-2 phase separates into RNA-rich polymerase-containing condensates. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003ePerdikari, T. M. \u003cem\u003eet al.\u003c/em\u003e SARS‐CoV‐2 nucleocapsid protein phase‐separates with RNA and with human hnRNPs. \u003cem\u003eThe EMBO Journal\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eLu, S. \u003cem\u003eet al.\u003c/em\u003e The SARS-CoV-2 nucleocapsid phosphoprotein forms mutually exclusive condensates with RNA and the membrane-associated M protein. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eHsieh, P.-K. \u003cem\u003eet al.\u003c/em\u003e Assembly of Severe Acute Respiratory Syndrome Coronavirus RNA Packaging Signal into Virus-Like Particles Is Nucleocapsid Dependent. \u003cem\u003eJournal of Virology\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 13848\u0026ndash;13855 (2005).\u003c/li\u003e\n\u003cli\u003eHsin, W.-C. \u003cem\u003eet al.\u003c/em\u003e Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus. \u003cem\u003eJournal of Biomedical Science\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 47 (2018).\u003c/li\u003e\n\u003cli\u003eAdem, Ş. \u003cem\u003eet al.\u003c/em\u003e Caffeic acid derivatives (CAFDs) as inhibitors of SARS-CoV-2: CAFDs-based functional foods as a potential alternative approach to combat COVID-19. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 153310 (2021).\u003c/li\u003e\n\u003cli\u003eKing, P. J. \u0026amp; Robinson, W. E. Resistance to the Anti-Human Immunodeficiency Virus Type 1 Compound l -Chicoric Acid Results from a Single Mutation at Amino Acid 140 of Integrase. \u003cem\u003eJournal of Virology\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 8420\u0026ndash;8424 (1998).\u003c/li\u003e\n\u003cli\u003eReinke, R. A. \u003cem\u003eet al.\u003c/em\u003e l-Chicoric acid inhibits human immunodeficiency virus type 1 integration in vivo and is a noncompetitive but reversible inhibitor of HIV-1 integrase in vitro. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e326\u003c/strong\u003e, 203\u0026ndash;219 (2004).\u003c/li\u003e\n\u003cli\u003eZhang, H.-L. \u003cem\u003eet al.\u003c/em\u003e Evaluation of Hepatocyteprotective and Anti-hepatitis B Virus Properties of Cichoric Acid from Cichorium intybus Leaves in Cell Culture. \u003cem\u003eBiological and Pharmaceutical Bulletin\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1214\u0026ndash;1220 (2014).\u003c/li\u003e\n\u003cli\u003eMatthews, B. W. Solvent content of protein crystals. \u003cem\u003eJ Mol Biol\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 491\u0026ndash;497 (1968).\u003c/li\u003e\n\u003cli\u003eZhou, R., Zeng, R., von Brunn, A. \u0026amp; Lei, J. Structural characterization of the C-terminal domain of SARS-CoV-2 nucleocapsid protein. \u003cem\u003eMolecular Biomedicine\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 2 (2020).\u003c/li\u003e\n\u003cli\u003eYang, M. \u003cem\u003eet al.\u003c/em\u003e Structural Insight Into the SARS-CoV-2 Nucleocapsid Protein C-Terminal Domain Reveals a Novel Recognition Mechanism for Viral Transcriptional Regulatory Sequences. \u003cem\u003eFrontiers in Chemistry\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eChang, C.-K. \u003cem\u003eet al.\u003c/em\u003e Multiple Nucleic Acid Binding Sites and Intrinsic Disorder of Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein: Implications for Ribonucleocapsid Protein Packaging. \u003cem\u003eJournal of Virology\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e, 2255\u0026ndash;2264 (2009).\u003c/li\u003e\n\u003cli\u003eRibeiro-Filho, H. V. \u003cem\u003eet al.\u003c/em\u003e Structural dynamics of SARS-CoV-2 nucleocapsid protein induced by RNA binding. \u003cem\u003ePLOS Computational Biology\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, e1010121 (2022).\u003c/li\u003e\n\u003cli\u003eDouangamath, A. \u003cem\u003eet al.\u003c/em\u003e Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease. \u003cem\u003eNature Communications\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eSalgado-Benvindo, C. \u003cem\u003eet al.\u003c/em\u003e Suramin inhibits SARS-CoV-2 infection in cell culture by interfering with early steps of the replication cycle. \u003cem\u003eAntimicrobial Agents and Chemotherapy\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eLandete, J. M. Ellagitannins, ellagic acid and their derived metabolites: A review about source, metabolism, functions and health. \u003cem\u003eFood Research International\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 1150\u0026ndash;1160 (2011).\u003c/li\u003e\n\u003cli\u003eLi, P. \u003cem\u003eet al.\u003c/em\u003e Identification of Chebulinic Acid and Chebulagic Acid as Novel Influenza Viral Neuraminidase Inhibitors. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eKesharwani, A. \u003cem\u003eet al.\u003c/em\u003e Anti-HSV-2 activity of Terminalia chebula Retz extract and its constituents, chebulagic and chebulinic acids. \u003cem\u003eBMC Complementary and Alternative Medicine\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, (2017).\u003c/li\u003e\n\u003cli\u003eLin, L. T. \u003cem\u003eet al.\u003c/em\u003e Broad-spectrum antiviral activity of chebulagic acid and punicalagin against viruses that use glycosaminoglycans for entry. \u003cem\u003eBMC Microbiology\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003eRoh, C. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide. \u003cem\u003eInternational Journal of Nanomedicine\u003c/em\u003e 2173 (2012) doi:10.2147/IJN.S31379.\u003c/li\u003e\n\u003cli\u003eLin, S.-Y. \u003cem\u003eet al.\u003c/em\u003e Structural Basis for the Identification of the N-Terminal Domain of Coronavirus Nucleocapsid Protein as an Antiviral Target. \u003cem\u003eJournal of Medicinal Chemistry\u003c/em\u003e \u003cstrong\u003e57\u003c/strong\u003e, 2247\u0026ndash;2257 (2014).\u003c/li\u003e\n\u003cli\u003eMatthias, A. \u003cem\u003eet al.\u003c/em\u003e Permeability studies of alkylamides and caffeic acid conjugates from echinacea using a Caco-2 cell monolayer model. \u003cem\u003eJournal of Clinical Pharmacy and Therapeutics\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, (2004).\u003c/li\u003e\n\u003cli\u003eCharvat, T. T., Lee, D. J., Robinson, W. E. \u0026amp; Chamberlin, A. R. Design, synthesis, and biological evaluation of chicoric acid analogs as inhibitors of HIV-1 integrase. \u003cem\u003eBioorganic and Medicinal Chemistry\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, (2006).\u003c/li\u003e\n\u003cli\u003ePeroni, L. A. \u003cem\u003eet al.\u003c/em\u003e Serological Testing for COVID-19, Immunological Surveillance, and Exploration of Protective Antibodies. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eNascimento, A. \u003cem\u003eet al.\u003c/em\u003e Launch of the Manac\u0026aacute; Beamline at Sirius: First Protein Crystallography Structures and New Opportunities for Pharmaceutical Development Using Synchrotrons. \u003cem\u003eSynchrotron Radiation News\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 3\u0026ndash;10 (2021).\u003c/li\u003e\n\u003cli\u003eKabsch, W. XDS. \u003cem\u003eActa Crystallographica Section D Biological Crystallography\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 125\u0026ndash;132 (2010).\u003c/li\u003e\n\u003cli\u003eKantardjieff, K. A. \u0026amp; Rupp, B. Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals. \u003cem\u003eProtein Science\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1865\u0026ndash;1871 (2003).\u003c/li\u003e\n\u003cli\u003eEvans, P. R. An introduction to data reduction: Space-group determination, scaling and intensity statistics. \u003cem\u003eActa Crystallographica Section D: Biological Crystallography\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, (2011).\u003c/li\u003e\n\u003cli\u003eVagin, A. \u0026amp; Teplyakov, A. Molecular replacement with MOLREP. \u003cem\u003eActa Crystallogr D Biol Crystallogr\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 22\u0026ndash;5 (2010).\u003c/li\u003e\n\u003cli\u003eMcCoy, A. J. \u003cem\u003eet al.\u003c/em\u003e Phaser crystallographic software. \u003cem\u003eJournal of Applied Crystallography\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 658\u0026ndash;674 (2007).\u003c/li\u003e\n\u003cli\u003eMurshudov, G. N., Vagin, A. A. \u0026amp; Dodson, E. J. Refinement of Macromolecular Structures by the Maximum-Likelihood Method. \u003cem\u003eActa Crystallographica Section D Biological Crystallography\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 240\u0026ndash;255 (1997).\u003c/li\u003e\n\u003cli\u003eMoriarty, N. W., Grosse-Kunstleve, R. W. \u0026amp; Adams, P. D. electronic Ligand Builder and Optimization Workbench ( eLBOW ): a tool for ligand coordinate and restraint generation. \u003cem\u003eActa Crystallographica Section D Biological Crystallography\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 1074\u0026ndash;1080 (2009).\u003c/li\u003e\n\u003cli\u003eEmsley, P. \u0026amp; Cowtan, K. Coot : model-building tools for molecular graphics. \u003cem\u003eActa Crystallographica Section D Biological Crystallography\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 2126\u0026ndash;2132 (2004).\u003c/li\u003e\n\u003cli\u003eGuerra, J. V. da S. \u003cem\u003eet al.\u003c/em\u003e ParKVFinder: A thread-level parallel approach in biomolecular cavity detection. \u003cem\u003eSoftwareX\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Nucleocapsid protein, SARS-CoV-2, packaging signal, chicoric acid, phenolic acids, protein-RNA disruptors, HTS, antivirals","lastPublishedDoi":"10.21203/rs.3.rs-1720953/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1720953/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe nucleocapsid (N) protein plays critical roles in coronavirus genome transcription and packaging, representing a key target for the development of novel antivirals, and for which structural information on ligand binding is scarce. We used a novel fluorescence polarization assay to identify small molecules that disrupt the binding of the N protein to a target RNA derived from the SARS-CoV-2 genome packaging signal. Several phenolic compounds, including L-chicoric acid (CA), were identified as high-affinity N-protein ligands. The binding of CA to the N protein was confirmed by isothermal titration calorimetry, \u003csup\u003e1\u003c/sup\u003eH-STD NMR, and by the crystal structure of CA bound to the N protein C-terminal domain (CTD), further revealing a new modulatory site in the SARS-CoV-2 N protein. Moreover, CA reduced SARS-CoV-2 replication in cell cultures. These data thus open venues for the development of new antivirals targeting the N protein, an essential and yet underexplored coronavirus target.\u003c/p\u003e","manuscriptTitle":"Discovery and structural characterization of chicoric acid as a SARS-CoV-2 nucleocapsid protein ligand and RNA binding disruptor","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-07-05 16:43:41","doi":"10.21203/rs.3.rs-1720953/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-07-11T04:17:21+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-07-06T18:26:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"984992d9-8d84-47c6-ab07-6c5ebcb6edd9","date":"2022-06-26T04:17:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-06-26T04:15:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-06-26T03:56:09+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-06-24T13:33:24+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-06-24T13:28:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2022-06-03T00:10:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e6dd6267-a6cf-457e-8029-06575a6d4fa4","owner":[],"postedDate":"July 5th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-10-17T08:29:35+00:00","versionOfRecord":[],"versionCreatedAt":"2022-07-05 16:43:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1720953","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1720953","identity":"rs-1720953","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}