Research on on-site periodontitis self-examination technology based on closed cartridge | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Research on on-site periodontitis self-examination technology based on closed cartridge Dixin Wei, Qi Ye, Hui Chen, Wenhao Zhang, Sui Huang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5682928/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Periodontitis is a prevalent inflammatory disease, with Porphyromonas gingivalis (Pg) identified as the primary causative bacterium of periodontal infection. In addition to its role in chronic periodontitis, Pg has also been associated with head and neck tumors, digestive tract tumors, neurological diseases, and atherosclerosis (AS). Therefore, establishing a rapid clinical detection method for Pg is of paramount importance. In this study, we developed a LAMP detection reagent for Pg, and assessed its performance in terms of sensitivity, specificity, repeatability, stability, linear range, and linearity using a commercial magnetic bead-based method. The integrated nucleic acid extraction and detection system has created an on-site instant detection platform for Pg based on a closed cartridge, demonstrating a sensitivity of 10 CFU/mL, no cross-reactivity with eight other bacterial pathogens, and excellent performance in repeatability, stability, linear range, and linearity. For 28 simulated samples, the detection results from the integrated system were consistent with the experimental outcomes of qPCR and LAMP detection following nucleic acid extraction in a conventional laboratory setting. The entire process can be completed in approximately one hour, significantly reducing the time required for clinical diagnosis and indicating substantial practical needs and application prospects. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Porphyromonas gingivalis (Pg) is a Gram-negative anaerobic bacterium. When cultured on blood agar, it can combine with heme to form black colonies that exhibit a metallic luster on the surface and complete hemolysis. The virulence factors of Pg include gingipains, capsule, pili, hemagglutinin, lipopolysaccharide, hemolysin, and iron uptake transporters, which play a key role in the processes of bacterial adhesion and invasion of host cells [1]. Periodontitis is a highly prevalent inflammatory disease, with Pg being the most significant pathogenic bacterium involved in periodontal infection. It adheres to periodontal tissue with the aid of pili and coaggregates with other bacteria, thereby increasing both the diversity and quantity of bacteria present in the plaque and participating in the formation of plaque biofilm [2]. In addition to inducing chronic periodontitis, Pg has also been associated with head and neck tumors, digestive tract tumors, neurological diseases, and atherosclerosis [3, 4]. Numerous studies have reported that Pg is linked to oral and digestive tract cancers. These diseases, caused by Pg, pose a significant threat to human health and impose considerable pressure on society. Therefore, establishing a rapid clinical detection method for Pg is crucial. The detection of Pg encompasses a variety of approaches, including conventional bacteriological methods, immunological techniques, molecular biology detection, and emerging technologies such as nanotechnology, surface-enhanced Raman scattering (SERS), and mass spectrometry. Commonly employed bacterial detection methods include culture techniques, which can be categorized into solid, liquid, and semi-solid cultures. Traditional bacterial isolation and culture methods are essential for clinical bacterial identification; however, these methods often require extended timeframes, making rapid identification challenging. The primary immunological detection methods include enzyme-linked immunosorbent assay (ELISA), which, despite its widespread use, has notable disadvantages such as a lengthy operational time of approximately 5 hours and a cumbersome series of steps. Another method, immunoblot detection (WB), often yields experimental results that are susceptible to variations in gel preparation, sample loading, film transfer, and temperature, among other factors. In contrast, the immunochromatographic detection method allows for visual result interpretation, significantly reducing detection time; however, it suffers from low sensitivity and the potential for false-negative outcomes [5-7]. Molecular biology detection methods encompass polymerase chain reaction (PCR), fluorescence quantitative PCR (qPCR), and loop-mediated isothermal amplification (LAMP). The first two methods are characterized by low detection limits and high specificity, but they require advanced equipment and skilled personnel for analysis and operation, and the amplification process can be time-consuming. Conversely, the emerging LAMP technique shows promise as a replacement for conventional PCR, boasting approximately 100 times the sensitivity of traditional methods. This advancement offers significant potential for point-of-care detection of Pg [8-14]. Other emerging technologies for detection necessitate complex experimental procedures and costly instruments, rendering them unsuitable for rapid point-of-care testing [15-17]. Integrated detection technology results from the optimization of the experimental process. This technology accelerates the detection process while minimizing the need for excessive instruments and manual intervention, thereby enhancing the accuracy of detection results. In this study, LAMP was employed to detect Pg in the pepO gene fragment, utilizing a commercial integrated detection system based on magnetic bead nucleic acid extraction and LAMP fluorescence detection to establish an efficient and integrated detection method for Pg. The system was compared with conventional laboratory instruments and PCR tests to demonstrate equivalent sensitivity and specificity, while requiring less time and fewer operations than the gold standard qPCR. 2. Materials and method 2.1 Integrated system inspection process The primary steps involved in the system detection process are based on the research conducted by Chen et al. [ 18 ] on integrated technology for the rapid detection of the monkeypox virus. The pathogen detection cartridge operates primarily through the vertical movement of an externally controlled plunger rod and liquid suction head within the liquid suction and discharge assembly, in conjunction with the rotation of the liquid storage base. This setup enables the completion of pathogen detection in a closed environment in a single, integrated, and automated manner. 2.2 Standard strains and nucleic acid extraction All strains utilized in this study were procured from the Henan Industrial Microbial Strain Engineering Technology Research Center. These strains include Porphyromonas gingivalis ATCC 33277, Staphylococcus aureus ATCC 12600, Aggregatibacter actinomycetemcomitans Y4, Porphyromonas asaccharolytica ATCC 25260, Streptococcus mutans NBRC 13955, Actinobacillus actinomycetemcomitans ATCC 43718, Tannerella forsythia ATCC 43037, Treponema denticola ATCC 35405, and Streptococcus oralis ATCC 10557. The aforementioned nine strains were employed to assess the specificity of the primers. Nucleic acids were extracted using the magnetic bead method with a nucleic acid extraction kit from Shenzhen Lemniscare Medical Technology Co., Ltd. (Shenzhen, China). The extraction was performed using the fully automatic nucleic acid extraction instrument MGX-3200, also from Shenzhen Lemniscare Medical Technology Co., Ltd. Upon completion of the extraction, the liquid from column 6 or 12 was transferred to a new nuclease-free 1.5 mL EP tube and stored at -20°C. The DNA concentration was determined using a NanoDrop ND-500 spectrophotometer from Hangzhou Aosheng Instrument Co., Ltd. (Hangzhou, China). 2.3 Establishment of LAMP system 2.3.1 Standard plasmid synthesis and primer design This study focused on the pepO gene of Pg, which is registered under the NCBI accession number AB010440.1. The corresponding sequence of the pepO gene was selected for analysis. Additionally, Primer Explorer V5 was utilized to design three sets of LAMP primers online, adhering to established primer design principles. Each set of primers comprised external primers F3 and B3, inner primers FIP and BIP, as well as loop primers LF and LB. PCR primers and probes were designed using Snapgene software. The sequences of all primers are presented in Table 1 . All primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., while the target gene was synthesized by Beijing Qingke Biotechnology Co., Ltd. LAMP and PCR experiments was calculated using the formula ((6.02 × 10 23 )/(X Dalton of the plasmid containing the fragment) × (X ng mL − 1 ×10 − 9 )), resulting in a fragment concentration of 3.3 × 10 10 copies per µL. Table 1 LAMP and PCR Primers sequences used in system. Method Primer ID Sequence (5'→3') LAMP-P1 F3-1 GGCAGTAATCGGCGCATT B3-1 TCGTGCAGGATGTCGAAT FIP-1 ACTGAGGTCGATGGCCGGTAGCTGCAATGGCAATAAGGGT BIP-1 CCGCAGGACGACTTTTATCGCTAGCCGTAGCGACTATAAGCA LF-1 GCTTCCTGTCAGTATCGTTAGTCT LB-1 ACTGCAACGGCAATTGGATG LAMP-P2 F3-2 CTGACAGGAAGCGCGAAC B3-2 GTCCTGCTGCAAGGTTGT FIP-2 CCAATTGCCGTTGCAGTAGCGACCATCGACCTCAGTGCCA BIP-2 GTCGCTACGGCTCATTCGACA CCACAATCAGGTGTACACGC LAMP-P3 F3-3 CTGACAGGAAGCGCGAAC FIP-3 CCAATTGCCGTTGCAGTAGCGA CAGTGCCATGGATACATCCG BIP-3 GTCGCTACGGCTCATTCGACA CCACAATCAGGTGTACACGC LF-3 GCTTCCTGTCAGTATCGTTAGTCTG LB-3 GCTACTGCAACGGCAATTGG qPCR Forward AGAAGTTTATCTACAGCCAATTTAGCT Reserve GGTGTTAACCCTGTCACCGT Probe TCTGCCTTATCGAATACTCTTCCG 2.4 LAMP system optimization Utilize the extracted Pg DNA template to perform the LAMP reaction, preparing the system according to the 25 µL LAMP system recommended by the enzyme raw material manufacturer. This includes 12.5 µL of 2 × LAMP Premix Buffer II, 1 µL each of FIP and BIP Primers (40 µM), 0.5 µL each of F3 and B3 Primers (20 µM), and 1 µL each of LF and LB Primers (20 µM). Additionally, include 1 µL of Bst 2.0 (8 U/µL) (Biori, Zhuhai, China), 1 µL of nuclease-free water, and 5 µL of DNA template. The thermal cycling conditions are set for 45 minutes at 65°C, with fluorescence data collected every minute. To optimize the reaction, determine the ideal primer set (P1 ~ P3), temperature range (50 ~ 75°C), the ratio of outer to inner primers (1:1 ~ 1:10), Bst 2.0 concentration (0.5 ~ 2.5 µL), and dye concentration (0.5 ~ 2.5 µL). 2.5 LAMP system specificity and sensitivity test The basic systems for LAMP and qPCR reactions were configured separately, and DNA templates from nine bacterial strains were utilized to assess the specificity of LAMP and PCR primers for Pg. The amplified products were verified and analyzed using 2% (w/v) agarose gel electrophoresis. To evaluate the sensitivity of the LAMP system, a 10-fold dilution of a 10 8 CFU/mL Pg solution was performed using a physiological saline gradient, resulting in bacterial concentrations ranging from 10 6 to 10 1 CFU/mL. A magnetic bead nucleic acid extraction kit was employed to extract bacterial genomic DNA from samples with concentrations of 10 6 to 10 1 CFU/mL Pg, following the optimized protocols for both LAMP and qPCR systems. Negative controls were established and placed in the commercial qPCR instrument Gentier mini (Xi'an Tianlong Technology Co., Ltd., Xi'an, China) for detection. 2.6 LAMP system homogeneity and stability testing We diluted the Pg bacterial liquid from an initial concentration of 10 8 CFU/mL to 10 6 CFU/mL using physiological saline and extracted the bacterial genomic DNA following the manufacturer's instructions. Sixteen reaction solutions were prepared according to the optimized LAMP system, distributed into two 8-row 0.2 mL centrifuge tubes, and placed into the commercial qPCR instrument, Gentier mini, for detection. Three different concentrations of standards were selected for testing: high (10 6 CFU/mL), medium (10 4 CFU/mL), and low (10 2 CFU/mL). A magnetic bead nucleic acid extraction kit was employed to extract the Pg bacterial genomic DNA. The reaction solution was prepared in accordance with the optimized LAMP system, and both a negative control and a positive control were established. Three samples were configured for each concentration and placed into the Gentier mini for detection. The experiment was conducted in triplicate to assess the high, medium, and low concentrations, and the stability of the results was preliminarily evaluated through the amplification curves obtained from the three experiments. 2.7 System application testing To test the application of the integrated system and the Pg LAMP detection kit, we utilized the tips of dental absorbent paper to dip into high, medium, and low concentrations of Pg solution, as well as sterile water, for 5 minutes each. Subsequently, the dental absorbent paper tips were soaked in PBS for an additional 5 minutes to simulate samples. A total of 28 random positive simulated samples and sterile water negative samples of varying concentrations were prepared. The nucleic acid extraction and real-time fluorescence LAMP detection were performed using the integrated system, and a comparison was made with the commercial extraction instrument MGX-3200 and the qPCR instrument Gentier mini. 3. Results 3.1 Optimization of LAMP reaction analysis Prepare the reaction solution according to the 25 µL LAMP system recommended by the enzyme manufacturer, and perform amplification using the three designed sets of LAMP primers to identify the most effective primer combination (Fig. 1A). The results indicated that the P3 primer set exhibited a lower Tt value and shorter amplification time compared to the P1 and P2 primer sets, leading to the selection of the P3 primer set as the optimal combination. Utilizing the optimal P3 primer combination, prepare the reaction solution in accordance with the aforementioned 25 µL LAMP system, and conduct amplification at reaction temperatures of 50, 55, 60, 65, 70, and 75°C to ascertain the optimal reaction temperature (Fig. 1B). The findings revealed that amplification efficiency was highest and reaction time was shortest at an amplification temperature of 65°C. Consequently, 65°C was determined to be the optimal reaction temperature. Under constant temperature conditions of 65°C, the P3 primer set was employed to optimize the ratio of outer to inner primers. As illustrated in Fig. 1C, the amplification efficiency was assessed at outer to inner primer ratios of 1:1, 1:2, 1:6, and 1:8. Although the differences in efficiency were minimal, it is evident that the 1:6 ratio resulted in the shortest amplification time; thus, a ratio of 1:8 was ultimately selected as the optimal configuration for the outer and inner primers. Maintaining the constant temperature of 65°C, the P3 primer set with a 1:8 ratio was utilized to prepare a LAMP reaction system for optimizing Bst 2.0 concentration. Figure 1D demonstrates that amplification efficiency was highest at a Bst 2.0 volume of 2.5 µL, leading to the selection of 2.5 µL as the optimal concentration. Continuing under the same temperature conditions with the P3 primer set, an outer to inner primer ratio of 1:8, and a Bst polymerase volume of 2.5 µL, a LAMP reaction system was established for dye concentration optimization. As shown in Fig. 1E, variations in dye concentration had a negligible effect on the LAMP reaction; however, higher dye concentrations exhibited slight amplification inhibition, resulting in a delayed Tt. Consequently, 0.5 µL of dye was chosen as the optimal concentration. 3.2 LAMP specificity and sensitivity evaluation Nine bacterial pathogens were specifically detected, with Pg being the only one that was amplified. No non-specific amplification was observed for other bacteria, as illustrated in Fig. 2A and Fig. 2B, thereby demonstrating the specificity of both the LAMP primers and the PCR primers. The LAMP amplification curves for six concentration gradients are presented in Fig. 3A. The shape of the amplification curve indicates that the amplification efficiency is both stable and high, with a sensitivity that can reach 10 CFU/mL, and a minimum detection time of less than 40 minutes. A clear linear relationship exists between the logarithm of plasmid concentration and the Tt value. As illustrated in Fig. 3B, the R² value is 0.749, suggesting that the LAMP detection system possesses potential for quantitative performance. Figure 3C displays the real-time fluorescence quantitative PCR amplification curve for the same six concentration gradients, while Fig. 3D presents the corresponding standard curve, which has an R² value of 0.986. The amplification curve indicates that the detection threshold for real-time fluorescence PCR is 10 2 CFU/mL, with the entire PCR process taking approximately 80 minutes. In terms of the linearity of the standard curve, LAMP demonstrates inferior performance compared to qPCR, particularly in low concentration detection. During the detection process, amplification efficiency decreases at high concentrations, resulting in instability and an overall linear decline; however, a linear relationship is still generally maintained. 3.3 LAMP homogeneity and stability assessment evaluation The 16-well LAMP real-time fluorescence amplification curves obtained from a commercial qPCR instrument are presented in Fig. 4. The shape of the curves indicates a relatively high degree of overlap among them. Based on the Tt values, the experimental results reveal an average Tt value of 10.03, with a standard deviation (SD) of 0.43 and a coefficient of variation (CV) of 0.43%. These findings suggest that the overall uniformity of the reagents is satisfactory. To ensure repeatability, three standard samples with high, medium, and low concentrations were analyzed. The amplification curves for the three detection methods are presented in Fig. 5A, Fig. 5B and Fig. 5C. Overall, the curve shapes indicate that the high, medium, and low concentrations were successfully amplified in each of the three experiments, demonstrating a high degree of similarity in curve shape and reproducibility across batches, with the order of reproducibility being high concentration > medium concentration > low concentration. We calculated the standard deviation (SD) and coefficient of variation (CV) values for the Tt values across the three concentrations in the three experiments. As illustrated in Fig. 5D, the CV values for the high concentration, medium concentration, and low concentration were 5.86%, 6.62%, and 24.68%, respectively. This performance further supports the order of high concentration > medium concentration > low concentration. Stable amplification was achieved at all concentration levels, indicating that the overall amplification efficiency of the system is reproducible. Therefore, the stability of the reagent for the instant diagnosis of Pg meets the necessary requirements and is suitable for real-time qualitative monitoring of bacteria, characterized by high specificity, sensitivity, and speed. 3.4 Overall assessment of system application The reagent and integrated system were evaluated as a whole using 28 simulated samples, with results presented in Table 2 . We compared the conventional testing methods of this system with the extraction instrument and Tianlong PCR. The experimental results from both approaches were consistent, indicating that this system has the potential to replace conventional laboratory testing solutions. The experimental procedure is straightforward, and the closed cartridge design helps mitigate issues related to experimental errors and environmental contamination. Furthermore, the entire experimental process with the integrated system is significantly shorter than that of conventional detection methods, greatly enhancing the efficiency of pathogen detection. Table 2 Comparison of the novel LAMP assay with a commercial qPCR assay. qPCR Assay The novel LAMP Assay Total Positive Rate (%) Concordance Rate (%) Positive Negative Positive 19 0 19 67.86% 100% Negative 0 9 9 Total 19 9 28 Positive Rate (%) 67.86% 3.5 Discussion In this study, the overall performance of the reagents was good in terms of sensitivity, homogeneity, and reproducibility. Masae Kitagawa et al [ 19 ] selectively and easily detected the Pg fimA II and IV genes by ring-mediated isothermal amplification with a sensitivity of only 10 2 CFU/mL; similarly, Yuxin Su et al [ 14 ] established a method for the rapid detection of Pg by ring-mediated isothermal amplification of molecular beacons with a sensitivity of 1.4 × 10 − 1 pg/µL, whereas the all-in-one assay platform for the detection of Pg by ring-mediated isothermal amplification, which was developed in the present study, has a sensitivity of 10 2 CFU/mL, and is easy to use, requiring only the addition of samples and Proteinase K to be on board for the assay, coupled with the fact that the cartridge is closed, which also avoids the problem of experimental and environmental pollution. Compared with the integrated system, the whole experimental process is much shorter than the conventional detection method, which improves the efficiency of pathogen detection to a greater extent. 4. Conclusion In conclusion, this study successfully developed a set of on-site periodontitis self-examination technologies based on closed cartridges and applied them for pathogen detection. The entire system is compact, portable, and capable of detecting pathogens quickly and effectively. For the extraction and detection of Pg, the complete process can be accomplished within one hour. The results from simulated sample tests are consistent with those obtained from qPCR, making this system particularly suitable for areas with limited medical resources or where on-site testing is essential. Additionally, it can be utilized to detect various epidemiological and unexpected diseases, such as the novel coronavirus, monkeypox virus, norovirus, and African swine fever. Therefore, this demonstrates that the system possesses the feasibility, speed, and accuracy required for point-of-care testing (POCT). Declarations Ethics declarations Clinical trial number: not applicable. Author Contributions DW: Writing original draft, including substantive translation; WZ: Provide financial support for research projects. QY: Ideas, formulation or evolution of overarching research goals and aims. SH: Supervision, Oversight and leadership of the planning and execution of research activities, including guidance of the core team. HC: Verification, whether as a part of the activity or separate, of the overall replication/reproducibility of results/experiments and other research outputs. Conflicts of interest There are no conflicts to declare. Acknowledgements Natural Science Foundation of Hunan Province of China (No.2022JJ50052), Outstanding Youth Project of Hunan Provincial Department of Education (22B0605). References Sharaf S, Hijazi K. Modulatory Mechanisms of Pathogenicity in Porphyromonas gingivalis and Other Periodontal Pathobionts. Microorganisms. 2022;11(1):15. https://doi.org/10.3390/microorganisms11010015 . Lv YT, Zeng JJ, Lu JY, Zhang XY, Xu PP, Su Y. Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) influences adipocytes injuries through triggering XBP1 and activating mitochondria-mediated apoptosis. Adipocyte. 2021;10(1):28–37. https://doi.org/10.1080/21623945.2020.1856527 . Ryder MI. Porphyromonas gingivalis and Alzheimer disease: Recent findings and potential therapies. J Periodontol. 2020;91(Suppl 1):S45–9. https://doi.org/10.1002/jper.20-0104 . Olsen I, Kell DB, Pretorius E. Is Porphyromonas gingivalis involved in Parkinson's disease? Eur J Clin Microbiol Infect Dis. 2020;39(11):2013–8. https://doi.org/10.1007/s10096-020-03944-2 . Kusugal P, Bhat KG, Ingalagi P, Patil S, Pattar G. Coculture method for in vitro cultivation of uncultured oral bacteria. J Oral Maxillofac Pathol. 2021;25(2):266–71. https://doi.org/10.4103/0973-029x.325125 . Zhao Q, Lu D, Zhang G, Zhang D, Shi X. Recent improvements in enzyme-linked immunosorbent assays based on nanomaterials. Talanta. 2021;223(Pt 1):121722. https://doi.org/10.1016/j.talanta.2020.121722 . O'Brien-Simpson NM, Burgess K, Lenzo JC, Brammar GC, Darby IB, Reynolds EC. Rapid Chair-Side Test for Detection of Porphyromonas gingivalis. J Dent Res. 2017;96(6):618–25. https://doi.org/10.1177/0022034517691720 . Lee J, Choi MK, Kim J, Chun S, Kim HG, Lee H, Kim J, Lee D, Han SH, Yoon DY. Development and Optimization of a Rapid Colorimetric Membrane Immunoassay for Porphyromonas gingivalis. J Microbiol Biotechnol. 2021;31(5):705–9. https://doi.org/10.4014/jmb.2103.03029 . Kulkarni PG, Gosavi S, Haricharan PB, Malgikar S, Mudrakola DP, Turagam N, Ealla KK. Molecular Detection of Porphyromonas gingivalis in Chronic Periodontitis Patients. J Contemp Dent Pract. 2018;19(8):992–6. Kulkarni MR, Bhat KG, Thomas BS, Bhat GS, Kulkarni RD. Identification of multiple strains of Porphyromonas gingivalis using heteroduplex polymerase chain reaction in varying severity of chronic periodontitis. Indian J Med Microbiol. 2018;36(1):81–6. https://doi.org/10.4103/ijmm.IJMM_17_434 . Brun A, Rangé H, Prouvost B, Mazighi M, Kapila Y, Bouchard P, Michel JB. Innovative application of nested PCR for detection of Porphyromonas gingivalis in human highly calcified atherothrombotic plaques. J Oral Microbiol. 2020;12(1):1742523. https://doi.org/10.1080/20002297.2020.1742523 . Gu BL, Qi YJ, Kong JY, Li ZT, Wang JP, Yuan X, Gao SG. An evaluation of direct PCR assays for the detection and quantification of Porphyromonas gingivalis. Epidemiol Infect. 2020;148:e107. https://doi.org/10.1017/s0950268820001053 . Su CY, Shigeishi H, Nishimura R, Ohta K, Sugiyama M. Detection of oral bacteria on the tongue dorsum using PCR amplification of 16S ribosomal RNA and its association with systemic disease in middle-aged and elderly patients. Biomed Rep. 2019;10(1):70–6. https://doi.org/10.3892/br.2018.1175 . Su Y, Huang S, Hong L, Zou D, Tang Y, Chao S, He X, Xu Y, Liu X, Li L, Feng L, Li W, Liu W, Ke Y, Huang L. Establishment of the molecular beacon-loop-mediated isothermal amplification method for the rapid detection of Porphyromonas gingivalis. J Microbiol Methods. 2019;160:68–72. https://doi.org/10.1016/j.mimet.2019.01.013 . Alhogail S, Suaifan G, Bizzarro S, Kaman WE, Bikker FJ, Weber K, Cialla-May D, Popp J, Zourob M. On site visual detection of Porphyromonas gingivalis related periodontitis by using a magnetic-nanobead based assay for gingipains protease biomarkers. Mikrochim Acta. 2018;185(2):149. https://doi.org/10.1007/s00604-018-2677-x . Witkowska E, Łasica AM, Niciński K, Potempa J, Kamińska A. In Search of Spectroscopic Signatures of Periodontitis: A SERS-Based Magnetomicrofluidic Sensor for Detection of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. ACS Sens. 2021;6(4):1621–35. https://doi.org/10.1021/acssensors.1c00166 . Yan YJ, Wang BW, Yang CM, Wu CY, Ou-Yang M. Autofluorescence Detection Method for Dental Plaque Bacteria Detection and Classification: Example of Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Streptococcus mutans. Dent J (Basel). 2021;9(7):74. https://doi.org/10.3390/dj9070074 . Chen H, Guan Y, Zhang X, Chen Y, Li S, Deng Y, Wu Y. Novel point-of-care rapid detection of monkeypox virus. Anal Methods. 2024;16(37):6403–10. https://doi.org/10.1039/d4ay01437e . Kitagawa M, Ouhara K, Oka H, Sakamoto S, Yamane Y, Kashiwagi A, Kanamoto R, Miyauchi M, Nagamine K. Selective and easy detection of the Porphyromonas gingivalis fimA type II and IV genes by loop-mediated isothermal amplification. J Microbiol Methods. 2021;185:106228. https://doi.org/10.1016/j.mimet.2021.106228 . Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5682928","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":396129107,"identity":"9dc57daa-998c-4e70-9e0f-18a68c404431","order_by":0,"name":"Dixin Wei","email":"","orcid":"","institution":"Shenzhen Baoan Women's and Children's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Dixin","middleName":"","lastName":"Wei","suffix":""},{"id":396129108,"identity":"088f53f8-7303-4a69-a33a-ae9ddc959f10","order_by":1,"name":"Qi Ye","email":"","orcid":"","institution":"Shenzhen Baoan Women's and Children's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Ye","suffix":""},{"id":396129109,"identity":"0a18a87e-304e-43f9-9584-277db6a16703","order_by":2,"name":"Hui Chen","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Chen","suffix":""},{"id":396129110,"identity":"65cc0b23-a823-4dbc-b7d0-700749bf7144","order_by":3,"name":"Wenhao Zhang","email":"","orcid":"","institution":"Shenzhen Baoan Women's and Children's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenhao","middleName":"","lastName":"Zhang","suffix":""},{"id":396129111,"identity":"c099aaed-3b01-40cf-b1eb-4e7b1d77776c","order_by":4,"name":"Sui Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYFACxjYwxcbMfPjBBwMbOeK18LOzpRnOKEgzJsYaNjAp2c9jIM3z4XAiQfXyM5LbHvPU3LHbcJjBwNjGgDmBgf3w0Q34tBjcSGw35jn2LBmoJeFxjgFbHgNPWtoNvFokEtukedgOJxscZjhgnGPAU8wgwWOGV4v8DJCWfyAtjA3SFkATGghpYbgB1MLbdthOspmZQZrBwICwFoMzD9sk5/YdTuBnZmMz7DFIMGYj5Bf59vRnEm++HbZn4z//+cGPP//l+NkPH8PvMChIbICx2IhRDgL2xCocBaNgFIyCEQgAhnZIOwKBe/0AAAAASUVORK5CYII=","orcid":"","institution":"Shenzhen Baoan Women's and Children's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Sui","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2024-12-20 10:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5682928/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5682928/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":72731376,"identity":"920f9fc9-c645-44bb-94b0-bd78e6002065","added_by":"auto","created_at":"2025-01-01 06:34:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":331302,"visible":true,"origin":"","legend":"\u003cp\u003eResult of optimization of LAMP reaction. (A) Screening primer group; (B) Temperature optimization; (C) Optimization of primer concentration; (D) Optimization of enzyme concentration; (E) Optimization of Dye concentration.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/27416018f6bcb854fcddf901.png"},{"id":72731107,"identity":"e51dd2af-4da2-49bb-ae21-a82491783ca2","added_by":"auto","created_at":"2025-01-01 06:26:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":73060,"visible":true,"origin":"","legend":"\u003cp\u003eResults of \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e specificity. (A) Agarose gel electrophoresis of LAMP amplification product; (B) Agarose gel electrophoresis of PCR amplification product. (A) and (B): M: 600 bp Marker, 1: \u003cem\u003eStaphylococcus aureus\u003c/em\u003e ATCC 12600, 2: \u003cem\u003eAggregatibacter actinomycetemcomitans\u003c/em\u003e Y4, 3: \u003cem\u003ePorphyromonas asaccharolytica\u003c/em\u003e ATCC 25260, 4:\u003cem\u003eStreptococcus mutans\u003c/em\u003e NBRC 13955, 5:\u003cem\u003eTannerella forsythia\u003c/em\u003e ATCC 43037, 6:\u003cem\u003eTreponema denticola\u003c/em\u003e ATCC 35405, 7:\u003cem\u003eActinobacillus actinomycetemcomitans\u003c/em\u003e ATCC 43718, 8:\u003cem\u003eStreptococcus oralis\u003c/em\u003e ATCC 10557, 9: Negative, 10: \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e ATCC 33277.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/487797c24b74ca65c4374bd4.png"},{"id":72731108,"identity":"d3f517e4-8671-4c2b-9070-20ca55f9702c","added_by":"auto","created_at":"2025-01-01 06:26:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":49844,"visible":true,"origin":"","legend":"\u003cp\u003eResults of \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e sensitivity. (A) LAMP amplification curves of six concentration gradients in the system; (B) Standard curve for LAMP assay; (C) qPCR amplification curves of six concentration gradients in the system; (D) Standard curve for qPCR assay.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/239dd5c4b43391896e685b49.png"},{"id":72731114,"identity":"6a599c4d-cfb1-441c-9c97-a9190f8f376b","added_by":"auto","created_at":"2025-01-01 06:26:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":20490,"visible":true,"origin":"","legend":"\u003cp\u003eLAMP system uniformity test results chart.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/2761d69851575e85145a0eb8.png"},{"id":72731717,"identity":"0f48fd6e-2bcb-45d4-aa8a-9871a5b87239","added_by":"auto","created_at":"2025-01-01 06:42:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":69566,"visible":true,"origin":"","legend":"\u003cp\u003eResults of homogeneity and stability. (A) Homogeneity test result; (B-D) Show the three LAMP amplification curves respectively; (E) Stability of the three LAMP experiments.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/dfc2467048b79da2c2240587.png"},{"id":103708978,"identity":"7f3bf816-1cdc-4cc4-b6ad-905ecc4a7075","added_by":"auto","created_at":"2026-03-02 02:55:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1209088,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/4ed951d8-1da1-4ddc-9296-4fbb4c430f86.pdf"},{"id":72731377,"identity":"3bdecc04-878a-491e-9224-3e4e8dc04570","added_by":"auto","created_at":"2025-01-01 06:34:40","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":528016,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-5682928/v1/988752bb0b8aeb2a029b362e.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Research on on-site periodontitis self-examination technology based on closed cartridge","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003ePorphyromonas gingivalis (Pg) is a Gram-negative anaerobic bacterium. When cultured on blood agar, it can combine with heme to form black colonies that exhibit a metallic luster on the surface and complete hemolysis. The virulence factors of Pg include gingipains, capsule, pili, hemagglutinin, lipopolysaccharide, hemolysin, and iron uptake transporters, which play a key role in the processes of bacterial adhesion and invasion of host cells [1]. Periodontitis is a highly prevalent inflammatory disease, with Pg being the most significant pathogenic bacterium involved in periodontal infection. It adheres to periodontal tissue with the aid of pili and coaggregates with other bacteria, thereby increasing both the diversity and quantity of bacteria present in the plaque and participating in the formation of plaque biofilm [2]. In addition to inducing chronic periodontitis, Pg has also been associated with head and neck tumors, digestive tract tumors, neurological diseases, and atherosclerosis [3, 4]. Numerous studies have reported that Pg is linked to oral and digestive tract cancers. These diseases, caused by Pg, pose a significant threat to human health and impose considerable pressure on society. Therefore, establishing a rapid clinical detection method for Pg is crucial.\u003c/p\u003e\n\u003cp\u003eThe detection of Pg encompasses a variety of approaches, including conventional bacteriological methods, immunological techniques, molecular biology detection, and emerging technologies such as nanotechnology, surface-enhanced Raman scattering (SERS), and mass spectrometry. Commonly employed bacterial detection methods include culture techniques, which can be categorized into solid, liquid, and semi-solid cultures. Traditional bacterial isolation and culture methods are essential for clinical bacterial identification; however, these methods often require extended timeframes, making rapid identification challenging.\u003c/p\u003e\n\u003cp\u003eThe primary immunological detection methods include enzyme-linked immunosorbent assay (ELISA), which, despite its widespread use, has notable disadvantages such as a lengthy operational time of approximately 5 hours and a cumbersome series of steps. Another method, immunoblot detection (WB), often yields experimental results that are susceptible to variations in gel preparation, sample loading, film transfer, and temperature, among other factors. In contrast, the immunochromatographic detection method allows for visual result interpretation, significantly reducing detection time; however, it suffers from low sensitivity and the potential for false-negative outcomes [5-7]. Molecular biology detection methods encompass polymerase chain reaction (PCR), fluorescence quantitative PCR (qPCR), and loop-mediated isothermal amplification (LAMP). The first two methods are characterized by low detection limits and high specificity, but they require advanced equipment and skilled personnel for analysis and operation, and the amplification process can be time-consuming. Conversely, the emerging LAMP technique shows promise as a replacement for conventional PCR, boasting approximately 100 times the sensitivity of traditional methods. This advancement offers significant potential for point-of-care detection of Pg [8-14]. Other emerging technologies for detection necessitate complex experimental procedures and costly instruments, rendering them unsuitable for rapid point-of-care testing [15-17].\u003c/p\u003e\n\u003cp\u003eIntegrated detection technology results from the optimization of the experimental process. This technology accelerates the detection process while minimizing the need for excessive instruments and manual intervention, thereby enhancing the accuracy of detection results. In this study, LAMP was employed to detect Pg in the \u003cem\u003epepO\u003c/em\u003e gene fragment, utilizing a commercial integrated detection system based on magnetic bead nucleic acid extraction and LAMP fluorescence detection to establish an efficient and integrated detection method for Pg. The system was compared with conventional laboratory instruments and PCR tests to demonstrate equivalent sensitivity and specificity, while requiring less time and fewer operations than the gold standard qPCR.\u003c/p\u003e"},{"header":"2. Materials and method","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Integrated system inspection process\u003c/h2\u003e \u003cp\u003eThe primary steps involved in the system detection process are based on the research conducted by Chen et al. [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] on integrated technology for the rapid detection of the monkeypox virus. The pathogen detection cartridge operates primarily through the vertical movement of an externally controlled plunger rod and liquid suction head within the liquid suction and discharge assembly, in conjunction with the rotation of the liquid storage base. This setup enables the completion of pathogen detection in a closed environment in a single, integrated, and automated manner.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Standard strains and nucleic acid extraction\u003c/h2\u003e \u003cp\u003eAll strains utilized in this study were procured from the Henan Industrial Microbial Strain Engineering Technology Research Center. These strains include \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e ATCC 33277, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e ATCC 12600, \u003cem\u003eAggregatibacter actinomycetemcomitans\u003c/em\u003e Y4, \u003cem\u003ePorphyromonas asaccharolytica\u003c/em\u003e ATCC 25260, \u003cem\u003eStreptococcus mutans\u003c/em\u003e NBRC 13955, \u003cem\u003eActinobacillus actinomycetemcomitans\u003c/em\u003e ATCC 43718, \u003cem\u003eTannerella forsythia\u003c/em\u003e ATCC 43037, \u003cem\u003eTreponema denticola\u003c/em\u003e ATCC 35405, and \u003cem\u003eStreptococcus oralis\u003c/em\u003e ATCC 10557. The aforementioned nine strains were employed to assess the specificity of the primers. Nucleic acids were extracted using the magnetic bead method with a nucleic acid extraction kit from Shenzhen Lemniscare Medical Technology Co., Ltd. (Shenzhen, China). The extraction was performed using the fully automatic nucleic acid extraction instrument MGX-3200, also from Shenzhen Lemniscare Medical Technology Co., Ltd. Upon completion of the extraction, the liquid from column 6 or 12 was transferred to a new nuclease-free 1.5 mL EP tube and stored at -20\u0026deg;C. The DNA concentration was determined using a NanoDrop ND-500 spectrophotometer from Hangzhou Aosheng Instrument Co., Ltd. (Hangzhou, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Establishment of LAMP system\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1 Standard plasmid synthesis and primer design\u003c/h2\u003e \u003cp\u003eThis study focused on the \u003cem\u003epepO\u003c/em\u003e gene of Pg, which is registered under the NCBI accession number AB010440.1. The corresponding sequence of the \u003cem\u003epepO\u003c/em\u003e gene was selected for analysis. Additionally, Primer Explorer V5 was utilized to design three sets of LAMP primers online, adhering to established primer design principles. Each set of primers comprised external primers F3 and B3, inner primers FIP and BIP, as well as loop primers LF and LB. PCR primers and probes were designed using Snapgene software. The sequences of all primers are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., while the target gene was synthesized by Beijing Qingke Biotechnology Co., Ltd. LAMP and PCR experiments was calculated using the formula ((6.02 \u0026times; 10\u003csup\u003e23\u003c/sup\u003e)/(X Dalton of the plasmid containing the fragment) \u0026times; (X ng mL\u0026thinsp;\u0026minus;\u0026thinsp;1 \u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e)), resulting in a fragment concentration of 3.3 \u0026times; 10\u003csup\u003e10\u003c/sup\u003e copies per \u0026micro;L.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLAMP and PCR Primers sequences used in system.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eLAMP-P1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF3-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCAGTAATCGGCGCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB3-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTGCAGGATGTCGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFIP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTGAGGTCGATGGCCGGTAGCTGCAATGGCAATAAGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBIP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGCAGGACGACTTTTATCGCTAGCCGTAGCGACTATAAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLF-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTCCTGTCAGTATCGTTAGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLB-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTGCAACGGCAATTGGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eLAMP-P2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF3-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACAGGAAGCGCGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB3-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCTGCTGCAAGGTTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFIP-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATTGCCGTTGCAGTAGCGACCATCGACCTCAGTGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBIP-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGCTACGGCTCATTCGACA CCACAATCAGGTGTACACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"4\" rowspan=\"5\"\u003e \u003cp\u003eLAMP-P3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF3-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACAGGAAGCGCGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFIP-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATTGCCGTTGCAGTAGCGA CAGTGCCATGGATACATCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBIP-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGCTACGGCTCATTCGACA CCACAATCAGGTGTACACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLF-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTCCTGTCAGTATCGTTAGTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLB-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTACTGCAACGGCAATTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAAGTTTATCTACAGCCAATTTAGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReserve\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTTAACCCTGTCACCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProbe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGCCTTATCGAATACTCTTCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 LAMP system optimization\u003c/h2\u003e \u003cp\u003eUtilize the extracted Pg DNA template to perform the LAMP reaction, preparing the system according to the 25 \u0026micro;L LAMP system recommended by the enzyme raw material manufacturer. This includes 12.5 \u0026micro;L of 2 \u0026times; LAMP Premix Buffer II, 1 \u0026micro;L each of FIP and BIP Primers (40 \u0026micro;M), 0.5 \u0026micro;L each of F3 and B3 Primers (20 \u0026micro;M), and 1 \u0026micro;L each of LF and LB Primers (20 \u0026micro;M). Additionally, include 1 \u0026micro;L of Bst 2.0 (8 U/\u0026micro;L) (Biori, Zhuhai, China), 1 \u0026micro;L of nuclease-free water, and 5 \u0026micro;L of DNA template. The thermal cycling conditions are set for 45 minutes at 65\u0026deg;C, with fluorescence data collected every minute. To optimize the reaction, determine the ideal primer set (P1\u0026thinsp;~\u0026thinsp;P3), temperature range (50\u0026thinsp;~\u0026thinsp;75\u0026deg;C), the ratio of outer to inner primers (1:1\u0026thinsp;~\u0026thinsp;1:10), Bst 2.0 concentration (0.5\u0026thinsp;~\u0026thinsp;2.5 \u0026micro;L), and dye concentration (0.5\u0026thinsp;~\u0026thinsp;2.5 \u0026micro;L).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 LAMP system specificity and sensitivity test\u003c/h2\u003e \u003cp\u003eThe basic systems for LAMP and qPCR reactions were configured separately, and DNA templates from nine bacterial strains were utilized to assess the specificity of LAMP and PCR primers for Pg. The amplified products were verified and analyzed using 2% (w/v) agarose gel electrophoresis.\u003c/p\u003e \u003cp\u003eTo evaluate the sensitivity of the LAMP system, a 10-fold dilution of a 10\u003csup\u003e8\u003c/sup\u003e CFU/mL Pg solution was performed using a physiological saline gradient, resulting in bacterial concentrations ranging from 10\u003csup\u003e6\u003c/sup\u003e to 10\u003csup\u003e1\u003c/sup\u003e CFU/mL. A magnetic bead nucleic acid extraction kit was employed to extract bacterial genomic DNA from samples with concentrations of 10\u003csup\u003e6\u003c/sup\u003e to 10\u003csup\u003e1\u003c/sup\u003e CFU/mL Pg, following the optimized protocols for both LAMP and qPCR systems. Negative controls were established and placed in the commercial qPCR instrument Gentier mini (Xi'an Tianlong Technology Co., Ltd., Xi'an, China) for detection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 LAMP system homogeneity and stability testing\u003c/h2\u003e \u003cp\u003eWe diluted the Pg bacterial liquid from an initial concentration of 10\u003csup\u003e8\u003c/sup\u003e CFU/mL to 10\u003csup\u003e6\u003c/sup\u003e CFU/mL using physiological saline and extracted the bacterial genomic DNA following the manufacturer's instructions. Sixteen reaction solutions were prepared according to the optimized LAMP system, distributed into two 8-row 0.2 mL centrifuge tubes, and placed into the commercial qPCR instrument, Gentier mini, for detection.\u003c/p\u003e \u003cp\u003eThree different concentrations of standards were selected for testing: high (10\u003csup\u003e6\u003c/sup\u003e CFU/mL), medium (10\u003csup\u003e4\u003c/sup\u003e CFU/mL), and low (10\u003csup\u003e2\u003c/sup\u003e CFU/mL). A magnetic bead nucleic acid extraction kit was employed to extract the Pg bacterial genomic DNA. The reaction solution was prepared in accordance with the optimized LAMP system, and both a negative control and a positive control were established. Three samples were configured for each concentration and placed into the Gentier mini for detection. The experiment was conducted in triplicate to assess the high, medium, and low concentrations, and the stability of the results was preliminarily evaluated through the amplification curves obtained from the three experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 System application testing\u003c/h2\u003e \u003cp\u003eTo test the application of the integrated system and the Pg LAMP detection kit, we utilized the tips of dental absorbent paper to dip into high, medium, and low concentrations of Pg solution, as well as sterile water, for 5 minutes each. Subsequently, the dental absorbent paper tips were soaked in PBS for an additional 5 minutes to simulate samples. A total of 28 random positive simulated samples and sterile water negative samples of varying concentrations were prepared. The nucleic acid extraction and real-time fluorescence LAMP detection were performed using the integrated system, and a comparison was made with the commercial extraction instrument MGX-3200 and the qPCR instrument Gentier mini.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Optimization of LAMP reaction analysis\u003c/h2\u003e\n \u003cp\u003ePrepare the reaction solution according to the 25 \u0026micro;L LAMP system recommended by the enzyme manufacturer, and perform amplification using the three designed sets of LAMP primers to identify the most effective primer combination (Fig. 1A). The results indicated that the P3 primer set exhibited a lower Tt value and shorter amplification time compared to the P1 and P2 primer sets, leading to the selection of the P3 primer set as the optimal combination. Utilizing the optimal P3 primer combination, prepare the reaction solution in accordance with the aforementioned 25 \u0026micro;L LAMP system, and conduct amplification at reaction temperatures of 50, 55, 60, 65, 70, and 75\u0026deg;C to ascertain the optimal reaction temperature (Fig. 1B). The findings revealed that amplification efficiency was highest and reaction time was shortest at an amplification temperature of 65\u0026deg;C. Consequently, 65\u0026deg;C was determined to be the optimal reaction temperature. Under constant temperature conditions of 65\u0026deg;C, the P3 primer set was employed to optimize the ratio of outer to inner primers. As illustrated in Fig. 1C, the amplification efficiency was assessed at outer to inner primer ratios of 1:1, 1:2, 1:6, and 1:8. Although the differences in efficiency were minimal, it is evident that the 1:6 ratio resulted in the shortest amplification time; thus, a ratio of 1:8 was ultimately selected as the optimal configuration for the outer and inner primers. Maintaining the constant temperature of 65\u0026deg;C, the P3 primer set with a 1:8 ratio was utilized to prepare a LAMP reaction system for optimizing Bst 2.0 concentration. Figure 1D demonstrates that amplification efficiency was highest at a Bst 2.0 volume of 2.5 \u0026micro;L, leading to the selection of 2.5 \u0026micro;L as the optimal concentration. Continuing under the same temperature conditions with the P3 primer set, an outer to inner primer ratio of 1:8, and a Bst polymerase volume of 2.5 \u0026micro;L, a LAMP reaction system was established for dye concentration optimization. As shown in Fig. 1E, variations in dye concentration had a negligible effect on the LAMP reaction; however, higher dye concentrations exhibited slight amplification inhibition, resulting in a delayed Tt. Consequently, 0.5 \u0026micro;L of dye was chosen as the optimal concentration.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 LAMP specificity and sensitivity evaluation\u003c/h2\u003e\n \u003cp\u003eNine bacterial pathogens were specifically detected, with Pg being the only one that was amplified. No non-specific amplification was observed for other bacteria, as illustrated in Fig. 2A and Fig. 2B, thereby demonstrating the specificity of both the LAMP primers and the PCR primers.\u003c/p\u003e\n \u003cp\u003eThe LAMP amplification curves for six concentration gradients are presented in Fig.\u0026nbsp;3A. The shape of the amplification curve indicates that the amplification efficiency is both stable and high, with a sensitivity that can reach 10 CFU/mL, and a minimum detection time of less than 40 minutes. A clear linear relationship exists between the logarithm of plasmid concentration and the Tt value. As illustrated in Fig.\u0026nbsp;3B, the R\u0026sup2; value is 0.749, suggesting that the LAMP detection system possesses potential for quantitative performance. Figure\u0026nbsp;3C displays the real-time fluorescence quantitative PCR amplification curve for the same six concentration gradients, while Fig.\u0026nbsp;3D presents the corresponding standard curve, which has an R\u0026sup2; value of 0.986. The amplification curve indicates that the detection threshold for real-time fluorescence PCR is 10\u003csup\u003e2\u003c/sup\u003e CFU/mL, with the entire PCR process taking approximately 80 minutes. In terms of the linearity of the standard curve, LAMP demonstrates inferior performance compared to qPCR, particularly in low concentration detection. During the detection process, amplification efficiency decreases at high concentrations, resulting in instability and an overall linear decline; however, a linear relationship is still generally maintained.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 LAMP homogeneity and stability assessment evaluation\u003c/h2\u003e\n \u003cp\u003eThe 16-well LAMP real-time fluorescence amplification curves obtained from a commercial qPCR instrument are presented in Fig. 4. The shape of the curves indicates a relatively high degree of overlap among them. Based on the Tt values, the experimental results reveal an average Tt value of 10.03, with a standard deviation (SD) of 0.43 and a coefficient of variation (CV) of 0.43%. These findings suggest that the overall uniformity of the reagents is satisfactory.\u003c/p\u003e\n \u003cp\u003eTo ensure repeatability, three standard samples with high, medium, and low concentrations were analyzed. The amplification curves for the three detection methods are presented in Fig. 5A, Fig. 5B and Fig. 5C. Overall, the curve shapes indicate that the high, medium, and low concentrations were successfully amplified in each of the three experiments, demonstrating a high degree of similarity in curve shape and reproducibility across batches, with the order of reproducibility being high concentration\u0026thinsp;\u0026gt;\u0026thinsp;medium concentration\u0026thinsp;\u0026gt;\u0026thinsp;low concentration. We calculated the standard deviation (SD) and coefficient of variation (CV) values for the Tt values across the three concentrations in the three experiments. As illustrated in Fig. 5D, the CV values for the high concentration, medium concentration, and low concentration were 5.86%, 6.62%, and 24.68%, respectively. This performance further supports the order of high concentration\u0026thinsp;\u0026gt;\u0026thinsp;medium concentration\u0026thinsp;\u0026gt;\u0026thinsp;low concentration. Stable amplification was achieved at all concentration levels, indicating that the overall amplification efficiency of the system is reproducible. Therefore, the stability of the reagent for the instant diagnosis of Pg meets the necessary requirements and is suitable for real-time qualitative monitoring of bacteria, characterized by high specificity, sensitivity, and speed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 Overall assessment of system application\u003c/h2\u003e\n \u003cp\u003eThe reagent and integrated system were evaluated as a whole using 28 simulated samples, with results presented in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. We compared the conventional testing methods of this system with the extraction instrument and Tianlong PCR. The experimental results from both approaches were consistent, indicating that this system has the potential to replace conventional laboratory testing solutions. The experimental procedure is straightforward, and the closed cartridge design helps mitigate issues related to experimental errors and environmental contamination. Furthermore, the entire experimental process with the integrated system is significantly shorter than that of conventional detection methods, greatly enhancing the efficiency of pathogen detection.\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComparison of the novel LAMP assay with a commercial qPCR assay.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eqPCR Assay\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eThe novel LAMP Assay\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePositive Rate (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eConcordance Rate (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e67.86%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePositive Rate (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e67.86%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 Discussion\u003c/h2\u003e\n \u003cp\u003eIn this study, the overall performance of the reagents was good in terms of sensitivity, homogeneity, and reproducibility. Masae Kitagawa et al [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e] selectively and easily detected the Pg fimA II and IV genes by ring-mediated isothermal amplification with a sensitivity of only 10\u003csup\u003e2\u003c/sup\u003e CFU/mL; similarly, Yuxin Su et al [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e] established a method for the rapid detection of Pg by ring-mediated isothermal amplification of molecular beacons with a sensitivity of 1.4 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e pg/\u0026micro;L, whereas the all-in-one assay platform for the detection of Pg by ring-mediated isothermal amplification, which was developed in the present study, has a sensitivity of 10\u003csup\u003e2\u003c/sup\u003e CFU/mL, and is easy to use, requiring only the addition of samples and Proteinase K to be on board for the assay, coupled with the fact that the cartridge is closed, which also avoids the problem of experimental and environmental pollution. Compared with the integrated system, the whole experimental process is much shorter than the conventional detection method, which improves the efficiency of pathogen detection to a greater extent.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eIn conclusion, this study successfully developed a set of on-site periodontitis self-examination technologies based on closed cartridges and applied them for pathogen detection. The entire system is compact, portable, and capable of detecting pathogens quickly and effectively. For the extraction and detection of Pg, the complete process can be accomplished within one hour. The results from simulated sample tests are consistent with those obtained from qPCR, making this system particularly suitable for areas with limited medical resources or where on-site testing is essential. Additionally, it can be utilized to detect various epidemiological and unexpected diseases, such as the novel coronavirus, monkeypox virus, norovirus, and African swine fever. Therefore, this demonstrates that the system possesses the feasibility, speed, and accuracy required for point-of-care testing (POCT).\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eClinical trial number: not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDW: Writing original draft, including substantive translation; WZ: Provide financial support for research projects. QY: Ideas, formulation or evolution of overarching research goals and aims. SH: Supervision, Oversight and leadership of the planning and execution of research activities, including guidance of the core team. HC: Verification, whether as a part of the activity or separate, of the overall replication/reproducibility of results/experiments and other research outputs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are no conflicts to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNatural Science Foundation of Hunan Province of China (No.2022JJ50052), Outstanding Youth Project of Hunan Provincial Department of Education (22B0605).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSharaf S, Hijazi K. Modulatory Mechanisms of Pathogenicity in Porphyromonas gingivalis and Other Periodontal Pathobionts. Microorganisms. 2022;11(1):15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms11010015\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms11010015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv YT, Zeng JJ, Lu JY, Zhang XY, Xu PP, Su Y. Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) influences adipocytes injuries through triggering XBP1 and activating mitochondria-mediated apoptosis. Adipocyte. 2021;10(1):28\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21623945.2020.1856527\u003c/span\u003e\u003cspan address=\"10.1080/21623945.2020.1856527\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyder MI. Porphyromonas gingivalis and Alzheimer disease: Recent findings and potential therapies. J Periodontol. 2020;91(Suppl 1):S45\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jper.20-0104\u003c/span\u003e\u003cspan address=\"10.1002/jper.20-0104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlsen I, Kell DB, Pretorius E. Is Porphyromonas gingivalis involved in Parkinson's disease? Eur J Clin Microbiol Infect Dis. 2020;39(11):2013\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10096-020-03944-2\u003c/span\u003e\u003cspan address=\"10.1007/s10096-020-03944-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKusugal P, Bhat KG, Ingalagi P, Patil S, Pattar G. Coculture method for in vitro cultivation of uncultured oral bacteria. J Oral Maxillofac Pathol. 2021;25(2):266\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/0973-029x.325125\u003c/span\u003e\u003cspan address=\"10.4103/0973-029x.325125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Q, Lu D, Zhang G, Zhang D, Shi X. Recent improvements in enzyme-linked immunosorbent assays based on nanomaterials. Talanta. 2021;223(Pt 1):121722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.talanta.2020.121722\u003c/span\u003e\u003cspan address=\"10.1016/j.talanta.2020.121722\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Brien-Simpson NM, Burgess K, Lenzo JC, Brammar GC, Darby IB, Reynolds EC. Rapid Chair-Side Test for Detection of Porphyromonas gingivalis. J Dent Res. 2017;96(6):618\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0022034517691720\u003c/span\u003e\u003cspan address=\"10.1177/0022034517691720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Choi MK, Kim J, Chun S, Kim HG, Lee H, Kim J, Lee D, Han SH, Yoon DY. Development and Optimization of a Rapid Colorimetric Membrane Immunoassay for Porphyromonas gingivalis. J Microbiol Biotechnol. 2021;31(5):705\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4014/jmb.2103.03029\u003c/span\u003e\u003cspan address=\"10.4014/jmb.2103.03029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni PG, Gosavi S, Haricharan PB, Malgikar S, Mudrakola DP, Turagam N, Ealla KK. Molecular Detection of Porphyromonas gingivalis in Chronic Periodontitis Patients. J Contemp Dent Pract. 2018;19(8):992\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulkarni MR, Bhat KG, Thomas BS, Bhat GS, Kulkarni RD. Identification of multiple strains of Porphyromonas gingivalis using heteroduplex polymerase chain reaction in varying severity of chronic periodontitis. Indian J Med Microbiol. 2018;36(1):81\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/ijmm.IJMM_17_434\u003c/span\u003e\u003cspan address=\"10.4103/ijmm.IJMM_17_434\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrun A, Rang\u0026eacute; H, Prouvost B, Mazighi M, Kapila Y, Bouchard P, Michel JB. Innovative application of nested PCR for detection of Porphyromonas gingivalis in human highly calcified atherothrombotic plaques. J Oral Microbiol. 2020;12(1):1742523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/20002297.2020.1742523\u003c/span\u003e\u003cspan address=\"10.1080/20002297.2020.1742523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu BL, Qi YJ, Kong JY, Li ZT, Wang JP, Yuan X, Gao SG. An evaluation of direct PCR assays for the detection and quantification of Porphyromonas gingivalis. Epidemiol Infect. 2020;148:e107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/s0950268820001053\u003c/span\u003e\u003cspan address=\"10.1017/s0950268820001053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu CY, Shigeishi H, Nishimura R, Ohta K, Sugiyama M. Detection of oral bacteria on the tongue dorsum using PCR amplification of 16S ribosomal RNA and its association with systemic disease in middle-aged and elderly patients. Biomed Rep. 2019;10(1):70\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/br.2018.1175\u003c/span\u003e\u003cspan address=\"10.3892/br.2018.1175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu Y, Huang S, Hong L, Zou D, Tang Y, Chao S, He X, Xu Y, Liu X, Li L, Feng L, Li W, Liu W, Ke Y, Huang L. Establishment of the molecular beacon-loop-mediated isothermal amplification method for the rapid detection of Porphyromonas gingivalis. J Microbiol Methods. 2019;160:68\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mimet.2019.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.mimet.2019.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhogail S, Suaifan G, Bizzarro S, Kaman WE, Bikker FJ, Weber K, Cialla-May D, Popp J, Zourob M. On site visual detection of Porphyromonas gingivalis related periodontitis by using a magnetic-nanobead based assay for gingipains protease biomarkers. Mikrochim Acta. 2018;185(2):149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00604-018-2677-x\u003c/span\u003e\u003cspan address=\"10.1007/s00604-018-2677-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWitkowska E, Łasica AM, Niciński K, Potempa J, Kamińska A. In Search of Spectroscopic Signatures of Periodontitis: A SERS-Based Magnetomicrofluidic Sensor for Detection of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. ACS Sens. 2021;6(4):1621\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acssensors.1c00166\u003c/span\u003e\u003cspan address=\"10.1021/acssensors.1c00166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan YJ, Wang BW, Yang CM, Wu CY, Ou-Yang M. Autofluorescence Detection Method for Dental Plaque Bacteria Detection and Classification: Example of Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Streptococcus mutans. Dent J (Basel). 2021;9(7):74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/dj9070074\u003c/span\u003e\u003cspan address=\"10.3390/dj9070074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Guan Y, Zhang X, Chen Y, Li S, Deng Y, Wu Y. Novel point-of-care rapid detection of monkeypox virus. Anal Methods. 2024;16(37):6403\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/d4ay01437e\u003c/span\u003e\u003cspan address=\"10.1039/d4ay01437e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKitagawa M, Ouhara K, Oka H, Sakamoto S, Yamane Y, Kashiwagi A, Kanamoto R, Miyauchi M, Nagamine K. Selective and easy detection of the Porphyromonas gingivalis fimA type II and IV genes by loop-mediated isothermal amplification. J Microbiol Methods. 2021;185:106228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mimet.2021.106228\u003c/span\u003e\u003cspan address=\"10.1016/j.mimet.2021.106228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5682928/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5682928/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePeriodontitis is a prevalent inflammatory disease, with Porphyromonas gingivalis (Pg) identified as the primary causative bacterium of periodontal infection. In addition to its role in chronic periodontitis, Pg has also been associated with head and neck tumors, digestive tract tumors, neurological diseases, and atherosclerosis (AS). Therefore, establishing a rapid clinical detection method for Pg is of paramount importance. In this study, we developed a LAMP detection reagent for Pg, and assessed its performance in terms of sensitivity, specificity, repeatability, stability, linear range, and linearity using a commercial magnetic bead-based method. The integrated nucleic acid extraction and detection system has created an on-site instant detection platform for Pg based on a closed cartridge, demonstrating a sensitivity of 10 CFU/mL, no cross-reactivity with eight other bacterial pathogens, and excellent performance in repeatability, stability, linear range, and linearity. For 28 simulated samples, the detection results from the integrated system were consistent with the experimental outcomes of qPCR and LAMP detection following nucleic acid extraction in a conventional laboratory setting. The entire process can be completed in approximately one hour, significantly reducing the time required for clinical diagnosis and indicating substantial practical needs and application prospects.\u003c/p\u003e","manuscriptTitle":"Research on on-site periodontitis self-examination technology based on closed cartridge","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-01 06:26:36","doi":"10.21203/rs.3.rs-5682928/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c13c99cf-da90-4028-a192-67efa4558b1c","owner":[],"postedDate":"January 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-02T02:54:40+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-01 06:26:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5682928","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5682928","identity":"rs-5682928","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.