Stem Cell Secretome-Enriched Hydrogels: A Novel Therapeutic Strategy for Osteoarthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Stem Cell Secretome-Enriched Hydrogels: A Novel Therapeutic Strategy for Osteoarthritis Alejandro Casado-Santos, Guillermo Vilariño-Feltrer, Yaiza González-Rodríguez, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9169856/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Osteoarthritis (OA) is a chronic degenerative joint disease characterized by progressive cartilage loss and synovial inflammation, for which current therapies are mainly symptomatic and fail to durably modify disease progression. Hyaluronic acid (HA) and chondroitin sulfate (CS) are widely used in viscosupplementation, but the rapid clearance of HA and limited bioactivity of simple mixtures restrict their long‑term benefit. In parallel, adipose‑derived mesenchymal stromal cell (ASC) secretome has emerged as a promising cell‑free therapeutic due to its pleiotropic anti‑inflammatory and regenerative actions. Here, we evaluated a novel strategy that combines a biomimetic HA‑g‑CS hydrogel with ASC‑derived secretome as an integrated, secretome‑enriched viscosupplement for OA. Methods: ASC secretome was characterised by nanoparticle tracking analysis and LC‑MS/MS proteomics, revealing a stable profile enriched in matrix‑remodelling enzymes, angiogenic and pro‑survival factors, and proteins linked to osteochondral repair. The SH‑HA‑g‑CS hydrogel was synthesised via sequential CS grafting and thiolation, and subsequently loaded with secretome at a 1:1 ratio for in vitro testing on human chondrocytes. Results: In a TNF+γ-IFN‑driven inflammatory model, samples treated with liquid HA+CS and CM preserved metabolic activity, supported migration, and modulated inflammatory and matrix‑related genes, with CM inducing the strongest downregulation of IL‑1α/IL‑6. Multiplex proteomics showed that HA+CS and CM reduced pro‑inflammatory and metalloproteinase outputs while maintaining controlled angiogenic signalling, whereas SH‑HA‑g‑CS, particularly when combined with CM, promoted a delayed yet sustained shift towards a lower‑inflammatory, reparative‑aligned secretory profile. Conclusions: Overall, these findings support secretome‑enriched HA‑g‑CS hydrogels as a promising cell‑free, disease‑modifying viscosupplement approach that integrates mechanical support with finely tuned immunomodulatory and regenerative cues in OA. Osteoarthritis hyaluronic acid chondroitin sulphate secretome mesenchymal stromal cells Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Osteoarthritis (OA) is the most common chronic articular disease globally, affecting millions of people and significantly impacting quality of life (Cui et al., 2020). It is characterized by a progressive loss of articular cartilage, subchondral bone sclerosis, and synovial inflammation (Funck-Brentano & Cohen-Solal, 2015). The disease is not singular but rather a heterogeneous group of conditions stemming from biochemical and biomechanical alterations that affect cartilage metabolism (Fernandes et al., 2002). While many aspects of the exact cause of OA are not fully understood, persistent synthesis of various mediators by articular tissues is believed to contribute to tissue deterioration. Inflammation plays a significant role in both the initiation and progression of OA, with the release of pro-inflammatory cytokines being a primary mediator of altered cartilage metabolism and increased catabolism (Tetlow et al., 2001). These signaling molecules degrade cartilage by upregulating inflammatory and catabolic genes and downregulating anti-inflammatory and anabolic genes. In its early stages, the articular cartilage surface becomes irregular with small fissures, progressing to larger irregularities and deep vertical fissures, eventually exposing the subchondral bone (Z. Zhang et al., 2011). Histologically, this progression involves chondrocyte apoptosis, decreased cellularity, and alterations in extracellular matrix production and degradation, along with inflammatory reactions in the synovial membrane (Kawasaki et al., 2008). Current conventional treatments for OA primarily focus on alleviating symptoms like pain and joint inflammation. Analgesics and non-steroidal anti-inflammatory drugs (NSAIDs) can provide temporary relief but do not halt disease progression or repair existing joint damage (Yu & Hunter, 2015). When these treatments prove insufficient, surgical interventions, including articular lavage, subchondral perforations, osteotomies, cartilage grafts, or arthroplasties may be considered. One increasingly popular therapeutic option is viscosupplementation, which involves the intra-articular injection of hyaluronic acid (HA). HA is a natural component of synovial fluid that plays a crucial role in joint lubrication and cushioning (Bannuru et al., 2011; Mosas et al., 2022; Taylor & Gallo, 2006). Additionally, chondroitin sulfate (CS), a structural component of articular cartilage, has demonstrated anti-inflammatory and chondroprotective properties, inhibiting cartilage degradation and promoting its repair (Ingavle et al., 2012). The combination of HA and CS offers advantages by improving joint lubrication, reducing inflammation, and promoting cartilage repair (Chavda et al., 2022; Nguyen et al., 2024). However, the effectiveness of this viscosupplementation is often limited due to the rapid degradation of HA within the body, making long-term clinical benefits challenging to sustain. To overcome these limitations and develop more effective therapies, recent advancements in regenerative medicine and bioengineering have focused on novel biomaterials such as hydrogels (Ao et al., 2022; Chavda et al., 2022). These materials can be engineered for the controlled release of biomolecules that promote tissue regeneration and reduce inflammation. Specifically, the combination of HA with CS has shown promise in enhancing the biomechanical properties of cartilage (Ao et al., 2022; M.-H. Kim et al., 2022). Grafting CS onto HA chains is expected to improve the bioavailability of both cartilage matrix components at the joint level, thereby prolonging treatment durability and more effectively mimicking natural cartilage properties. This synergistic combination can enhance the ability of HA to provide joint lubrication and shock absorption, thereby helping to reduce mechanical stress on the cartilage while allowing CS to promote cartilage health by inhibiting tissue-degrading enzymes and stimulating proteoglycan and type II collagen production (Mihajlovic et al., 2022). Furthermore, mesenchymal stromal cells (MSCs), particularly bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose-derived mesenchymal stem cells (ASCs), have emerged as a promising source of cell therapies with significant anti-inflammatory and regenerative capabilities (Baglio et al., 2012). The secretome of MSCs comprises a complex array of soluble factors, including proteins, lipids, and nucleic acids, which can influence tissue regeneration, immune modulation, and cellular repair (D’arrigo et al., 2019). The use of the complete secretome (as a "cell-free therapy") offers significant advantages over cell-based therapies, as it mitigates risks associated with cellular transplantation, such as immunological rejection and tumorigenicity (D’arrigo et al., 2019; Murphy et al., 2019). Cell-free therapies are also generally easier to scale, standardize, and are more compatible with conventional pharmaceutical manufacturing processes, simplifying logistics and reducing costs. The secretome of ASCs can modulate local inflammatory responses, which is crucial for treating chronic inflammatory processes that accelerate cartilage degradation such as OA (González-Cubero et al., 2024). It also includes growth factors and cytokines that promote the proliferation of resident cartilage cells and the synthesis of the extracellular matrix, aiding in damaged cartilage restoration (Murphy et al., 2019). Incorporating the secretome into an injectable hydrogel allows for a localized and minimally invasive administration. This integration enables the controlled release of these bioactive factors, potentially prolonging their therapeutic activity and reducing the need for frequent applications (Murphy et al., 2019). The main aim of this study is to evaluate the anti-inflammatory and regenerative potential of a newly developed injectable hydrogel composed of HA grafted with CS and enriched with the secretome derived from ASCs, for application in the treatment of OA. 2. Materials and Methods 2.1. Cell culture and Secretome Collection The human chondrocyte cell line MCB-Hm-Chondro-Innop LP01 (Innoprot ® ) was maintained in alpha Minimum Essential Medium (MEM α; Gibco ® ) supplemented with 3% platelet lysate (PL; Elarem ® ), 1% penicillin–streptomycin (Pen-Stre; Gibco ® ), 0.1% amphotericin B (HyClone ® ), 0.1% gentamicin (Gibco ® ), 0.02% vancomycin (Thermo Scientific ® ), and heparin at a final concentration of 0.75 U/mL, constituting the complete growth medium. Cultures were incubated under standard conditions (37°C, 5% CO₂), and the medium was renewed every two days. Once the cultures reached approximately 80% confluence, the respective treatments were applied. Cells from passages 2–3 were employed to ensure experimental consistency and all experiments were performed in triplicate unless otherwise is stated. The MCB-HTC-22 LP01 human ASC line (Histocell ® ) was cultured in Minimum Essential Medium Alpha (MEM α, Gibco ® ) supplemented with 3% human platelet lysate (Elarem ® ), 1% Penicillin-Streptomycin (Gibco ® ), 0.1% Amphotericin B (HyClone ® ), 0.1% Gentamicin (Gibco ® ), 0.02% Vancomycin (Thermo Scientific ® ), and 0.75 U/mL heparin (Sigma-Aldrich ® ) to formulate a complete growth medium. Cells were incubated under standard conditions (37°C, 5% CO₂), and the medium was renewed every two days. All experiments were performed using passages 2-4. For ASC-derived secretome generation, cells were cultured until 80–90% confluence was reached and then incubated in mitogen-free medium for 48 h; thereafter, the conditioned medium was collected, centrifuged to remove cellular debris, filtered through a 0.22 μm filter (Merck Millipore ® ), and stored at −80°C for subsequent analyses. 2.1.1. Secretome characterization Total protein concentration in the secretome samples was determined using the Micro BCA Protein Assay Kit (Thermo Scientific ® ). Nanoparticle tracking analysis (NTA) was carried out using the NanoSight LM10 ® system to assess particle size distribution and concentration. For proteomic profiling, proteins were first precipitated with acetone and subsequently digested using the Filter-Aided Sample Preparation (FASP) method (Wiśniewski et al., 2009). The resulting peptides were analyzed by liquid chromatography–tandem mass spectrometry (LC-MS/MS) on a timsTOF HT mass spectrometer coupled to an Evosep ONE system. Protein identification and quantification were performed using FragPipe software, with alignment against the Mus musculus Uniprot/SwissProt database, applying a 1% false discovery rate (FDR) threshold. Only proteins detected in at least 70% of samples per group were retained for downstream analysis. Missing values were imputed using the quantile regression imputation of left-censored data (QRILC) approach implemented in Perseus (v2.1.2.0 (Tyanova et al., 2016). Statistical significance was evaluated using a Student’s t-test (p < 0.05), and results are presented as log 2 fold changes. 2.2. AH-CS hydrogel synthesis An injectable, in situ gellable hyaluronic acid–chondroitin sulfate hydrogel (SH‑HA‑g‑CS) was prepared for this study based on its previously reported grafting efficiency, gelation behavior and controlled CS‑release profile in a separate manuscript that is currently under peer review. Briefly, medium‑ to high‑molecular‑weight HA sodium salt was first thiolated via EDC/NHS‑mediated activation of carboxyl groups and subsequent coupling with cysteamine hydrochloride, yielding thiolated HA (HA‑SH) solutions suitable for pH‑triggered disulfide crosslinking. In parallel, CS from shark cartilage was covalently grafted onto HA chains using the same carbodiimide chemistry, exploiting the terminal primary amine groups of CS to obtain HA‑g‑CS macromolecules at a HA:CS molar ratio of 0.02. To generate CS‑functionalized, crosslinkable hydrogels, a combined approach was employed in which thiolation and CS grafting were integrated into a sequential “24/48” reaction strategy based on the time spent in reaction by each reagent (24 h for HA and 48 h for CS). In this protocol, HA was dissolved at an optimized concentration and reacted with CS at the previously described HA:CS molar ratio prior to thiol introduction, allowing preferential grafting of CS onto the HA backbone before completion of thiolation. After the coupling steps, reaction mixtures were extensively dialyzed using appropriate molecular‑weight‑cutoff membranes to remove unreacted reagents and free CS and then stored under refrigerated conditions until use. 2.3. Secretome-enriched HA-g-CS hydrogel For in vitro experiments, the selected SH‑HA‑g‑CS hydrogel was combined with the MSC-secretome to obtain a secretome‑enriched formulation. The hydrogel precursor and the concentrated secretome were mixed at a 2:1 (v/v) ratio under gentle conditions to ensure a homogeneous distribution of soluble factors within the HA‑g‑CS matrix. During mixing, the pH was carefully monitored and maintained within the physiological range to favour appropriate gelation while preserving the stability and bioactivity of the secretome components. The final preparation was adjusted to yield a reproducible gel consistency suitable for handling and for subsequent in vitro testing of its biological effects. 2.4. In vitro evaluation on human chondrocytes An in vitro model on human chondrocytes was established under both basal and osteoarthritis‑like inflammatory conditions. Briefly, chondrocytes (P2) were seeded in 6‑well plates at a density of approximately 1 × 10^5 cells per well and cultured under standard conditions until reaching 80% confluence. At this point, the different experiments were carried out as described below. For the in vitro model of osteoarthritis‑like inflammation, TNF (25 ng/mL) and γ-IFN (50 ng/mL) were used as the pro‑inflammatory stimuli. Throughout the different experiments a set of samples was evaluated under both basal and/or inflammatory conditions (infl.). Table 1 summarizes the set of samples evaluated for each experiment. Table 1. Set of samples used in each experiment. EXPERIMENT BASAL SAMPLE INFLAMMATORY SAMPLE Cytotoxicity MTT assay Control CS HA HA+CS HA-g-CS CM - Wound healing assay Control CS HA HA+CS HA-g-CS CM - qPCR Control CS HA HA+CS CM Synvisc-One ® SH–HA-g–CS SH-HA-g-CS + CM Control infl. CS infl. HA infl. HA+CS infl. CM infl. SH–HA-g–CS infl. SH-HA-g-CS + CM infl. Multiplex proteomic assay Control SH–HA-g–CS Control infl. CS infl. HA infl. HA+CS infl. CM infl. SH–HA-g–CS infl. SH-HA-g-CS + CM infl. The concentrations used for each treatment were: control (complete growth medium–non treated), HA (800 ng/μl), CS (267 ng/μl), HA+CS mixture (800/267 ng/μl), HA-g-CS (1000 μl), CM (500 μl; 1.41 mg/mL), Synvisc-One® (1000 μl), SH–HA-g–CS (1000 μl), SH–HA-g–CS + CM (1500 μl on 2:1 ratio). This configuration allowed for the assessment of the modulatory effects of the tested formulations on chondrocyte viability, metabolic activity, migration and the expression of anabolic, hypertrophic and inflammatory markers under controlled inflammatory stress. 2.4.1. Cytotoxicity MTT assay MTT assay [3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazol bromide] (Invitrogen ® ) was performed to assess possible cytotoxic effects on the cells. Chondrocytes were cultivated onto 48-well plates until an ~80% confluence was reached with an initial density of 1.2·10 4 cells/well. The different conditions were applied for 24 hours. After incubation, the medium was removed and cells rinsed twice with PBS. Phenol red-free Dulbecco's Modified Eagle Medium (DMEM, Gibco ® ) with 10% MTT was used as incubation medium for 3 hours at 37ºC in darkness. A solubilization solution (100 μL) containing DMSO and isopropanol (1:1) (Fisher Scientific ® ) was then added to each well and plates were incubated for approximately 30 minutes on a microplate orbital shaker (PMS-1000i, Grant Bio™). Optical density was measured with a multiplate spectrophotometer at 570 nm (Multiskan GO, Thermo Fisher Scientific ® ). The blank values were subtracted from the absorbance readings and then normalized to the control group, corresponding to a 100% viability. All experiments were performed in triplicate. 2.4.2. Wound healing assay Proliferation, migration and wound closure abilities of assayed chondrocytes were evaluated via the wound closure assay. Cells were cultured into 6-well plates until an ~80% confluence was reached. A micropipette tip was used to generate an even scratch mark in a cross pattern to simulate a wound area. Cells were washed twice with PBS to remove detached cells and remaining debris, and the different treatments were applied with the culture media for 24 hours. Images from four random fields per well were acquired at 0 and after 24 hours. The percentage of wound closure was calculated using Fiji software (ImageJ, version 1.54p). Two independent technical replicates were performed per condition (n = 2). Within each replicate, four independent wound areas were analyzed and averaged. Due to the limited number of independent replicates (n < 3), no inferential statistical analysis was performed, and the data are presented descriptively as the individual measurements and mean ± SD. 2.4.3. Quantitative real-time PCR (qPCR) Gene expression analysis was conducted by quantitative real-time PCR (qPCR). The GeneMATRIX universal RNA purification kit (EURx ® ) was used to extract RNA from cells and quantified with a Qubit 4 Fluorimeter (Thermo Scientific ® ). Reverse transcription was performed to obtain the corresponding cDNA using a commercial kit (Applied Biosystems ® ). Amplification reactions were conducted on a QuantStudio™ 3 thermocycler (Applied Biosystems ® ) with Power SYBR Green PCR Master Mix 2× (Takara ® ) using a final volume of 10 μL per reaction. Relative mRNA expression levels of the selected genes were calculated using the 2 –ΔΔCt method, with ACT-β as the housekeeping gene. Primer sequences are provided in Table 2 . All experiments were carried out in triplicate. Table 2. Primer sequences and conditions used for qPCR. Gene NCBI RefSeq Forward/Reverse (5’-3’) Tª melt. (ºC) Product size (bp) ACT-β NM_001101.3 CCCTCCATCGTCCACCGCAAATGCT CTGCTGTCACCTTCACCGTTCCAGT 59.7 58.0 131 ACAN NM_001369268.1 CTGCCCAACTACCCGGCCAT TGCGCCCTGTCAAAGTCGAG 72.1 71.0 200 IL−6 NM_000600.3 ATAACCACCCCTGACCCAA CCATGCTACATTTGCCGAA 74.4 72.5 169 IL−10 NM_000572 TCTCCGAGATGCCTTCAGCAGA TCAGACAAGGCTTGGCAACCCA 64.0 64.0 126 IL-1a NM_000575.5 AGAGGGAAGAAATCATCAAGC TTATACTTTGATTGAGGGCG 57.5 59.2 139 2.4.4. Multiplex proteomic assay The characterization of chondrocyte-derived secreted proteins enables the evaluation of treatment-induced posttranslational responses, providing an important insight that further supports qPCR gene expression results. To quantify the differential protein content derived from each treatment, the Olink's Proximity Extension Assay (PEA) technology was used with a 48 Cytokine panel. Measurements were postprocessed with the NPX Software (Olink ® ) to correlate readings (Normalized Protein eXpression (NPX) units) to the corresponding protein concentration (pg/mL). Raw data was checked for missing readings or inconsistencies and arranged into four clusters based on their function: pro-inflammatory, anti-inflammatory, angiogenic or apoptotic. To prevent data loss and allow for subsequent calculations the pseudocount method was employed (data not shown). To reduce possible data asymmetry and variance within samples, raw values were log 2 transformed. A per-protein Z-score normalization was performed, enabling the centering of each protein value around its mean and standard deviation (SD), thus avoiding bias related to absolute concentration values within different proteins. Secretome collection was performed once each treatment time was concluded, followed by a thorough rinse with PBS and a 48-hour post-treatment culture depleted from any external source of proteins, minimizing any interference with the proteomic assay. 2.5. Statistical analysis All experiments were performed using three biological replicates, with three technical replicates per sample unless otherwise is indicated for specific tests. Results are provided as the mean ± SD of each experimental outcome. Statistical analyses were conducted using GraphPad Prism software (version 8.0.1). Normality was validated via the Shapiro-Wilk test, and statistical significance was assessed by one-way ANOVA followed by Dunnett or Tuckey post-hoc analysis for multiple comparisons. p < 0.05 was considered statistically significant. 3. Results 3.1. Secretome characterization ASC‑derived secretome was initially characterized in terms of total protein content and particle-associated parameters. BCA assay revealed a mean protein concentration of 1.41 ± 0.01 mg/mL. NTA analysis showed a mean particle concentration of 1.6·10 9 ± 1.73·10 8 particles/mL, with a mean diameter of 165.57 ± 7.20 nm. Zeta potential values were -25.50 ± 1.20 mV, falling within the range associated with optimal colloidal stability. The proteomic analysis revealed a consistent enrichment of proteins associated with extracellular matrix remodelling and tissue repair, as illustrated in Figure 1 . Of relevance was the high abundance of matrix‑remodelling enzymes such as MMP1, MMP2 and MMP3, together with reparative matrix components including periostin (POSTN) and laminin A4 (LAMA4). MMP2 and FSTL1 exhibited the highest levels of relative expression and remained remarkably stable across independent preparations, underscoring the reproducibility of the secretome profile. Also, different key proteins in osteogenesis‑related pathways are present, including LTBP2, TWSG1, clusterin (CLUS), complement factor H (CFAH), biglycan (PGS2/decorin), heat shock proteins (BiP, HSP70/HS71A and HSP7C), complement components (C1S) and various extracellular enzymes and regulators. At the same time, proteins related to vascular signalling and guidance, such as SLIT2, PTK7 and neuropilin‑2 (NRP2), were detected, suggesting a coordinated angiogenic programme beyond simple matrix degradation. The presence of secreted pro‑survival factors, particularly FSTL1 and neuregulin‑1 (NRG1), further supports the hypothesis of a pro‑reparative microenvironment. Overall, the observed angiogenic and matrix‑modulating profile indicates a secretome capable of promoting tissue remodelling and vascular organisation in a controlled manner. This panel is consistent with a secreted microenvironment able to modulate TGF‑β/BMP signalling, extracellular matrix organisation and cellular stress responses, which are key processes for bone and osteochondral regeneration in osteoarthritic contexts. In the inflammatory domain, the secretome contained multiple mediators linked to early danger signalling, leukocyte recruitment and endothelial activation, including HMGB1 and IFIT3, as well as chemokines such as CXCL8/IL‑8 and CCL2 together with adhesion molecules like VCAM1, ICAM1 and ROBO1. This profile co‑existed with a distinct subset of anti‑inflammatory and pro‑resolving proteins, notably annexin A1 (ANXA1), TSG6 and matrix‑associated regulators such as POSTN and HTRA1, which are involved in controlled tissue remodelling and dampening of inflammatory cascades. Classic regulators of inflammatory resolution and oxidative‑stress control, including heat‑shock proteins HSP70/HS71A and HSP7C, were also present alongside cytokine and chemokine modulators, indicating a balanced signature capable of limiting excessive inflammation while preserving immune surveillance. This immunomodulatory profile was further complemented by proteins involved in complement regulation (C1R, C1S, CFH), cell–cell interaction and adhesion (CD44, VCAM1) and tissue protection. 3.2. In vitro assessment of chondrocyte response A series of experiments were conducted with two primary objectives: to evaluate the preliminary basal effects of the different treatments on chondrocytes (cytotoxicity and wound healing assays) and to validate their role on chondrocyte response to pro-inflammatory stimulation (qPCR and proteomic analyses). 3.2.1. Cytotoxicity MTT assay The evaluation of chondrocyte viability using the MTT assay ( Fig. 2A ) revealed no significant differences for most treatments (HA, CS, HA+CS) compared to the control group. However, a modest but statistically significant decrease (**p < 0.01) for both HA-g-CS and CM after 24 h of exposure was observed. Nevertheless, as the MTT assay reflects cellular metabolic activity rather than direct cell viability, the apparent reduction in the CM group (~ -40%) may be influenced by the experimental design. In this condition, CM accounted for approximately one third of the total culture volume, which, while compatible with a 24 h culture period, could have resulted in partial nutrient dilution and a consequent decrease in cellular metabolic activity rather than true cytotoxicity. 3.2.2. Wound healing assay Cell migration capacity was evaluated through the wound healing assay ( Fig. 2B ). After 24 h of treatment, most samples reached a wound closure rate above 90%, with HA-g-CS showing a performance comparable to both commercially available HA, CS and their combination. On the other hand, the CM group exhibited a markedly lower wound closure percentage (43.37% ± 26.3), together with a higher variability among replicates. These findings are consistent with those obtained in the MTT assay, as a reduced cellular metabolic activity may be associated with impaired migratory and proliferative behavior. Due to the limited number of independent technical replicates, the wound healing data are presented descriptively without statistical comparison between groups. 3.2.3. Quantitative real-time PCR (qPCR) To assess the effects of the different treatments and the potential interaction between CM and SH-HA-g-CS, a three-phase experimental design was employed. Chondrocytes under both basal and pre-established inflammatory conditions were cultured for 4, 7 and 14 days with the corresponding treatments. At days 4 and 7, a preliminary pro-inflammatory panel composed of IL-6 and IL-1α was evaluated for the main liquid formulations. At 14 days, ACAN and IL-10 were additionally evaluated to further characterize the structural and anti-inflammatory profiles. Gelled formulations (Synvisc-One ® , SH-HA-g-CS and SH-HA-g-CS + CM) were only assessed at this time point due to their slow-degrading, late-effect design. At day 4, the control infl. showed a marked upregulation of both IL-6 and IL-1α compared to the non-inflamed control ( Fig. 3 A,B ), confirming the establishment of the inflammatory model. Single-component treatments (CS infl., HA infl.) induced a modest modulatory response, with a significant reduction of IL-1α (CS, **p < 0.01; HA, ***p < 0.001), while non-significant changes were observed for IL-6 relative to the control infl. group. The combination of both products (HA+CS infl.) resulted in a more pronounced response, significantly reducing both IL-6 (**p < 0.01) and IL-1α (***p 0.05). CM treatments presented the most pronounced modulation, with values similar to control for IL-1α (p > 0.05) and significantly lower than control infl. for IL-6 (***p < 0.001). After 7 days ( Fig. 3C,D ), the overall inflammatory response decreased, particularly for IL-6. CS infl. and HA infl. treatments presented heterogeneous responses, maintaining a significantly elevated expression of both IL-1α and IL-6 compared to the control group (***p < 0.001). HA+CS infl. also showed a mixed profile, with the highest IL-1α levels (***p < 0.001 vs control) but lower IL-6 relative expression, although still higher than control (***p < 0.001) and comparable to control infl. CM samples again resulted in the lowest expression levels, with CM infl. showing significantly lower expression levels of both IL-1α and IL-6 (***p < 0.001) compared to control infl. In the final 14 days stage ( Fig. 3E-H ), gelled formulations were also analyzed, including ACAN and IL-10 for most samples. A distinct response pattern can be observed between liquid and gelled treatments. In the case of IL-1α, a modest but non-significant reduction compared to control infl. can be observed for HA infl., HA+CS infl. and CM infl. with the latter presenting the lowest expression. In contrast, an overall upregulation was found in all gelled formulations except for Synvisc-One ® , especially SH-HA-g-CS infl. (***p < 0.001 vs control and control infl.). Notably, the combination of SH-HA-g-CS with CM attenuated this response, resulting in IL-1α levels of SH-HA-g-CS + CM infl. comparable to the control infl. group (p > 0.05). A similar trend was observed for IL-6, although all liquid treatments reached a significant reduction compared to control infl. (***p < 0.001). Synvisc-One ® showed expression levels comparable to the control infl., while SH-HA-g-CS + CM infl. significantly reduced the IL-6 expression compared to SH-HA-g-CS infl. (***p < 0.001). Regarding IL-10, HA infl. showed the highest expression among liquid treatments (***p < 0.001 vs control infl.). For the gelled formulations, Synvisc-One ® and SH-HA-g-CS exhibited comparable responses, while SH-HA-g-CS + CM and SH-HA-g-CS + CM infl. displayed markedly higher IL-10 expression (~380-fold and ~250-fold respectively vs control; ***p < 0.001). Finally, the ACAN profile observed followed an opposite pattern compared to the interleukins assayed. Liquid treatments showed increased expression, especially HA+CS (**p < 0.01 vs control; ***p < 0.001 vs control infl.), whereas gelled treatments exhibited a strong reduction, with SH-HA-g-CS presenting the highest level among them, although still significantly lower than both control and control infl. (**p < 0.001). 3.2.4. Multiplex proteomic assay To evaluate the global effect of each treatment over time in an inflammatory osteoarthritic-like in vitro model, a multiplex proteomic assay was conducted. To allow for a comparative pattern recognition across a panel composed of 41 proteins with heterogeneous absolute concentration ranges, the z-score calculated on log 2 -transformed data was primarily used ( Fig. 4 ). This normalization allows assessment of relative up or down regulation of each protein across conditions, while minimizing bias introduced by proteins with intrinsically high or low basal abundance. A selection of key treatments were evaluated (control, control infl., CS infl., HA infl., HA+CS infl., CM infl., SH-HA-g-CS, SH-HA-g-CS infl. and SH-HA-g-CS + CM infl.) over three key time points: 4, 7 and 14 days. On day 4, exposure to the inflammatory stimulus successfully resulted in a marked response across all inflamed conditions compared with the non-inflamed control. Control infl. showed high concentrations of canonical chemokine and cytokine families like CCLs and CXCLs, together with elevated angiogenic mediators including CSF1-3, HGF and VEGFA (x̅ = 156 pg/mL). This early response was accompanied by robust increases in apoptotic markers, particularly MMP1 (6731 pg/mL) and MMP12 (253 pg/mL), while anti-inflammatory protein levels were modest (x̅ = 1.5 pg/mL). All inflamed treatments (infl.) broadly retained this highly inflamed proteomic landscape, with differences emerging mainly in the relative attenuation of selected pro-inflammatory and apoptotic markers. CS infl. and HA infl. cultures presented pro-inflammatory chemokine levels comparable to or slightly below those of the control infl., with z-scores consistently in the upper range of their distributions. IL-6 remained strongly elevated, and MMP1 concentrations were even superior to control infl. (7118 pg/mL and 8190 pg/mL respectively), indicating that they did not substantially diminish the early inflammatory burst at the level of these markers, although some individual chemokines displayed slightly lower levels in the case of HA infl. The HA+CS infl. condition showed a more notable attenuation among the inflamed liquids at this time point: while pro-inflammatory chemokines and IL-6 remained high in absolute terms, their concentrations and z-scores were consistently lower than control infl. or CS infl., and MMP1 was slightly reduced relative to the highest values observed (z-score: 1.30 vs 1.32 for HA infl.). At the same time, angiogenic mediators (CSF1, CSF3, HGF, VEGFA) remained clearly elevated, and anti-inflammatory proteins such as IL-10 and IL-33 were detectable. CM infl. samples preserved a strong inflammatory signature comparable to control infl., with high chemokines, IL-6 (z-score: 1.01 vs 0.98 for HA+CS infl.), MMP1 and TNFSF10, and robust angiogenic responses. Overall, at day 4, HA+CS-inflamed displayed the most evident relative attenuation of the early pro-inflammatory (x̅ z-score: 0.86) and apoptotic (x̅ z-score: 1.42) peaks while maintaining a broad angiogenic profile (x̅ z-score: 0.91), and the highest anti-inflammatory response (x̅ z-score: 1.42) within an otherwise uniformly high inflammatory context. By day 7, the global proteomic profile shifted towards a partial resolution of the acute inflammatory response, with a general decrease in pro-inflammatory factors across all inflamed samples compared with day 4. The control infl. retained detectable pro-inflammatory activity, but most chemokines and IL-6 dropped to intermediate or low levels, and z-scores moved toward zero or negative values (x̅ z-score: -0.62). Angiogenic factors such as CSF1, CSF3, HGF and VEGFA also decreased compared with day 4 (x̅ z-score: -0.34), and apoptotic markers including MMP1 and TNFSF10 showed a substantial reduction in concentration and normalized z-scores (x̅ z-score: -0.35). Anti-inflammatory mediators remained low to modest in absolute terms (x̅ z-score: -0.51). CS infl. cultures presented several pro-inflammatory chemokines (e.g. CXCL9, CCL2, CXCL8) and IL-6 still elevated relative to the day-7 control infl. (380 pg/mL vs 116 pg/mL respectively), and MMP1 was comparatively high for this time point. Z-scores for these markers were close to or slightly above zero, indicating that CS infl. maintained a moderate pro-inflammatory and proteolytic burden, although it also presented the highest anti-inflammatory profile at this time point (x̅ z-score: 0.40). HA infl. and HA+CS infl. treatments displayed lower chemokine and IL-6 (IL-6: 159 pg/mL and 96 pg/mL respectively) concentrations than CS infl. (380 pg/mL), with further reductions in MMP1, suggesting a more advanced decline of the early inflammatory peak. CM infl. showed the most pronounced reduction in pro-inflammatory chemokines and IL-6 (z-score: -1.43) among the inflamed liquids, with many pro-inflammatory z-scores in the negative range (x̅ z-score: -0.71) and MMP1 substantially lower than at day 4 (7711 pg/mL vs 113 pg/mL) and lower than in the other day-7 inflamed groups (z-score: -0.61). Despite this attenuation, a sustained angiogenic activity was detected, although at lower levels than at day 4. Anti-inflammatory proteins remained low but detectable, with no strong divergence between treatments. Thus, on day 7, CM infl. exhibited the lowest residual pro-inflammatory (x̅ z-score: -0.71) and apoptotic (x̅ z-score: -0.46) marker levels among treatments, with low but preserved angiogenic signals (x̅ z-score: -0.59). At day 14, the majority of measured proteins were further reduced compared with earlier time points, indicating a late, partially resolved state of the in vitro model, with residual but heterogeneous inflammatory and remodeling activity. For the liquid conditions (CS, HA and CS+HA), all showed markedly lower pro-inflammatory chemokines and IL-6 (~3-30 pg/mL) compared with day 4, and MMP1 concentrations decreased into a modest range (~17-35 pg/mL), although differences among these three treatments remained discernible. In parallel, angiogenic mediators such as CSF1 and VEGFA persisted at low to moderate levels. Anti-inflammatory proteins were generally low across all conditions, with small IL-10 signals in some groups. The HA+CS infl. condition displayed the lowest combination of chemokine, IL-6 and MMP1 levels among the liquid inflamed treatments, with near baseline or mildly negative z-scores for many pro-inflammatory (x̅ z-score: -0.96) markers, while angiogenic signals, though reduced, remained detectable (x̅ z-score: –1.46), with remarkably low apoptotic mediators (x̅ z-score: –1.51). The gel-based conditions, evaluated only at day 14, displayed a distinct proteomic pattern. The SH-HA-g-CS infl. and SH-HA-g-CS + CM infl. treatments both exhibited low absolute levels of most chemokines compared with other treatments early time point values, but maintained relatively high IL-6 (1335 pg/mL and 1229 pg/mL respectively) and CCL2 concentrations (1447 pg/mL and 1075 pg/mL), consistent with a residual inflammatory state in the gel environment. Angiogenic markers showed a more differentiated profile: SH-HA-g-CS infl. presented relatively high CSF2 (1.91 pg/mL) and CSF3 (27.6 pg/mL), whereas SH-HA-g-CS + CM inflamed showed lower values for these specific factors but similar or slightly lower levels of CSF1 (~11 pg/mL) and VEGFA (16-22 pg/mL). Anti-inflammatory mediators were low in both gels, with slightly higher IL-10 (0.008 pg/mL vs 0.024 pg/mL) and anti-inflammatory mean concentrations in SH-HA-g-CS + CM infl. Apoptotic markers remained modest in both gels, with comparable MMP1 levels (25-28 pg/mL) and low MMP12. When evaluated across the full panel using category-wise mean concentrations (SH-HA-g-CS infl. vs SH-HA-g-CS + CM infl: pro-inflammatory–200.53 pg/mL vs 182.25 pg/mL; anti-inflammatory–0.0105 pg/mL vs 0.0178 pg/mL; angiogenic–9.44 pg/mL vs 8.13 pg/mL; apoptotic–6.46 pg/mL vs 7.39 pg/mL) and weighting the functional classes by panel size (pro-inflammatory > angiogenic > apoptotic > anti-inflammatory), SH-HA-g-CS + CM inflamed displayed a lower mean pro-inflammatory burden and slightly higher anti-inflammatory output but somewhat lower angiogenic and higher apoptotic means than SH-HA-g-CS infl. Under this weighting scheme, the lower global pro-inflammatory mean in SH-HA-g-CS + CM inflamed became the dominant signal at day 14 in gel formulations. 4. Discussion This composite secretome-enriched HA-CS hydrogel was designed to act as a dual-function therapeutic strategy: providing joint lubrication and mechanical support through the HA-CS matrix, while delivering a sustained release of bioactive molecules from the ASC-secretome to modulate inflammation and enhance cartilage regeneration. By combining a biomimetic proteoglycan-like scaffold with a cell-free biological component, this approach aims to move beyond purely symptomatic viscosupplementation and towards a next generation, regenerative, cell free alternative to conventional stem cell therapies. In our inflammatory chondrocyte model, the transcriptional data revealed that early time points were dominated by strong upregulation of IL-1α and IL-6 in inflamed controls, consistent with the central role of these cytokines in OA pathophysiology (Fernandes et al., 2002). HA and CS in solution produced only modest reductions in inflammatory gene expression, whereas HA+CS more consistently attenuated IL-1α/IL-6 transcripts at 7 and 14 days. CM further amplified this effect, leading to the most pronounced downregulation of inflammatory genes at midterm, in agreement with previous studies demonstrating that ASC secretome reduces TNF induced hypertrophy and catabolic markers in human chondrocytes and favors a shift towards a less inflammatory phenotype (Cadelano et al., 2026; Miller et al., 2014; Molnar et al., 2021a; Niada et al., 2019; Palombella et al., 2025). Regarding matrix related genes, ACAN expression tended to be preserved or mildly increased in liquid HA, CS and HA+CS treatments compared to the control, consistent with the chondroprotective and extracellular matrix supporting actions described for these glycosaminoglycans (Ao et al., 2022; Mihajlovic et al., 2022). However, in the presence of the hydrogel, especially at later time points, ACAN was downregulated despite the attenuation of some inflammatory mediators, an effect that may reflect mechanical stress and altered cell–substrate interactions in 2D cultures exposed to a viscous, partially crosslinked phase. This interpretation aligns with previous reports indicating that HA based hydrogels can modulate cytoskeletal tension and mechanotransduction in chondrocytes, necessitating 3D or explant models to fully capture their beneficial effects on matrix synthesis (Molnar et al., 2021b; Vassallo et al., 2025). The fact that MMP1 remained detectable, and in some conditions relatively high, despite ACAN downregulation supports the idea of ongoing tissue remodeling signals rather than a purely degenerative profile, given the described role of MMP1 in wound healing and matrix turnover (Hashizume & Mihara, 2010). In line with these molecular findings, the short‑term viability and migration assays support the overall biocompatibility of the tested formulations. MTT data at 24 h showed that all HA‑ and CS‑based treatments, including HA‑g‑CS, maintained chondrocyte metabolic activity above the viability threshold, with values comparable to or slightly lower than controls, indicating the absence of acute cytotoxic effects under the tested conditions. Similarly, most groups achieved wound closure rates above 90% in the scratch assay, and HA‑g‑CS displayed a migratory performance comparable to commercial HA, CS and their combination, suggesting that the hydrogel backbone does not impair baseline chondrocyte motility. In contrast, CM‑treated cells exhibited markedly lower wound closure percentages and higher variability, consistent with the reduced metabolic activity observed in the MTT assay; this pattern may reflect a shift towards a more quiescent or regulatory phenotype rather than overt toxicity, as reported in other secretome‑based approaches (Niada et al., 2019). Given the limited number of technical replicates, these data were interpreted descriptively, but they provide an important safety and functionality context for the subsequent long‑term molecular readouts. These results were supported by the multiplex proteomic analysis which showed that the temporal and treatment specific patterns reflect a dynamic interplay between pro inflammatory, anti-inflammatory, angiogenic and apoptotic processes, with clearly differentiated modulatory profiles for CS, HA, CM and SH‑HA‑g‑CS, alone or in combination. At day 4, inflamed controls displayed a typical acute inflammatory signature, characterized by high levels of chemokines (CXCL8 11, CCL2, CCL7, CCL8) and IL 6, robust production of MMP1, MMP12 and TNFSF10, and a broad angiogenic response including CSF1, CSF3, HGF and VEGFA, consistent with the cytokine/chemokine cascades and matrix remodeling surges commonly reported in OA like chondrocyte systems and TNF induced models of cartilage inflammation (Miller et al., 2014; Molnar et al., 2021a). Within this highly inflamed context, HA+CS consistently reduced key chemokines, interleukins and metalloproteinases compared with the other liquid treatments, while maintaining angiogenic signaling, suggesting a synergistic effect of HA and CS in attenuating the early inflammatory and catabolic response without fully suppressing reparative vascular cues, in line with previous reports on HA/CS combinations in OA. (Ma et al., 2025; Marrero-Berrios et al., 2024; Molnar et al., 2021b). At day 7, the system transitioned into a sub-acute phase, with a global decline in pro-inflammatory markers and metalloproteinases across treatments, indicating partial resolution of the acute TNF+γ-IFN stimulus. However, the extent of this resolution differed. CS alone maintained relatively high levels across all four functional categories, including chemokines and MMP1, suggesting a more persistent inflammatory/proteolytic environment, whereas HA and especially HA+CS showed more marked reductions in these mediators. Notably, CM emerged as the liquid treatment with the lowest residual pro inflammatory and apoptotic burden, with many chemokines and IL 6 approaching or falling below non inflamed control levels and MMP1 clearly attenuated, while preserving an intermediate angiogenic profile (CSF1, VEGFA). This pattern is compatible with the multifactorial regulatory capacity described for ASC derived secretomes, which can dampen hypertrophy, catabolism and inflammatory signaling in TNF stimulated chondrocytes while maintaining cartilage protective pathways (Kim et al., 2026). In this mid term window, CM thus appears as the liquid condition most closely aligned with a reparative immunomodulatory profile (Cadelano et al., 2026; Palombella et al., 2025). Lastly by day 14, the system entered a late repair phase, with generally low concentrations of most proteins and partial normalization of z scores, indicative of a global decline in secretory activity. Among the liquid treatments, HA+CS again was clearly the most reparative aligned condition, combining the lowest pro inflammatory and metalloproteinase levels with a still detectable but attenuated angiogenic output. In contrast, HA and CS alone retained greater residual inflammatory and apoptotic activity, suggesting that their combination more effectively sustains a low inflammatory background as cultures mature. Biologically, late reductions in IL 6, CCL2, CXCL8 and MMP1 are consistent with a microenvironment more permissive for cartilage matrix stability, given the involvement of these mediators in catabolic signaling, immune cell recruitment and collagen degradation (Navarro et al., 2024). The persistence of low to moderate CSF1 and VEGFA may reflect ongoing vascular and myeloid supportive signaling at the tissue interface, which could be relevant for in vivo repair, although sustained angiogenesis in the joint has also been associated with pain and OA progression and must therefore be interpreted cautiously (Jiang et al., 2024; Mapp & Walsh, 2012; Miller et al., 2014). The gel‑based conditions, evaluated at day 14 because of their slow‑degrading, late‑onset profile, introduced additional complexity regarding cytokine bioavailability and retention (Nguyen et al., 2024). Both inflamed gel groups (with and without CM) showed higher IL‑6 and CCL2 levels than the corresponding liquid formulations, suggesting that the hydrogel microenvironment either sustains a mild inflammatory tone or modifies cytokine diffusion and clearance. However, their functional behavior was not identical. SH‑HA‑g‑CS alone exhibited a more pronounced angiogenic signature, particularly through CSF2 and CSF3, whereas SH‑HA‑g‑CS+CM was characterized by a lower overall pro‑inflammatory output and a slightly higher anti‑inflammatory signal, at the expense of moderately reduced angiogenesis and a modest increase in apoptotic markers. When the different functional classes were weighted by panel size, giving greater relevance to pro‑inflammatory mediators than to angiogenic, apoptotic or anti‑inflammatory factors, the lower global pro‑inflammatory mean of SH‑HA‑g‑CS+CM became determinant, identifying this formulation as the gelled condition most closely aligned with a reparative profile at day 14. This interpretation is consistent with previous observations for SH‑HA‑g‑CS 24/48 (results not shown) and other biomimetic proteoglycan‑like hydrogels, where prolonged, low‑level release of glycosaminoglycans favors a more anabolic and less catabolic chondrocyte phenotype over time. In this context, the addition of CM appears to further bias the system towards a reduced pro‑inflammatory state (Niada et al., 2019), likely through the exogenous supply of anti‑inflammatory and pro‑angiogenic mediators enriched in the secretome, which may secondarily attenuate endogenous cytokine production (Vassallo et al., 2025). Mechanistically, the distinct behaviors of liquid and gel treatments suggest that HA, CS and CM influence chondrocyte inflammatory biology through complementary and context-dependent processes (Ma et al., 2025). Free HA and CS in solution appear to modulate chemokine, IL-6 and MMP1 outputs, with the HA+CS combination consistently associated with the lowest inflammatory/apoptotic load at both early and late time points. This may involve changes in receptor engagement, pericellular matrix properties or downstream signaling pathways that temper NF-κB and related inflammatory cascades (M.-H. Kim et al., 2022; Navarro et al., 2024; Nguyen et al., 2024). The CM, in contrast, provides a broader mixture of trophic and regulatory mediators that accelerate the decay of the inflammatory and catabolic peak and promote a return towards a lower-activity state at mid-term, consistent with the recognized immunomodulatory and chondroprotective potential of ASC‑secretome in preclinical OA models and ex vivo cartilage systems (Palombella et al., 2025). In the gel context, proteomic results indicate that the CS-grafted proteoglycan design might be acting in a delayed reparative way. Among other possible reasons, this phenomenon might be driven by the lower, yet sustained, bioavailability of CS and HA over time compared to the liquid formulations. The physical state could also be interfering with the local concentration and retention of cytokines and growth factors, altering both the kinetics and spatial distribution of inflammatory and angiogenic cues (Nguyen et al., 2024; B.-G. Zhang et al., 2025). Despite these promising findings, this in vitro strategy has inherent limitations. The 2D culture system cannot fully reproduce the molecular and biomechanical dynamics of an OA joint and likely overestimates the retention and exposure time of “free” liquid treatments such as HA, CS, HA+CS or CM compared with the rapid clearance and limited cartilage permeability. In addition, as suggested by the qPCR data, the presence of a viscous gel phase directly on a 2D monolayer may generate mechanical stress on chondrocytes, contributing to ACAN downregulation and persistent MMP1 expression. Future studies in 3D culture systems, cartilage explants and large animal OA models, including detailed pharmacokinetic analyses and dose response evaluations, will be required to validate these findings and to determine whether the reparative aligned profiles observed here translate into durable structural and symptomatic benefits. Abbreviations ASCs: Adipose Stem Cells BM-MSCs: Bone Marrow Mesenchymal Stem Cells CM: Conditioned Medium CS: Chondroitin Sulfate FASP: Filter-Aided Sample Preparation FDR: False Discovery Rate HA: Hyaluronic Acid NTA: Nanoparticle Tracking Analysis MSCs: Mesenchymal Stem Cells OA: Osteoarthritis PEA: Proximity Extension Assay QRILC: Quantile Regression Imputation of Left-censored data qPCR: Quantitative PCR SD: Standard Deviation SH-HA-g-CS: Gellable Hyaluronic Acid–Chondroitin Sulfate Hydrogel Declarations Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This research received funding from The Generalitat Valenciana CIGE/2021/174. We thank also the support by Fundación Leonesa Pro-neurociencias and Doctor José García Cosamalón. Authors' contributions Alejandro Casado-Santos: Writing – review & editing, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation. Guillermo Vilariño-Feltrer : Writing – review & editing, Supervision, Methodology, Investigation, Formal analysis, Data curation. Mª. Elsa González-Cubero : Writing – review & editing, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Yaiza González Rodríguez: Validation, Supervision, Formal analysis, Data curation. Mª Luisa González-Fernández: Supervision, Methodology, Investigation, Formal analysis, Data curation. Vega Villar-Suárez: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Declaration of generative AI in scientific writing During the preparation of this work the authors used PERPLEXITY to improve readability and language of this manuscript. After using this tool, the authors reviewed and edited the content as needed and took full responsibility for the content of the publication. Consent to Publish declaration: not applicable. Consent to Participate declaration: not applicable. Ethics declaration: not applicable. References Ao, Y., Tang, W., Tan, H., Li, J., Wang, F., & Yang, L. (2022). Hydrogel composed of type II collagen, chondroitin sulfate and hyaluronic acid for cartilage tissue engineering. Bio-medical materials and engineering , 33 (6), 515-523. https://doi.org/10.3233/BME-221404 Baglio, S. R., Pegtel, D. M., & Baldini, N. (2012). Mesenchymal stem cell secreted vesicles provide novel opportunities in (stem) cell-free therapy. Frontiers in physiology , 3 , 359. https://doi.org/10.3389/fphys.2012.00359 Bannuru, R. R., Natov, N. S., Dasi, U. R., Schmid, C. H., & McAlindon, T. E. (2011). Therapeutic trajectory following intra-articular hyaluronic acid injection in knee osteoarthritis–meta-analysis. Osteoarthritis and cartilage , 19 (6), 611-619. https://doi.org/10.1016/J.JOCA.2010.09.014 Cadelano, F., Giannasi, C., Rossi, N., Della Morte, E., Niada, S., Talò, G., Mistretta, D. A., Moretti, M., Peretti, G. M., Mangiavini, L., & Brini, A. T. (2026). Evaluation of MSC-Secretome Effects in an Ex Vivo Compartmentalized Osteochondral Interface Model. Stem Cells International , 2026 (1), 3275855. https://doi.org/10.1155/sci/3275855 Chavda, S., Rabbani, S. A., Wadhwa, T., & Khaimah, R. A. (2022). Role and Effectiveness of Intra-articular Injection of Hyaluronic Acid in the Treatment of Knee Osteoarthritis: A Systematic Review. Cureus , 14 (4), e24503. https://doi.org/10.7759/CUREUS.24503 Cui, C., Han, S., Shen, X., He, H., Chen, Y., Zhao, J., Wei, Y., Wang, Y., Zhu, Q., Li, D., & Yin, H. (2020). ISLR regulates skeletal muscle atrophy via IGF1-PI3K/Akt-Foxo signaling pathway. Cell and Tissue Research , 381 (3), 479-492. https://doi.org/10.1007/s00441-020-03251-4 D’arrigo, D., Roffi, A., Cucchiarini, M., Moretti, M., Candrian, C., & Filardo, G. (2019). Secretome and Extracellular Vesicles as New Biological Therapies for Knee Osteoarthritis: A Systematic Review. Journal of clinical medicine , 8 (11). https://doi.org/10.3390/JCM8111867 Fernandes, J. C., Martel-Pelletier, J., & Pelletier, J.-P. (2002). The role of cytokines in osteoarthritis pathophysiology. Biorheology , 39 (1-2), 237-246. From the American Association of Neurological Surgeons (AANS), American Society of Neuroradiology (ASNR), Cardiovascular and Interventional Radiology Society of Europe (CIRSE), Canadian Interventional Radiology Association (CIRA), Congress of Neurological Surgeons (CNS), European Society of Minimally Invasive Neurological Therapy (ESMINT), European Society of Neuroradiology (ESNR), European Stroke Organization (ESO), Society for Cardiovascular Angiography and Interventions (SCAI), Society of Interventional Radiology (SIR), Society of NeuroInterventional Surgery (SNIS), and World Stroke Organization (WSO), Sacks, D., Baxter, B., Campbell, B. C. V., Carpenter, J. S., Cognard, C., Dippel, D., Eesa, M., Fischer, U., Hausegger, K., Hirsch, J. A., Shazam Hussain, M., Jansen, O., Jayaraman, M. V., Khalessi, A. A., Kluck, B. W., Lavine, S., Meyers, P. M., Ramee, S., … Vorwerk, D. (2018). Multisociety Consensus Quality Improvement Revised Consensus Statement for Endovascular Therapy of Acute Ischemic Stroke. International Journal of Stroke: Official Journal of the International Stroke Society , 13 (6), 612-632. https://doi.org/10.1177/1747493018778713 Funck-Brentano, T., & Cohen-Solal, M. (2015). Subchondral bone and osteoarthritis. Current Opinion in Rheumatology , 27 (4), 420-426. https://doi.org/10.1097/BOR.0000000000000181 González-Cubero, E., González-Fernández, M. L., Esteban-Blanco, M., Pérez-Castrillo, S., Pérez-Fernández, E., Navasa, N., Aransay, A. M., Anguita, J., & Villar-Suárez, V. (2024). The Therapeutic Potential of Adipose-Derived Mesenchymal Stem Cell Secretome in Osteoarthritis: A Comprehensive Study. International Journal of Molecular Sciences 2024, Vol. 25, Page 11287 , 25 (20), 11287. https://doi.org/10.3390/IJMS252011287 Hashizume, M., & Mihara, M. (2010). High molecular weight hyaluronic acid inhibits IL-6-induced MMP production from human chondrocytes by up-regulating the ERK inhibitor, MKP-1. Biochemical and Biophysical Research Communications , 403 (2), 184-189. https://doi.org/10.1016/j.bbrc.2010.10.135 Ingavle, G. C., Dormer, N. H., Gehrke, S. H., & Detamore, M. S. (2012). Using chondroitin sulfate to improve the viability and biosynthesis of chondrocytes encapsulated in interpenetrating network (IPN) hydrogels of agarose and poly(ethylene glycol) diacrylate. Journal of Materials Science: Materials in Medicine , 23 (1), 157-170. https://doi.org/10.1007/s10856-011-4499-9 Jiang, Z., Cai, X., Yao, X., Zhang, S., Lan, W., Jin, Z., Tang, F., Ma, W., Yao, X., Chen, C., & Lan, T. (2024). The causal effect of cytokine cycling levels on osteoarthritis: A bidirectional Mendelian randomized study. Frontiers in Immunology , 14 . https://doi.org/10.3389/fimmu.2023.1334361 Kawasaki, Y., Xu, Z. Z., Wang, X., Park, J. Y., Zhuang, Z. Y., Tan, P. H., Gao, Y. J., Roy, K., Corfas, G., Lo, E. H., & Ji, R. R. (2008). Distinct roles of matrix metalloproteases in the early- and late-phase development of neuropathic pain. Nature Medicine , 14 (3), 331-336. https://doi.org/10.1038/nm1723 Kim, M.-H., Nguyen, D.-T., & Kim, D.-D. (2022). Recent studies on modulating hyaluronic acid-based hydrogels for controlled drug delivery. Journal of Pharmaceutical Investigation , 52 (4), 397-413. https://doi.org/10.1007/s40005-022-00568-w Kim, W. S., Woo, C. H., Lee, K. S., Choi, Y. C., Yun, Y. E., Choi, J. S., & Cho, Y. W. (2026). Extracellular vesicles from human adipose-derived stem cells relieve pain and inflammation in a rat model of knee osteoarthritis. Stem Cell Research & Therapy . https://doi.org/10.1186/s13287-026-04932-7 Ma, Y., Yang, X., Jiang, M., Ye, W., Qin, H., & Tan, S. (2025). Alone or in combination, hyaluronic acid and chondroitin sulfate alleviate ECM degradation in osteoarthritis by inhibiting the NF-κB pathway. Journal of Orthopaedic Surgery and Research , 20 (1), 11. https://doi.org/10.1186/s13018-024-05411-6 Mapp, P. I., & Walsh, D. A. (2012). Mechanisms and targets of angiogenesis and nerve growth in osteoarthritis. Nature Reviews Rheumatology , 8 (7), 390-398. https://doi.org/10.1038/nrrheum.2012.80 Marrero-Berrios, I., Salter, S. E., Hirday, R., Rabolli, C. P., Tan, A., Hung, C. T., Schloss, R. S., & Yarmush, M. L. (2024). In vitro inflammatory multi-cellular model of osteoarthritis. Osteoarthritis and Cartilage Open , 6 (1), 100432. https://doi.org/10.1016/j.ocarto.2023.100432 Mihajlovic, M., Rikkers, M., Mihajlovic, M., Viola, M., Schuiringa, G., Ilochonwu, B. C., Masereeuw, R., Vonk, L., Malda, J., Ito, K., & Vermonden, T. (2022). Viscoelastic Chondroitin Sulfate and Hyaluronic Acid Double-Network Hydrogels with Reversible Cross-Links. Biomacromolecules , 23 (3), 1350-1365. https://doi.org/10.1021/ACS.BIOMAC.1C01583 Miller, R. E., Miller, R. J., & Malfait, A.-M. (2014). Osteoarthritis joint pain: The cytokine connection. Cytokine , 70 (2), 185-193. https://doi.org/10.1016/j.cyto.2014.06.019 Molnar, V., Matišić, V., Kodvanj, I., Bjelica, R., Jeleč, Ž., Hudetz, D., Rod, E., Čukelj, F., Vrdoljak, T., Vidović, D., Starešinić, M., Sabalić, S., Dobričić, B., Petrović, T., Antičević, D., Borić, I., Košir, R., Zmrzljak, U. P., & Primorac, D. (2021a). Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. International Journal of Molecular Sciences , 22 (17), 9208. https://doi.org/10.3390/ijms22179208 Molnar, V., Matišić, V., Kodvanj, I., Bjelica, R., Jeleč, Ž., Hudetz, D., Rod, E., Čukelj, F., Vrdoljak, T., Vidović, D., Starešinić, M., Sabalić, S., Dobričić, B., Petrović, T., Antičević, D., Borić, I., Košir, R., Zmrzljak, U. P., & Primorac, D. (2021b). Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. International Journal of Molecular Sciences , 22 (17), 9208. https://doi.org/10.3390/ijms22179208 Mosas, K. K. A., Chandrasekar, A. R., Dasan, A., Pakseresht, A., & Galusek, D. (2022). Recent Advancements in Materials and Coatings for Biomedical Implants. Gels , 8 (5), 323. https://doi.org/10.3390/GELS8050323 Murphy, J. M., Raman, S., Mancuso, P., Glynn, A., & Barry, F. (2019). Mesenchymal stem cell therapy for osteoarthritis: The critical role of the cell secretome. Frontiers in Bioengineering and Biotechnology , 7 (January), 1-9. https://doi.org/10.3389/fbioe.2019.00009 Navarro, G., Gómez-Autet, M., Morales, P., Rebassa, J. B., Llinas Del Torrent, C., Jagerovic, N., Pardo, L., & Franco, R. (2024). Homodimerization of CB2 cannabinoid receptor triggered by a bivalent ligand enhances cellular signaling. Pharmacological Research , 208 , 107363. https://doi.org/10.1016/j.phrs.2024.107363 Nguyen, M., Battistoni, C. M., Babiak, P. M., Liu, J. C., & Panitch, A. (2024). Chondroitin Sulfate/Hyaluronic Acid-Blended Hydrogels Suppress Chondrocyte Inflammation under Pro-Inflammatory Conditions. ACS biomaterials science & engineering , 10 (5), 3242-3254. https://doi.org/10.1021/ACSBIOMATERIALS.4C00200 Niada, S., Giannasi, C., Gomarasca, M., Stanco, D., Casati, S., & Brini, A. T. (2019). Adipose-derived stromal cell secretome reduces TNFα-induced hypertrophy and catabolic markers in primary human articular chondrocytes. Stem Cell Research , 38 , 101463. https://doi.org/10.1016/j.scr.2019.101463 Palombella, S., Lopa, S., Recordati, C., Canesi, S., Moretti, M., & Lovati, A. B. (2025). Impact of adipose-derived mesenchymal stem cells and their secretome on osteoarthritis in a rat model. BMC Musculoskeletal Disorders , 26 (1), 392. https://doi.org/10.1186/s12891-025-08642-8 Taylor, K. R., & Gallo, R. L. (2006). Glycosaminoglycans and their proteoglycans: Host-associated molecular patterns for initiation and modulation of inflammation. FASEB journal : official publication of the Federation of American Societies for Experimental Biology , 20 (1), 9-22. https://doi.org/10.1096/fj.05-4682rev Tetlow, L. C., Adlam, D. J., & Woolley, D. E. (2001). Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: Associations with degenerative changes. Arthritis & Rheumatism , 44 (3), 585-594. https://doi.org/10.1002/1529-0131(200103)44:3%253C585::AID-ANR107%253E3.0.CO;2-C Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M. Y., Geiger, T., Mann, M., & Cox, J. (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nature Methods , 13 (9), 731-740. https://doi.org/10.1038/NMETH.3901, Vassallo, V., Di Meo, C., D’Agostino, A., La Gatta, A., Cimini, D., Toro, G., Iolascon, G., Mastrogiacomo, M., & Schiraldi, C. (2025). Biomechanical and biological features of hyaluronic acid in combination with chondroitin and platelet rich plasma for regenerative medicine applications. Frontiers in Bioengineering and Biotechnology , 13 , 1607469. https://doi.org/10.3389/fbioe.2025.1607469 Wiśniewski, J. R., Zougman, A., Nagaraj, N., & Mann, M. (2009). Universal sample preparation method for proteome analysis. Nature Methods , 6 (5), 359-362. https://doi.org/10.1038/NMETH.1322, Yu, S. P., & Hunter, D. J. (2015). Managing osteoarthritis. Australian Prescriber , 38 (4), 115-119. https://doi.org/10.18773/austprescr.2015.039 Zhang, B.-G., Liu, Q., Ma, T., Liu, J.-J., Zhang, Y., Liu, F., Wen, X.-M., Wang, D.-X., Jiang, W., & An, W.-B. (2025). Mechanism and application of injectable hydrogel as carrier system in the treatment of osteoarthritis. Frontiers in Bioengineering and Biotechnology , 13 . https://doi.org/10.3389/fbioe.2025.1636518 Zhang, Z., Jin, W., Beckett, J., Otto, T., & Moed, B. (2011). A proteomic approach for identification and localization of the pericellular components of chondrocytes. Histochemistry and Cell Biology , 136 (2), 153-162. https://doi.org/10.1007/s00418-011-0834-y Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9169856","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":614705918,"identity":"1a2a3508-82ab-4e6e-b789-c587e378f7a9","order_by":0,"name":"Alejandro Casado-Santos","email":"","orcid":"","institution":"University of León-Universidad de León","correspondingAuthor":false,"prefix":"","firstName":"Alejandro","middleName":"","lastName":"Casado-Santos","suffix":""},{"id":614705919,"identity":"e32a25af-a350-44f6-9386-ed1761c150c5","order_by":1,"name":"Guillermo Vilariño-Feltrer","email":"","orcid":"","institution":"Universitat Politècnica de València","correspondingAuthor":false,"prefix":"","firstName":"Guillermo","middleName":"","lastName":"Vilariño-Feltrer","suffix":""},{"id":614705920,"identity":"5f75c30c-81ca-4e62-9a56-f1d61519a647","order_by":2,"name":"Yaiza González-Rodríguez","email":"","orcid":"","institution":"University of León-Universidad de León","correspondingAuthor":false,"prefix":"","firstName":"Yaiza","middleName":"","lastName":"González-Rodríguez","suffix":""},{"id":614705921,"identity":"afbd9ad8-b3d1-42b0-adf9-f1e48f379d22","order_by":3,"name":"Elsa González-Cubero","email":"","orcid":"","institution":"University of León-Universidad de León","correspondingAuthor":false,"prefix":"","firstName":"Elsa","middleName":"","lastName":"González-Cubero","suffix":""},{"id":614705922,"identity":"7a60164f-8dff-4593-be64-b67d16ab4d66","order_by":4,"name":"María Luisa González-Fernández","email":"","orcid":"","institution":"University of León-Universidad de León","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"Luisa","lastName":"González-Fernández","suffix":""},{"id":614705923,"identity":"4944092f-3431-49de-93bc-892224c0fc79","order_by":5,"name":"Vega Villar-Suárez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie2RsarCMBSGTyicLKlZT+FynyEu0s1XKQh16eZyQbg41UV3HcTXcKyLLlFwE1wKQieFjg4OJh0Fo6NDvuknycf5DwHweL4X+mkBsNKGjxWBAIGy4eMxVkGy4e1TtR0fapbHAvmuGoarWEg+LaC+OxStB8RyU0z0O6dQk4gm+4TN89dKNMsSAm13SfEUGlcdMxWEI4eyvPRujSIrHFila5W7o5gkviH4MwqlGDRTyCiADkVkGCeNUgXRwiiktVpPHbsg356Ptfr/lTJl9TU3YTxplzdHMfMRCpLns8IlAPDSfe/xeDyeB6vIP52qDXRiAAAAAElFTkSuQmCC","orcid":"","institution":"University of León-Universidad de León","correspondingAuthor":true,"prefix":"","firstName":"Vega","middleName":"","lastName":"Villar-Suárez","suffix":""}],"badges":[],"createdAt":"2026-03-19 13:09:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9169856/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9169856/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105901512,"identity":"e43934af-878e-4f16-a159-63acd31c581b","added_by":"auto","created_at":"2026-04-01 09:29:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1830232,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of the secretome proteomic profile. The central radar chart shows the mean protein concentration in log2 for each category (angiogenesis, pro-inflammation, anti-inflammation, immunomodulation and osteogenesis). The outer bar charts represent the cluster of proteins (concentration in log2) for each group and their associated function.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9169856/v1/5757f9175619d2606634d2c5.png"},{"id":105901598,"identity":"d53ca20f-6673-41f4-88c1-0d7a36a28671","added_by":"auto","created_at":"2026-04-01 09:29:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":67933,"visible":true,"origin":"","legend":"\u003cp\u003eA) MTT assay results after 24 h of treatment. The percentage of cell viability ± SD is calculated with respect to the control group (100% viability).**p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9169856/v1/c6b6f28cc967addc71afd1c3.png"},{"id":105901514,"identity":"b74faa9f-6cbb-406b-a31a-f087cccbbe32","added_by":"auto","created_at":"2026-04-01 09:29:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3151771,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression of IL-1α (A, C, E), IL-6 (B, D, F), ACAN (G) and IL-10 (H) in chondrocytes under different treatments for 4 (A, B), 7 (C, D) and 14 (E, F, G, H) days respectively. n = 3. ns p\u0026gt;0.05; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 (black asterisk - compared to control; blue asterisk - compared to control infl.). Each bar represents the mean fold change (2⁻ΔΔCt) ± SD.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9169856/v1/e264ac37fe8f648db15f8065.png"},{"id":105901607,"identity":"3bc83924-5b4f-4a8e-8a8b-701c1ed35002","added_by":"auto","created_at":"2026-04-01 09:29:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1325115,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap illustrating the log2 z-score obtained for each protein. The panel is grouped horizontally by protein function (Pro-inflammatory, anti-inflammatory, angiogenic, apoptotic) and vertically by time (4, 7 and 14 days).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9169856/v1/9d60488b147a43da449d8cf3.png"},{"id":107913225,"identity":"0e6c9af9-edbe-4461-bc14-6987fd32d39f","added_by":"auto","created_at":"2026-04-27 13:43:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6236895,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9169856/v1/888a150d-7d76-4b42-8954-a63cbbf75769.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Stem Cell Secretome-Enriched Hydrogels: A Novel Therapeutic Strategy for Osteoarthritis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eOsteoarthritis (OA) is the most common chronic articular disease globally, affecting millions of people and significantly impacting quality of life (Cui et\u0026nbsp;al., 2020). It is characterized by a progressive loss of articular cartilage, subchondral bone sclerosis, and synovial inflammation (Funck-Brentano \u0026amp; Cohen-Solal, 2015). The disease is not singular but rather a heterogeneous group of conditions stemming from biochemical and biomechanical alterations that affect cartilage metabolism (Fernandes et\u0026nbsp;al., 2002). While many aspects of the exact cause of OA are not fully understood, persistent synthesis of various mediators by articular tissues is believed to contribute to tissue deterioration. Inflammation plays a significant role in both the initiation and progression of OA, with the release of pro-inflammatory cytokines being a primary mediator of altered cartilage metabolism and increased catabolism (Tetlow et\u0026nbsp;al., 2001). These signaling molecules degrade cartilage by upregulating inflammatory and catabolic genes and downregulating anti-inflammatory and anabolic genes. In its early stages, the articular cartilage surface becomes irregular with small fissures, progressing to larger irregularities and deep vertical fissures, eventually exposing the subchondral bone (Z. Zhang et\u0026nbsp;al., 2011). Histologically, this progression involves chondrocyte apoptosis, decreased cellularity, and alterations in extracellular matrix production and degradation, along with inflammatory reactions in the synovial membrane (Kawasaki et\u0026nbsp;al., 2008).\u003c/p\u003e\n\u003cp\u003eCurrent conventional treatments for OA primarily focus on alleviating symptoms like pain and joint inflammation. Analgesics and non-steroidal anti-inflammatory drugs (NSAIDs) can provide temporary relief but do not halt disease progression or repair existing joint damage (Yu \u0026amp; Hunter, 2015). When these treatments prove insufficient, surgical interventions, including articular lavage, subchondral perforations, osteotomies, cartilage grafts, or arthroplasties may be considered. One increasingly popular therapeutic option is viscosupplementation, which involves the intra-articular injection of hyaluronic acid (HA). HA is a natural component of synovial fluid that plays a crucial role in joint lubrication and cushioning (Bannuru et\u0026nbsp;al., 2011; Mosas et\u0026nbsp;al., 2022; Taylor \u0026amp; Gallo, 2006). Additionally, chondroitin sulfate (CS), a structural component of articular cartilage, has demonstrated anti-inflammatory and chondroprotective properties, inhibiting cartilage degradation and promoting its repair (Ingavle et\u0026nbsp;al., 2012). The combination of HA and CS offers advantages by improving joint lubrication, reducing inflammation, and promoting cartilage repair (Chavda et\u0026nbsp;al., 2022; Nguyen et\u0026nbsp;al., 2024). However, the effectiveness of this viscosupplementation is often limited due to the rapid degradation of HA within the body, making long-term clinical benefits challenging to sustain.\u003c/p\u003e\n\u003cp\u003eTo overcome these limitations and develop more effective therapies, recent advancements in regenerative medicine and bioengineering have focused on novel biomaterials such as hydrogels (Ao et\u0026nbsp;al., 2022; Chavda et\u0026nbsp;al., 2022). These materials can be engineered for the controlled release of biomolecules that promote tissue regeneration and reduce inflammation. Specifically, the combination of HA with CS has shown promise in enhancing the biomechanical properties of cartilage (Ao et\u0026nbsp;al., 2022; M.-H. Kim et\u0026nbsp;al., 2022). Grafting CS onto HA chains is expected to improve the bioavailability of both cartilage matrix components at the joint level, thereby prolonging treatment durability and more effectively mimicking natural cartilage properties. This synergistic combination can enhance the ability of HA to provide joint lubrication and shock absorption, thereby helping to reduce mechanical stress on the cartilage while allowing CS to promote cartilage health by inhibiting tissue-degrading enzymes and stimulating proteoglycan and type II collagen production (Mihajlovic et\u0026nbsp;al., 2022).\u003c/p\u003e\n\u003cp\u003eFurthermore, mesenchymal stromal cells (MSCs), particularly bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose-derived mesenchymal stem cells (ASCs), have emerged as a promising source of cell therapies with significant anti-inflammatory and regenerative capabilities \u0026nbsp;(Baglio et al., 2012). The secretome of MSCs comprises a complex array of soluble factors, including proteins, lipids, and nucleic acids, which can influence tissue regeneration, immune modulation, and cellular repair (D’arrigo et al., 2019). The use of the complete secretome (as a \"cell-free therapy\") offers significant advantages over cell-based therapies, as it mitigates risks associated with cellular transplantation, such as immunological rejection and tumorigenicity (D’arrigo et al., 2019; Murphy et al., 2019). Cell-free therapies are also generally easier to scale, standardize, and are more compatible with conventional pharmaceutical manufacturing processes, simplifying logistics and reducing costs. The secretome of ASCs can modulate local inflammatory responses, which is crucial for treating chronic inflammatory processes that accelerate cartilage degradation such as OA (González-Cubero et al., 2024). It also includes growth factors and cytokines that promote the proliferation of resident cartilage cells and the synthesis of the extracellular matrix, aiding in damaged cartilage restoration (Murphy et al., 2019). Incorporating the secretome into an injectable hydrogel allows for a localized and minimally invasive administration. This integration enables the controlled release of these bioactive factors, potentially prolonging their therapeutic activity and reducing the need for frequent applications (Murphy et al., 2019).\u003c/p\u003e\n\u003cp\u003eThe main aim of this study is to evaluate the anti-inflammatory and regenerative potential of a newly developed injectable hydrogel composed of HA grafted with CS and enriched with the secretome derived from ASCs, for application in the treatment of OA.\u0026nbsp;\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e2.1. Cell culture and Secretome Collection\u003c/p\u003e\n\u003cp\u003eThe human chondrocyte cell line MCB-Hm-Chondro-Innop LP01 (Innoprot\u003csup\u003e®\u003c/sup\u003e) was maintained in alpha Minimum Essential Medium (MEM α; Gibco\u003csup\u003e®\u003c/sup\u003e) supplemented with 3% platelet lysate (PL; Elarem\u003csup\u003e®\u003c/sup\u003e), 1% penicillin–streptomycin (Pen-Stre; Gibco\u003csup\u003e®\u003c/sup\u003e), 0.1% amphotericin B (HyClone\u003csup\u003e®\u003c/sup\u003e), 0.1% gentamicin (Gibco\u003csup\u003e®\u003c/sup\u003e), 0.02% vancomycin (Thermo Scientific\u003csup\u003e®\u003c/sup\u003e), and heparin at a final concentration of 0.75 U/mL, constituting the complete growth medium. Cultures were incubated under standard conditions (37°C, 5% CO₂), and the medium was renewed every two days. Once the cultures reached approximately 80% confluence, the respective treatments were applied. Cells from passages 2–3 were employed to ensure experimental consistency and all experiments were performed in triplicate unless otherwise is stated.\u003c/p\u003e\n\u003cp\u003eThe MCB-HTC-22 LP01 human ASC line (Histocell\u003csup\u003e®\u003c/sup\u003e) was cultured in Minimum Essential Medium Alpha (MEM α, Gibco\u003csup\u003e®\u003c/sup\u003e) supplemented with 3% human platelet lysate (Elarem\u003csup\u003e®\u003c/sup\u003e), 1% Penicillin-Streptomycin (Gibco\u003csup\u003e®\u003c/sup\u003e), 0.1% Amphotericin B (HyClone\u003csup\u003e®\u003c/sup\u003e), 0.1% Gentamicin (Gibco\u003csup\u003e®\u003c/sup\u003e), 0.02% Vancomycin (Thermo Scientific\u003csup\u003e®\u003c/sup\u003e), and 0.75 U/mL heparin (Sigma-Aldrich\u003csup\u003e®\u003c/sup\u003e) to formulate a complete growth medium. Cells were incubated under standard conditions (37°C, 5% CO₂), and the medium was renewed every two days. All experiments were performed using passages 2-4. For ASC-derived secretome generation, cells were cultured until 80–90% confluence was reached and then incubated in mitogen-free medium for 48 h; thereafter, the conditioned medium was collected, centrifuged to remove cellular debris, filtered through a 0.22 μm filter (Merck Millipore\u003csup\u003e®\u003c/sup\u003e), and stored at −80°C for subsequent analyses.\u003c/p\u003e\n\u003cp\u003e2.1.1. Secretome characterization\u003c/p\u003e\n\u003cp\u003eTotal protein concentration in the secretome samples was determined using the Micro BCA Protein Assay Kit (Thermo Scientific\u003csup\u003e®\u003c/sup\u003e). Nanoparticle tracking analysis (NTA) was carried out using the NanoSight LM10\u003csup\u003e®\u003c/sup\u003e system to assess particle size distribution and concentration.\u003c/p\u003e\n\u003cp\u003eFor proteomic profiling, proteins were first precipitated with acetone and subsequently digested using the Filter-Aided Sample Preparation (FASP) method (Wiśniewski et\u0026nbsp;al., 2009). The resulting peptides were analyzed by liquid chromatography–tandem mass spectrometry (LC-MS/MS) on a timsTOF HT mass spectrometer coupled to an Evosep ONE system. Protein identification and quantification were performed using FragPipe software, with alignment against the Mus musculus Uniprot/SwissProt database, applying a 1% false discovery rate (FDR) threshold.\u003c/p\u003e\n\u003cp\u003eOnly proteins detected in at least 70% of samples per group were retained for downstream analysis. Missing values were imputed using the quantile regression imputation of left-censored data (QRILC) approach implemented in Perseus (v2.1.2.0 (Tyanova et\u0026nbsp;al., 2016). Statistical significance was evaluated using a Student’s t-test (p \u0026lt; 0.05), and results are presented as log\u003csub\u003e2\u003c/sub\u003e fold changes.\u003c/p\u003e\n\u003cp\u003e2.2. AH-CS hydrogel synthesis\u003c/p\u003e\n\u003cp\u003eAn injectable, \u003cem\u003ein situ\u003c/em\u003e gellable hyaluronic acid–chondroitin sulfate hydrogel (SH‑HA‑g‑CS) was prepared for this study based on its previously reported grafting efficiency, gelation behavior and controlled CS‑release profile in a separate manuscript that is currently under peer review. Briefly, medium‑ to high‑molecular‑weight HA sodium salt was first thiolated via EDC/NHS‑mediated activation of carboxyl groups and subsequent coupling with cysteamine hydrochloride, yielding thiolated HA (HA‑SH) solutions suitable for pH‑triggered disulfide crosslinking. In parallel, CS from shark cartilage was covalently grafted onto HA chains using the same carbodiimide chemistry, exploiting the terminal primary amine groups of CS to obtain HA‑g‑CS macromolecules at a HA:CS molar ratio of 0.02.\u003c/p\u003e\n\u003cp\u003eTo generate CS‑functionalized, crosslinkable hydrogels, a combined approach was employed in which thiolation and CS grafting were integrated into a sequential “24/48” reaction strategy based on the time spent in reaction by each reagent (24 h for HA and 48 h for CS). In this protocol, HA was dissolved at an optimized concentration and reacted with CS at the previously described HA:CS molar ratio prior to thiol introduction, allowing preferential grafting of CS onto the HA backbone before completion of thiolation. After the coupling steps, reaction mixtures were extensively dialyzed using appropriate molecular‑weight‑cutoff membranes to remove unreacted reagents and free CS and then stored under refrigerated conditions until use.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.3. Secretome-enriched HA-g-CS hydrogel\u003c/p\u003e\n\u003cp\u003eFor \u003cem\u003ein vitro\u003c/em\u003e experiments, the selected SH‑HA‑g‑CS hydrogel was combined with the MSC-secretome to obtain a secretome‑enriched formulation. The hydrogel precursor and the concentrated secretome were mixed at a 2:1 (v/v) ratio under gentle conditions to ensure a homogeneous distribution of soluble factors within the HA‑g‑CS matrix. During mixing, the pH was carefully monitored and maintained within the physiological range to favour appropriate gelation while preserving the stability and bioactivity of the secretome components. The final preparation was adjusted to yield a reproducible gel consistency suitable for handling and for subsequent \u003cem\u003ein vitro\u003c/em\u003e testing of its biological effects.\u003c/p\u003e\n\u003cp\u003e2.4. \u003cem\u003eIn vitro\u003c/em\u003e evaluation on human chondrocytes\u003c/p\u003e\n\u003cp\u003eAn \u003cem\u003ein vitro\u003c/em\u003e model on human chondrocytes was established under both basal and \u0026nbsp; osteoarthritis‑like inflammatory conditions. Briefly, chondrocytes (P2) were seeded in 6‑well plates at a density of approximately 1 × 10^5 cells per well and cultured under standard conditions until reaching 80% confluence. At this point, the different experiments were carried out as described below. For the \u003cem\u003ein vitro\u003c/em\u003e model of osteoarthritis‑like inflammation, TNF (25 ng/mL) and γ-IFN (50 ng/mL) were used as the pro‑inflammatory stimuli.\u003c/p\u003e\n\u003cp\u003eThroughout the different experiments a set of samples was evaluated under both basal and/or inflammatory conditions (infl.). \u003cstrong\u003eTable 1\u003c/strong\u003e summarizes the set of samples evaluated for each experiment.\u003c/p\u003e\n\u003cp\u003eTable 1. Set of samples used in each experiment.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eEXPERIMENT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eBASAL SAMPLE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eINFLAMMATORY SAMPLE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCytotoxicity MTT\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eassay\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003cp\u003eCS\u003c/p\u003e\n \u003cp\u003eHA\u003c/p\u003e\n \u003cp\u003eHA+CS\u003c/p\u003e\n \u003cp\u003eHA-g-CS\u003c/p\u003e\n \u003cp\u003eCM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eWound healing\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eassay\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003cp\u003eCS\u003c/p\u003e\n \u003cp\u003eHA\u003c/p\u003e\n \u003cp\u003eHA+CS\u003c/p\u003e\n \u003cp\u003eHA-g-CS\u003c/p\u003e\n \u003cp\u003eCM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eqPCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003cp\u003eCS\u003c/p\u003e\n \u003cp\u003eHA\u003c/p\u003e\n \u003cp\u003eHA+CS\u003c/p\u003e\n \u003cp\u003eCM\u003c/p\u003e\n \u003cp\u003eSynvisc-One\u003csup\u003e®\u003c/sup\u003e\u003c/p\u003e\n \u003cp\u003eSH–HA-g–CS\u003c/p\u003e\n \u003cp\u003eSH-HA-g-CS + CM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl infl.\u003c/p\u003e\n \u003cp\u003eCS infl.\u003c/p\u003e\n \u003cp\u003eHA infl.\u003c/p\u003e\n \u003cp\u003eHA+CS infl.\u003c/p\u003e\n \u003cp\u003eCM infl.\u003c/p\u003e\n \u003cp\u003eSH–HA-g–CS infl.\u003c/p\u003e\n \u003cp\u003eSH-HA-g-CS + CM infl.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eMultiplex proteomic\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eassay\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003cp\u003eSH–HA-g–CS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eControl infl.\u003c/p\u003e\n \u003cp\u003eCS infl.\u003c/p\u003e\n \u003cp\u003eHA infl.\u003c/p\u003e\n \u003cp\u003eHA+CS infl.\u003c/p\u003e\n \u003cp\u003eCM infl.\u003c/p\u003e\n \u003cp\u003eSH–HA-g–CS infl.\u003c/p\u003e\n \u003cp\u003eSH-HA-g-CS + CM infl.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe concentrations used for each treatment were: control (complete growth medium–non treated), HA (800 ng/μl), CS (267 ng/μl), HA+CS mixture (800/267 ng/μl), HA-g-CS (1000 μl), CM (500 μl; 1.41 mg/mL), Synvisc-One® (1000 μl), SH–HA-g–CS (1000 μl), SH–HA-g–CS + CM (1500 μl on 2:1 ratio).\u003c/p\u003e\n\u003cp\u003eThis configuration allowed for the assessment of the modulatory effects of the tested formulations on chondrocyte viability, metabolic activity, migration and the expression of anabolic, hypertrophic and inflammatory markers under controlled inflammatory stress.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4.1.\u0026nbsp; \u0026nbsp;Cytotoxicity MTT assay\u003c/p\u003e\n\u003cp\u003eMTT assay [3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazol bromide] (Invitrogen\u003csup\u003e®\u003c/sup\u003e) was performed to assess possible cytotoxic effects on the cells. Chondrocytes were cultivated onto 48-well plates until an ~80% confluence was reached with an initial density of 1.2·10\u003csup\u003e4\u0026nbsp;\u003c/sup\u003ecells/well. The different conditions were applied for 24 hours. After incubation, the medium was removed and cells rinsed twice with PBS. Phenol red-free Dulbecco's Modified Eagle Medium (DMEM, Gibco\u003csup\u003e®\u003c/sup\u003e) with 10% MTT was used as incubation medium for 3 hours at 37ºC in darkness. A solubilization solution (100 μL) containing DMSO and isopropanol (1:1) (Fisher Scientific\u003csup\u003e®\u003c/sup\u003e) was then added to each well and plates were incubated for approximately 30 minutes on a microplate orbital shaker (PMS-1000i, Grant Bio™). Optical density was measured with a multiplate spectrophotometer at 570 nm (Multiskan GO, Thermo Fisher Scientific\u003csup\u003e®\u003c/sup\u003e). The blank values were subtracted from the absorbance readings and then normalized to the control group, corresponding to a 100% viability. All experiments were performed in triplicate.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4.2.\u0026nbsp; \u0026nbsp;Wound healing assay\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eProliferation, migration and wound closure abilities of assayed chondrocytes were evaluated via the wound closure assay. Cells were cultured into 6-well plates until an ~80% confluence was reached. A micropipette tip was used to generate an even scratch mark in a cross pattern to simulate a wound area. Cells were washed twice with PBS to remove detached cells and remaining debris, and the different treatments were applied with the culture media for 24 hours. Images from four random fields per well were acquired at 0 and after 24 hours. The percentage of wound closure was calculated using Fiji software (ImageJ, version 1.54p). Two independent technical replicates were performed per condition (n = 2). Within each replicate, four independent wound areas were analyzed and averaged. Due to the limited number of independent replicates (n \u0026lt; 3), no inferential statistical analysis was performed, and the data are presented descriptively as the individual measurements and mean ± SD.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.4.3.\u0026nbsp; \u0026nbsp;Quantitative real-time PCR (qPCR)\u003c/p\u003e\n\u003cp\u003eGene expression analysis was conducted by quantitative real-time PCR (qPCR). The GeneMATRIX universal RNA purification kit (EURx\u003csup\u003e®\u003c/sup\u003e) was used to extract RNA from cells and quantified with a Qubit 4 Fluorimeter (Thermo Scientific\u003csup\u003e®\u003c/sup\u003e). Reverse transcription was performed to obtain the corresponding cDNA using a commercial kit (Applied Biosystems\u003csup\u003e®\u003c/sup\u003e). Amplification reactions were conducted on a QuantStudio™ 3 thermocycler (Applied Biosystems\u003csup\u003e®\u003c/sup\u003e) with Power SYBR Green PCR Master Mix 2× (Takara\u003csup\u003e®\u003c/sup\u003e) using a final volume of 10 μL per reaction. Relative mRNA expression levels of the selected genes were calculated using the 2\u003csup\u003e–ΔΔCt\u003c/sup\u003e method, with ACT-β as the housekeeping gene. Primer sequences are provided in \u003cstrong\u003eTable 2\u003c/strong\u003e. All experiments were\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ecarried out in triplicate.\u003c/p\u003e\n\u003cp\u003eTable 2.\u0026nbsp;Primer sequences and conditions used for qPCR.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eNCBI RefSeq\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eForward/Reverse (5’-3’)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTª melt. (ºC)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eProduct size (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eACT-β\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001101.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCCCTCCATCGTCCACCGCAAATGCT\u003cbr\u003e\u0026nbsp;CTGCTGTCACCTTCACCGTTCCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e59.7\u003cbr\u003e\u0026nbsp;58.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e131\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eACAN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001369268.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCTGCCCAACTACCCGGCCAT\u003c/p\u003e\n \u003cp\u003eTGCGCCCTGTCAAAGTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e72.1\u003c/p\u003e\n \u003cp\u003e71.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIL−6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000600.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eATAACCACCCCTGACCCAA\u003cbr\u003e\u0026nbsp;CCATGCTACATTTGCCGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e74.4\u003cbr\u003e\u0026nbsp;72.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e169\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIL−10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000572\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTCTCCGAGATGCCTTCAGCAGA\u003cbr\u003e\u0026nbsp;TCAGACAAGGCTTGGCAACCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e64.0\u003c/p\u003e\n \u003cp\u003e64.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIL-1a\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_000575.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAGAGGGAAGAAATCATCAAGC\u003c/p\u003e\n \u003cp\u003eTTATACTTTGATTGAGGGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e57.5\u003c/p\u003e\n \u003cp\u003e59.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e139\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.4.4.\u0026nbsp; \u0026nbsp;Multiplex proteomic assay\u003c/p\u003e\n\u003cp\u003eThe characterization of chondrocyte-derived secreted proteins enables the evaluation of treatment-induced posttranslational responses, providing an important insight that further supports qPCR gene expression results.\u003c/p\u003e\n\u003cp\u003eTo quantify the differential protein content derived from each treatment, the Olink's Proximity Extension Assay (PEA) technology was used with a 48 Cytokine panel. Measurements were postprocessed with the NPX Software (Olink\u003csup\u003e®\u003c/sup\u003e) to correlate readings (Normalized Protein eXpression (NPX) units) to the corresponding protein concentration (pg/mL). Raw data was checked for missing readings or inconsistencies and arranged into four clusters based on their function: pro-inflammatory, anti-inflammatory, angiogenic or apoptotic. To prevent data loss and allow for subsequent calculations the pseudocount method was employed (data not shown). To reduce possible data asymmetry and variance within samples, raw values were log\u003csub\u003e2\u003c/sub\u003e transformed. A per-protein Z-score normalization was performed, enabling the centering of each protein value around its mean and standard deviation (SD), thus avoiding bias related to absolute concentration values within different proteins. Secretome collection was performed once each treatment time was concluded, followed by a thorough rinse with PBS and a 48-hour post-treatment culture depleted from any external source of proteins, minimizing any interference with the proteomic assay.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.5. Statistical analysis\u003c/p\u003e\n\u003cp\u003eAll experiments were performed using three biological replicates, with three technical replicates per sample unless otherwise is indicated for specific tests. Results are provided as the mean ± SD of each experimental outcome. Statistical analyses were conducted using GraphPad Prism software (version 8.0.1). Normality was validated via the Shapiro-Wilk test, and statistical significance was assessed by one-way ANOVA followed by Dunnett or Tuckey post-hoc analysis for multiple comparisons. p \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1. Secretome characterization\u003c/p\u003e\n\u003cp\u003eASC‑derived secretome was initially characterized in terms of total protein content and particle-associated parameters. BCA assay revealed a mean protein concentration of 1.41 \u0026plusmn; 0.01 mg/mL. NTA analysis showed a mean particle concentration of 1.6\u0026middot;10\u003csup\u003e9\u0026nbsp;\u003c/sup\u003e\u0026plusmn; 1.73\u0026middot;10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eparticles/mL, with a mean diameter of 165.57 \u0026plusmn; 7.20 nm. Zeta potential values were -25.50 \u0026plusmn; 1.20 mV, falling within the range associated with optimal colloidal stability.\u003c/p\u003e\n\u003cp\u003eThe proteomic analysis revealed a consistent enrichment of proteins associated with extracellular matrix remodelling and tissue repair, as illustrated in \u003cstrong\u003eFigure 1\u003c/strong\u003e. Of relevance was the high abundance of matrix‑remodelling enzymes such as MMP1, MMP2 and MMP3, together with reparative matrix components including periostin (POSTN) and laminin A4 (LAMA4). MMP2 and FSTL1 exhibited the highest levels of relative expression and remained remarkably stable across independent preparations, underscoring the reproducibility of the secretome profile. Also, different key proteins in osteogenesis‑related pathways are present, including LTBP2, TWSG1, clusterin (CLUS), complement factor H (CFAH), biglycan (PGS2/decorin), heat shock proteins (BiP, HSP70/HS71A and HSP7C), complement components (C1S) and various extracellular enzymes and regulators. At the same time, proteins related to vascular signalling and guidance, such as SLIT2, PTK7 and neuropilin‑2 (NRP2), were detected, suggesting a coordinated angiogenic programme beyond simple matrix degradation. The presence of secreted pro‑survival factors, particularly FSTL1 and neuregulin‑1 (NRG1), further supports the hypothesis of a pro‑reparative microenvironment. Overall, the observed angiogenic and matrix‑modulating profile indicates a secretome capable of promoting tissue remodelling and vascular organisation in a controlled manner. This panel is consistent with a secreted microenvironment able to modulate TGF‑\u0026beta;/BMP signalling, extracellular matrix organisation and cellular stress responses, which are key processes for bone and osteochondral regeneration in osteoarthritic contexts. \u003cv:shapetype id=\"_x0000_t75\" coordsize=\"21600,21600\" o:spt=\"75\" o:preferrelative=\"t\" path=\"m@4@5l@4@11@9@11@9@5xe\" filled=\"f\" stroked=\"f\"\u003e\u0026nbsp;\u003cv:stroke joinstyle=\"miter\"\u003e\u0026nbsp;\u003cv:formulas\u003e\u0026nbsp;\u003cv:f eqn=\"if lineDrawn pixelLineWidth 0\"\u003e\u0026nbsp;\u003cv:f eqn=\"sum @0 1 0\"\u003e\u0026nbsp;\u003cv:f eqn=\"sum 0 0 @1\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @2 1 2\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @3 21600 pixelWidth\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @3 21600 pixelHeight\"\u003e\u0026nbsp;\u003cv:f eqn=\"sum @0 0 1\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @6 1 2\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @7 21600 pixelWidth\"\u003e\u0026nbsp;\u003cv:f eqn=\"sum @8 21600 0\"\u003e\u0026nbsp;\u003cv:f eqn=\"prod @7 21600 pixelHeight\"\u003e\u0026nbsp;\u003cv:f eqn=\"sum @10 21600 0\"\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:f\u003e\u0026nbsp;\u003c/v:formulas\u003e\n \u003cv:path o:extrusionok=\"f\" gradientshapeok=\"t\" o:connecttype=\"rect\"\u003e\u0026nbsp;\u003c/v:path\u003e\u0026nbsp;\n \u003c/v:stroke\u003e\u0026nbsp;\u003c/v:shapetype\u003e\n \u003cv:shape id=\"Imagen_x0020_2\" o:spid=\"_x0000_i1028\" type=\"#_x0000_t75\"\u003e\u0026nbsp;\u003cv:imagedata src=\"file:///C%3A/Users/khan07/AppData/Local/Temp/msohtmlclip1/01/clip_image001.png\" o:title=\"\"\u003e\u0026nbsp;\u003c/v:imagedata\u003e\u0026nbsp;\u003c/v:shape\u003e\n\u003c/p\u003e\n\u003cp\u003eIn the inflammatory domain, the secretome contained multiple mediators linked to early danger signalling, leukocyte recruitment and endothelial activation, including HMGB1 and IFIT3, as well as chemokines such as CXCL8/IL‑8 and CCL2 together with adhesion molecules like VCAM1, ICAM1 and ROBO1. This profile co‑existed with a distinct subset of anti‑inflammatory and pro‑resolving proteins, notably annexin A1 (ANXA1), TSG6 and matrix‑associated regulators such as POSTN and HTRA1, which are involved in controlled tissue remodelling and dampening of inflammatory cascades. Classic regulators of inflammatory resolution and oxidative‑stress control, including heat‑shock proteins HSP70/HS71A and HSP7C, were also present alongside cytokine and chemokine modulators, indicating a balanced signature capable of limiting excessive inflammation while preserving immune surveillance. This immunomodulatory profile was further complemented by proteins involved in complement regulation (C1R, C1S, CFH), cell\u0026ndash;cell interaction and adhesion (CD44, VCAM1) and tissue protection.\u003c/p\u003e\n\u003cp\u003e3.2. \u003cem\u003eIn vitro\u003c/em\u003e assessment of chondrocyte response\u003c/p\u003e\n\u003cp\u003eA series of experiments were conducted with two primary objectives: to evaluate the preliminary basal effects of the different treatments on chondrocytes (cytotoxicity and wound healing assays) and to validate their role on chondrocyte response to pro-inflammatory stimulation (qPCR and proteomic analyses).\u003c/p\u003e\n\u003cp\u003e3.2.1. \u0026nbsp; Cytotoxicity MTT assay\u003c/p\u003e\n\u003cp\u003eThe evaluation of chondrocyte viability using the MTT assay (\u003cstrong\u003eFig. 2A\u003c/strong\u003e) revealed no significant differences for most treatments (HA, CS, HA+CS) compared to the control group. However, a modest but statistically significant decrease (**p \u0026lt; 0.01) for both HA-g-CS and CM after 24 h of exposure was observed. Nevertheless, as the MTT assay reflects cellular metabolic activity rather than direct cell viability, the apparent reduction in the CM group (~ -40%) may be influenced by the experimental design. In this condition, CM accounted for approximately one third of the total culture volume, which, while compatible with a 24 h culture period, could have resulted in partial nutrient dilution and a consequent decrease in cellular metabolic activity rather than true cytotoxicity.\u003c/p\u003e\n\u003cp\u003e3.2.2. \u0026nbsp; Wound healing assay\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCell migration capacity was evaluated through the wound healing assay (\u003cstrong\u003eFig. 2B\u003c/strong\u003e). After 24 h of treatment, most samples reached a wound closure rate above 90%, with HA-g-CS showing a performance comparable to both commercially available HA, CS and their combination. On the other hand, the CM group exhibited a markedly lower wound closure percentage (43.37% \u0026plusmn; 26.3), together with a higher variability among replicates. These findings are consistent with those obtained in the MTT assay, as a reduced cellular metabolic activity may be associated with impaired migratory and proliferative behavior. Due to the limited number of independent technical replicates, the wound healing data are presented descriptively without statistical comparison between groups.\u003c/p\u003e\n\u003cp\u003e3.2.3. \u0026nbsp; Quantitative real-time PCR (qPCR)\u003c/p\u003e\n\u003cp\u003eTo assess the effects of the different treatments and the potential interaction between CM and SH-HA-g-CS, a three-phase experimental design was employed. Chondrocytes under both basal and pre-established inflammatory conditions were cultured for 4, 7 and 14 days with the corresponding treatments. At days 4 and 7, a preliminary pro-inflammatory panel composed of IL-6 and IL-1\u0026alpha; was evaluated for the main liquid formulations. At 14 days, ACAN and IL-10 were additionally evaluated to further characterize the structural and anti-inflammatory profiles. Gelled formulations (Synvisc-One\u003csup\u003e\u0026reg;\u003c/sup\u003e, SH-HA-g-CS and SH-HA-g-CS + CM) were only assessed at this time point due to their slow-degrading, late-effect design.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt day 4, the control infl. showed a marked upregulation of both IL-6 and IL-1\u0026alpha; compared to the non-inflamed control (\u003cstrong\u003eFig. 3 A,B\u003c/strong\u003e), confirming the establishment of the inflammatory model. Single-component treatments (CS infl., HA infl.) induced a modest modulatory response, with a significant reduction of IL-1\u0026alpha; (CS, **p \u0026lt; 0.01; HA, ***p \u0026lt; 0.001), while non-significant changes were observed for IL-6 relative to the control infl. group. The combination of both products (HA+CS infl.) resulted in a more pronounced response, significantly reducing both IL-6 (**p \u0026lt; 0.01) and IL-1\u0026alpha; \u0026nbsp;(***p \u0026lt; 0.001) compared to control infl., with IL-1\u0026alpha; values even similar to its non-inflamed counterpart (p \u0026gt; 0.05). CM treatments presented the most pronounced modulation, with values similar to control for IL-1\u0026alpha; (p \u0026gt; 0.05) and significantly lower than control infl. for IL-6 (***p \u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003eAfter 7 days (\u003cstrong\u003eFig. 3C,D\u003c/strong\u003e), the overall inflammatory response decreased, particularly for IL-6. CS infl. and HA infl. treatments presented heterogeneous responses, maintaining a significantly elevated expression of both IL-1\u0026alpha; and IL-6 compared to the control group (***p \u0026lt; 0.001). HA+CS infl. also showed a mixed profile, with the highest IL-1\u0026alpha; levels (***p \u0026lt; 0.001 vs control) but lower IL-6 relative expression, although still higher than control (***p \u0026lt; 0.001) and comparable to control infl. CM samples again resulted in the lowest expression levels, with CM infl. showing significantly lower expression levels of both IL-1\u0026alpha; and IL-6 (***p \u0026lt; 0.001) compared to control infl.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the final 14 days stage (\u003cstrong\u003eFig. 3E-H\u003c/strong\u003e), gelled formulations were also analyzed, including ACAN and IL-10 for most samples. A distinct response pattern can be observed between liquid and gelled treatments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the case of IL-1\u0026alpha;, a modest but non-significant reduction compared to control infl. can be observed for HA infl., HA+CS infl. and CM infl. with the latter presenting the lowest expression. In contrast, an overall upregulation was found in all gelled formulations except for Synvisc-One\u003csup\u003e\u0026reg;\u003c/sup\u003e, especially SH-HA-g-CS infl. (***p \u0026lt; 0.001 vs control and control infl.). Notably, the combination of SH-HA-g-CS with CM attenuated this response, resulting in IL-1\u0026alpha; levels of SH-HA-g-CS + CM infl. comparable to the control infl. group (p \u0026gt; 0.05).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA similar trend was observed for IL-6, although all liquid treatments reached a significant reduction compared to control infl. (***p \u0026lt; 0.001). Synvisc-One\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003eshowed expression levels comparable to the control infl., while SH-HA-g-CS + CM infl. significantly reduced the IL-6 expression compared to SH-HA-g-CS infl. (***p \u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003eRegarding IL-10, HA infl. showed the highest expression among liquid treatments (***p \u0026lt; 0.001 vs control infl.). For the gelled formulations, Synvisc-One\u003csup\u003e\u0026reg;\u003c/sup\u003e and SH-HA-g-CS exhibited comparable responses, while SH-HA-g-CS + CM and SH-HA-g-CS + CM infl. displayed markedly higher IL-10 expression (~380-fold and ~250-fold respectively vs control; ***p \u0026lt; 0.001).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFinally, the ACAN profile observed followed an opposite pattern compared to the interleukins assayed. Liquid treatments showed increased expression, especially HA+CS (**p \u0026lt; 0.01 vs control; ***p \u0026lt; 0.001 vs control infl.), whereas gelled treatments exhibited a strong reduction, with SH-HA-g-CS presenting the highest level among them, although still significantly lower than both control and control infl. (**p \u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003e3.2.4. \u0026nbsp; Multiplex proteomic assay\u003c/p\u003e\n\u003cp\u003eTo evaluate the global effect of each treatment over time in an inflammatory osteoarthritic-like\u003cem\u003e\u0026nbsp;in vitro\u003c/em\u003e model, a multiplex proteomic assay was conducted. To allow for a comparative pattern recognition across a panel composed of 41 proteins with heterogeneous absolute concentration ranges, the z-score calculated on log\u003csub\u003e2\u003c/sub\u003e-transformed data was primarily used (\u003cstrong\u003eFig. 4\u003c/strong\u003e). This normalization allows assessment of relative up or down regulation of each protein across conditions, while minimizing bias introduced by proteins with intrinsically high or low basal abundance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA selection of key treatments were evaluated \u0026nbsp;(control, control infl., CS infl., HA infl., HA+CS infl., CM infl., SH-HA-g-CS, SH-HA-g-CS infl. and \u0026nbsp;SH-HA-g-CS + CM infl.) over three key time points: 4, 7 and 14 days.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOn day 4, exposure to the inflammatory stimulus successfully resulted in a marked response across all inflamed conditions compared with the non-inflamed control. Control infl. showed high concentrations of canonical chemokine and cytokine families like CCLs and CXCLs, together with elevated angiogenic mediators including CSF1-3, HGF and VEGFA (x̅ = 156 pg/mL). This early response was accompanied by robust increases in apoptotic markers, particularly MMP1 (6731 pg/mL) and MMP12 (253 pg/mL), while anti-inflammatory protein levels were modest (x̅ = 1.5 pg/mL). All inflamed treatments (infl.) broadly retained this highly inflamed proteomic landscape, with differences emerging mainly in the relative attenuation of selected pro-inflammatory and apoptotic markers. \u003cv:shape id=\"Imagen_x0020_4\" o:spid=\"_x0000_i1025\" type=\"#_x0000_t75\"\u003e\u0026nbsp;\u003cv:imagedata src=\"file:///C%3A/Users/khan07/AppData/Local/Temp/msohtmlclip1/01/clip_image004.png\" o:title=\"\" croptop=\"999f\" cropbottom=\"1106f\" cropleft=\"975f\"\u003e\u0026nbsp;\u003c/v:imagedata\u003e\u0026nbsp;\u003c/v:shape\u003e\n\u003c/p\u003e\n\u003cp\u003eCS infl. and HA infl. cultures presented pro-inflammatory chemokine levels comparable to or slightly below those of the control infl., with z-scores consistently in the upper range of their distributions. IL-6 remained strongly elevated, and MMP1 concentrations were even superior to control infl. (7118 pg/mL and 8190 pg/mL respectively), indicating that they did not substantially diminish the early inflammatory burst at the level of these markers, although some individual chemokines displayed slightly lower levels in the case of HA infl. The HA+CS infl. condition showed a more notable attenuation among the inflamed liquids at this time point: while pro-inflammatory chemokines and IL-6 remained high in absolute terms, their concentrations and z-scores were consistently lower than control infl. or CS infl., and MMP1 was slightly reduced relative to the highest values observed (z-score: 1.30 vs 1.32 for HA infl.). At the same time, angiogenic mediators (CSF1, CSF3, HGF, VEGFA) remained clearly elevated, and anti-inflammatory proteins such as IL-10 and IL-33 were detectable. CM infl. samples preserved a strong inflammatory signature comparable to control infl., with high chemokines, IL-6 (z-score: 1.01 vs 0.98 for HA+CS infl.), MMP1 and TNFSF10, and robust angiogenic responses. Overall, at day 4, HA+CS-inflamed displayed the most evident relative attenuation of the early pro-inflammatory (x̅ z-score: 0.86) and apoptotic (x̅ z-score: 1.42) peaks while maintaining a broad angiogenic profile (x̅ z-score: 0.91), and the highest anti-inflammatory response (x̅ z-score: 1.42) within an otherwise uniformly high inflammatory context. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBy day 7, the global proteomic profile shifted towards a partial resolution of the acute inflammatory response, with a general decrease in pro-inflammatory factors across all inflamed samples compared with day 4. The control infl. retained detectable pro-inflammatory activity, but most chemokines and IL-6 dropped to intermediate or low levels, and z-scores moved toward zero or negative values (x̅ z-score: -0.62). Angiogenic factors such as CSF1, CSF3, HGF and VEGFA also decreased compared with day 4 (x̅ z-score: -0.34), and apoptotic markers including MMP1 and TNFSF10 showed a substantial reduction in concentration and normalized z-scores (x̅ z-score: -0.35). Anti-inflammatory mediators remained low to modest in absolute terms (x̅ z-score: -0.51).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCS infl. cultures presented several pro-inflammatory chemokines (e.g. CXCL9, CCL2, CXCL8) and IL-6 still elevated relative to the day-7 control infl. (380 pg/mL vs 116 pg/mL respectively), and MMP1 was comparatively high for this time point. Z-scores for these markers were close to or slightly above zero, indicating that CS infl. maintained a moderate pro-inflammatory and proteolytic burden, although it also presented the highest anti-inflammatory profile at this time point (x̅ z-score: 0.40). HA infl. and HA+CS infl. treatments displayed lower chemokine and IL-6 (IL-6: 159 pg/mL and 96 pg/mL respectively) concentrations than CS infl. (380 pg/mL), with further reductions in MMP1, suggesting a more advanced decline of the early inflammatory peak. CM infl. showed the most pronounced reduction in pro-inflammatory chemokines and IL-6 (z-score: -1.43) among the inflamed liquids, with many pro-inflammatory z-scores in the negative range (x̅ z-score: -0.71) and MMP1 substantially lower than at day 4 (7711 pg/mL vs 113 pg/mL) and lower than in the other day-7 inflamed groups (z-score: -0.61). Despite this attenuation, a sustained angiogenic activity was detected, although at lower levels than at day 4. Anti-inflammatory proteins remained low but detectable, with no strong divergence between treatments. Thus, on day 7, CM infl. exhibited the lowest residual pro-inflammatory (x̅ z-score: -0.71) and apoptotic (x̅ z-score: -0.46) marker levels among treatments, with low but preserved angiogenic signals (x̅ z-score: -0.59).\u003c/p\u003e\n\u003cp\u003eAt day 14, the majority of measured proteins were further reduced compared with earlier time points, indicating a late, partially resolved state of the \u003cem\u003ein vitro\u003c/em\u003e model, with residual but heterogeneous inflammatory and remodeling activity. For the liquid conditions (CS, HA and CS+HA), all showed markedly lower pro-inflammatory chemokines and IL-6 (~3-30 \u0026nbsp;pg/mL) compared with day 4, and MMP1 concentrations decreased into a modest range (~17-35 \u0026nbsp;pg/mL), although differences among these three treatments remained discernible. In parallel, angiogenic mediators such as CSF1 and VEGFA persisted at low to moderate levels. Anti-inflammatory proteins were generally low across all conditions, with small IL-10 signals in some groups. The HA+CS infl. condition displayed the lowest combination of chemokine, IL-6 and MMP1 levels among the liquid inflamed treatments, with near baseline or mildly negative z-scores for many pro-inflammatory (x̅ z-score: -0.96) markers, while angiogenic signals, though reduced, remained detectable (x̅ z-score: \u0026ndash;1.46), with remarkably low apoptotic mediators (x̅ z-score: \u0026ndash;1.51).\u003c/p\u003e\n\u003cp\u003eThe gel-based conditions, evaluated only at day 14, displayed a distinct proteomic pattern. The SH-HA-g-CS infl. and SH-HA-g-CS + CM infl. treatments both exhibited low absolute levels of most chemokines compared with other treatments early time point values, but maintained relatively high IL-6 (1335 pg/mL and 1229 pg/mL respectively) and CCL2 concentrations (1447 pg/mL and 1075 pg/mL), consistent with a residual inflammatory state in the gel environment. Angiogenic markers showed a more differentiated profile: SH-HA-g-CS infl. presented relatively high CSF2 (1.91 pg/mL) and CSF3 (27.6 pg/mL), whereas SH-HA-g-CS + CM inflamed showed lower values for these specific factors but similar or slightly lower levels of CSF1 (~11 pg/mL) and VEGFA (16-22 pg/mL). Anti-inflammatory mediators were low in both gels, with slightly higher IL-10 (0.008 pg/mL vs 0.024 pg/mL) and anti-inflammatory mean concentrations in SH-HA-g-CS + CM infl. Apoptotic markers remained modest in both gels, with comparable MMP1 levels (25-28 pg/mL) and low MMP12. When evaluated across the full panel using category-wise mean concentrations (SH-HA-g-CS infl. vs SH-HA-g-CS + CM infl: pro-inflammatory\u0026ndash;200.53 pg/mL vs 182.25 pg/mL; anti-inflammatory\u0026ndash;0.0105 pg/mL vs 0.0178 pg/mL; angiogenic\u0026ndash;9.44 pg/mL vs 8.13 pg/mL; apoptotic\u0026ndash;6.46 pg/mL vs 7.39 pg/mL) and weighting the functional classes by panel size (pro-inflammatory \u0026gt; angiogenic \u0026gt; apoptotic \u0026gt; anti-inflammatory), SH-HA-g-CS + CM inflamed displayed a lower mean pro-inflammatory burden and slightly higher anti-inflammatory output but somewhat lower angiogenic and higher apoptotic means than SH-HA-g-CS infl. Under this weighting scheme, the lower global pro-inflammatory mean in SH-HA-g-CS + CM inflamed became the dominant signal at day 14 in gel formulations.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis composite secretome-enriched HA-CS hydrogel was designed to act as a dual-function therapeutic strategy: providing joint lubrication and mechanical support through the HA-CS matrix, while delivering a sustained release of bioactive molecules from the ASC-secretome to modulate inflammation and enhance cartilage regeneration. By combining a biomimetic proteoglycan-like scaffold with a cell-free biological component, this approach aims to move beyond purely symptomatic viscosupplementation and towards a next generation, regenerative, cell free alternative to conventional stem cell therapies.\u003c/p\u003e\n\u003cp\u003eIn our inflammatory chondrocyte model, the transcriptional data revealed that early time points were dominated by strong upregulation of IL-1α and IL-6 in inflamed controls, consistent with the central role of these cytokines in OA pathophysiology (Fernandes et al., 2002). HA and CS in solution produced only modest reductions in inflammatory gene expression, whereas HA+CS more consistently attenuated IL-1α/IL-6 transcripts at 7 and 14 days. CM further amplified this effect, leading to the most pronounced downregulation of inflammatory genes at midterm, in agreement with previous studies demonstrating that ASC secretome reduces TNF induced hypertrophy and catabolic markers in human chondrocytes and favors a shift towards a less inflammatory phenotype (Cadelano et al., 2026; Miller et al., 2014; Molnar et al., 2021a; Niada et al., 2019; Palombella et al., 2025).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRegarding matrix related genes, ACAN expression tended to be preserved or mildly increased in liquid HA, CS and HA+CS treatments compared to the control, consistent with the chondroprotective and extracellular matrix supporting actions described for these glycosaminoglycans (Ao et\u0026nbsp;al., 2022; Mihajlovic et\u0026nbsp;al., 2022). However, in the presence of the hydrogel, especially at later time points, ACAN was downregulated despite the attenuation of some inflammatory mediators, an effect that may reflect mechanical stress and altered cell–substrate interactions in 2D cultures exposed to a viscous, partially crosslinked phase. This interpretation aligns with previous reports indicating that HA based hydrogels can modulate cytoskeletal tension and mechanotransduction in chondrocytes, necessitating 3D or explant models to fully capture their beneficial effects on matrix synthesis (Molnar et al., 2021b; Vassallo et al., 2025). The fact that MMP1 remained detectable, and in some conditions relatively high, despite ACAN downregulation supports the idea of ongoing tissue remodeling signals rather than a purely degenerative profile, given the described role of MMP1 in wound healing and matrix turnover (Hashizume \u0026amp; Mihara, 2010).\u003c/p\u003e\n\u003cp\u003eIn line with these molecular findings, the short‑term viability and migration assays support the overall biocompatibility of the tested formulations. MTT data at 24 h showed that all HA‑ and CS‑based treatments, including HA‑g‑CS, maintained chondrocyte metabolic activity above the viability threshold, with values comparable to or slightly lower than controls, indicating the absence of acute cytotoxic effects under the tested conditions. Similarly, most groups achieved wound closure rates above 90% in the scratch assay, and HA‑g‑CS displayed a migratory performance comparable to commercial HA, CS and their combination, suggesting that the hydrogel backbone does not impair baseline chondrocyte motility. In contrast, CM‑treated cells exhibited markedly lower wound closure percentages and higher variability, consistent with the reduced metabolic activity observed in the MTT assay; this pattern may reflect a shift towards a more quiescent or regulatory phenotype rather than overt toxicity, as reported in other secretome‑based approaches (Niada et\u0026nbsp;al., 2019). Given the limited number of technical replicates, these data were interpreted descriptively, but they provide an important safety and functionality context for the subsequent long‑term molecular readouts.\u003c/p\u003e\n\u003cp\u003eThese results were supported by the multiplex proteomic analysis which showed that the temporal and treatment specific patterns reflect a dynamic interplay between pro inflammatory, anti-inflammatory, angiogenic and apoptotic processes, with clearly differentiated modulatory profiles for CS, HA, CM and SH‑HA‑g‑CS, alone or in combination. At day 4, inflamed controls displayed a typical acute inflammatory signature, characterized by high levels of chemokines (CXCL8 11, CCL2, CCL7, CCL8) and IL 6, robust production of MMP1, MMP12 and TNFSF10, and a broad angiogenic response including CSF1, CSF3, HGF and VEGFA, consistent with the cytokine/chemokine cascades and matrix remodeling surges commonly reported in OA like chondrocyte systems and TNF induced models of cartilage inflammation (Miller et al., 2014; Molnar et al., 2021a). Within this highly inflamed context, HA+CS consistently reduced key chemokines, interleukins and metalloproteinases compared with the other liquid treatments, while maintaining angiogenic signaling, suggesting a synergistic effect of HA and CS in attenuating the early inflammatory and catabolic response without fully suppressing reparative vascular cues, in line with previous reports on HA/CS combinations in OA. (Ma et al., 2025; Marrero-Berrios et al., 2024; Molnar et al., 2021b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt day 7, the system transitioned into a sub-acute phase, with a global decline in pro-inflammatory markers and metalloproteinases across treatments, indicating partial resolution of the acute TNF+γ-IFN stimulus. However, the extent of this resolution differed. CS alone maintained relatively high levels across all four functional categories, including chemokines and MMP1, suggesting a more persistent inflammatory/proteolytic environment, whereas HA and especially HA+CS showed more marked reductions in these mediators. Notably, CM emerged as the liquid treatment with the lowest residual pro inflammatory and apoptotic burden, with many chemokines and IL 6 approaching or falling below non inflamed control levels and MMP1 clearly attenuated, while preserving an intermediate angiogenic profile (CSF1, VEGFA). This pattern is compatible with the multifactorial regulatory capacity described for ASC derived secretomes, which can dampen hypertrophy, catabolism and inflammatory signaling in TNF stimulated chondrocytes while maintaining cartilage protective pathways (Kim et al., 2026). In this mid term window, CM thus appears as the liquid condition most closely aligned with a reparative immunomodulatory profile (Cadelano et al., 2026; Palombella et al., 2025).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLastly by day 14, the system entered a late repair phase, with generally low concentrations of most proteins and partial normalization of z scores, indicative of a global decline in secretory activity. Among the liquid treatments, HA+CS again was clearly the most reparative aligned condition, combining the lowest pro inflammatory and metalloproteinase levels with a still detectable but attenuated angiogenic output. In contrast, HA and CS alone retained greater residual inflammatory and apoptotic activity, suggesting that their combination more effectively sustains a low inflammatory background as cultures mature. Biologically, late reductions in IL 6, CCL2, CXCL8 and MMP1 are consistent with a microenvironment more permissive for cartilage matrix stability, given the involvement of these mediators in catabolic signaling, immune cell recruitment and collagen degradation (Navarro et al., 2024). The persistence of low to moderate CSF1 and VEGFA may reflect ongoing vascular and myeloid supportive signaling at the tissue interface, which could be relevant for \u003cem\u003ein vivo\u003c/em\u003e repair, although sustained angiogenesis in the joint has also been associated with pain and OA progression and must therefore be interpreted cautiously (Jiang et al., 2024; Mapp \u0026amp; Walsh, 2012; Miller et al., 2014).\u003c/p\u003e\n\u003cp\u003eThe gel‑based conditions, evaluated at day 14 because of their slow‑degrading, late‑onset profile, introduced additional complexity regarding cytokine bioavailability and retention (Nguyen et\u0026nbsp;al., 2024). Both inflamed gel groups (with and without CM) showed higher IL‑6 and CCL2 levels than the corresponding liquid formulations, suggesting that the hydrogel microenvironment either sustains a mild inflammatory tone or modifies cytokine diffusion and clearance. However, their functional behavior was not identical. SH‑HA‑g‑CS alone exhibited a more pronounced angiogenic signature, particularly through CSF2 and CSF3, whereas SH‑HA‑g‑CS+CM was characterized by a lower overall pro‑inflammatory output and a slightly higher anti‑inflammatory signal, at the expense of moderately reduced angiogenesis and a modest increase in apoptotic markers. When the different functional classes were weighted by panel size, giving greater relevance to pro‑inflammatory mediators than to angiogenic, apoptotic or anti‑inflammatory factors, the lower global pro‑inflammatory mean of SH‑HA‑g‑CS+CM became determinant, identifying this formulation as the gelled condition most closely aligned with a reparative profile at day 14. This interpretation is consistent with previous observations for SH‑HA‑g‑CS 24/48 (results not shown) and other biomimetic proteoglycan‑like hydrogels, where prolonged, low‑level release of glycosaminoglycans favors a more anabolic and less catabolic chondrocyte phenotype over time. In this context, the addition of CM appears to further bias the system towards a reduced pro‑inflammatory state (Niada et\u0026nbsp;al., 2019), likely through the exogenous supply of anti‑inflammatory and pro‑angiogenic mediators enriched in the secretome, which may secondarily attenuate endogenous cytokine production (Vassallo et\u0026nbsp;al., 2025).\u003c/p\u003e\n\u003cp\u003eMechanistically, the distinct behaviors of liquid and gel treatments suggest that HA, CS and CM influence chondrocyte inflammatory biology through complementary and context-dependent processes (Ma et al., 2025). Free HA and CS in solution appear to modulate chemokine, IL-6 and MMP1 outputs, with the HA+CS combination consistently associated with the lowest inflammatory/apoptotic load at both early and late time points. This may involve changes in receptor engagement, pericellular matrix properties or downstream signaling pathways that temper NF-κB and related inflammatory cascades (M.-H. Kim et al., 2022; Navarro et al., 2024; Nguyen et al., 2024). The CM, in contrast, provides a broader mixture of trophic and regulatory mediators that accelerate the decay of the inflammatory and catabolic peak and promote a return towards a lower-activity state at mid-term, consistent with the recognized immunomodulatory and chondroprotective potential of ASC‑secretome in preclinical OA models and \u003cem\u003eex vivo\u003c/em\u003e cartilage systems (Palombella et al., 2025). In the gel context, proteomic results indicate that the CS-grafted proteoglycan design might be acting in a delayed reparative way. Among other possible reasons, this phenomenon might be driven by the lower, yet sustained, bioavailability of CS and HA over time compared to the liquid formulations. The physical state could also be interfering with the local concentration and retention of cytokines and growth factors, altering both the kinetics and spatial distribution of inflammatory and angiogenic cues (Nguyen et al., 2024; B.-G. Zhang et al., 2025).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDespite these promising findings, this \u003cem\u003ein vitro\u003c/em\u003e strategy has inherent limitations. The 2D culture system cannot fully reproduce the molecular and biomechanical dynamics of an OA joint and likely overestimates the retention and exposure time of “free” liquid treatments such as HA, CS, HA+CS or CM compared with the rapid clearance and limited cartilage permeability. In addition, as suggested by the qPCR data, the presence of a viscous gel phase directly on a 2D monolayer may generate mechanical stress on chondrocytes, contributing to ACAN downregulation and persistent MMP1 expression. Future studies in 3D culture systems, cartilage explants and large animal OA models, including detailed pharmacokinetic analyses and dose response evaluations, will be required to validate these findings and to determine whether the reparative aligned profiles observed here translate into durable structural and symptomatic benefits.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003eASCs:\u0026nbsp;\u003c/strong\u003eAdipose Stem Cells\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBM-MSCs:\u0026nbsp;\u003c/strong\u003eBone Marrow Mesenchymal Stem Cells\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCM:\u0026nbsp;\u003c/strong\u003eConditioned Medium\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCS:\u0026nbsp;\u003c/strong\u003eChondroitin Sulfate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFASP:\u0026nbsp;\u003c/strong\u003eFilter-Aided Sample Preparation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFDR:\u0026nbsp;\u003c/strong\u003eFalse Discovery Rate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHA:\u0026nbsp;\u003c/strong\u003eHyaluronic Acid\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNTA:\u003c/strong\u003e Nanoparticle Tracking Analysis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMSCs:\u0026nbsp;\u003c/strong\u003eMesenchymal Stem Cells\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOA:\u0026nbsp;\u003c/strong\u003eOsteoarthritis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePEA:\u0026nbsp;\u003c/strong\u003eProximity Extension Assay\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQRILC:\u003c/strong\u003e Quantile Regression Imputation of Left-censored data\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqPCR:\u0026nbsp;\u003c/strong\u003eQuantitative PCR\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSD:\u0026nbsp;\u003c/strong\u003eStandard Deviation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSH-HA-g-CS:\u0026nbsp;\u003c/strong\u003eGellable Hyaluronic Acid–Chondroitin Sulfate Hydrogel\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received funding from The Generalitat Valenciana CIGE/2021/174. We thank also the support by Fundación Leonesa Pro-neurociencias and Doctor José García Cosamalón.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAlejandro Casado-Santos:\u003c/strong\u003e Writing – review \u0026amp; editing, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation.\u0026nbsp;\u003cstrong\u003eGuillermo Vilariño-Feltrer\u003c/strong\u003e: Writing – review \u0026amp; editing, Supervision, Methodology, Investigation, Formal analysis, Data curation. Mª. \u003cstrong\u003eElsa González-Cubero\u003c/strong\u003e: Writing – review \u0026amp; editing, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. \u003cstrong\u003eYaiza González Rodríguez:\u003c/strong\u003e Validation, Supervision, Formal analysis, Data curation. \u003cstrong\u003eMª Luisa González-Fernández:\u003c/strong\u003e Supervision, Methodology, Investigation, Formal analysis, Data curation. \u003cstrong\u003eVega Villar-Suárez:\u0026nbsp;\u003c/strong\u003eWriting – review \u0026amp; editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of generative AI in scientific writing\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the preparation of this work the authors used PERPLEXITY to improve readability and language of this manuscript. After using this tool, the authors reviewed and edited the content as needed and took full responsibility for the content of the publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish declaration:\u0026nbsp;\u003c/strong\u003enot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate declaration:\u003c/strong\u003e not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration:\u003c/strong\u003e not applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAo, Y., Tang, W., Tan, H., Li, J., Wang, F., \u0026amp; Yang, L. (2022). Hydrogel composed of type II collagen, chondroitin sulfate and hyaluronic acid for cartilage tissue engineering. \u003cem\u003eBio-medical materials and engineering\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(6), 515-523. https://doi.org/10.3233/BME-221404\u003c/li\u003e\n \u003cli\u003eBaglio, S. R., Pegtel, D. M., \u0026amp; Baldini, N. (2012). Mesenchymal stem cell secreted vesicles provide novel opportunities in (stem) cell-free therapy. \u003cem\u003eFrontiers in physiology\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e, 359. https://doi.org/10.3389/fphys.2012.00359\u003c/li\u003e\n \u003cli\u003eBannuru, R. R., Natov, N. S., Dasi, U. R., Schmid, C. H., \u0026amp; McAlindon, T. E. (2011). Therapeutic trajectory following intra-articular hyaluronic acid injection in knee osteoarthritis\u0026ndash;meta-analysis. \u003cem\u003eOsteoarthritis and cartilage\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(6), 611-619. https://doi.org/10.1016/J.JOCA.2010.09.014\u003c/li\u003e\n \u003cli\u003eCadelano, F., Giannasi, C., Rossi, N., Della Morte, E., Niada, S., Tal\u0026ograve;, G., Mistretta, D. A., Moretti, M., Peretti, G. M., Mangiavini, L., \u0026amp; Brini, A. T. (2026). Evaluation of MSC-Secretome Effects in an Ex Vivo Compartmentalized Osteochondral Interface Model. \u003cem\u003eStem Cells International\u003c/em\u003e, \u003cem\u003e2026\u003c/em\u003e(1), 3275855. https://doi.org/10.1155/sci/3275855\u003c/li\u003e\n \u003cli\u003eChavda, S., Rabbani, S. A., Wadhwa, T., \u0026amp; Khaimah, R. A. (2022). Role and Effectiveness of Intra-articular Injection of Hyaluronic Acid in the Treatment of Knee Osteoarthritis: A Systematic Review. \u003cem\u003eCureus\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(4), e24503. https://doi.org/10.7759/CUREUS.24503\u003c/li\u003e\n \u003cli\u003eCui, C., Han, S., Shen, X., He, H., Chen, Y., Zhao, J., Wei, Y., Wang, Y., Zhu, Q., Li, D., \u0026amp; Yin, H. (2020). ISLR regulates skeletal muscle atrophy via IGF1-PI3K/Akt-Foxo signaling pathway. \u003cem\u003eCell and Tissue Research\u003c/em\u003e, \u003cem\u003e381\u003c/em\u003e(3), 479-492. https://doi.org/10.1007/s00441-020-03251-4\u003c/li\u003e\n \u003cli\u003eD\u0026rsquo;arrigo, D., Roffi, A., Cucchiarini, M., Moretti, M., Candrian, C., \u0026amp; Filardo, G. (2019). Secretome and Extracellular Vesicles as New Biological Therapies for Knee Osteoarthritis: A Systematic Review. \u003cem\u003eJournal of clinical medicine\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(11). https://doi.org/10.3390/JCM8111867\u003c/li\u003e\n \u003cli\u003eFernandes, J. C., Martel-Pelletier, J., \u0026amp; Pelletier, J.-P. (2002). The role of cytokines in osteoarthritis pathophysiology. \u003cem\u003eBiorheology\u003c/em\u003e, \u003cem\u003e39\u003c/em\u003e(1-2), 237-246.\u003c/li\u003e\n \u003cli\u003eFrom the American Association of Neurological Surgeons (AANS), American Society of Neuroradiology (ASNR), Cardiovascular and Interventional Radiology Society of Europe (CIRSE), Canadian Interventional Radiology Association (CIRA), Congress of Neurological Surgeons (CNS), European Society of Minimally Invasive Neurological Therapy (ESMINT), European Society of Neuroradiology (ESNR), European Stroke Organization (ESO), Society for Cardiovascular Angiography and Interventions (SCAI), Society of Interventional Radiology (SIR), Society of NeuroInterventional Surgery (SNIS), and World Stroke Organization (WSO), Sacks, D., Baxter, B., Campbell, B. C. V., Carpenter, J. S., Cognard, C., Dippel, D., Eesa, M., Fischer, U., Hausegger, K., Hirsch, J. A., Shazam Hussain, M., Jansen, O., Jayaraman, M. V., Khalessi, A. A., Kluck, B. W., Lavine, S., Meyers, P. M., Ramee, S., \u0026hellip; Vorwerk, D. (2018). Multisociety Consensus Quality Improvement Revised Consensus Statement for Endovascular Therapy of Acute Ischemic Stroke. \u003cem\u003eInternational Journal of Stroke: Official Journal of the International Stroke Society\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(6), 612-632. https://doi.org/10.1177/1747493018778713\u003c/li\u003e\n \u003cli\u003eFunck-Brentano, T., \u0026amp; Cohen-Solal, M. (2015). Subchondral bone and osteoarthritis. \u003cem\u003eCurrent Opinion in Rheumatology\u003c/em\u003e, \u003cem\u003e27\u003c/em\u003e(4), 420-426. https://doi.org/10.1097/BOR.0000000000000181\u003c/li\u003e\n \u003cli\u003eGonz\u0026aacute;lez-Cubero, E., Gonz\u0026aacute;lez-Fern\u0026aacute;ndez, M. L., Esteban-Blanco, M., P\u0026eacute;rez-Castrillo, S., P\u0026eacute;rez-Fern\u0026aacute;ndez, E., Navasa, N., Aransay, A. M., Anguita, J., \u0026amp; Villar-Su\u0026aacute;rez, V. (2024). The Therapeutic Potential of Adipose-Derived Mesenchymal Stem Cell Secretome in Osteoarthritis: A Comprehensive Study. \u003cem\u003eInternational Journal of Molecular Sciences 2024, Vol. 25, Page 11287\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(20), 11287. https://doi.org/10.3390/IJMS252011287\u003c/li\u003e\n \u003cli\u003eHashizume, M., \u0026amp; Mihara, M. (2010). High molecular weight hyaluronic acid inhibits IL-6-induced MMP production from human chondrocytes by up-regulating the ERK inhibitor, MKP-1. \u003cem\u003eBiochemical and Biophysical Research Communications\u003c/em\u003e, \u003cem\u003e403\u003c/em\u003e(2), 184-189. https://doi.org/10.1016/j.bbrc.2010.10.135\u003c/li\u003e\n \u003cli\u003eIngavle, G. C., Dormer, N. H., Gehrke, S. H., \u0026amp; Detamore, M. S. (2012). Using chondroitin sulfate to improve the viability and biosynthesis of chondrocytes encapsulated in interpenetrating network (IPN) hydrogels of agarose and poly(ethylene glycol) diacrylate. \u003cem\u003eJournal of Materials Science: Materials in Medicine\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(1), 157-170. https://doi.org/10.1007/s10856-011-4499-9\u003c/li\u003e\n \u003cli\u003eJiang, Z., Cai, X., Yao, X., Zhang, S., Lan, W., Jin, Z., Tang, F., Ma, W., Yao, X., Chen, C., \u0026amp; Lan, T. (2024). The causal effect of cytokine cycling levels on osteoarthritis: A bidirectional Mendelian randomized study. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e. https://doi.org/10.3389/fimmu.2023.1334361\u003c/li\u003e\n \u003cli\u003eKawasaki, Y., Xu, Z. Z., Wang, X., Park, J. Y., Zhuang, Z. Y., Tan, P. H., Gao, Y. J., Roy, K., Corfas, G., Lo, E. H., \u0026amp; Ji, R. R. (2008). Distinct roles of matrix metalloproteases in the early- and late-phase development of neuropathic pain. \u003cem\u003eNature Medicine\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(3), 331-336. https://doi.org/10.1038/nm1723\u003c/li\u003e\n \u003cli\u003eKim, M.-H., Nguyen, D.-T., \u0026amp; Kim, D.-D. (2022). Recent studies on modulating hyaluronic acid-based hydrogels for controlled drug delivery. \u003cem\u003eJournal of Pharmaceutical Investigation\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(4), 397-413. https://doi.org/10.1007/s40005-022-00568-w\u003c/li\u003e\n \u003cli\u003eKim, W. S., Woo, C. H., Lee, K. S., Choi, Y. C., Yun, Y. E., Choi, J. S., \u0026amp; Cho, Y. W. (2026). Extracellular vesicles from human adipose-derived stem cells relieve pain and inflammation in a rat model of knee osteoarthritis. \u003cem\u003eStem Cell Research \u0026amp; Therapy\u003c/em\u003e. https://doi.org/10.1186/s13287-026-04932-7\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMa, Y., Yang, X., Jiang, M., Ye, W., Qin, H., \u0026amp; Tan, S. (2025). Alone or in combination, hyaluronic acid and chondroitin sulfate alleviate ECM degradation in osteoarthritis by inhibiting the NF-\u0026kappa;B pathway. \u003cem\u003eJournal of Orthopaedic Surgery and Research\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(1), 11. https://doi.org/10.1186/s13018-024-05411-6\u003c/li\u003e\n \u003cli\u003eMapp, P. I., \u0026amp; Walsh, D. A. (2012). Mechanisms and targets of angiogenesis and nerve growth in osteoarthritis. \u003cem\u003eNature Reviews Rheumatology\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(7), 390-398. https://doi.org/10.1038/nrrheum.2012.80\u003c/li\u003e\n \u003cli\u003eMarrero-Berrios, I., Salter, S. E., Hirday, R., Rabolli, C. P., Tan, A., Hung, C. T., Schloss, R. S., \u0026amp; Yarmush, M. L. (2024). In vitro inflammatory multi-cellular model of osteoarthritis. \u003cem\u003eOsteoarthritis and Cartilage Open\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(1), 100432. https://doi.org/10.1016/j.ocarto.2023.100432\u003c/li\u003e\n \u003cli\u003eMihajlovic, M., Rikkers, M., Mihajlovic, M., Viola, M., Schuiringa, G., Ilochonwu, B. C., Masereeuw, R., Vonk, L., Malda, J., Ito, K., \u0026amp; Vermonden, T. (2022). Viscoelastic Chondroitin Sulfate and Hyaluronic Acid Double-Network Hydrogels with Reversible Cross-Links. \u003cem\u003eBiomacromolecules\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(3), 1350-1365. https://doi.org/10.1021/ACS.BIOMAC.1C01583\u003c/li\u003e\n \u003cli\u003eMiller, R. E., Miller, R. J., \u0026amp; Malfait, A.-M. (2014). Osteoarthritis joint pain: The cytokine connection. \u003cem\u003eCytokine\u003c/em\u003e, \u003cem\u003e70\u003c/em\u003e(2), 185-193. https://doi.org/10.1016/j.cyto.2014.06.019\u003c/li\u003e\n \u003cli\u003eMolnar, V., Mati\u0026scaron;ić, V., Kodvanj, I., Bjelica, R., Jeleč, Ž., Hudetz, D., Rod, E., Čukelj, F., Vrdoljak, T., Vidović, D., Stare\u0026scaron;inić, M., Sabalić, S., Dobričić, B., Petrović, T., Antičević, D., Borić, I., Ko\u0026scaron;ir, R., Zmrzljak, U. P., \u0026amp; Primorac, D. (2021a). Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(17), 9208. https://doi.org/10.3390/ijms22179208\u003c/li\u003e\n \u003cli\u003eMolnar, V., Mati\u0026scaron;ić, V., Kodvanj, I., Bjelica, R., Jeleč, Ž., Hudetz, D., Rod, E., Čukelj, F., Vrdoljak, T., Vidović, D., Stare\u0026scaron;inić, M., Sabalić, S., Dobričić, B., Petrović, T., Antičević, D., Borić, I., Ko\u0026scaron;ir, R., Zmrzljak, U. P., \u0026amp; Primorac, D. (2021b). Cytokines and Chemokines Involved in Osteoarthritis Pathogenesis. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(17), 9208. https://doi.org/10.3390/ijms22179208\u003c/li\u003e\n \u003cli\u003eMosas, K. K. A., Chandrasekar, A. R., Dasan, A., Pakseresht, A., \u0026amp; Galusek, D. (2022). Recent Advancements in Materials and Coatings for Biomedical Implants. \u003cem\u003eGels\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(5), 323. https://doi.org/10.3390/GELS8050323\u003c/li\u003e\n \u003cli\u003eMurphy, J. M., Raman, S., Mancuso, P., Glynn, A., \u0026amp; Barry, F. (2019). Mesenchymal stem cell therapy for osteoarthritis: The critical role of the cell secretome. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(January), 1-9. https://doi.org/10.3389/fbioe.2019.00009\u003c/li\u003e\n \u003cli\u003eNavarro, G., G\u0026oacute;mez-Autet, M., Morales, P., Rebassa, J. B., Llinas Del Torrent, C., Jagerovic, N., Pardo, L., \u0026amp; Franco, R. (2024). Homodimerization of CB2 cannabinoid receptor triggered by a bivalent ligand enhances cellular signaling. \u003cem\u003ePharmacological Research\u003c/em\u003e, \u003cem\u003e208\u003c/em\u003e, 107363. https://doi.org/10.1016/j.phrs.2024.107363\u003c/li\u003e\n \u003cli\u003eNguyen, M., Battistoni, C. M., Babiak, P. M., Liu, J. C., \u0026amp; Panitch, A. (2024). Chondroitin Sulfate/Hyaluronic Acid-Blended Hydrogels Suppress Chondrocyte Inflammation under Pro-Inflammatory Conditions. \u003cem\u003eACS biomaterials science \u0026amp; engineering\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(5), 3242-3254. https://doi.org/10.1021/ACSBIOMATERIALS.4C00200\u003c/li\u003e\n \u003cli\u003eNiada, S., Giannasi, C., Gomarasca, M., Stanco, D., Casati, S., \u0026amp; Brini, A. T. (2019). Adipose-derived stromal cell secretome reduces TNF\u0026alpha;-induced hypertrophy and catabolic markers in primary human articular chondrocytes. \u003cem\u003eStem Cell Research\u003c/em\u003e, \u003cem\u003e38\u003c/em\u003e, 101463. https://doi.org/10.1016/j.scr.2019.101463\u003c/li\u003e\n \u003cli\u003ePalombella, S., Lopa, S., Recordati, C., Canesi, S., Moretti, M., \u0026amp; Lovati, A. B. (2025). Impact of adipose-derived mesenchymal stem cells and their secretome on osteoarthritis in a rat model. \u003cem\u003eBMC Musculoskeletal Disorders\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(1), 392. https://doi.org/10.1186/s12891-025-08642-8\u003c/li\u003e\n \u003cli\u003eTaylor, K. R., \u0026amp; Gallo, R. L. (2006). Glycosaminoglycans and their proteoglycans: Host-associated molecular patterns for initiation and modulation of inflammation. \u003cem\u003eFASEB journal : official publication of the Federation of American Societies for Experimental Biology\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(1), 9-22. https://doi.org/10.1096/fj.05-4682rev\u003c/li\u003e\n \u003cli\u003eTetlow, L. C., Adlam, D. J., \u0026amp; Woolley, D. E. (2001). Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: Associations with degenerative changes. \u003cem\u003eArthritis \u0026amp; Rheumatism\u003c/em\u003e, \u003cem\u003e44\u003c/em\u003e(3), 585-594. https://doi.org/10.1002/1529-0131(200103)44:3%253C585::AID-ANR107%253E3.0.CO;2-C\u003c/li\u003e\n \u003cli\u003eTyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M. Y., Geiger, T., Mann, M., \u0026amp; Cox, J. (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data.\u0026nbsp;\u003cem\u003eNature Methods\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(9), 731-740. https://doi.org/10.1038/NMETH.3901,\u003c/li\u003e\n \u003cli\u003eVassallo, V., Di Meo, C., D\u0026rsquo;Agostino, A., La Gatta, A., Cimini, D., Toro, G., Iolascon, G., Mastrogiacomo, M., \u0026amp; Schiraldi, C. (2025). Biomechanical and biological features of hyaluronic acid in combination with chondroitin and platelet rich plasma for regenerative medicine applications. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 1607469. https://doi.org/10.3389/fbioe.2025.1607469\u003c/li\u003e\n \u003cli\u003eWiśniewski, J. R., Zougman, A., Nagaraj, N., \u0026amp; Mann, M. (2009). Universal sample preparation method for proteome analysis. \u003cem\u003eNature Methods\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(5), 359-362. https://doi.org/10.1038/NMETH.1322,\u003c/li\u003e\n \u003cli\u003eYu, S. P., \u0026amp; Hunter, D. J. (2015). Managing osteoarthritis. \u003cem\u003eAustralian Prescriber\u003c/em\u003e, \u003cem\u003e38\u003c/em\u003e(4), 115-119. https://doi.org/10.18773/austprescr.2015.039\u003c/li\u003e\n \u003cli\u003eZhang, B.-G., Liu, Q., Ma, T., Liu, J.-J., Zhang, Y., Liu, F., Wen, X.-M., Wang, D.-X., Jiang, W., \u0026amp; An, W.-B. (2025). Mechanism and application of injectable hydrogel as carrier system in the treatment of osteoarthritis. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e. https://doi.org/10.3389/fbioe.2025.1636518\u003c/li\u003e\n \u003cli\u003eZhang, Z., Jin, W., Beckett, J., Otto, T., \u0026amp; Moed, B. (2011). A proteomic approach for identification and localization of the pericellular components of chondrocytes. \u003cem\u003eHistochemistry and Cell Biology\u003c/em\u003e, \u003cem\u003e136\u003c/em\u003e(2), 153-162. https://doi.org/10.1007/s00418-011-0834-y\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Osteoarthritis, hyaluronic acid, chondroitin sulphate, secretome, mesenchymal stromal cells","lastPublishedDoi":"10.21203/rs.3.rs-9169856/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9169856/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Osteoarthritis (OA) is a chronic degenerative joint disease characterized by progressive cartilage loss and synovial inflammation, for which current therapies are mainly symptomatic and fail to durably modify disease progression. Hyaluronic acid (HA) and chondroitin sulfate (CS) are widely used in viscosupplementation, but the rapid clearance of HA and limited bioactivity of simple mixtures restrict their long‑term benefit. In parallel, adipose‑derived mesenchymal stromal cell (ASC) secretome has emerged as a promising cell‑free therapeutic due to its pleiotropic anti‑inflammatory and regenerative actions. Here, we evaluated a novel strategy that combines a biomimetic HA‑g‑CS hydrogel with ASC‑derived secretome as an integrated, secretome‑enriched viscosupplement for OA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e ASC secretome was characterised by nanoparticle tracking analysis and LC‑MS/MS proteomics, revealing a stable profile enriched in matrix‑remodelling enzymes, angiogenic and pro‑survival factors, and proteins linked to osteochondral repair. The SH‑HA‑g‑CS hydrogel was synthesised via sequential CS grafting and thiolation, and subsequently loaded with secretome at a 1:1 ratio for \u003cem\u003ein vitro\u003c/em\u003e testing on human chondrocytes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In a TNF+γ-IFN‑driven inflammatory model, samples treated with liquid HA+CS and CM preserved metabolic activity, supported migration, and modulated inflammatory and matrix‑related genes, with CM inducing the strongest downregulation of IL‑1α/IL‑6. Multiplex proteomics showed that HA+CS and CM reduced pro‑inflammatory and metalloproteinase outputs while maintaining controlled angiogenic signalling, whereas SH‑HA‑g‑CS, particularly when combined with CM, promoted a delayed yet sustained shift towards a lower‑inflammatory, reparative‑aligned secretory profile.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eOverall, these findings support secretome‑enriched HA‑g‑CS hydrogels as a promising cell‑free, disease‑modifying viscosupplement approach that integrates mechanical support with finely tuned immunomodulatory and regenerative cues in OA.\u003c/p\u003e","manuscriptTitle":"Stem Cell Secretome-Enriched Hydrogels: A Novel Therapeutic Strategy for Osteoarthritis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-01 09:27:34","doi":"10.21203/rs.3.rs-9169856/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"da5eed38-054c-4cb5-900d-deb2d395ee98","owner":[],"postedDate":"April 1st, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T13:41:05+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-01 09:27:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9169856","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9169856","identity":"rs-9169856","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.