Serum miR-181а and miR-25 levels in patients with breast cancer or a benign breast disease

Serum miR-181а and miR-25 levels in patients with breast cancer or a benign breast disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Serum miR-181а and miR-25 levels in patients with breast cancer or a benign breast disease Maria Perepechaeva, Anastasia Studenikina, Andrew Proskura, Alevtina Grishanova, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2299018/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Breast tumours comprise a wide range of disorders requiring different and often personalised treatment plans. The microRNA levels indicating the regulation of gene expression involved in oncogenesis can serve as diagnostic and prognostic biomarkers of benign and malignant breast diseases. Circulating miR-181а and miR-25 were quantified here using droplet digital PCR (ddPCR) in 77 serum samples from patients with invasive breast carcinoma (IBC) (50 samples) or benign breast diseases (16 samples) and ‘potentially healthy’ controls (11 samples). МiR-181а expression was higher in patients with fibroadenoma or fibrocystic disease/adenosis (low risk of malignant transformation) as compared to potentially healthy controls. In IBC patients, miR-181a expression was higher in luminal B-like (HER2 − ), HER2 + (non-luminal) and triple-negative breast cancer (TNBC) groups, while miR-25 expression was higher in luminal B-like (HER2 − ) and TNBC groups compared to potentially healthy controls. Compared to the luminal A-like group, miR-181а expression was higher in luminal B-like (HER2 − ) and HER2 + (non-luminal) groups, whereas miR-25 expression was elevated in luminal B-like (HER2 − ) and TNBC groups. МiR-25 expression was higher in the luminal B-like (HER2 − ) group compared to the TNBC group. Thus, miR-181a and miR-25 may be markers of precancerous changes in women with benign breast diseases. In IBC patients, levels of miR-181a and miR-25 can reflect either favourable or adverse processes in a tumour owing to their multiple effects. They can be potentially used as biomarkers in a large diagnostic panel. Biological sciences/Cancer/Breast cancer Biological sciences/Cancer/Tumour biomarkers miR-181а miR-25 microRNA biomarkers breast cancer benign breast disease Figures Figure 1 Figure 2 Introduction Breast cancer (BC) is the most common cancer among women and the leading cause of cancer death 1 , 2 . Invasive breast carcinoma (IBC) includes a wide range of malignant epithelial tumour subtypes that vary in morphology, clinical presentation and prognosis and require different, often personalised treatment plans 1 , 2 . IBC aetiology and pathogenesis may be related to dysregulation of microRNAs (miRNA, miR) 3 , which repress their target genes at the post-transcriptional level. Many of these genes are involved in cell proliferation, differentiation, migration, and apoptosis 3 , 4 . It is expected that miRNA expression profiling will allow them to be employed as biomarkers for diagnosis, theranostics and prognosis 5 . MiR-181а and miR-25 are known as either oncogenic miRNAs or tumour suppressors in different types of cancer 5 – 7 , in different types of BC 3 , 4 and even within the same BC subtype 8 – 10 . In breast tissues, miR-181а as a tumour suppressor targets genes encoding matrix metalloproteinase MMP-14 11 , pleckstrin homology-like domain, family A, member 1 (PHLDA1), BC resistance protein BCRP 4 , Bcl-2 12 and autophagy-associated proteins 13 . As a proto-oncogene, miR-181а is associated with aberrant activation of the TGF-β signalling pathway 4 and targets mRNA of genes ataxia telangiectasia mutated ( ATM ), BAX 4 and NDRG2 3 . MiR-181 enhances metastatic potential of BC cells, thereby promoting epithelial–mesenchymal transition and formation of an invasive phenotype 14 , whereas high levels of miR-181a correlate with poor survival of patients with BC 15 . MiR-181а is one of the most common exosomal human plasma miRNAs 16 , and changes in its serum level may serve as a biomarker 4 . Nonetheless, the data available on serum miR-181a levels depending on disease status are inconsistent 17 , 18 . MiR-25 is mostly known as an oncogenic miRNA 19 . MiR-25 expression is elevated in BC samples compared to non-malignant breast tissues in aggressive BC types such as triple-negative BC (TNBC) 20 and HER2 + BC 5 . MiR-25 promotes tumour proliferation by targeting tumour suppressor BTG2 ’s mRNA in TNBC 21 and participates in autophagy processes by interacting with autophagy regulator ULK1 ’s mRNA 22 and in TNF-dependent cell death by interacting with NOX4 mRNA 23 . Nevertheless, there is also evidence of improved survival in BC with elevated miR-25 levels 24 as well as tumour growth inhibition via the involvement of miR-25 in the regulation of the Wnt signalling pathway 25 . Overexpression of miR-25 has been shown in the serum of Chinese BC patients 26 , and it can be reasonably assumed that miR-25-3p is a biomarker of BC. Unfortunately, little attention has been paid to the treatment of benign breast diseases 27 , although these conditions may increase the risk of BC 28 . For example, a complex breast cyst and complex solid and cystic breast mass can be malignant in 23–31% of cases 29 . Adenosis is often associated with fibrocystic alterations, whereas sclerosing and apocrine adenosis correlate with a 1.5–2.0-fold increase in the risk of BC 2 . Fibroadenoma is generally associated with a minimal increase in the risk of malignancy 2 ; however, the risk is high in women with a family history of BC and/or BRCA-1/2 mutations 30 . An analysis of circulating miR-181a miR-25 levels in different types of breast disease can provide a clearer understanding of their potential as biomarkers. With this aim, we investigated concentrations of miR-181a and miR-25 in the serum of patients with IBC of different molecular subtypes, with or without lymphogenous metastasis, as well as in patients with a benign breast disease and in potentially healthy donors. Materials And Methods Patients and sample collection The study population consisted of 77 serum samples collected from patients at Municipal Hospital No. 1, Novosibirsk (Russia). Eleven people (Novosibirsk Municipal Blood Transfusion Station) were classified as potentially healthy, 50 patients got a diagnosis of IBC (among them, 48 patients with stage GII and two patients with stage GI) and 16 patients had a benign breast disease. Metastases in regional lymph nodes were present in 20 IBC patients (average age 52 [range 23–72] years) and absent in 30 patients (average age 58 [range 35–79] years). The whole study was conducted in accordance with the World Medical Association Declaration of Helsinki 1964 as amended in 2013 at the 64th WMAJ General Assembly (Fortaleza, Brazil, October 2013). All patients gave their voluntary informed consent to participate in the study. The study protocol was approved by the Ethics Committee at the Institute of Molecular Biology and Biophysics, a subdivision of the Federal Research Centre of Fundamental and Translational Medicine (Protocol No. 2016-3). The patients underwent surgical treatment and finally got a diagnosis on the basis of pathomorphological findings. Neoadjuvant therapy was not performed. In recent years, new molecular markers for differences in pathogenesis, treatment response and prognosis were added to the IBC classification 2 , 31 . Nevertheless, due to the lack of time and resources, molecular classification of BC in the vast majority of healthcare systems is still largely based on immunohistochemical evaluation of such biomarkers as oestrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (HER2) as well as on assays of the Ki-67 proliferation marker 2 , 31 . We chose this classification and identified molecular subtypes of each tumour among the samples under study (Table 1 ) 32 , 33 . Table 1 IBC Subtyping Criteria 32 , 33 Subtype ER PR HER2 Ki-67 (%) Luminal A-like + +/- - < 20% Luminal B-like HER2 − + +/- - ≥ 20% Luminal B-like HER2 + + +/- + Any HER2 + (non-luminal) - - + Any TNBC - - - Any Luminal A-like BC was diagnosed in 15 patients with IBC [average age 58 (35–79) years], luminal B-like HER2 negative (luminal B-like [HER2 − ]) in 12 patients [average age 53 (23–69) years], luminal B-like HER2 + (luminal B-like [HER2 + ]) in 2 patients [average age 57 (47–67) years], HER2 + (non-luminal) type in 5 patients, [average age 55 (40–69) years], and TNBC was diagnosed in 14 patients [average age 56 (35–72) years]. Patients with a benign breast disease were subdivided into two groups 34 . The first group of a low risk of malignant transformation (a non-proliferative type of fibrocystic disease, fibroadenosis or fibroadenoma) included 14 patients [average age 50 (18–83) years]. The second group included two patients: a 40-year-old woman with a proliferative type of fibroadenosis and a 41-year-old woman with sclerosing adenosis. Rna Isolation And Cdna Synthesis MiRNA was isolated using the NucleoSpin miRNA Plasma Kit (Macherey-Nagel, Germany) as per the manufacturer’s protocol. Reverse transcription was performed with miRNA-specific stem-loop adapters and reverse transcriptase M-MuLV–RH (Biolabmix, Russia), as per the manufacturer’s protocol. The mixture was incubated at 18 °C for 30 min, then at 42 °C for 30 min and finally at 85 °C for 5 min. Sequences of the stem-loop adapters were as follows: miR-181а: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCACCG-3′; miR-25: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGACCG-3′; U6: 5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCCATGC-3′. Droplet Digital Pcr (Ddpcr) MiRNA expression was evaluated by means of ddPCR probes and a QX200 AutoDG Droplet Digital PCR System (Bio-Rad Laboratories, USA). To generate droplets in a final volume of 20 µl, 2x supermix for ddPCR (Bio-Rad), 7 µl cDNA and a primer mix consisting of 5 µM probe and 20 µM forward and reverse primers were used. The primer sequences were as follows: miR-181а: forward 5′-GCCGCAACATTCAACGCTGT-3′, probe 5′-(FAM)-TTCGCACTGGATACGACACTCACCG-(BHQ1)-3′; miR-25: forward 5′-GCCGCCATTGCACTTGTCT-3′, probe 5′-(FAM)-TTCGCACTGGATACGACTCAGACCG-(BHQ1)-3′; U6: forward 5′- GCCGCATACAGAGAAGATTA-3′, probe 5′-(FAM)-TTCGCACTGGATACGACGGCCATGC-(BHQ1)-3′; and common reverse primer 5′-AGTGCAGGGTCCGAGGTA-3′. Droplets were obtained using a QX200 automatic droplet generator (Bio-Rad). The reaction was conducted under the following conditions: heating at 95°C for 10 min, then 39 cycles of denaturation at 95°C for 30 s and annealing/extension at 55°C for 10 min, then 98 °С for 10 min. After that, a QX200 droplet reader was used, and the results were analysed in the Quantasoft™ software (Bio-Rad). A no-matrix control was included in each assay. Small nuclear RNA U6 served as an internal standard for the miRNAs being quantified. Statistical analysis This procedure was performed using the STATISTICA software. The data distribution pattern was determined by the Lilliefors-corrected Kolmogorov–Smirnoff test. The Kruskal–Wallis test was performed to compare independent groups, followed by an intergroup comparison using the Mann–Whitney U test. Results And Discussion The quantitation of miR-181a and miR-25 levels in the serum of patients with IBC of different molecular subtypes showed that the samples of aggressive IBC subtypes tend to have higher levels of miR-181a and miR-25. The obtained differences were significant according to the Kruskal–Wallis test at p = 0.0127 for miR-181а (Fig. 1 ) and p = 0.0077 for miR-25 (Fig. 2 ). MiR-181а and miR-25 in IBC samples Pairwise comparisons of expression levels among the groups by the Mann–Whitney U test indicated that miR-181а expression was higher in luminal B-like (HER2 − ) (p = 0.006707), HER2 + (non-luminal) (p = 0.017358) and TNBC groups (p = 0.017247) compared to potentially healthy controls (Fig. 1 ), whereas miR-25 expression was found to be elevated in luminal B-like (HER2 − ) (p = 0.004346) and TNBC groups (p = 0.030586) (Fig. 2 ). Compared to the luminal A-like group, miR-181а expression was higher in luminal B-like (HER2 − ) (p = 0.021335) and HER2 + (non-luminal) groups (p = 0.023241) (Fig. 1 ), whereas miR-25 expression proved to be elevated in luminal B-like (HER2 − ) (p = 0.001175) and TNBC (p = 0.038167) groups (Fig. 2 ). In addition, the miR-25 level was higher in the luminal B-like (HER2 − ) group than in the TNBC group (p = 0.043372) (Fig. 2 ). Despite some evidence of a relation between metastases and miR-181a levels 14 , 35 , we failed to reveal any significant differences either in the miR-181а level or in the miR-25 level between the groups of patients with and without metastases to lymph nodes. Furthermore, we did not find any correlations between the levels of studied miRNAs and age; this finding may be important in terms of immunosenescence 36 . MiR-181а and miR-25 in luminal A-like samples Luminal A-like BC is the most common molecular subtype of BC with a relatively good prognosis 37 . In our work, levels of both miR-181а and miR-25 in the luminal А-like BC group did not differ from those in the group of potentially healthy subjects and were the lowest in the non-control groups. Thus, miR-181a and miR-25 do not seem to affect the pathogenesis of luminal А-like IBC as either proto-oncogenes or tumour suppressors. MiR-181а and miR-25 in luminal B-like samples The highest level and widest range of miR-181а and miR-25 expression values were observed in the luminal B-like (HER2 − ) IBC group. Compared to luminal А-like IBC, these tumours have a more aggressive phenotype, a higher risk of recurrence and a worse prognosis 38 . The luminal B-like BC phenotype features the greatest extent of tumour genome methylation among all BC subtypes 39 . On the one hand, alterations in the epigenome cause miRNA dysregulation in cancer; on the other hand, miRNAs themselves indirectly control these DNA and histone modifications. Increased miR-181а and miR-25 expression levels may reflect methylation processes in luminal B-like IBC cells 40 . MiR-181а and miR-25 in HER2 + samples In agreement with literature data 41 , miR-181a expression was found to be elevated in HER2 + (non-luminal) IBC samples. We can also noticed a trend towards higher miR-181a levels in luminal B-like (HER2 + ) samples; however, we cannot draw conclusions from the analysis of two samples. MiR-181a has been reported to suppress the ATM gene in BC cells, thereby impairing the DNA damage response 8 , 42 . ATM dysfunction contributes to HER2-dependent carcinogenicity in vitro and in vivo 43 . On the other hand, ATM may have tumourigenic potential in HER2 + BC as a modulator of the HER2 protein’s stability 43 . Thus, miR-181a can be both a bad and a good diagnostic marker in HER2 + samples. Our findings are not consistent with literature data on miR-25 overexpression in HER2 + IBC samples 5 . MiR-181а and miR-25 in TNBC samples TNBC is the most aggressive IBC subtype and is associated with rapid progression and poor prognosis 2 . We revealed increased miR-181а expression in the TNBC group compared to the potentially healthy controls, consistently with some literature data 8 , 10 and in contradiction to other findings 9 . In basal-like tumours, the extent of genome methylation is the lowest among IBC cases 39 . The effect of miRNA in the TNBC group is unlikely to be mediated by methylation. It can be assumed that miR-181a acts as a TGF-β–regulated tumour progression regulator 14 , 44 . Genes related to the TGF-β signalling pathway are thought to be prognostic markers of TNBC 45 , whereas TGF-β1 expression is known to be elevated in TNBC tissues 46 . Nonetheless, at an early stage of cancer progression, TGFβ works as a tumour suppressor and promotes oncogenesis only at a later stage 44 . Therefore, the observed overexpression of miR-181a in TNBC samples may indicate an increase in proto-oncogenic or tumour-suppressive transduction of the TGF-β signal or changes in other molecular pathways such as suppression of the pro-apoptotic BAX gene 47 . Our findings are in line with literature data about miR-25, which is highly active in TNBC 20 . MiR-181a and miR-25 have been identified as components of an expression signature consisting of six miRNAs; this signature predicts the status of BRCA1/2 mutations, for which a standard test can give a false negative result 48 . Our results support the thesis that increased miR-181a and miR-25 expression may be an indication for more thorough testing for possible BRCA1/2 mutations 48 . MiR-181 in benign-breast-disease samples We revealed greater miR-181a expression in the fibroadenoma group (p = 0.018537) and fibrocystic disease/adenosis group (p = 0.029736) (a low risk of malignant transformation) as compared to the potentially healthy controls (Fig. 1 ). By contrast, miR-181a expression in the group with benign breast diseases having a high risk of malignant transformation did not differ from the control level. Fibrous aberrations in breast tissue and simple cysts do not raise the risk of BC 49 , and fibrocystic breast disease is generally not associated with an increased risk of malignancy. Nonetheless, in certain histopathological and clinical conditions, fibrocystic disease may correlate with a BC risk (up to 50%) 50 . The average age at diagnosis of carcinoma developing from fibroadenoma is 42.5 years, i.e., ~ 20 years after the most likely age at diagnosis of fibroadenoma. Therefore, malignant transformation should be suspected in older women with fibroadenoma and a family history of BC and/or BRCA-1/2 mutations 30 . Very few data are available on the types of cancer that are more likely to arise via malignant transformation of benign breast diseases. It is known that microglandular adenosis can be a precursor to ER − cancer 2 . It is possible that changes in miR-181a and miR-25 levels can be useful in complex diagnostic protocols and for risk assessment of malignant transformation in benign breast diseases. Conclusions We revealed elevated miR-181a expression levels in patients with a benign breast disease having a low risk of malignant transformation. Clinically significant molecular/genetic abnormalities have not been found in these patients 2 , and this miRNA’s level may be a negative predictor of precancerous changes. In patients with IBC, miR-181a and miR-25 expression levels are generally higher in more malignant IBC subtypes (such as luminal B-like [HER2 − ] and TNBC); however, this overexpression may reflect either favourable or adverse processes in the tumour owing to the multiple effects of the miRNAs in question, especially miR-181а. MiR-181а and miR-25 can target mRNAs of several genes and simultaneously affect several targets, pathways and processes, including those that act differently in relation to tumour progression. These targets may be modulated by other miRNAs, thus pointing to the existence of autoregulatory loops. The use of miR-181а and miR-25 as markers seems to make sense only in a set of other markers. It is feasible to develop a diagnostic panel that would include both miR-181а and miR-25 and their target genes. Declarations Competing interests The authors declare no competing interests. Funding and acknowledgments The study was supported by a state assignment from the Ministry of Health of the Russian Federation (No. AAAA-A18-118030790008-7) and by project No. 1021050601082-2-1.6.4;3.1.6 within government funding of topic No. FGMU-2022-0004 for the Institute of Molecular Biology and Biophysics, the Federal Research Center of Fundamental and Translational Medicine. The work was performed on the equipment of the multi-access centre Proteomic Analysis, supported by funding from the Ministry of Science and Higher Education of the Russian Federation (state assignment No. 075-15-2021-691). The authors thank Dr. N.A. Shevchuk for language help and proofreading the article. Author contributions M.P. performed the experiments and data analyses and wrote the first draft of the manuscript; A.S. performed the experiments and data analyses; A.P. contributed to the data collection and management; A.G. participated in project administration and in interpretation of the data; A.A. conceived and designed the study and participated in interpretation and analysis of the data and in project administration. All authors have reviewed and approved the manuscript. Data availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Lukasiewicz, S. et al. Breast Cancer-Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies-An Updated Review. Cancers (Basel) 13 , doi: 10.3390/cancers13174287 (2021). Breast Tumours: WHO Classification of Tumours . 5th edn, Vol. 2 (2019). Zhai, Z. et al. MiR-181a-5p facilitates proliferation, invasion, and glycolysis of breast cancer through NDRG2-mediated activation of PTEN/AKT pathway. Bioengineered 13 , 83–95, doi: 10.1080/21655979.2021.2006974 (2022). Yang, C., Tabatabaei, S. N., Ruan, X. & Hardy, P. The Dual Regulatory Role of MiR-181a in Breast Cancer. Cell Physiol Biochem 44 , 843–856, doi: 10.1159/000485351 (2017). Mahmoudian, M. et al. Identification of a six-microRNA signature as a potential diagnostic biomarker in breast cancer tissues. J Clin Lab Anal 35 , e24010, doi: 10.1002/jcla.24010 (2021). Ma, Z. et al. MiR-181a-5p inhibits cell proliferation and migration by targeting Kras in non-small cell lung cancer A549 cells. Acta Biochim Biophys Sin (Shanghai) 47 , 630–638, doi: 10.1093/abbs/gmv054 (2015). Yang, M., Zhai, X., Ge, T., Yang, C. & Lou, G. miR-181a-5p Promotes Proliferation and Invasion and Inhibits Apoptosis of Cervical Cancer Cells via Regulating Inositol Polyphosphate-5-Phosphatase A (INPP5A). Oncol Res 26 , 703–712, doi: 10.3727/096504017X14982569377511 (2018). Bisso, A. et al. Oncogenic miR-181a/b affect the DNA damage response in aggressive breast cancer. Cell Cycle 12 , 1679–1687, doi: 10.4161/cc.24757 (2013). Berber, U. et al. miR-205 and miR-200c: Predictive Micro RNAs for Lymph Node Metastasis in Triple Negative Breast Cancer. J Breast Cancer 17 , 143–148, doi: 10.4048/jbc.2014.17.2.143 (2014). Ouyang, M. et al. MicroRNA profiling implies new markers of chemoresistance of triple-negative breast cancer. PLoS One 9 , e96228, doi: 10.1371/journal.pone.0096228 (2014). Li, Y. et al. miR-181a-5p Inhibits Cancer Cell Migration and Angiogenesis via Downregulation of Matrix Metalloproteinase-14. Cancer Res 75 , 2674–2685, doi: 10.1158/0008-5472.CAN-14-2875 (2015). El Majzoub, R. et al. A thiosemicarbazone derivative induces triple negative breast cancer cell apoptosis: possible role of miRNA-125a-5p and miRNA-181a-5p. Genes Genomics 41 , 1431–1443, doi: 10.1007/s13258-019-00866-y (2019). Park, J. W. et al. Autophagy inhibits cancer stemness in triple-negative breast cancer via miR-181a-mediated regulation of ATG5 and/or ATG2B. Mol Oncol, doi: 10.1002/1878-0261.13180 (2022). Taylor, M. A., Sossey-Alaoui, K., Thompson, C. L., Danielpour, D. & Schiemann, W. P. TGF-beta upregulates miR-181a expression to promote breast cancer metastasis. Journal of Clinical Investigation 123 , 150–163, doi: 10.1172/Jci64946 (2013). Ling, H., Fabbri, M. & Calin, G. A. MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat Rev Drug Discov 12 , 847–865, doi: 10.1038/nrd4140 (2013). Huang, X. et al. Characterization of human plasma-derived exosomal RNAs by deep sequencing. BMC Genomics 14 , 319, doi: 10.1186/1471-2164-14-319 (2013). Ferracin, M. et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget 6 , 14545–14555, doi: 10.18632/oncotarget.3859 (2015). Godfrey, A. C. et al. Serum microRNA expression as an early marker for breast cancer risk in prospectively collected samples from the Sister Study cohort. Breast Cancer Res 15 , R42, doi: 10.1186/bcr3428 (2013). Sarkozy, M., Kahan, Z. & Csont, T. A myriad of roles of miR-25 in health and disease. Oncotarget 9 , 21580–21612, doi: 10.18632/oncotarget.24662 (2018). Farazi, T. A. et al. Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol 15 , R9, doi: 10.1186/gb-2014-15-1-r9 (2014). Chen, H., Pan, H., Qian, Y., Zhou, W. & Liu, X. MiR-25-3p promotes the proliferation of triple negative breast cancer by targeting BTG2. Mol Cancer 17 , 4, doi: 10.1186/s12943-017-0754-0 (2018). Wang, Z. Y. et al. MicroRNA-25 regulates chemoresistance-associated autophagy in breast cancer cells, a process modulated by the natural autophagy inducer isoliquiritigenin. Oncotarget 5 , 7013–7026, doi:DOI 10.18632/oncotarget.2192 (2014). Wang, L. J., Chiou, J. T., Lee, Y. C. & Chang, L. S. Docetaxel-triggered SIDT2/NOX4/JNK/HuR signaling axis is associated with TNF-alpha-mediated apoptosis of cancer cells. Biochem Pharmacol 195 , 114865, doi: 10.1016/j.bcp.2021.114865 (2022). Chang, J. T., Wang, F., Chapin, W. & Huang, R. S. Identification of MicroRNAs as Breast Cancer Prognosis Markers through the Cancer Genome Atlas. PLoS One 11 , e0168284, doi: 10.1371/journal.pone.0168284 (2016). Yao, J. et al. lncMICAL21 sponges miR25 to regulate DKK3 expression and inhibits activation of the Wnt/betacatenin signaling pathway in breast cancer. Int J Mol Med 49 , doi: 10.3892/ijmm.2021.5078 (2022). Hu, Z. B. et al. Serum microRNA profiling and breast cancer risk: the use of miR-484/191 as endogenous controls. Carcinogenesis 33 , 828–834, doi: 10.1093/carcin/bgs030 (2012). Stachs, A., Stubert, J., Reimer, T. & Hartmann, S. Benign Breast Disease in Women. Dtsch Arztebl Int 116 , 565–574, doi: 10.3238/arztebl.2019.0565 (2019). Roman, M. et al. Breast density, benign breast disease, and risk of breast cancer over time. Eur Radiol 31 , 4839–4847, doi: 10.1007/s00330-020-07490-5 (2021). Mehta, N., Rousslang, L., Shokouh-Amiri, M., Wiley, E. L. & Green, L. Complex Solid and Cystic Breast Cancer: A Series of Six Case Reports. J Radiol Case Rep 14 , 21–44, doi: 10.3941/jrcr.v14i2.3712 (2020). Chintamani et al. Carcinoma developing in a fibroadenoma in a woman with a family history of breast cancer: a case report and review of literature. Cases J 2 , 9348, doi: 10.1186/1757-1626-2-9348 (2009). Tan, P. H. et al. The 2019 World Health Organization classification of tumours of the breast. Histopathology 77 , 181–185, doi: 10.1111/his.14091 (2020). Goldhirsch, A. et al. Personalizing the treatment of women with early breast cancer: highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann Oncol 24 , 2206–2223, doi: 10.1093/annonc/mdt303 (2013). Erber, R. et al. Molecular Subtyping of Invasive Breast Cancer Using a PAM50-Based Multigene Expression Test-Comparison with Molecular-Like Subtyping by Tumor Grade/Immunohistochemistry and Influence on Oncologist's Decision on Systemic Therapy in a Real-World Setting. Int J Mol Sci 23 , doi: 10.3390/ijms23158716 (2022). Zendehdel, M., Niakan, B., Keshtkar, A., Rafiei, E. & Salamat, F. Subtypes of Benign Breast Disease as a Risk Factor for Breast Cancer: A Systematic Review and Meta-Analysis Protocol. Iran J Med Sci 43 , 1–8 (2018). Wang, B., Li, J. D., Sun, M., Sun, L. H. & Zhang, X. Y. MiRNA Expression in Breast Cancer Varies with Lymph Node Metastasis and Other Clinicopathologic Features. Iubmb Life 66 , 371–377, doi: 10.1002/iub.1273 (2014). Lian, J., Yue, Y., Yu, W. & Zhang, Y. Immunosenescence: a key player in cancer development. J Hematol Oncol 13 , 151, doi: 10.1186/s13045-020-00986-z (2020). Jia, R. et al. Identification of key genes unique to the luminal a and basal-like breast cancer subtypes via bioinformatic analysis. World J Surg Oncol 18 , 268, doi: 10.1186/s12957-020-02042-z (2020). Lundgren, C. et al. Agreement between molecular subtyping and surrogate subtype classification: a contemporary population-based study of ER-positive/HER2-negative primary breast cancer. Breast Cancer Res Treat 178 , 459–467, doi: 10.1007/s10549-019-05378-7 (2019). Holm, K. et al. Molecular subtypes of breast cancer are associated with characteristic DNA methylation patterns. Breast Cancer Res 12 , R36, doi: 10.1186/bcr2590 (2010). Humphries, B., Wang, Z. & Yang, C. MicroRNA Regulation of Epigenetic Modifiers in Breast Cancer. Cancers (Basel) 11 , doi: 10.3390/cancers11070897 (2019). Hua, H., Zhang, H., Kong, Q. & Jiang, Y. Mechanisms for estrogen receptor expression in human cancer. Exp Hematol Oncol 7 , 24, doi: 10.1186/s40164-018-0116-7 (2018). Stucci, L. S. et al. The ATM Gene in Breast Cancer: Its Relevance in Clinical Practice. Genes (Basel) 12 , doi: 10.3390/genes12050727 (2021). Stagni, V. et al. ATM kinase sustains HER2 tumorigenicity in breast cancer. Nat Commun 6 , 6886, doi: 10.1038/ncomms7886 (2015). Vishnubalaji, R. & Alajez, N. M. Epigenetic regulation of triple negative breast cancer (TNBC) by TGF-beta signaling. Sci Rep 11 , 15410, doi: 10.1038/s41598-021-94514-9 (2021). Thalor, A., Kumar Joon, H., Singh, G., Roy, S. & Gupta, D. Machine learning assisted analysis of breast cancer gene expression profiles reveals novel potential prognostic biomarkers for triple-negative breast cancer. Comput Struct Biotechnol J 20 , 1618–1631, doi: 10.1016/j.csbj.2022.03.019 (2022). Liu, N., Qi, D., Jiang, J., Zhang, J. & Yu, C. Significance of combined TGF-beta1 and survivin expression on the prognosis of patients with triple-negative breast cancer. Oncol Lett 23 , 193, doi: 10.3892/ol.2022.13313 (2022). Kale, J., Osterlund, E. J. & Andrews, D. W. BCL-2 family proteins: changing partners in the dance towards death. Cell Death Differ 25 , 65–80, doi: 10.1038/cdd.2017.186 (2018). Tanic, M. et al. MicroRNA expression signatures for the prediction of BRCA1/2 mutation-associated hereditary breast cancer in paraffin-embedded formalin-fixed breast tumors. Int J Cancer 136 , 593–602, doi: 10.1002/ijc.29021 (2015). Orr, B. & Kelley, J. L., 3rd. Benign Breast Diseases: Evaluation and Management. Clin Obstet Gynecol 59 , 710–726, doi: 10.1097/GRF.0000000000000233 (2016). Malherbe, K., Khan, M. & Fatima, S. in StatPearls (2022). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2299018","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":155580743,"identity":"b813df4c-7fd0-409c-afbb-6721c5f00d89","order_by":0,"name":"Maria Perepechaeva","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDACdhhDAkza8DMwMD7Ar4UZVUuaZAMDs2EDKVoOE9ai28x78HFFxR05/tnNDx/z1JyXMG8/zP7oBsO9RFz6zA7zJRueOfPMWOLOMWNjnmO3JWTOJDM25zAU49HCYybZ2HY4cYNEgpnkDLbbdRIS/AeBWhLwaTH/2fjvcP0GifTvP2f8OychIcHMSEiLGWNjw+EEA4kcM4aPbQeI0cKXLNlw7JnhjBs5xRIf+5IlJHiSGWfnGCQY49RyvPfgx4aaO/L8M9I3fkj4ZichwX6Y4XNORYIsLi0MDDwg4gC6qAFO9Ti1jIJRMApGwShAAAAAWFjffyjgPQAAAABJRU5ErkJggg==","orcid":"","institution":"Federal Research Center of Fundamental and Translational Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Maria","middleName":"","lastName":"Perepechaeva","suffix":""},{"id":155580745,"identity":"35e9d5d1-86b8-4b3f-b9f9-ed22d020ca40","order_by":1,"name":"Anastasia Studenikina","email":"","orcid":"","institution":"Novosibirsk State Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anastasia","middleName":"","lastName":"Studenikina","suffix":""},{"id":155580749,"identity":"79d1c309-a504-4d72-beeb-46e72fdc4366","order_by":2,"name":"Andrew Proskura","email":"","orcid":"","institution":"Federal Research Center of Fundamental and Translational Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Proskura","suffix":""},{"id":155580752,"identity":"6f4bc899-c1b5-40e1-bed7-fe240b3e8361","order_by":3,"name":"Alevtina Grishanova","email":"","orcid":"","institution":"Federal Research Center of Fundamental and Translational Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alevtina","middleName":"","lastName":"Grishanova","suffix":""},{"id":155580754,"identity":"dd7de4ab-07d2-40b1-b441-5f873d0d086d","order_by":4,"name":"Alexander Autenshlyus","email":"","orcid":"","institution":"Novosibirsk State Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alexander","middleName":"","lastName":"Autenshlyus","suffix":""}],"badges":[],"createdAt":"2022-11-22 02:14:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2299018/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2299018/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":29777321,"identity":"98ee0cca-9ab5-49f1-b961-2306fe674fca","added_by":"auto","created_at":"2022-12-01 15:22:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":142317,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of miR-181а in serum samples from patients with benign breast disease or IBC and healthy controls. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2299018/v1/7b116412d073e98cf7bdd616.png"},{"id":29777322,"identity":"afcfa7ac-9e3e-490d-9d2b-631e2d911791","added_by":"auto","created_at":"2022-12-01 15:22:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":191585,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of miR-25 in serum samples from patients with a benign breast disease or IBC and healthy controls. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2299018/v1/96213455d2b24d9e0c63401a.png"},{"id":35494037,"identity":"6b6089e9-0432-4a08-a78a-0fee666f945d","added_by":"auto","created_at":"2023-04-09 07:29:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":636169,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2299018/v1/c5bd431c-0dd8-493f-bc8d-4f28846465df.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Serum miR-181а and miR-25 levels in patients with breast cancer or a benign breast disease","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBreast cancer (BC) is the most common cancer among women and the leading cause of cancer death\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Invasive breast carcinoma (IBC) includes a wide range of malignant epithelial tumour subtypes that vary in morphology, clinical presentation and prognosis and require different, often personalised treatment plans\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIBC aetiology and pathogenesis may be related to dysregulation of microRNAs (miRNA, miR)\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, which repress their target genes at the post-transcriptional level. Many of these genes are involved in cell proliferation, differentiation, migration, and apoptosis\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. It is expected that miRNA expression profiling will allow them to be employed as biomarkers for diagnosis, theranostics and prognosis\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMiR-181а and miR-25 are known as either oncogenic miRNAs or tumour suppressors in different types of cancer\u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, in different types of BC\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e and even within the same BC subtype\u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In breast tissues, miR-181а as a tumour suppressor targets genes encoding matrix metalloproteinase MMP-14\u003csup\u003e11\u003c/sup\u003e, pleckstrin homology-like domain, family A, member 1 (PHLDA1), BC resistance protein BCRP\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e, Bcl-2\u003csup\u003e12\u003c/sup\u003e and autophagy-associated proteins\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. As a proto-oncogene, miR-181а is associated with aberrant activation of the TGF-β signalling pathway\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e and targets mRNA of genes ataxia telangiectasia mutated (\u003cem\u003eATM\u003c/em\u003e), \u003cem\u003eBAX\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e and \u003cem\u003eNDRG2\u003c/em\u003e\u003csup\u003e3\u003c/sup\u003e. MiR-181 enhances metastatic potential of BC cells, thereby promoting epithelial\u0026ndash;mesenchymal transition and formation of an invasive phenotype\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, whereas high levels of miR-181a correlate with poor survival of patients with BC\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMiR-181а is one of the most common exosomal human plasma miRNAs\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, and changes in its serum level may serve as a biomarker\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Nonetheless, the data available on serum miR-181a levels depending on disease status are inconsistent\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMiR-25 is mostly known as an oncogenic miRNA\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. MiR-25 expression is elevated in BC samples compared to non-malignant breast tissues in aggressive BC types such as triple-negative BC (TNBC)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e and HER2\u003csup\u003e+\u003c/sup\u003e BC\u003csup\u003e5\u003c/sup\u003e. MiR-25 promotes tumour proliferation by targeting tumour suppressor \u003cem\u003eBTG2\u003c/em\u003e\u0026rsquo;s mRNA in TNBC\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and participates in autophagy processes by interacting with autophagy regulator \u003cem\u003eULK1\u003c/em\u003e\u0026rsquo;s mRNA\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e and in TNF-dependent cell death by interacting with \u003cem\u003eNOX4\u003c/em\u003e mRNA\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Nevertheless, there is also evidence of improved survival in BC with elevated miR-25 levels\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e as well as tumour growth inhibition via the involvement of miR-25 in the regulation of the Wnt signalling pathway\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOverexpression of miR-25 has been shown in the serum of Chinese BC patients\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, and it can be reasonably assumed that miR-25-3p is a biomarker of BC.\u003c/p\u003e \u003cp\u003eUnfortunately, little attention has been paid to the treatment of benign breast diseases\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, although these conditions may increase the risk of BC\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. For example, a complex breast cyst and complex solid and cystic breast mass can be malignant in 23\u0026ndash;31% of cases\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Adenosis is often associated with fibrocystic alterations, whereas sclerosing and apocrine adenosis correlate with a 1.5\u0026ndash;2.0-fold increase in the risk of BC\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Fibroadenoma is generally associated with a minimal increase in the risk of malignancy\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; however, the risk is high in women with a family history of BC and/or BRCA-1/2 mutations\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAn analysis of circulating miR-181a miR-25 levels in different types of breast disease can provide a clearer understanding of their potential as biomarkers. With this aim, we investigated concentrations of miR-181a and miR-25 in the serum of patients with IBC of different molecular subtypes, with or without lymphogenous metastasis, as well as in patients with a benign breast disease and in potentially healthy donors.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients and sample collection\u003c/h2\u003e \u003cp\u003eThe study population consisted of 77 serum samples collected from patients at Municipal Hospital No. 1, Novosibirsk (Russia). Eleven people (Novosibirsk Municipal Blood Transfusion Station) were classified as potentially healthy, 50 patients got a diagnosis of IBC (among them, 48 patients with stage GII and two patients with stage GI) and 16 patients had a benign breast disease. Metastases in regional lymph nodes were present in 20 IBC patients (average age 52 [range 23\u0026ndash;72] years) and absent in 30 patients (average age 58 [range 35\u0026ndash;79] years).\u003c/p\u003e \u003cp\u003e The whole study was conducted in accordance with the World Medical Association Declaration of Helsinki 1964 as amended in 2013 at the 64th WMAJ General Assembly (Fortaleza, Brazil, October 2013). All patients gave their voluntary informed consent to participate in the study. The study protocol was approved by the Ethics Committee at the Institute of Molecular Biology and Biophysics, a subdivision of the Federal Research Centre of Fundamental and Translational Medicine (Protocol No. 2016-3).\u003c/p\u003e \u003cp\u003eThe patients underwent surgical treatment and finally got a diagnosis on the basis of pathomorphological findings. Neoadjuvant therapy was not performed.\u003c/p\u003e \u003cp\u003eIn recent years, new molecular markers for differences in pathogenesis, treatment response and prognosis were added to the IBC classification\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Nevertheless, due to the lack of time and resources, molecular classification of BC in the vast majority of healthcare systems is still largely based on immunohistochemical evaluation of such biomarkers as oestrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (HER2) as well as on assays of the Ki-67 proliferation marker\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. We chose this classification and identified molecular subtypes of each tumour among the samples under study (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e)\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIBC Subtyping Criteria\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSubtype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eER\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHER2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKi-67 (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLuminal A-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;20%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLuminal B-like HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;20%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLuminal B-like HER2\u003csup\u003e+\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAny\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHER2\u003csup\u003e+\u003c/sup\u003e (non-luminal)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAny\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAny\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eLuminal A-like BC was diagnosed in 15 patients with IBC [average age 58 (35\u0026ndash;79) years], luminal B-like HER2 negative (luminal B-like [HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e]) in 12 patients [average age 53 (23\u0026ndash;69) years], luminal B-like HER2\u003csup\u003e+\u003c/sup\u003e (luminal B-like [HER2\u003csup\u003e+\u003c/sup\u003e]) in 2 patients [average age 57 (47\u0026ndash;67) years], HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) type in 5 patients, [average age 55 (40\u0026ndash;69) years], and TNBC was diagnosed in 14 patients [average age 56 (35\u0026ndash;72) years].\u003c/p\u003e \u003cp\u003ePatients with a benign breast disease were subdivided into two groups\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. The first group of a low risk of malignant transformation (a non-proliferative type of fibrocystic disease, fibroadenosis or fibroadenoma) included 14 patients [average age 50 (18\u0026ndash;83) years]. The second group included two patients: a 40-year-old woman with a proliferative type of fibroadenosis and a 41-year-old woman with sclerosing adenosis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRna Isolation And Cdna Synthesis\u003c/h3\u003e\n\u003cp\u003eMiRNA was isolated using the NucleoSpin miRNA Plasma Kit (Macherey-Nagel, Germany) as per the manufacturer\u0026rsquo;s protocol. Reverse transcription was performed with miRNA-specific stem-loop adapters and reverse transcriptase M-MuLV\u0026ndash;RH (Biolabmix, Russia), as per the manufacturer\u0026rsquo;s protocol. The mixture was incubated at 18 \u0026deg;C for 30 min, then at 42 \u0026deg;C for 30 min and finally at 85 \u0026deg;C for 5 min. Sequences of the stem-loop adapters were as follows: miR-181а: 5\u0026prime;-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTCACCG-3\u0026prime;; miR-25: 5\u0026prime;-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGACCG-3\u0026prime;; U6: 5\u0026prime;- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCCATGC-3\u0026prime;.\u003c/p\u003e\n\u003ch3\u003eDroplet Digital Pcr (Ddpcr)\u003c/h3\u003e\n\u003cp\u003eMiRNA expression was evaluated by means of ddPCR probes and a QX200 AutoDG Droplet Digital PCR System (Bio-Rad Laboratories, USA). To generate droplets in a final volume of 20 \u0026micro;l, 2x supermix for ddPCR (Bio-Rad), 7 \u0026micro;l cDNA and a primer mix consisting of 5 \u0026micro;M probe and 20 \u0026micro;M forward and reverse primers were used. The primer sequences were as follows: miR-181а: forward 5\u0026prime;-GCCGCAACATTCAACGCTGT-3\u0026prime;, probe 5\u0026prime;-(FAM)-TTCGCACTGGATACGACACTCACCG-(BHQ1)-3\u0026prime;; miR-25: forward 5\u0026prime;-GCCGCCATTGCACTTGTCT-3\u0026prime;, probe 5\u0026prime;-(FAM)-TTCGCACTGGATACGACTCAGACCG-(BHQ1)-3\u0026prime;; U6: forward 5\u0026prime;- GCCGCATACAGAGAAGATTA-3\u0026prime;, probe 5\u0026prime;-(FAM)-TTCGCACTGGATACGACGGCCATGC-(BHQ1)-3\u0026prime;; and common reverse primer 5\u0026prime;-AGTGCAGGGTCCGAGGTA-3\u0026prime;.\u003c/p\u003e \u003cp\u003eDroplets were obtained using a QX200 automatic droplet generator (Bio-Rad). The reaction was conducted under the following conditions: heating at 95\u0026deg;C for 10 min, then 39 cycles of denaturation at 95\u0026deg;C for 30 s and annealing/extension at 55\u0026deg;C for 10 min, then 98 \u0026deg;С for 10 min. After that, a QX200 droplet reader was used, and the results were analysed in the Quantasoft\u0026trade; software (Bio-Rad). A no-matrix control was included in each assay. Small nuclear RNA U6 served as an internal standard for the miRNAs being quantified.\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThis procedure was performed using the STATISTICA software. The data distribution pattern was determined by the Lilliefors-corrected Kolmogorov\u0026ndash;Smirnoff test. The Kruskal\u0026ndash;Wallis test was performed to compare independent groups, followed by an intergroup comparison using the Mann\u0026ndash;Whitney \u003cem\u003eU\u003c/em\u003e test.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results And Discussion","content":"\u003cp\u003eThe quantitation of miR-181a and miR-25 levels in the serum of patients with IBC of different molecular subtypes showed that the samples of aggressive IBC subtypes tend to have higher levels of miR-181a and miR-25. The obtained differences were significant according to the Kruskal\u0026ndash;Wallis test at p\u0026thinsp;=\u0026thinsp;0.0127 for miR-181а (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and p\u0026thinsp;=\u0026thinsp;0.0077 for miR-25 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMiR-181а and miR-25 in IBC samples\u003c/h2\u003e \u003cp\u003ePairwise comparisons of expression levels among the groups by the Mann\u0026ndash;Whitney \u003cem\u003eU\u003c/em\u003e test indicated that miR-181а expression was higher in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) (p\u0026thinsp;=\u0026thinsp;0.006707), HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) (p\u0026thinsp;=\u0026thinsp;0.017358) and TNBC groups (p\u0026thinsp;=\u0026thinsp;0.017247) compared to potentially healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), whereas miR-25 expression was found to be elevated in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) (p\u0026thinsp;=\u0026thinsp;0.004346) and TNBC groups (p\u0026thinsp;=\u0026thinsp;0.030586) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCompared to the luminal A-like group, miR-181а expression was higher in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) (p\u0026thinsp;=\u0026thinsp;0.021335) and HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) groups (p\u0026thinsp;=\u0026thinsp;0.023241) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), whereas miR-25 expression proved to be elevated in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) (p\u0026thinsp;=\u0026thinsp;0.001175) and TNBC (p\u0026thinsp;=\u0026thinsp;0.038167) groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In addition, the miR-25 level was higher in the luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) group than in the TNBC group (p\u0026thinsp;=\u0026thinsp;0.043372) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eDespite some evidence of a relation between metastases and miR-181a levels\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e, we failed to reveal any significant differences either in the miR-181а level or in the miR-25 level between the groups of patients with and without metastases to lymph nodes. Furthermore, we did not find any correlations between the levels of studied miRNAs and age; this finding may be important in terms of immunosenescence\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eMiR-181а and miR-25 in luminal A-like samples\u003c/span\u003e\u003c/h2\u003e \u003cp\u003eLuminal A-like BC is the most common molecular subtype of BC with a relatively good prognosis\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In our work, levels of both miR-181а and miR-25 in the luminal А-like BC group did not differ from those in the group of potentially healthy subjects and were the lowest in the non-control groups. Thus, miR-181a and miR-25 do not seem to affect the pathogenesis of luminal А-like IBC as either proto-oncogenes or tumour suppressors.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eMiR-181а and miR-25 in luminal B-like samples\u003c/span\u003e\u003c/h2\u003e \u003cp\u003eThe highest level and widest range of miR-181а and miR-25 expression values were observed in the luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) IBC group. Compared to luminal А-like IBC, these tumours have a more aggressive phenotype, a higher risk of recurrence and a worse prognosis\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The luminal B-like BC phenotype features the greatest extent of tumour genome methylation among all BC subtypes\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. On the one hand, alterations in the epigenome cause miRNA dysregulation in cancer; on the other hand, miRNAs themselves indirectly control these DNA and histone modifications. Increased miR-181а and miR-25 expression levels may reflect methylation processes in luminal B-like IBC cells\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMiR-181а and miR-25 in HER2\u003csup\u003e+\u003c/sup\u003e samples\u003c/h2\u003e \u003cp\u003eIn agreement with literature data\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, miR-181a expression was found to be elevated in HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) IBC samples. We can also noticed a trend towards higher miR-181a levels in luminal B-like (HER2\u003csup\u003e+\u003c/sup\u003e) samples; however, we cannot draw conclusions from the analysis of two samples.\u003c/p\u003e \u003cp\u003eMiR-181a has been reported to suppress the \u003cem\u003eATM\u003c/em\u003e gene in BC cells, thereby impairing the DNA damage response\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. ATM dysfunction contributes to HER2-dependent carcinogenicity \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. On the other hand, ATM may have tumourigenic potential in HER2\u003csup\u003e+\u003c/sup\u003e BC as a modulator of the HER2 protein\u0026rsquo;s stability\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Thus, miR-181a can be both a bad and a good diagnostic marker in HER2\u003csup\u003e+\u003c/sup\u003e samples.\u003c/p\u003e \u003cp\u003eOur findings are not consistent with literature data on miR-25 overexpression in HER2\u003csup\u003e+\u003c/sup\u003e IBC samples\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eMiR-181а and miR-25 in TNBC samples\u003c/span\u003e\u003c/h2\u003e \u003cp\u003eTNBC is the most aggressive IBC subtype and is associated with rapid progression and poor prognosis\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. We revealed increased miR-181а expression in the TNBC group compared to the potentially healthy controls, consistently with some literature data\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e and in contradiction to other findings\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn basal-like tumours, the extent of genome methylation is the lowest among IBC cases\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. The effect of miRNA in the TNBC group is unlikely to be mediated by methylation. It can be assumed that miR-181a acts as a TGF-β\u0026ndash;regulated tumour progression regulator\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Genes related to the TGF-β signalling pathway are thought to be prognostic markers of TNBC\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e, whereas TGF-β1 expression is known to be elevated in TNBC tissues\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Nonetheless, at an early stage of cancer progression, TGFβ works as a tumour suppressor and promotes oncogenesis only at a later stage\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTherefore, the observed overexpression of miR-181a in TNBC samples may indicate an increase in proto-oncogenic or tumour-suppressive transduction of the TGF-β signal or changes in other molecular pathways such as suppression of the pro-apoptotic \u003cem\u003eBAX\u003c/em\u003e gene\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOur findings are in line with literature data about miR-25, which is highly active in TNBC\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. MiR-181a and miR-25 have been identified as components of an expression signature consisting of six miRNAs; this signature predicts the status of BRCA1/2 mutations, for which a standard test can give a false negative result\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Our results support the thesis that increased miR-181a and miR-25 expression may be an indication for more thorough testing for possible BRCA1/2 mutations\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eMiR-181 in benign-breast-disease samples\u003c/span\u003e\u003c/h2\u003e \u003cp\u003eWe revealed greater miR-181a expression in the fibroadenoma group (p\u0026thinsp;=\u0026thinsp;0.018537) and fibrocystic disease/adenosis group (p\u0026thinsp;=\u0026thinsp;0.029736) (a low risk of malignant transformation) as compared to the potentially healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). By contrast, miR-181a expression in the group with benign breast diseases having a high risk of malignant transformation did not differ from the control level.\u003c/p\u003e \u003cp\u003eFibrous aberrations in breast tissue and simple cysts do not raise the risk of BC\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e, and fibrocystic breast disease is generally not associated with an increased risk of malignancy. Nonetheless, in certain histopathological and clinical conditions, fibrocystic disease may correlate with a BC risk (up to 50%)\u003csup\u003e50\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe average age at diagnosis of carcinoma developing from fibroadenoma is 42.5 years, i.e., ~\u0026thinsp;20 years after the most likely age at diagnosis of fibroadenoma. Therefore, malignant transformation should be suspected in older women with fibroadenoma and a family history of BC and/or BRCA-1/2 mutations\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eVery few data are available on the types of cancer that are more likely to arise via malignant transformation of benign breast diseases. It is known that microglandular adenosis can be a precursor to ER\u003csup\u003e\u0026minus;\u003c/sup\u003e cancer\u003csup\u003e2\u003c/sup\u003e. It is possible that changes in miR-181a and miR-25 levels can be useful in complex diagnostic protocols and for risk assessment of malignant transformation in benign breast diseases.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusions","content":"\u003cp\u003eWe revealed elevated miR-181a expression levels in patients with a benign breast disease having a low risk of malignant transformation. Clinically significant molecular/genetic abnormalities have not been found in these patients\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, and this miRNA\u0026rsquo;s level may be a negative predictor of precancerous changes.\u003c/p\u003e \u003cp\u003eIn patients with IBC, miR-181a and miR-25 expression levels are generally higher in more malignant IBC subtypes (such as luminal B-like [HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e] and TNBC); however, this overexpression may reflect either favourable or adverse processes in the tumour owing to the multiple effects of the miRNAs in question, especially miR-181а.\u003c/p\u003e \u003cp\u003eMiR-181а and miR-25 can target mRNAs of several genes and simultaneously affect several targets, pathways and processes, including those that act differently in relation to tumour progression. These targets may be modulated by other miRNAs, thus pointing to the existence of autoregulatory loops. The use of miR-181а and miR-25 as markers seems to make sense only in a set of other markers. It is feasible to develop a diagnostic panel that would include both miR-181а and miR-25 and their target genes.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe authors declare no competing interests.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e \u003cb\u003eFunding and acknowledgments\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe study was supported by a state assignment from the Ministry of Health of the Russian Federation (No. AAAA-A18-118030790008-7) and by project No. 1021050601082-2-1.6.4;3.1.6 within government funding of topic No. FGMU-2022-0004 for the Institute of Molecular Biology and Biophysics, the Federal Research Center of Fundamental and Translational Medicine.\u003c/p\u003e \u003cp\u003eThe work was performed on the equipment of the multi-access centre Proteomic Analysis, supported by funding from the Ministry of Science and Higher Education of the Russian Federation (state assignment No. 075-15-2021-691). The authors thank Dr. N.A. Shevchuk for language help and proofreading the article.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eM.P.\u0026nbsp;\u003c/strong\u003eperformed the experiments and data analyses and wrote the first draft of the manuscript; \u003cstrong\u003eA.S.\u0026nbsp;\u003c/strong\u003eperformed the experiments and data analyses; \u003cstrong\u003eA.P.\u003c/strong\u003e contributed to the data collection and management; \u003cstrong\u003eA.G.\u003c/strong\u003e participated in project administration and in interpretation of the data; \u003cstrong\u003eA.A.\u0026nbsp;\u003c/strong\u003econceived and designed the study and participated in interpretation and analysis of the data and in project administration. All authors have reviewed and approved the manuscript.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLukasiewicz, S. \u003cem\u003eet al.\u003c/em\u003e Breast Cancer-Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies-An Updated Review. \u003cem\u003eCancers (Basel)\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers13174287\u003c/span\u003e\u003cspan address=\"10.3390/cancers13174287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBreast Tumours: \u003cem\u003eWHO Classification of Tumours\u003c/em\u003e. 5th edn, Vol.\u0026nbsp;2 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai, Z. \u003cem\u003eet al.\u003c/em\u003e MiR-181a-5p facilitates proliferation, invasion, and glycolysis of breast cancer through NDRG2-mediated activation of PTEN/AKT pathway. Bioengineered \u003cb\u003e13\u003c/b\u003e, 83\u0026ndash;95, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/21655979.2021.2006974\u003c/span\u003e\u003cspan address=\"10.1080/21655979.2021.2006974\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, C., Tabatabaei, S. N., Ruan, X. \u0026amp; Hardy, P. The Dual Regulatory Role of MiR-181a in Breast Cancer. Cell Physiol Biochem \u003cb\u003e44\u003c/b\u003e, 843\u0026ndash;856, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000485351\u003c/span\u003e\u003cspan address=\"10.1159/000485351\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahmoudian, M. \u003cem\u003eet al.\u003c/em\u003e Identification of a six-microRNA signature as a potential diagnostic biomarker in breast cancer tissues. J Clin Lab Anal \u003cb\u003e35\u003c/b\u003e, e24010, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcla.24010\u003c/span\u003e\u003cspan address=\"10.1002/jcla.24010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, Z. \u003cem\u003eet al.\u003c/em\u003e MiR-181a-5p inhibits cell proliferation and migration by targeting Kras in non-small cell lung cancer A549 cells. Acta Biochim Biophys Sin (Shanghai) \u003cb\u003e47\u003c/b\u003e, 630\u0026ndash;638, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/abbs/gmv054\u003c/span\u003e\u003cspan address=\"10.1093/abbs/gmv054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, M., Zhai, X., Ge, T., Yang, C. \u0026amp; Lou, G. miR-181a-5p Promotes Proliferation and Invasion and Inhibits Apoptosis of Cervical Cancer Cells via Regulating Inositol Polyphosphate-5-Phosphatase A (INPP5A). Oncol Res \u003cb\u003e26\u003c/b\u003e, 703\u0026ndash;712, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3727/096504017X14982569377511\u003c/span\u003e\u003cspan address=\"10.3727/096504017X14982569377511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBisso, A. \u003cem\u003eet al.\u003c/em\u003e Oncogenic miR-181a/b affect the DNA damage response in aggressive breast cancer. Cell Cycle \u003cb\u003e12\u003c/b\u003e, 1679\u0026ndash;1687, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4161/cc.24757\u003c/span\u003e\u003cspan address=\"10.4161/cc.24757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerber, U. \u003cem\u003eet al.\u003c/em\u003e miR-205 and miR-200c: Predictive Micro RNAs for Lymph Node Metastasis in Triple Negative Breast Cancer. J Breast Cancer \u003cb\u003e17\u003c/b\u003e, 143\u0026ndash;148, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4048/jbc.2014.17.2.143\u003c/span\u003e\u003cspan address=\"10.4048/jbc.2014.17.2.143\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang, M. \u003cem\u003eet al.\u003c/em\u003e MicroRNA profiling implies new markers of chemoresistance of triple-negative breast cancer. PLoS One \u003cb\u003e9\u003c/b\u003e, e96228, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0096228\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0096228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y. \u003cem\u003eet al.\u003c/em\u003e miR-181a-5p Inhibits Cancer Cell Migration and Angiogenesis via Downregulation of Matrix Metalloproteinase-14. Cancer Res \u003cb\u003e75\u003c/b\u003e, 2674\u0026ndash;2685, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-14-2875\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-14-2875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl Majzoub, R. \u003cem\u003eet al.\u003c/em\u003e A thiosemicarbazone derivative induces triple negative breast cancer cell apoptosis: possible role of miRNA-125a-5p and miRNA-181a-5p. Genes Genomics \u003cb\u003e41\u003c/b\u003e, 1431\u0026ndash;1443, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13258-019-00866-y\u003c/span\u003e\u003cspan address=\"10.1007/s13258-019-00866-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, J. W. \u003cem\u003eet al.\u003c/em\u003e Autophagy inhibits cancer stemness in triple-negative breast cancer via miR-181a-mediated regulation of ATG5 and/or ATG2B. Mol Oncol, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/1878-0261.13180\u003c/span\u003e\u003cspan address=\"10.1002/1878-0261.13180\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor, M. A., Sossey-Alaoui, K., Thompson, C. L., Danielpour, D. \u0026amp; Schiemann, W. P. TGF-beta upregulates miR-181a expression to promote breast cancer metastasis. Journal of Clinical Investigation \u003cb\u003e123\u003c/b\u003e, 150\u0026ndash;163, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/Jci64946\u003c/span\u003e\u003cspan address=\"10.1172/Jci64946\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing, H., Fabbri, M. \u0026amp; Calin, G. A. MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat Rev Drug Discov \u003cb\u003e12\u003c/b\u003e, 847\u0026ndash;865, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrd4140\u003c/span\u003e\u003cspan address=\"10.1038/nrd4140\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, X. \u003cem\u003eet al.\u003c/em\u003e Characterization of human plasma-derived exosomal RNAs by deep sequencing. BMC Genomics \u003cb\u003e14\u003c/b\u003e, 319, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2164-14-319\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-14-319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerracin, M. \u003cem\u003eet al.\u003c/em\u003e Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget \u003cb\u003e6\u003c/b\u003e, 14545\u0026ndash;14555, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.3859\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.3859\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGodfrey, A. C. \u003cem\u003eet al.\u003c/em\u003e Serum microRNA expression as an early marker for breast cancer risk in prospectively collected samples from the Sister Study cohort. Breast Cancer Res \u003cb\u003e15\u003c/b\u003e, R42, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/bcr3428\u003c/span\u003e\u003cspan address=\"10.1186/bcr3428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkozy, M., Kahan, Z. \u0026amp; Csont, T. A myriad of roles of miR-25 in health and disease. Oncotarget \u003cb\u003e9\u003c/b\u003e, 21580\u0026ndash;21612, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.24662\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.24662\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarazi, T. A. \u003cem\u003eet al.\u003c/em\u003e Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. \u003cem\u003eGenome Biol\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, R9, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2014-15-1-r9\u003c/span\u003e\u003cspan address=\"10.1186/gb-2014-15-1-r9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, H., Pan, H., Qian, Y., Zhou, W. \u0026amp; Liu, X. MiR-25-3p promotes the proliferation of triple negative breast cancer by targeting BTG2. Mol Cancer \u003cb\u003e17\u003c/b\u003e, 4, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-017-0754-0\u003c/span\u003e\u003cspan address=\"10.1186/s12943-017-0754-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. Y. \u003cem\u003eet al.\u003c/em\u003e MicroRNA-25 regulates chemoresistance-associated autophagy in breast cancer cells, a process modulated by the natural autophagy inducer isoliquiritigenin. Oncotarget \u003cb\u003e5\u003c/b\u003e, 7013\u0026ndash;7026, doi:DOI \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.2192\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.2192\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, L. J., Chiou, J. T., Lee, Y. C. \u0026amp; Chang, L. S. Docetaxel-triggered SIDT2/NOX4/JNK/HuR signaling axis is associated with TNF-alpha-mediated apoptosis of cancer cells. Biochem Pharmacol \u003cb\u003e195\u003c/b\u003e, 114865, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bcp.2021.114865\u003c/span\u003e\u003cspan address=\"10.1016/j.bcp.2021.114865\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang, J. T., Wang, F., Chapin, W. \u0026amp; Huang, R. S. Identification of MicroRNAs as Breast Cancer Prognosis Markers through the Cancer Genome Atlas. PLoS One \u003cb\u003e11\u003c/b\u003e, e0168284, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0168284\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0168284\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao, J. \u003cem\u003eet al.\u003c/em\u003e lncMICAL21 sponges miR25 to regulate DKK3 expression and inhibits activation of the Wnt/betacatenin signaling pathway in breast cancer. Int J Mol Med \u003cb\u003e49\u003c/b\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijmm.2021.5078\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2021.5078\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu, Z. B. \u003cem\u003eet al.\u003c/em\u003e Serum microRNA profiling and breast cancer risk: the use of miR-484/191 as endogenous controls. Carcinogenesis \u003cb\u003e33\u003c/b\u003e, 828\u0026ndash;834, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/carcin/bgs030\u003c/span\u003e\u003cspan address=\"10.1093/carcin/bgs030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStachs, A., Stubert, J., Reimer, T. \u0026amp; Hartmann, S. Benign Breast Disease in Women. Dtsch Arztebl Int \u003cb\u003e116\u003c/b\u003e, 565\u0026ndash;574, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3238/arztebl.2019.0565\u003c/span\u003e\u003cspan address=\"10.3238/arztebl.2019.0565\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoman, M. \u003cem\u003eet al.\u003c/em\u003e Breast density, benign breast disease, and risk of breast cancer over time. Eur Radiol \u003cb\u003e31\u003c/b\u003e, 4839\u0026ndash;4847, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00330-020-07490-5\u003c/span\u003e\u003cspan address=\"10.1007/s00330-020-07490-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehta, N., Rousslang, L., Shokouh-Amiri, M., Wiley, E. L. \u0026amp; Green, L. Complex Solid and Cystic Breast Cancer: A Series of Six Case Reports. J Radiol Case Rep \u003cb\u003e14\u003c/b\u003e, 21\u0026ndash;44, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3941/jrcr.v14i2.3712\u003c/span\u003e\u003cspan address=\"10.3941/jrcr.v14i2.3712\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChintamani \u003cem\u003eet al.\u003c/em\u003e Carcinoma developing in a fibroadenoma in a woman with a family history of breast cancer: a case report and review of literature. Cases J \u003cb\u003e2\u003c/b\u003e, 9348, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1757-1626-2-9348\u003c/span\u003e\u003cspan address=\"10.1186/1757-1626-2-9348\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan, P. H. \u003cem\u003eet al.\u003c/em\u003e The 2019 World Health Organization classification of tumours of the breast. Histopathology \u003cb\u003e77\u003c/b\u003e, 181\u0026ndash;185, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/his.14091\u003c/span\u003e\u003cspan address=\"10.1111/his.14091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldhirsch, A. \u003cem\u003eet al.\u003c/em\u003e Personalizing the treatment of women with early breast cancer: highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann Oncol \u003cb\u003e24\u003c/b\u003e, 2206\u0026ndash;2223, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/annonc/mdt303\u003c/span\u003e\u003cspan address=\"10.1093/annonc/mdt303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErber, R. \u003cem\u003eet al.\u003c/em\u003e Molecular Subtyping of Invasive Breast Cancer Using a PAM50-Based Multigene Expression Test-Comparison with Molecular-Like Subtyping by Tumor Grade/Immunohistochemistry and Influence on Oncologist's Decision on Systemic Therapy in a Real-World Setting. Int J Mol Sci \u003cb\u003e23\u003c/b\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23158716\u003c/span\u003e\u003cspan address=\"10.3390/ijms23158716\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZendehdel, M., Niakan, B., Keshtkar, A., Rafiei, E. \u0026amp; Salamat, F. Subtypes of Benign Breast Disease as a Risk Factor for Breast Cancer: A Systematic Review and Meta-Analysis Protocol. Iran J Med Sci \u003cb\u003e43\u003c/b\u003e, 1\u0026ndash;8 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, B., Li, J. D., Sun, M., Sun, L. H. \u0026amp; Zhang, X. Y. MiRNA Expression in Breast Cancer Varies with Lymph Node Metastasis and Other Clinicopathologic Features. Iubmb Life \u003cb\u003e66\u003c/b\u003e, 371\u0026ndash;377, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/iub.1273\u003c/span\u003e\u003cspan address=\"10.1002/iub.1273\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLian, J., Yue, Y., Yu, W. \u0026amp; Zhang, Y. Immunosenescence: a key player in cancer development. J Hematol Oncol \u003cb\u003e13\u003c/b\u003e, 151, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13045-020-00986-z\u003c/span\u003e\u003cspan address=\"10.1186/s13045-020-00986-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia, R. \u003cem\u003eet al.\u003c/em\u003e Identification of key genes unique to the luminal a and basal-like breast cancer subtypes via bioinformatic analysis. World J Surg Oncol \u003cb\u003e18\u003c/b\u003e, 268, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12957-020-02042-z\u003c/span\u003e\u003cspan address=\"10.1186/s12957-020-02042-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundgren, C. \u003cem\u003eet al.\u003c/em\u003e Agreement between molecular subtyping and surrogate subtype classification: a contemporary population-based study of ER-positive/HER2-negative primary breast cancer. Breast Cancer Res Treat \u003cb\u003e178\u003c/b\u003e, 459\u0026ndash;467, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10549-019-05378-7\u003c/span\u003e\u003cspan address=\"10.1007/s10549-019-05378-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolm, K. \u003cem\u003eet al.\u003c/em\u003e Molecular subtypes of breast cancer are associated with characteristic DNA methylation patterns. Breast Cancer Res \u003cb\u003e12\u003c/b\u003e, R36, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/bcr2590\u003c/span\u003e\u003cspan address=\"10.1186/bcr2590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHumphries, B., Wang, Z. \u0026amp; Yang, C. MicroRNA Regulation of Epigenetic Modifiers in Breast Cancer. Cancers (Basel) \u003cb\u003e11\u003c/b\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers11070897\u003c/span\u003e\u003cspan address=\"10.3390/cancers11070897\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHua, H., Zhang, H., Kong, Q. \u0026amp; Jiang, Y. Mechanisms for estrogen receptor expression in human cancer. Exp Hematol Oncol \u003cb\u003e7\u003c/b\u003e, 24, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40164-018-0116-7\u003c/span\u003e\u003cspan address=\"10.1186/s40164-018-0116-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStucci, L. S. \u003cem\u003eet al.\u003c/em\u003e The ATM Gene in Breast Cancer: Its Relevance in Clinical Practice. Genes (Basel) \u003cb\u003e12\u003c/b\u003e, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/genes12050727\u003c/span\u003e\u003cspan address=\"10.3390/genes12050727\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStagni, V. \u003cem\u003eet al.\u003c/em\u003e ATM kinase sustains HER2 tumorigenicity in breast cancer. Nat Commun \u003cb\u003e6\u003c/b\u003e, 6886, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms7886\u003c/span\u003e\u003cspan address=\"10.1038/ncomms7886\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVishnubalaji, R. \u0026amp; Alajez, N. M. Epigenetic regulation of triple negative breast cancer (TNBC) by TGF-beta signaling. Sci Rep \u003cb\u003e11\u003c/b\u003e, 15410, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-021-94514-9\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-94514-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThalor, A., Kumar Joon, H., Singh, G., Roy, S. \u0026amp; Gupta, D. Machine learning assisted analysis of breast cancer gene expression profiles reveals novel potential prognostic biomarkers for triple-negative breast cancer. Comput Struct Biotechnol J \u003cb\u003e20\u003c/b\u003e, 1618\u0026ndash;1631, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.csbj.2022.03.019\u003c/span\u003e\u003cspan address=\"10.1016/j.csbj.2022.03.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, N., Qi, D., Jiang, J., Zhang, J. \u0026amp; Yu, C. Significance of combined TGF-beta1 and survivin expression on the prognosis of patients with triple-negative breast cancer. Oncol Lett \u003cb\u003e23\u003c/b\u003e, 193, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2022.13313\u003c/span\u003e\u003cspan address=\"10.3892/ol.2022.13313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKale, J., Osterlund, E. J. \u0026amp; Andrews, D. W. BCL-2 family proteins: changing partners in the dance towards death. Cell Death Differ \u003cb\u003e25\u003c/b\u003e, 65\u0026ndash;80, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cdd.2017.186\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2017.186\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanic, M. \u003cem\u003eet al.\u003c/em\u003e MicroRNA expression signatures for the prediction of BRCA1/2 mutation-associated hereditary breast cancer in paraffin-embedded formalin-fixed breast tumors. Int J Cancer \u003cb\u003e136\u003c/b\u003e, 593\u0026ndash;602, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ijc.29021\u003c/span\u003e\u003cspan address=\"10.1002/ijc.29021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrr, B. \u0026amp; Kelley, J. L., 3rd. Benign Breast Diseases: Evaluation and Management. Clin Obstet Gynecol \u003cb\u003e59\u003c/b\u003e, 710\u0026ndash;726, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/GRF.0000000000000233\u003c/span\u003e\u003cspan address=\"10.1097/GRF.0000000000000233\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalherbe, K., Khan, M. \u0026amp; Fatima, S. in \u003cem\u003eStatPearls\u003c/em\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"miR-181а, miR-25, microRNA, biomarkers, breast cancer, benign breast disease","lastPublishedDoi":"10.21203/rs.3.rs-2299018/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2299018/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBreast tumours comprise a wide range of disorders requiring different and often personalised treatment plans. The microRNA levels indicating the regulation of gene expression involved in oncogenesis can serve as diagnostic and prognostic biomarkers of benign and malignant breast diseases. Circulating miR-181а and miR-25 were quantified here using droplet digital PCR (ddPCR) in 77 serum samples from patients with invasive breast carcinoma (IBC) (50 samples) or benign breast diseases (16 samples) and \u0026lsquo;potentially healthy\u0026rsquo; controls (11 samples). МiR-181а expression was higher in patients with fibroadenoma or fibrocystic disease/adenosis (low risk of malignant transformation) as compared to potentially healthy controls. In IBC patients, miR-181a expression was higher in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e), HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) and triple-negative breast cancer (TNBC) groups, while miR-25 expression was higher in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) and TNBC groups compared to potentially healthy controls. Compared to the luminal A-like group, miR-181а expression was higher in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) and HER2\u003csup\u003e+\u003c/sup\u003e (non-luminal) groups, whereas miR-25 expression was elevated in luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) and TNBC groups. МiR-25 expression was higher in the luminal B-like (HER2\u003csup\u003e\u0026minus;\u003c/sup\u003e) group compared to the TNBC group. Thus, miR-181a and miR-25 may be markers of precancerous changes in women with benign breast diseases. In IBC patients, levels of miR-181a and miR-25 can reflect either favourable or adverse processes in a tumour owing to their multiple effects. They can be potentially used as biomarkers in a large diagnostic panel.\u003c/p\u003e","manuscriptTitle":"Serum miR-181а and miR-25 levels in patients with breast cancer or a benign breast disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-01 15:21:50","doi":"10.21203/rs.3.rs-2299018/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b828e560-be4b-4a78-a506-5eb2dc4a70fd","owner":[],"postedDate":"December 1st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":17285746,"name":"Biological sciences/Cancer/Breast cancer"},{"id":17285747,"name":"Biological sciences/Cancer/Tumour biomarkers"}],"tags":[],"updatedAt":"2023-04-09T07:29:20+00:00","versionOfRecord":[],"versionCreatedAt":"2022-12-01 15:21:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2299018","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2299018","identity":"rs-2299018","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}