Uncarboxylated Osteocalcin Inhibits De Novo Lipogenesis and Promotes Fatty Acid Oxidation via SIRT1 to Alleviate Hepatocyte Lipid Accumulation

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

AbstractBackground Non-alcoholic fatty liver disease (NAFLD) is a disease characterized by the hepatic lipids accumulation resulting from genetic susceptibility and metabolic dysfunction. Uncarboxylated osteocalcin (GluOC) is a protein that is synthesized by osteoblasts which performs a vital function in the management of energy balance. Previous studies have shown that GluOC is beneficial for lipid and glucose metabolism in KKAy mice induced fatty liver. GluOC effectively ameliorates hyperglycemia, fatty liver, and hyperlipidemia. Furthermore, it regulates stearyl-coenzyme A desaturase 1 (SCD1) expression through AMP-activated protein kinase (AMPK), which alleviates hepatocyte lipid accumulation. However, the underlying mechanisms by which GluOC alleviates hepatocyte lipid accumulation need further elucidation. Methods In this study, the NCTC 1469 cells induced by oleic acid (OA) and palmitic acid (PA) were used in the establishment of the NAFLD cell model. Triglyceride (TG) kits and BODIPY 493/503 staining were employed to measure the levels of hepatocyte lipid accumulation. Immunoprecipitation, western blotting, and real-time PCR analyzed the expression of protein and mRNA in the fatty acid oxidation (FAO) and de novo lipogenesis (DNL) pathways. Results The results indicated that increasing concentrations of GluOC resulted in reduced intracellular lipid accumulation and triglyceride levels. GluOC promoted sirtuin1 (SIRT1) expression, inhibited acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FASN) expression, promoted medium-chain acyl-CoA dehydrogenase (MCAD) and long-chain acyl-CoA dehydrogenase (LCAD) expression. In addition, GluOC activated AMPK phosphorylation and peroxisome proliferator activated receptor γ coactivator-1 α (PGC-1α) deacetylation. si-SIRT1 attenuated the above effects of GluOC, resulting in hepatocyte lipid accumulation. Conclusion GluOC inhibited DNL via SIRT1-AMPK and promoted FAO via SIRT1-PGC-1α to alleviate lipid accumulation in hepatocytes. This provides new insights for further research in NAFLD.
Full text 110,928 characters · extracted from preprint-html · click to expand
Uncarboxylated Osteocalcin Inhibits De Novo Lipogenesis and Promotes Fatty Acid Oxidation via SIRT1 to Alleviate Hepatocyte Lipid Accumulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Uncarboxylated Osteocalcin Inhibits De Novo Lipogenesis and Promotes Fatty Acid Oxidation via SIRT1 to Alleviate Hepatocyte Lipid Accumulation Lei Chen, Miao Zhang, Jiaojiao Xu, Jianhong Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3856420/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Non-alcoholic fatty liver disease (NAFLD) is a disease characterized by the hepatic lipids accumulation resulting from genetic susceptibility and metabolic dysfunction. Uncarboxylated osteocalcin (GluOC) is a protein that is synthesized by osteoblasts which performs a vital function in the management of energy balance. Previous studies have shown that GluOC is beneficial for lipid and glucose metabolism in KKAy mice induced fatty liver. GluOC effectively ameliorates hyperglycemia, fatty liver, and hyperlipidemia. Furthermore, it regulates stearyl-coenzyme A desaturase 1 (SCD1) expression through AMP-activated protein kinase (AMPK), which alleviates hepatocyte lipid accumulation. However, the underlying mechanisms by which GluOC alleviates hepatocyte lipid accumulation need further elucidation. Methods In this study, the NCTC 1469 cells induced by oleic acid (OA) and palmitic acid (PA) were used in the establishment of the NAFLD cell model. Triglyceride (TG) kits and BODIPY 493/503 staining were employed to measure the levels of hepatocyte lipid accumulation. Immunoprecipitation, western blotting, and real-time PCR analyzed the expression of protein and mRNA in the fatty acid oxidation (FAO) and de novo lipogenesis (DNL) pathways. Results The results indicated that increasing concentrations of GluOC resulted in reduced intracellular lipid accumulation and triglyceride levels. GluOC promoted sirtuin1 (SIRT1) expression, inhibited acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FASN) expression, promoted medium-chain acyl-CoA dehydrogenase (MCAD) and long-chain acyl-CoA dehydrogenase (LCAD) expression. In addition, GluOC activated AMPK phosphorylation and peroxisome proliferator activated receptor γ coactivator-1 α (PGC-1α) deacetylation. si-SIRT1 attenuated the above effects of GluOC, resulting in hepatocyte lipid accumulation. Conclusion GluOC inhibited DNL via SIRT1-AMPK and promoted FAO via SIRT1-PGC-1α to alleviate lipid accumulation in hepatocytes. This provides new insights for further research in NAFLD. uncarboxylated osteocalcin lipid accumulation Sirt1 DNL FAO Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is connected to genetic susceptibility and metabolic dysfunction, and the disease spectrum includes hepatic steatosis, nonalcoholic steatohepatitis, hepatocirrhosis and hepatocarcinogen[ 1 ]. The prevalence of NAFLD worldwide was 32.4% with an increasing prevalence over time (25.5% before 2005 and 37.8% after 2016). (25.5% before 2005 and 37.8% after 2016). The prevalence of male (39.7%) was higher than that of female (25.6%)[ 2 ]. Common risk factors for NAFLD include diabetes, insulin resistance, obesity, genetic factors, high fat diet, sarcopenia and sedentary lifestyle[ 3 ]. Studies have shown that NAFLD is present in 47.3%-63.7% of patients with diabetes and 80% of obese individuals[ 4 ]. As a chronic hepatic disease, in NAFLD early stages, it is associated with disorders of energy metabolism, especially lipid metabolism[ 5 ]. In normal conditions, lipid uptake and output in the liver are balanced, which is regulated by four major pathways: fatty acid oxidation (FAO), Very low density lipoproteins (VLDL) transport endogenous triglycerides, fatty acid uptake and de novo lipogenesis (DNL). However, in pathological conditions, excess energy entering the liver accumulates as triglycerides in hepatocytes, ultimately causing NAFLD[ 6 ]. In NAFLD, hepatic DNL and fatty acid uptake are increased, whereas compensatory enhanced FAO is insufficient to normalize lipid balance and may potentially contribute to cell damage and disease progression through the induction of oxidative stress[ 7 ]. To date, intervention-mediated weight loss has been the primary recommended treatment for NAFLD[ 8 ]. Hence, the identification of effective therapeutic methods is urgently required. Uncarboxylated osteocalcin (GluOC) is a non-collagenous acid glycoprotein composed of 46–50 amino acids[ 9 ]. It functions as a vitamin K-dependent calcium-binding protein[ 10 ]. GluOC is primarily synthesized by osteoblasts and odontoblasts, with additional production by proliferating chondrocytes and it plays a crucial role bone calcium metabolism and regulates glucose and lipid metabolism[ 11 – 14 ]. GluOC has been shown to have an important regulatory effect on lipid metabolism, and in vivo experiments have shown that intermittent oral GluOC can decrease the white adipocytes size of mice[ 15 ]. Another animal experiment also demonstrated that GluOC was injected intraperitoneally into mice for 14 weeks, improving insulin sensitivity as well as glucose tolerance, and reversing hepatic steatosis[ 16 ]. Previous studies in our laboratory have demonstrated that GluOC effectively suppresses DNL by activating AMPK in OA/PA-induced hepatocytes[ 17 ]. Although numerous studies have indicated that GluOC might be a potential drug, current understanding of GluOC in hepatic lipid metabolism remains at an exploratory stage, there is a lack of research on the regulation of GluOC on FAO and the underlying mechanisms of GluOC in alleviating NAFLD still need to be more deeply studied. The mediation of SIRT1 in lipid metabolism of livers has been demonstrated in recent studies, and SIRT1 expression negatively correlates with developing NAFLD[ 18 , 19 ]. SIRT1 as NAD-dependent sirtuin-1 or nicotinamide adenine dinucleotide (NAD+) deacetylase, is highly conserved and involved in key processes related to hepatic fatty acid oxidation and synthesis[ 20 , 21 ]. One study has shown that obese patients with hepatic steatosis had lower serum SIRT1 levels than mild steatosis, in addition to, the steatosis patients in both groups had lower serum SIRT1 levels than lean individuals[ 18 ]. The expression of SIRT1 protein exhibited a significant decrease in rats, mice, and in cultures hepatocytes by a high-fat induced diet[ 22 , 23 ]. Furthermore, knockout of the liver-specific SIRT1 gene in mice resulted in enhanced inflammation, endoplasmic reticulum stress and hepatic steatosis[ 24 ], which confirming the important involvement of SIRT1 in improving lipid metabolism of hepatic. However, further studies are essential to resolve whether SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism. AMP-activated protein kinase (AMPK) participates in numerous metabolic processes in the body, maintains systemic energy balance under various stress conditions and regulating hepatic lipid metabolism[ 25 ]. Its phosphorylation at Thr172 is necessary to regulate lipid metabolism[ 26 ]. A study has shown that AMPK regulates acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FASN) expression in DNL through sterol regulatory element binding protein-1c (SREBP-1c)[ 27 ]. Another study has shown that AMPK can also directly phosphorylate ACC and regulate its activity[ 28 ]. Some studies have shown that SIRT1 has benefits for lipid metabolism through reducing fatty acid chain synthesis via SIRT1/AMPK pathway in hepatocytes[ 20 , 22 – 24 , 29 ]. However, it has not been shown whether the SIRT1/AMPK pathway mediates mechanisms of GluOC-regulated lipid metabolism. Peroxisome proliferator activated receptor γ coactivator-1 α (PGC-1α) is a direct downstream target of SIRT1 that enhances FAO[ 30 , 31 ]. And as a transcriptional coactivator, PGC-1α promotes the target genes expression of mitochondrial oxidative metabolism, which include medium-chain acyl-CoA dehydrogenase (MCAD) and long-chain acyl-CoA dehydrogenase (LCAD) expression, which are the major enzymes involved in FAO[ 32 – 37 ]. The latest studies have demonstrated that SIRT1 activation facilitates PGC-1α deacetylation, promotes gene transcription that regulates mitochondrial biogenesis and FAO to maintain energy metabolic homeostasis[ 38 – 40 ]. Under high fat conditions, SIRT1 can modulate various intracellular homeostasis via modulation of mitochondrial function and lipid autophagy through PGC-1α[ 41 ]. These evidences suggest that SIRT1/PGC-1α pathway is critical in regulating NAFLD. However, it has not been shown whether the SIRT1/PGC-1α pathway mediates the lipid metabolism mechanisms regulated by GluOC. In this study, a series of experiments were designed to comprehensively describe the potential involvement of SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism and to investigate the mechanism underlying GluOC supplementation to improve lipid metabolism. This study first demonstrated that SIRT1 mediates the GluOC mechanism in alleviating hepatocyte lipid accumulation. GluOC inhibits DNL via SIRT1-AMPK pathway and promotes FAO via SIRT1-PGC-1α pathway. 2. Materials and Methods 2.1. Antibodies and Reagents Compound C was from Selleck (Houston, USA). BODIPY 493/503 and PGC1α inhibitor SR-18292 were from MCE (NJ, USA). Protein A + G agarose was from Lablead Biotech (Beijing, China). Mouse IgG was from Beyotime (Shanghai, China). Antibodies against SIRT1, FASN, AMPKα, and Phospho-AMPKα1 were from Cell Signaling Technology (Danvers, USA). LCAD, MCAD, PGC-1α and ACC, antibodies were from Proteintech Group (Chicago, USA). Anti-Acetyllysine Mouse mAb was from PTM bio (Hangzhou, China). GluOC utilized in the experiments was acquired by prokaryotic expression in our laboratory. 2.2. Cell Culture The NCTC 1469 cells (Procell Life Science & Technology, Wuhan, China) were cultivated in DMEM medium. Cells were induced for 12h in medium containing oleic acid (OA) (0.125mM) and palmitic acid (PA) (0.25mM) before being subjected to GluOC treatment 24 hours. Based on the experimental results, a concentration of 12 ng/mL of GluOC was selected as the experimental concentration. For siRNA transfection experiments, transfection was performed when the fusion rate reached 80% and the hepatocytes were cultured in Opti-MEM medium. And induced with OA/PA for 12 h followed by GluOC for 24 h. In inhibitor experiments, inhibitors were added when the fusion rate reached 80% and induced with OA/PA for 12 h and followed by GluOC treatment. 2.3. Cell Staining The coverslips were gently agitated in PBS for 30 seconds each, with three repetitions, then immersed in 4% paraformaldehyde solution (Leagene, Beijing, China) for 30 minutes. Afterwards, incubated with 1µM BODIPY 493/503 stain at 25℃ for 10 minutes, and the coverslips were gently agitated in PBS after staining. Finally, the fluorescence microscope (Leica Microsystems, Wetzlar, Germany) was used to capture images. 2.4. Measurement of the Triacylglycerol (TG) Level TG reagent kit was employed to measure the levels of hepatocyte lipid accumulation and was purchased from Applygen Technologics Inc (Beijing, China). The processing was performed according to the protocol from the manufacturer. 2.5. Transfection Assay The fragments si-SIRT1 sequences (Sangon, Shanghai, China) were the following: siRNA-SIRT1 sense: 5’-GAAGUUGACCUCCUCAUUGU-3’; Negative control siRNA sense: 5’-UUCUCCGAACGUGUCACGUTT-3’. The Hieff TransTM Liposomal Transfection Reagent was purchased from Yeasen (Shanghai, China). The opti-MEM was from Gibco (Carlsbad, CA, USA). Hieff TransTM was incubated with mixed opti-MEM for 5 min and then siRNA was added. After cultivation for 20 minutes at 25℃, the mixed solution was added, incubated for 24 hours in a CO2 incubator before various subsequent treatments. Ultimately, cells were harvested for subsequent analysis. 2.6. Reverse Transcription–Quantitative PCR The trizol was purchased from Biosharp Biotech (Beijing, China) used to extract total RNA. The Hifair Ⅲ 1st Strand cDNA Synthesis SuperMix was used to reverse transcribe 1µg RNA to cDNA purchased from Yeasen Biotech (Shanghai, China). TransStart Top Green qPCR SuperMix(+ Dye II) was used to perform qPCR from TransGen Biotech (Beijing, China). The β-actin as the internal standard gene was used to standardize the detection data. The primer sequences as shown in Table 1 . Table 1 Primers for real-time PCR Gene Species Forward Primer (5’→3’) Reverse Primer (5’→3’) Sirt1 Mouse TGATTGGCACCGATCCTCG CCACAGCGTCATATCATCCAG FASN Mouse GGTGTGGTGGGTTTGGTGAATTGT TCACGAGGTCATGCTTTAGCACCT ACC Mouse CTCCCGATTCATAATTGGGTCTG TCGACCTTGTTTTACTAGGTGC MCAD Mouse AACACAACACTCGAAAGCGG TTCTGCTGTTCCGTCAACTCA LCAD Mouse TTTCCTCGGAGCATGACATTTT GCCAGCTTTTTCCCAGACCT β-actin Mouse GATCTGGCACCACACCTTCT GGGGTGTTGAAGGTCTCAAA 2.7. Western Blotting Assay The prepared samples were loaded according to the amount of 30µg protein per lane, followed by separation on 10% SDS-PAGE gels. Membranes were placed in specific primary antibodies and incubated for 10 h at 4℃, then secondary antibodies at 25°C for 1.5 h. ECL kit (BioRad Hercules, USA) was used to visualize the target proteins. To quantify the levels of protein expression, phospho-protein bands and acetylated protein bands were normalized to their respective total protein levels and β-actin was applied to normalize the intensity of the bands. Densitometric analysis performed with ImageJ version 6 software. 2.8. Immunoprecipitation (IP) Cell lysate was used to lyse cells, and appropriate amounts of protein samples were then added to plain IgG of the same species used in immunoprecipitation and sufficiently resuspended using protein A + G agarose. The mixture was gently shaken for 30 minutes at 4°C and then centrifuged for 5 minutes to collect the supernatant for subsequent immunoprecipitation experiments. Primary antibodies for immunoprecipitation were added and incubated overnight with slow shaking at 4°C. Pre-resuspended protein A + G agarose was added, gently shaken for 1 h, and then centrifuged. After centrifugation, the samples were slowly removed, the supernatant was carefully removed to avoid removal of the precipitate, and the PBS was used to wash the samples five times (each time using a volume of 1 mL). After the final wash, the supernatant was discarded, and 5×SDS-PAGE electrophoresis loading buffer was added to re-suspend and vortex the resulting pellet. Samples were then subjected to high-speed centrifugation to sediment them at the bottom of the tube. Some or all samples were collected after immersion in a metal bath for 5 minutes at a temperature of 100°C for subsequent SDS-PAGE electrophoresis. 2.9. Statistical Analysis GraphPad Prism version 9.0 was used to perform statistical analysis, one-way ANOVA and two-tailed Student’s t-test was used to analyze. All data are presented as mean ± SD of at least three independent replicates, and statistical significance was defined as P < 0.05. 3. Result 3.1. GluOC Inhibits Hepatocyte Lipid Accumulation To clarify the role of GluOC in lipid accumulation, the lipid droplet fluorescent dye (BODIPY 493/503) was employed to measure the change of hepatocyte lipid levels after GluOC treatment. Different concentrations of GluOC (0,4,8,12 ng/mL) were added after 12 h of treatment with OA/PA, lipid accumulation in hepatocytes was detected by dyeing after 24 h. Lipid droplet accumulation was more significant in cells after OA/PA induction. Indicating that the lipid accumulation model was successfully established (Fig. 1 a,b). The lipid accumulation of NCTC 1469 cells exhibited a dose-dependent decrease with increasing GluOC concentrations (0, 4, 8, 12 ng/mL), and the most significant inhibition of lipid accumulation was observed at a concentration of 12 ng/mL. These findings indicated that GluOC could inhibit the OA/PA-induced lipid metabolism in NCTC 1469 cells. 3.2. GluOC Inhibits Hepatocytes Lipid Accumulation by Promoting FAO and Inhibiting DNL To clarify the mechanistic role of GluOC in lipid accumulation, an intervention with 12 ng/mL of GluOC, the following experiments was designed. As shown in Fig. 2 a-j, the results demonstrated that GluOC could enhances the expression of MCAD and LCAD, while suppressing ACC and FASN expression, compared with the OA/PA group. This indicated that GluOC could inhibit fatty acid DNL and promote FAO. 3.3. GluOC Inhibits Hepatocyte Lipid Accumulation via SIRT1 In the present study, to demonstrate whether SIRT1 is involved in the mechanism of GluOC-induced lipid metabolism, the following experiments was designed. As shown in Fig. 3 a-c, the OA/PA induction inhibited SIRT1 expression, and GluOC treatment significantly promoted SIRT1 expression, indicating that GluOC improved SIRT1 expression in the high-fat condition. To further investigate the mechanism of SIRT1, the Hieff Trans liposomal nucleic acid transfection reagent was first used to transfect siRNA and inhibit SIRT1 expression. The results demonstrated that mRNA levels were inhibited in the siRNA group, as shown in Fig. 3 d. Subsequently, whether the SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism was investigated. As shown in Fig. 3 e, TG levels were significantly increased under OA/PA-induced conditions and decreased after GluOC treatment, and knockdown of SIRT1 attenuated the effects of GluOC. And the results of the BODIPY 493/503 staining assay were consistent with those of TG (Fig. 3 f,g). This study demonstrated that SIRT1 mediates the key mechanism of GluOC in improving hepatocyte lipid metabolism. 3.4. GluOC Promotes FAO and Inhibits DNL via SIRT1 To demonstrate whether SIRT1 is involved in the mechanism of GluOC-induced FAO and DNL, the following experiments was designed. As shown in Fig. 4 a-e, GluOC treatment promoted the protein and mRNA expression of LCAD and MCAD, and the effect of GluOC was attenuated after SIRT1 knockdown, under OA/PA induction. As shown in Fig. 4 f-j, GluOC treatment inhibited the expression of ACC and FASN, and the effect of GluOC was attenuated after SIRT1 knockdown. The present results showed that GluOC promoted FAO and inhibited DNL via SIRT1. 3.5. GluOC Reduces the FASN and ACC Expression by Activating AMPK (Thr172) Phosphorylation via SIRT1. To verified whether SIRT1 knockdown affects p-AMPK (Thr172) expression, the following experiments was designed. As shown in Fig. 5 a,b, GluOC treatment promoted the p-AMPK expression, and the effect of GluOC was attenuated after SIRT1 knockdown, suggesting that GluOC promotes the AMPK phosphorylation via SIRT1. GluOC activates the SIRT1/AMPK pathway by upregulating SIRT1 levels, which may be one of the important mechanisms by which GluOC inhibits lipid accumulation. To further verify whether GluOC inhibits DNL via the SIRT1/p-AMPK pathway, we performed experiments with the AMPK activation inhibitor Compound C (CC). The p-AMPK (Thr172), AMPK, FASN and ACC protein expression were detected. As shown in Fig. 5 c,d, GluOC treatment promoted AMPK phosphorylation, and the effect of GluOC was attenuated by the addition of compound C. Subsequently, the ACC and FASN protein expression was examined. As shown in Fig. 5 e-h, GluOC treatment inhibited the ACC and FASN protein expression, and this effect was attenuated by the addition of compound C, indicating that AMPK activation was a critical step when GluOC inhibited DNL. According to the above results, GluOC reduces the expression of FASN and ACC by activating SIRT1/AMPK pathway. This demonstrates that SIRT1/AMPK is a key pathway in GluOC inhibition of DNL. 3.6. GluOC Enhances the MCAD and LCAD Expression by Upregulating PGC-1α Deacetylation via SIRT1. To verified whether SIRT1 knockdown affects acetylated PGC-1α expression, the following experiments was designed. As showed in Fig. 6 a,b, GluOC treatment inhibited the acetylated of PGC-1α, and the effect of GluOC was attenuated after SIRT1 knockdown, indicating that GluOC promotes PGC-1α deacetylation via SIRT1. GluOC activates the SIRT1/PGC-1α pathway by upregulating SIRT1 levels, which may be one of the important mechanisms by which GluOC inhibits lipid accumulation. To further verify whether GluOC promotes FAO via the SIRT1/PGC-1α pathway, we performed experiments using PGC-1α inhibitor SR-18292 (SR). GluOC treatment inhibited the acetylated of PGC-1α, the effect of GluOC was attenuated by the addition of SR-18292 (Fig. 6 c,d). Subsequently, the MCAD and LCAD protein expression was examined. As shown in Fig. 6 e-h, GluOC treatment promoted the MCAD and LCAD protein expression, and the effect of GluOC was attenuated by the addition of SR-18292, indicating that PGC-1α deacetylation was a critical step when GluOC promoted FAO. According to the above results, GluOC upregulates the expression of MCAD and LCAD by promoting PGC-1α deacetylation via SIRT1. 4. Discussion This study used OA/PA-induced NCTC1469 cells as a model for NAFLD. GluOC inhibited intracellular lipid accumulation and upregulated SIRT1 expression in hepatocytes. GluOC inhibited DNL by activating AMPK (Thr172) phosphorylation via SIRT1 and promoted FAO by up-regulating PGC-1α deacetylation via SIRT1 (Fig. 7 ). GluOC reduces hepatocyte lipid accumulation via SIRT1/AMPK and SIRT1/PGC1α pathways. Over the past years, NAFLD prevalence has increased, and this condition results in a serious influence and challenge to human health[ 42 ]. The liver can maintain a number of physiological processes in the body and is the regulatory center for maintaining the balance of lipid metabolism[ 43 ]. The disruption between lipid acquisition and removal leads to hepatic steatosis[ 5 , 44 ]. The processes involved in hepatic lipid input and output are tightly regulated by complex interactions between various crucial proteins to maintain strict control over hepatic lipid homeostasis, and disruption of these pathways can cause hepatic lipid accumulation and subsequent development of NAFLD[ 45 ]. Naturally, reducing hepatocytes lipid accumulation could alleviate NAFLD symptoms. In this study, NAFLD cell model was established using OA/PA treatment on NCTC 1469 cells. Hepatocytes were stained with BODIPY 493/503 and images were obtained by fluorescence microscopy. The results demonstrate significant hepatocyte lipid accumulation after 12 hours of OA/PA treatment (Fig. 1 ). GluOC, a small molecule protein, functions as an endocrine hormone that can enter the bloodstream[ 46 ]. The potential of GluOC to improve hyperglycemia symptoms in KKAy mice has been demonstrated in previous studies in our laboratory, as well as ameliorate fatty liver and hypertriglyceridemia by inhibiting DNL and promoting FAO[ 47 ]. The present study demonstrated that GluOC improved lipid metabolism induced by OA/PA and reduced intracellular lipid accumulation by promoting FAO as well as inhibiting DNL (Fig. 1 ). Therefore, GluOC is a new and very promising drug for the therapeutic treatment of NAFLD, and investigation into its underlying mechanism of GluOC in the reduction of hepatocyte lipid accumulation will impact positively on the quality of life for patients with NAFLD. SIRT1 is essential for hepatic homeostasis as well as the development of hepatic lipid accumulation[ 48 ]. Recent evidence has shown a decreased expression of several sirtuins, including SIRT1, in patients with NAFLD compared with controls[ 49 ]. Additionally, this finding has been supported by various experiments conducted in vivo and in vitro, with hepatic-specific SIRT1 knockout mice resulting in enhanced hepatic lipid accumulation, ultimately resulting in hepatic steatosis on a standard diet[ 50 , 51 ]. Showing significant decreases in SIRT1 protein expression levels induced by high-fat diets or cultured hepatocytes[ 52 ]. Additionally, overexpression of SIRT1 ameliorated HFD-induced hepatic steatosis by promoting energy expenditure, improving glucose tolerance, and reducing triglyceride accumulation, thereby demonstrating the SIRT1's critical role in improving hepatocyte lipid metabolism[ 53 ]. This study demonstrated that NCTC 1469 cells induced by OA/PA exhibited decreased expression of SIRT1, which was reversed by GluOC treatment. Furthermore, knockdown of SIRT1 attenuated the function of GluOC in decreasing hepatocyte lipid accumulation, demonstrating SIRT1 is mediated in alleviating lipid accumulation effect of GluOC. AMPK maintains energy balance by regulating anabolism and catabolism and regulates hepatic lipid and glucose metabolism[ 54 , 55 ]. SIRT1 activity is correlated with AMPK, and SIRT1 has also been demonstrated to modulate AMPK activation in NAFLD[ 20 , 56 ]. Previous studies have shown that GluOC effectively suppresses DNL by activating AMPK in OA/PA-induced hepatocytes[ 17 ]. This study indicated that GluOC promoted p-AMPK expression while inhibiting the ACC and FASN expression. The function of GluOC was attenuated by SIRT1 knockdown, and the FASN and ACC expression increased after treatment with the AMPK inhibitor Compound C. Therefore, it can be concluded that GluOC inhibit DNL through the SIRT1/AMPK signalling pathway, thereby alleviating lipid accumulation in hepatocytes. SIRT1 acts as a deacetylase that targets PGC-1α[ 57 , 58 ]. PGC-1α facilitates the transport and utilization of fatty acids, including medium, long and very long chain fatty acids by promoting target genes expression, as a transcriptional coactivator, thereby improving fatty acid oxidation[ 32 – 34 ]. The present study suggests that GluOC treatment significantly reduces the acetylation level of PGC1α while increasing expression of the FAO enzymes MCAD and LCAD. However, knockdown of SIRT1 attenuates this effect. Moreover, the results indicate that inhibition of PGC1α with SR18292 leads to a reduction in the expression of LCAD and MCAD. In conclusion, GluOC may reduce hepatic lipid accumulation via SIRT1/PGC1α signaling pathway to enhance FAO. Therefore, GluOC is a promising drug with great potential for further study. At the same time, this study has limitations, and the vivo experiments are required to verify the safety and effectiveness of GluOC. 5. Conclusions Over the past years, NAFLD prevalence has increased, and new drug research is extremely urgent for the increasing population of sufferers. In the present study, GluOC reduced hepatocyte lipid accumulation through both pathways simultaneously. GluOC inhibited the DNL by activating the phosphorylation of AMPK (Thr172) and promoted FAO by activating PGC-1α deacetylation via SIRT1. In summary, the present study indicates that GluOC could significantly reduce hepatocyte lipid accumulation through SIRT1, and SIRT1 as a key target of GluOC, plays a pivotal role in mitigating hepatocyte lipid accumulation. This suggests GluOC is a novel drug candidate for NAFLD, which provides a positive significance for the improvement of patients' quality of life in clinical practice. Declarations Acknowledgements : Not applicable Authors’ information: Medical School, University of Chinese Academy of Sciences, Beijing, China. Lei Chen ( [email protected] ), Miao Zhang ( [email protected] ), Jiaojiao Xu ( [email protected] ) and Jianhong Yang* ( [email protected] ) * Correspondence: [email protected] Authors' contributions : L.C., M.Z., J.X. and J.Y. contributed to Provide ideas. L.C., M.Z. design for the entire experiment. L.C. accomplished the experiments and wrote this manuscript. L.C., M.Z., J.X. and J.Y. were responsible for modifying the manuscript. All authors have read and approved the final manuscript. Funding : Fundamental Research Funds for the Central Universities (Grant No. E2E43202X2). Availability of data and materials : The data presented in this study are available on request from the corresponding author. Ethics approval and consent to participate : Not applicable Consent for publication : Not applicable Competing interests : The authors declare no conflict of interest. References Fan JG, Wei L, Zhuang H. Guidelines of prevention and treatment of nonalcoholic fatty liver disease (2018, China). J Dig Dis. 2019;20(4):163–73. Riazi K, Azhari H, Charette JH, Underwood FE, King JA, Afshar EE, Swain MG, Congly SE, Kaplan GG, Shaheen AA. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2022;7(9):851–61. Fan JG, Kim SU, Wong VW. New trends on obesity and NAFLD in Asia. J Hepatol. 2017;67(4):862–73. Powell EE, Wong VW, Rinella M. Non-alcoholic fatty liver disease. Lancet. 2021;397(10290):2212–24. Loomba R, Friedman SL, Shulman GI. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell. 2021;184(10):2537–64. Badmus OO, Hillhouse SA, Anderson CD, Hinds TD, Stec DE. Molecular mechanisms of metabolic associated fatty liver disease (MAFLD): functional analysis of lipid metabolism pathways. Clin Sci (Lond). 2022;136(18):1347–66. Townsend SA, Newsome PN. Non-alcoholic fatty liver disease in 2016. Br Med Bull. 2016;119(1):143–56. Pouwels S, Sakran N, Graham Y, Leal A, Pintar T, Yang W, Kassir R, Singhal R, Mahawar K, Ramnarain D. Non-alcoholic fatty liver disease (NAFLD): a review of pathophysiology, clinical management and effects of weight loss. BMC Endocr Disord. 2022;22(1):63. Hauschka PV, Lian JB, Cole DE, Gundberg CM. Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev. 1989;69(3):990–1047. Hauschka PV, Carr SA. Calcium-dependent alpha-helical structure in osteocalcin. Biochemistry. 1982;21(10):2538–47. Lee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin R, Mee PJ, McKee MD, Jung DY, et al. Endocrine regulation of energy metabolism by the skeleton. Cell. 2007;130(3):456–69. Dirckx N, Moorer MC, Clemens TL, Riddle RC. The role of osteoblasts in energy homeostasis. Nat Rev Endocrinol. 2019;15(11):651–65. Yasutake Y, Mizokami A, Kawakubo-Yasukochi T, Chishaki S, Takahashi I, Takeuchi H, Hirata M. Long-term oral administration of osteocalcin induces insulin resistance in male mice fed a high-fat, high-sucrose diet. Am J Physiol Endocrinol Metab. 2016;310(8):E662–75. Ferron M, Hinoi E, Karsenty G, Ducy P. Osteocalcin differentially regulates beta cell and adipocyte gene expression and affects the development of metabolic diseases in wild-type mice. Proc Natl Acad Sci U S A. 2008;105(13):5266–70. Otani T, Mizokami A, Hayashi Y, Gao J, Mori Y, Nakamura S, Takeuchi H, Hirata M. Signaling pathway for adiponectin expression in adipocytes by osteocalcin. Cell Signal. 2015;27(3):532–44. Ferron M, McKee MD, Levine RL, Ducy P, Karsenty G. Intermittent injections of osteocalcin improve glucose metabolism and prevent type 2 diabetes in mice. Bone. 2012;50(2):568–75. Wang D, Zhang M, Xu J, Yang J. Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation. Molecules. 2023;28(7). Mariani S, Fiore D, Basciani S, Persichetti A, Contini S, Lubrano C, Salvatori L, Lenzi A, Gnessi L. Plasma levels of SIRT1 associate with non-alcoholic fatty liver disease in obese patients. Endocrine. 2015;49(3):711–6. Guo Y, Li JX, Mao TY, Zhao WH, Liu LJ, Wang YL. Targeting Sirt1 in a rat model of high-fat diet-induced non-alcoholic fatty liver disease: Comparison of Gegen Qinlian decoction and resveratrol. Exp Ther Med. 2017;14(5):4279–87. Li J, Liu M, Yu H, Wang W, Han L, Chen Q, Ruan J, Wen S, Zhang Y, Wang T. Mangiferin Improves Hepatic Lipid Metabolism Mainly Through Its Metabolite-Norathyriol by Modulating SIRT-1/AMPK/SREBP-1c Signaling. Front Pharmacol. 2018;9:201. Khader A, Yang WL, Godwin A, Prince JM, Nicastro JM, Coppa GF, Wang P. Sirtuin 1 Stimulation Attenuates Ischemic Liver Injury and Enhances Mitochondrial Recovery and Autophagy. Crit Care Med. 2016;44(8):e651–663. Deng XQ, Chen LL, Li NX. The expression of SIRT1 in nonalcoholic fatty liver disease induced by high-fat diet in rats. Liver Int. 2007;27(5):708–15. Liou CJ, Lee YK, Ting NC, Chen YL, Shen SC, Wu SJ, Huang WC. Protective Effects of Licochalcone A Ameliorates Obesity and Non-Alcoholic Fatty Liver Disease Via Promotion of the Sirt-1/AMPK Pathway in Mice Fed a High-Fat Diet. Cells. 2019;8(5). Yang Y, Li W, Liu Y, Sun Y, Li Y, Yao Q, Li J, Zhang Q, Gao Y, Gao L, et al. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway. J Nutr Biochem. 2014;25(11):1207–17. Garcia D, Hellberg K, Chaix A, Wallace M, Herzig S, Badur MG, Lin T, Shokhirev MN, Pinto AFM, Ross DS, et al. Genetic Liver-Specific AMPK Activation Protects against Diet-Induced Obesity and NAFLD. Cell Rep. 2019;26(1):192–208e196. Wang Q, Liu S, Zhai A, Zhang B, Tian G. AMPK-Mediated Regulation of Lipid Metabolism by Phosphorylation. Biol Pharm Bull. 2018;41(7):985–93. Li Y, Xu S, Mihaylova MM, Zheng B, Hou X, Jiang B, Park O, Luo Z, Lefai E, Shyy JY, et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011;13(4):376–88. Scott JW, Norman DG, Hawley SA, Kontogiannis L, Hardie DG. Protein kinase substrate recognition studied using the recombinant catalytic domain of AMP-activated protein kinase and a model substrate. J Mol Biol. 2002;317(2):309–23. Sharma A, Anand SK, Singh N, Dwarkanath A, Dwivedi UN, Kakkar P. Berbamine induced activation of the SIRT1/LKB1/AMPK signaling axis attenuates the development of hepatic steatosis in high-fat diet-induced NAFLD rats. Food Funct. 2021;12(2):892–909. Miller KN, Clark JP, Anderson RM. Mitochondrial regulator PGC-1a-Modulating the modulator. Curr Opin Endocr Metab Res. 2019;5:37–44. Zou P, Liu L, Zheng LD, Payne KK, Manjili MH, Idowu MO, Zhang J, Schmelz EM, Cheng Z. Coordinated Upregulation of Mitochondrial Biogenesis and Autophagy in Breast Cancer Cells: The Role of Dynamin Related Protein-1 and Implication for Breast Cancer Treatment. Oxid Med Cell Longev. 2016;2016:4085727. Huss JM, Kopp RP, Kelly DP. Peroxisome proliferator-activated receptor coactivator-1alpha (PGC-1alpha) coactivates the cardiac-enriched nuclear receptors estrogen-related receptor-alpha and -gamma. Identification of novel leucine-rich interaction motif within PGC-1alpha. J Biol Chem. 2002;277(43):40265–74. Cheng CF, Ku HC, Lin H. PGC-1α as a Pivotal Factor in Lipid and Metabolic Regulation. Int J Mol Sci. 2018;19(11). Purushotham A, Schug TT, Xu Q, Surapureddi S, Guo X, Li X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab. 2009;9(4):327–38. Espinoza DO, Boros LG, Crunkhorn S, Gami H, Patti ME. Dual modulation of both lipid oxidation and synthesis by peroxisome proliferator-activated receptor-gamma coactivator-1alpha and – 1beta in cultured myotubes. FASEB J. 2010;24(4):1003–14. Zhang H. HIF-1 suppresses lipid catabolism to promote cancer progression. Mol Cell Oncol. 2015;2(4):e980184. Du D, Liu C, Qin M, Zhang X, Xi T, Yuan S, Hao H, Xiong J. Metabolic dysregulation and emerging therapeutical targets for hepatocellular carcinoma. Acta Pharm Sin B. 2022;12(2):558–80. Nemoto S, Fergusson MM, Finkel T. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1{alpha}. J Biol Chem. 2005;280(16):16456–60. Yang M, Cui Y, Song J, Cui C, Wang L, Liang K, Wang C, Sha S, He Q, Hu H, et al. Mesenchymal stem cell-conditioned medium improved mitochondrial function and alleviated inflammation and apoptosis in non-alcoholic fatty liver disease by regulating SIRT1. Biochem Biophys Res Commun. 2021;546:74–82. Li X. SIRT1 and energy metabolism. Acta Biochim Biophys Sin (Shanghai). 2013;45(1):51–60. Jiang Y, Chen D, Gong Q, Xu Q, Pan D, Lu F, Tang Q. Elucidation of SIRT-1/PGC-1α-associated mitochondrial dysfunction and autophagy in nonalcoholic fatty liver disease. Lipids Health Dis. 2021;20(1):40. Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology. 2016;64(1):73–84. Trefts E, Gannon M, Wasserman DH. The liver. Curr Biol. 2017;27(21):R1147–51. Petersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, DePaoli AM, Taylor SI, Gorden P, et al. Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest. 2002;109(10):1345–50. Ipsen DH, Lykkesfeldt J, Tveden-Nyborg P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol Life Sci. 2018;75(18):3313–27. Zeng H, Ge J, Xu W, Ma H, Chen L, Xia M, Pan B, Lin H, Wang S, Gao X. Type 2 Diabetes Is Causally Associated With Reduced Serum Osteocalcin: A Genomewide Association and Mendelian Randomization Study. J Bone Min Res. 2021;36(9):1694–707. Zhang XL, Wang YN, Ma LY, Liu ZS, Ye F, Yang JH. Uncarboxylated osteocalcin ameliorates hepatic glucose and lipid metabolism in KKAy mice via activating insulin signaling pathway. Acta Pharmacol Sin. 2020;41(3):383–93. Colak Y, Yesil A, Mutlu HH, Caklili OT, Ulasoglu C, Senates E, Takir M, Kostek O, Yilmaz Y, Yilmaz Enc F, et al. A potential treatment of non-alcoholic fatty liver disease with SIRT1 activators. J Gastrointestin Liver Dis. 2014;23(3):311–9. Wu T, Liu YH, Fu YC, Liu XM, Zhou XH. Direct evidence of sirtuin downregulation in the liver of non-alcoholic fatty liver disease patients. Ann Clin Lab Sci. 2014;44(4):410–8. Rodgers JT, Puigserver P. Fasting-dependent glucose and lipid metabolic response through hepatic sirtuin 1. Proc Natl Acad Sci U S A. 2007;104(31):12861–6. Wang RH, Li C, Deng CX. Liver steatosis and increased ChREBP expression in mice carrying a liver specific SIRT1 null mutation under a normal feeding condition. Int J Biol Sci. 2010;6(7):682–90. Caron AZ, He X, Mottawea W, Seifert EL, Jardine K, Dewar-Darch D, Cron GO, Harper ME, Stintzi A, McBurney MW. The SIRT1 deacetylase protects mice against the symptoms of metabolic syndrome. Faseb j. 2014;28(3):1306–16. Pfluger PT, Herranz D, Velasco-Miguel S, Serrano M, Tschöp MH. Sirt1 protects against high-fat diet-induced metabolic damage. Proc Natl Acad Sci U S A. 2008;105(28):9793–8. Guo X, Yin X, Liu Z, Wang J. Non-Alcoholic Fatty Liver Disease (NAFLD) Pathogenesis and Natural Products for Prevention and Treatment. Int J Mol Sci. 2022;23(24). Hardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol. 2012;13(4):251–62. Dogra S, Kar AK, Girdhar K, Daniel PV, Chatterjee S, Choubey A, Ghosh S, Patnaik S, Ghosh D, Mondal P. Zinc oxide nanoparticles attenuate hepatic steatosis development in high-fat-diet fed mice through activated AMPK signaling axis. Nanomedicine. 2019;17:210–22. Tang BL. Sirt1 and the Mitochondria. Mol Cells. 2016;39(2):87–95. Gerhart-Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R, Alt FW, Wu Z, Puigserver P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 2007;26(7):1913–23. Additional Declarations No competing interests reported. Supplementary Files westernblottingdata1.pdf westernblottingdata2.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3856420","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":270252502,"identity":"ef49310f-24bb-4b9e-a3ff-9b16254b8778","order_by":0,"name":"Lei Chen","email":"","orcid":"","institution":"Medical School, University of Chinese Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Chen","suffix":""},{"id":270252503,"identity":"d68b138a-6de8-4e9b-a1d9-8af672d122dd","order_by":1,"name":"Miao Zhang","email":"","orcid":"","institution":"Medical School, University of Chinese Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Zhang","suffix":""},{"id":270252504,"identity":"0f3f3003-c2bb-46fc-8c00-ae0cd29bd67c","order_by":2,"name":"Jiaojiao Xu","email":"","orcid":"","institution":"Medical School, University of Chinese Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jiaojiao","middleName":"","lastName":"Xu","suffix":""},{"id":270252505,"identity":"67ab499c-db4d-4b19-8a45-8d95990567b8","order_by":3,"name":"Jianhong Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYLACyQYb0rWkkaqFseEwCaoNjp89/MJyx/nE/vbjDxh+1DDImxPUciYvzULyzO3EGWdyDBh7jjEY7mwgpOVAjpmBZNvtxA0MOQwMvA0MCQYHCGk5/wak5VziBv7nDxj/EqXlRo7xA8m2A4kbJBIMmImyRfLGGzMGybZk4xk33hgcljkmYbiBkBa+8znGnyXb7GT7+9MfPnxTYyNP0BaFAwxs0hJQDlCxBD7FECDfwMD88QNhdaNgFIyCUTCSAQBIN0Sn9S+6vQAAAABJRU5ErkJggg==","orcid":"","institution":"Medical School, University of Chinese Academy of Sciences","correspondingAuthor":true,"prefix":"","firstName":"Jianhong","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-01-12 09:29:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3856420/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3856420/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50562439,"identity":"4e201f75-e048-4930-8d33-fd3893663e05","added_by":"auto","created_at":"2024-02-02 14:32:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1080794,"visible":true,"origin":"","legend":"\u003cp\u003eGluOC reduced the hepatocyte lipid accumulation induced by OA/PA. (a) Representative micrographs stained with BODIPY 493/503. NCTC 1469 cells were treated for 24h in serum-free medium containing 0, 4, 8, and 12 ng/mL GluOC. (b) Average fluorescence intensity of Fig. 1a was measured. ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001; \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, \u003csup\u003e####\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001 versus OA/PA group.\u003c/p\u003e","description":"","filename":"floatimage153.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/f1fc9c22af4d114114a180e1.png"},{"id":50562436,"identity":"5d73081a-d9da-48e6-aa48-d922c163672d","added_by":"auto","created_at":"2024-02-02 14:32:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":217677,"visible":true,"origin":"","legend":"\u003cp\u003eGluOC promoted fatty acid β-oxidation, and inhibited DNL under OA/PA-induced conditions. (a-e) GluOC promoted the protein and mRNA expression of LCAD and MCAD under OA/PA-induced conditions. (f-j) GluOC downregulated protein and mRNA expression of FASN and ACC under OA/PA-induced conditions. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage250.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/2cf0ecec45dce80a1d0373f5.png"},{"id":50563114,"identity":"db58a960-5270-4816-9cbb-e8d6b924785a","added_by":"auto","created_at":"2024-02-02 14:40:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":922232,"visible":true,"origin":"","legend":"\u003cp\u003eGluOC promoted the expression of SIRT1, inhibited hepatocyte lipid accumulation via SIRT1. (a-c) GluOC promoted the protein and mRNA expression of SIRT1 under OA/PA induction conditions.(d) The siRNA-mediated knockdown markedly suppressed the SIRT1 expression. (e) Knockdown of SIRT1 attenuated the GluOC-induced downregulation of triglyceride levels in NCTC 1469 cells. (f,g) Knockdown of SIRT1 attenuated the GluOC-induced downregulation of lipid levels in NCTC 1469 cells. Fig 2f was mean fluorescence intensity of Figure 2g. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage348.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/d417ccb87f2807df2188e369.png"},{"id":50563116,"identity":"8d491c05-2744-4472-9c01-8df901b83042","added_by":"auto","created_at":"2024-02-02 14:40:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":233580,"visible":true,"origin":"","legend":"\u003cp\u003eOsteocalcin promoted MCAD and LCAD expression, and inhibited the ACC and FASN expression in hepatocytes by activating SIRT1. (a-c) Knockdown of SIRT1 attenuated the GluOC-induced upregulation of MCAD and LCAD proteins in NCTC 1469 cells exposed to OA/PA. (d,e) Knockdown of SIRT1 attenuated the GluOC-induced upregulation of MCAD and LCAD mRNA in NCTC 1469 cells exposed to OA/PA. (f-h) Knockdown of SIRT1 attenuated the GluOC-induced downregulation of ACC and FASN proteins in NCTC 1469 cells exposed to OA/PA. (i,j) Knockdown of SIRT1 attenuated the GluOC-induced downregulation of ACC and FASN mRNA in NCTC 1469 cells exposed to OA/PA. **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage431.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/0452b4160c7ed4f0b9a6b9d5.png"},{"id":50563117,"identity":"d917c416-2e7f-4668-b9ec-1b164e0b79a8","added_by":"auto","created_at":"2024-02-02 14:40:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":186710,"visible":true,"origin":"","legend":"\u003cp\u003eThe SIRT1/AMPK pathway mediated the GluOC-induced downregulation of ACC and FASN expression. (a,b) Knockdown of SIRT1 attenuated the GluOC-induced upregulation of the Phosphorylation of AMPK in NCTC 1469 cells exposed to OA/PA. (c,d) Compound C downregulated the p-AMPK expression and attenuated the GluOC-induced upregulation of the p-AMPK expression in NCTC 1469 cells exposed to OA/PA. (e-h) Compound C attenuated the GluOC-induced downregulation of ACC and FASN. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage520.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/a1c448a7b1eeaa10406c43d3.png"},{"id":50562440,"identity":"6cd258eb-9295-4804-8b89-c5b5561ddce7","added_by":"auto","created_at":"2024-02-02 14:32:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":194029,"visible":true,"origin":"","legend":"\u003cp\u003eThe SIRT1/PGC-1α pathway mediated the GluOC-induced upregulation of MCAD and LCAD expression.(a,b) Knockdown of SIRT1 attenuated the GluOC-induceddownregulation of the acetylation of protein PGC-1α in NCTC 1469 cells exposed to OA/PA. (c,d) SR-18292 promoted the acetylated of PGC-1α as well as attenuated the GluOC-induced downregulation of acetylated PGC-1α expression. (e-h) SR-18292 attenuated the GluOC-induced upregulation of MCAD and LCAD. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, ****\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage612.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/f3529690d48b0b1c264347d1.png"},{"id":50563115,"identity":"9101413f-6799-431f-a7ff-2fde97536803","added_by":"auto","created_at":"2024-02-02 14:40:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":139366,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart of the hypothesis that GluOC alleviates lipid accumulation in hepatocytes.\u003c/p\u003e","description":"","filename":"floatimage79.png","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/7ef3bf4463d514bb628739bd.png"},{"id":50563948,"identity":"d5650d0b-2930-4125-be22-1bccaa002d2c","added_by":"auto","created_at":"2024-02-02 14:56:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2990663,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/05b296d2-1979-469f-afc3-96e9831b01ee.pdf"},{"id":50562442,"identity":"73403dc8-4aa2-4c16-80e3-b8ae82c18f0a","added_by":"auto","created_at":"2024-02-02 14:32:54","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1287520,"visible":true,"origin":"","legend":"","description":"","filename":"westernblottingdata1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/6345acb278478d379d93f8e2.pdf"},{"id":50562444,"identity":"d250fc7c-00d9-4629-9ae5-641b96f4186f","added_by":"auto","created_at":"2024-02-02 14:32:54","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1383509,"visible":true,"origin":"","legend":"","description":"","filename":"westernblottingdata2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3856420/v1/de53152613a5132673e48d40.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Uncarboxylated Osteocalcin Inhibits De Novo Lipogenesis and Promotes Fatty Acid Oxidation via SIRT1 to Alleviate Hepatocyte Lipid Accumulation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe pathogenesis of non-alcoholic fatty liver disease (NAFLD) is connected to genetic susceptibility and metabolic dysfunction, and the disease spectrum includes hepatic steatosis, nonalcoholic steatohepatitis, hepatocirrhosis and hepatocarcinogen[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The prevalence of NAFLD worldwide was 32.4% with an increasing prevalence over time (25.5% before 2005 and 37.8% after 2016). (25.5% before 2005 and 37.8% after 2016). The prevalence of male (39.7%) was higher than that of female (25.6%)[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Common risk factors for NAFLD include diabetes, insulin resistance, obesity, genetic factors, high fat diet, sarcopenia and sedentary lifestyle[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Studies have shown that NAFLD is present in 47.3%-63.7% of patients with diabetes and 80% of obese individuals[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As a chronic hepatic disease, in NAFLD early stages, it is associated with disorders of energy metabolism, especially lipid metabolism[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In normal conditions, lipid uptake and output in the liver are balanced, which is regulated by four major pathways: fatty acid oxidation (FAO), Very low density lipoproteins (VLDL) transport endogenous triglycerides, fatty acid uptake and de novo lipogenesis (DNL). However, in pathological conditions, excess energy entering the liver accumulates as triglycerides in hepatocytes, ultimately causing NAFLD[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In NAFLD, hepatic DNL and fatty acid uptake are increased, whereas compensatory enhanced FAO is insufficient to normalize lipid balance and may potentially contribute to cell damage and disease progression through the induction of oxidative stress[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. To date, intervention-mediated weight loss has been the primary recommended treatment for NAFLD[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hence, the identification of effective therapeutic methods is urgently required.\u003c/p\u003e \u003cp\u003eUncarboxylated osteocalcin (GluOC) is a non-collagenous acid glycoprotein composed of 46\u0026ndash;50 amino acids[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It functions as a vitamin K-dependent calcium-binding protein[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. GluOC is primarily synthesized by osteoblasts and odontoblasts, with additional production by proliferating chondrocytes and it plays a crucial role bone calcium metabolism and regulates glucose and lipid metabolism[\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. GluOC has been shown to have an important regulatory effect on lipid metabolism, and in vivo experiments have shown that intermittent oral GluOC can decrease the white adipocytes size of mice[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Another animal experiment also demonstrated that GluOC was injected intraperitoneally into mice for 14 weeks, improving insulin sensitivity as well as glucose tolerance, and reversing hepatic steatosis[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Previous studies in our laboratory have demonstrated that GluOC effectively suppresses DNL by activating AMPK in OA/PA-induced hepatocytes[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Although numerous studies have indicated that GluOC might be a potential drug, current understanding of GluOC in hepatic lipid metabolism remains at an exploratory stage, there is a lack of research on the regulation of GluOC on FAO and the underlying mechanisms of GluOC in alleviating NAFLD still need to be more deeply studied.\u003c/p\u003e \u003cp\u003eThe mediation of SIRT1 in lipid metabolism of livers has been demonstrated in recent studies, and SIRT1 expression negatively correlates with developing NAFLD[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. SIRT1 as NAD-dependent sirtuin-1 or nicotinamide adenine dinucleotide (NAD+) deacetylase, is highly conserved and involved in key processes related to hepatic fatty acid oxidation and synthesis[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. One study has shown that obese patients with hepatic steatosis had lower serum SIRT1 levels than mild steatosis, in addition to, the steatosis patients in both groups had lower serum SIRT1 levels than lean individuals[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The expression of SIRT1 protein exhibited a significant decrease in rats, mice, and in cultures hepatocytes by a high-fat induced diet[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Furthermore, knockout of the liver-specific SIRT1 gene in mice resulted in enhanced inflammation, endoplasmic reticulum stress and hepatic steatosis[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], which confirming the important involvement of SIRT1 in improving lipid metabolism of hepatic. However, further studies are essential to resolve whether SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism.\u003c/p\u003e \u003cp\u003eAMP-activated protein kinase (AMPK) participates in numerous metabolic processes in the body, maintains systemic energy balance under various stress conditions and regulating hepatic lipid metabolism[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Its phosphorylation at Thr172 is necessary to regulate lipid metabolism[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. A study has shown that AMPK regulates acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FASN) expression in DNL through sterol regulatory element binding protein-1c (SREBP-1c)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Another study has shown that AMPK can also directly phosphorylate ACC and regulate its activity[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Some studies have shown that SIRT1 has benefits for lipid metabolism through reducing fatty acid chain synthesis via SIRT1/AMPK pathway in hepatocytes[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. However, it has not been shown whether the SIRT1/AMPK pathway mediates mechanisms of GluOC-regulated lipid metabolism.\u003c/p\u003e \u003cp\u003ePeroxisome proliferator activated receptor γ coactivator-1 α (PGC-1α) is a direct downstream target of SIRT1 that enhances FAO[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. And as a transcriptional coactivator, PGC-1α promotes the target genes expression of mitochondrial oxidative metabolism, which include medium-chain acyl-CoA dehydrogenase (MCAD) and long-chain acyl-CoA dehydrogenase (LCAD) expression, which are the major enzymes involved in FAO[\u003cspan additionalcitationids=\"CR33 CR34 CR35 CR36\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The latest studies have demonstrated that SIRT1 activation facilitates PGC-1α deacetylation, promotes gene transcription that regulates mitochondrial biogenesis and FAO to maintain energy metabolic homeostasis[\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Under high fat conditions, SIRT1 can modulate various intracellular homeostasis via modulation of mitochondrial function and lipid autophagy through PGC-1α[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. These evidences suggest that SIRT1/PGC-1α pathway is critical in regulating NAFLD. However, it has not been shown whether the SIRT1/PGC-1α pathway mediates the lipid metabolism mechanisms regulated by GluOC.\u003c/p\u003e \u003cp\u003eIn this study, a series of experiments were designed to comprehensively describe the potential involvement of SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism and to investigate the mechanism underlying GluOC supplementation to improve lipid metabolism. This study first demonstrated that SIRT1 mediates the GluOC mechanism in alleviating hepatocyte lipid accumulation. GluOC inhibits DNL via SIRT1-AMPK pathway and promotes FAO via SIRT1-PGC-1α pathway.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Antibodies and Reagents\u003c/h2\u003e \u003cp\u003eCompound C was from Selleck (Houston, USA). BODIPY 493/503 and PGC1α inhibitor SR-18292 were from MCE (NJ, USA). Protein A\u0026thinsp;+\u0026thinsp;G agarose was from Lablead Biotech (Beijing, China). Mouse IgG was from Beyotime (Shanghai, China). Antibodies against SIRT1, FASN, AMPKα, and Phospho-AMPKα1 were from Cell Signaling Technology (Danvers, USA). LCAD, MCAD, PGC-1α and ACC, antibodies were from Proteintech Group (Chicago, USA). Anti-Acetyllysine Mouse mAb was from PTM bio (Hangzhou, China). GluOC utilized in the experiments was acquired by prokaryotic expression in our laboratory.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell Culture\u003c/h2\u003e \u003cp\u003eThe NCTC 1469 cells (Procell Life Science \u0026amp; Technology, Wuhan, China) were cultivated in DMEM medium. Cells were induced for 12h in medium containing oleic acid (OA) (0.125mM) and palmitic acid (PA) (0.25mM) before being subjected to GluOC treatment 24 hours. Based on the experimental results, a concentration of 12 ng/mL of GluOC was selected as the experimental concentration. For siRNA transfection experiments, transfection was performed when the fusion rate reached 80% and the hepatocytes were cultured in Opti-MEM medium. And induced with OA/PA for 12 h followed by GluOC for 24 h. In inhibitor experiments, inhibitors were added when the fusion rate reached 80% and induced with OA/PA for 12 h and followed by GluOC treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Cell Staining\u003c/h2\u003e \u003cp\u003eThe coverslips were gently agitated in PBS for 30 seconds each, with three repetitions, then immersed in 4% paraformaldehyde solution (Leagene, Beijing, China) for 30 minutes. Afterwards, incubated with 1\u0026micro;M BODIPY 493/503 stain at 25℃ for 10 minutes, and the coverslips were gently agitated in PBS after staining. Finally, the fluorescence microscope (Leica Microsystems, Wetzlar, Germany) was used to capture images.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Measurement of the Triacylglycerol (TG) Level\u003c/h2\u003e \u003cp\u003eTG reagent kit was employed to measure the levels of hepatocyte lipid accumulation and was purchased from Applygen Technologics Inc (Beijing, China). The processing was performed according to the protocol from the manufacturer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Transfection Assay\u003c/h2\u003e \u003cp\u003eThe fragments si-SIRT1 sequences (Sangon, Shanghai, China) were the following: siRNA-SIRT1 sense: 5\u0026rsquo;-GAAGUUGACCUCCUCAUUGU-3\u0026rsquo;; Negative control siRNA sense: 5\u0026rsquo;-UUCUCCGAACGUGUCACGUTT-3\u0026rsquo;. The Hieff TransTM Liposomal Transfection Reagent was purchased from Yeasen (Shanghai, China). The opti-MEM was from Gibco (Carlsbad, CA, USA). Hieff TransTM was incubated with mixed opti-MEM for 5 min and then siRNA was added. After cultivation for 20 minutes at 25℃, the mixed solution was added, incubated for 24 hours in a CO2 incubator before various subsequent treatments. Ultimately, cells were harvested for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Reverse Transcription\u0026ndash;Quantitative PCR\u003c/h2\u003e \u003cp\u003eThe trizol was purchased from Biosharp Biotech (Beijing, China) used to extract total RNA. The Hifair Ⅲ 1st Strand cDNA Synthesis SuperMix was used to reverse transcribe 1\u0026micro;g RNA to cDNA purchased from Yeasen Biotech (Shanghai, China). TransStart Top Green qPCR SuperMix(+\u0026thinsp;Dye II) was used to perform qPCR from TransGen Biotech (Beijing, China). The β-actin as the internal standard gene was used to standardize the detection data. The primer sequences as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse Primer (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSirt1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATTGGCACCGATCCTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCACAGCGTCATATCATCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFASN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTGGTGGGTTTGGTGAATTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCACGAGGTCATGCTTTAGCACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCCGATTCATAATTGGGTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCGACCTTGTTTTACTAGGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACACAACACTCGAAAGCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTCTGCTGTTCCGTCAACTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLCAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCCTCGGAGCATGACATTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCAGCTTTTTCCCAGACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCTGGCACCACACCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGGGTGTTGAAGGTCTCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Western Blotting Assay\u003c/h2\u003e \u003cp\u003eThe prepared samples were loaded according to the amount of 30\u0026micro;g protein per lane, followed by separation on 10% SDS-PAGE gels. Membranes were placed in specific primary antibodies and incubated for 10 h at 4℃, then secondary antibodies at 25\u0026deg;C for 1.5 h. ECL kit (BioRad Hercules, USA) was used to visualize the target proteins. To quantify the levels of protein expression, phospho-protein bands and acetylated protein bands were normalized to their respective total protein levels and β-actin was applied to normalize the intensity of the bands. Densitometric analysis performed with ImageJ version 6 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Immunoprecipitation (IP)\u003c/h2\u003e \u003cp\u003eCell lysate was used to lyse cells, and appropriate amounts of protein samples were then added to plain IgG of the same species used in immunoprecipitation and sufficiently resuspended using protein A\u0026thinsp;+\u0026thinsp;G agarose. The mixture was gently shaken for 30 minutes at 4\u0026deg;C and then centrifuged for 5 minutes to collect the supernatant for subsequent immunoprecipitation experiments. Primary antibodies for immunoprecipitation were added and incubated overnight with slow shaking at 4\u0026deg;C. Pre-resuspended protein A\u0026thinsp;+\u0026thinsp;G agarose was added, gently shaken for 1 h, and then centrifuged. After centrifugation, the samples were slowly removed, the supernatant was carefully removed to avoid removal of the precipitate, and the PBS was used to wash the samples five times (each time using a volume of 1 mL). After the final wash, the supernatant was discarded, and 5\u0026times;SDS-PAGE electrophoresis loading buffer was added to re-suspend and vortex the resulting pellet. Samples were then subjected to high-speed centrifugation to sediment them at the bottom of the tube. Some or all samples were collected after immersion in a metal bath for 5 minutes at a temperature of 100\u0026deg;C for subsequent SDS-PAGE electrophoresis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Statistical Analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism version 9.0 was used to perform statistical analysis, one-way ANOVA and two-tailed Student\u0026rsquo;s t-test was used to analyze. All data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of at least three independent replicates, and statistical significance was defined as \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. GluOC Inhibits Hepatocyte Lipid Accumulation\u003c/h2\u003e \u003cp\u003eTo clarify the role of GluOC in lipid accumulation, the lipid droplet fluorescent dye (BODIPY 493/503) was employed to measure the change of hepatocyte lipid levels after GluOC treatment. Different concentrations of GluOC (0,4,8,12 ng/mL) were added after 12 h of treatment with OA/PA, lipid accumulation in hepatocytes was detected by dyeing after 24 h. Lipid droplet accumulation was more significant in cells after OA/PA induction. Indicating that the lipid accumulation model was successfully established (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea,b). The lipid accumulation of NCTC 1469 cells exhibited a dose-dependent decrease with increasing GluOC concentrations (0, 4, 8, 12 ng/mL), and the most significant inhibition of lipid accumulation was observed at a concentration of 12 ng/mL. These findings indicated that GluOC could inhibit the OA/PA-induced lipid metabolism in NCTC 1469 cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. GluOC Inhibits Hepatocytes Lipid Accumulation by Promoting FAO and Inhibiting DNL\u003c/h2\u003e \u003cp\u003eTo clarify the mechanistic role of GluOC in lipid accumulation, an intervention with 12 ng/mL of GluOC, the following experiments was designed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-j, the results demonstrated that GluOC could enhances the expression of MCAD and LCAD, while suppressing ACC and FASN expression, compared with the OA/PA group. This indicated that GluOC could inhibit fatty acid DNL and promote FAO.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3. GluOC Inhibits Hepatocyte Lipid Accumulation via SIRT1\u003c/h2\u003e \u003cp\u003eIn the present study, to demonstrate whether SIRT1 is involved in the mechanism of GluOC-induced lipid metabolism, the following experiments was designed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c, the OA/PA induction inhibited SIRT1 expression, and GluOC treatment significantly promoted SIRT1 expression, indicating that GluOC improved SIRT1 expression in the high-fat condition. To further investigate the mechanism of SIRT1, the Hieff Trans liposomal nucleic acid transfection reagent was first used to transfect siRNA and inhibit SIRT1 expression. The results demonstrated that mRNA levels were inhibited in the siRNA group, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed. Subsequently, whether the SIRT1 mediates the mechanism of GluOC-regulated lipid metabolism was investigated. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, TG levels were significantly increased under OA/PA-induced conditions and decreased after GluOC treatment, and knockdown of SIRT1 attenuated the effects of GluOC. And the results of the BODIPY 493/503 staining assay were consistent with those of TG (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef,g). This study demonstrated that SIRT1 mediates the key mechanism of GluOC in improving hepatocyte lipid metabolism.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. GluOC Promotes FAO and Inhibits DNL via SIRT1\u003c/h2\u003e \u003cp\u003eTo demonstrate whether SIRT1 is involved in the mechanism of GluOC-induced FAO and DNL, the following experiments was designed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-e, GluOC treatment promoted the protein and mRNA expression of LCAD and MCAD, and the effect of GluOC was attenuated after SIRT1 knockdown, under OA/PA induction. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef-j, GluOC treatment inhibited the expression of ACC and FASN, and the effect of GluOC was attenuated after SIRT1 knockdown. The present results showed that GluOC promoted FAO and inhibited DNL via SIRT1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. GluOC Reduces the FASN and ACC Expression by Activating AMPK (Thr172) Phosphorylation via SIRT1.\u003c/h2\u003e \u003cp\u003eTo verified whether SIRT1 knockdown affects p-AMPK (Thr172) expression, the following experiments was designed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea,b, GluOC treatment promoted the p-AMPK expression, and the effect of GluOC was attenuated after SIRT1 knockdown, suggesting that GluOC promotes the AMPK phosphorylation via SIRT1. GluOC activates the SIRT1/AMPK pathway by upregulating SIRT1 levels, which may be one of the important mechanisms by which GluOC inhibits lipid accumulation.\u003c/p\u003e \u003cp\u003eTo further verify whether GluOC inhibits DNL via the SIRT1/p-AMPK pathway, we performed experiments with the AMPK activation inhibitor Compound C (CC). The p-AMPK (Thr172), AMPK, FASN and ACC protein expression were detected. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec,d, GluOC treatment promoted AMPK phosphorylation, and the effect of GluOC was attenuated by the addition of compound C. Subsequently, the ACC and FASN protein expression was examined. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee-h, GluOC treatment inhibited the ACC and FASN protein expression, and this effect was attenuated by the addition of compound C, indicating that AMPK activation was a critical step when GluOC inhibited DNL. According to the above results, GluOC reduces the expression of FASN and ACC by activating SIRT1/AMPK pathway. This demonstrates that SIRT1/AMPK is a key pathway in GluOC inhibition of DNL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.6. GluOC Enhances the MCAD and LCAD Expression by Upregulating PGC-1α Deacetylation via SIRT1.\u003c/h2\u003e \u003cp\u003eTo verified whether SIRT1 knockdown affects acetylated PGC-1α expression, the following experiments was designed. As showed in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea,b, GluOC treatment inhibited the acetylated of PGC-1α, and the effect of GluOC was attenuated after SIRT1 knockdown, indicating that GluOC promotes PGC-1α deacetylation via SIRT1. GluOC activates the SIRT1/PGC-1α pathway by upregulating SIRT1 levels, which may be one of the important mechanisms by which GluOC inhibits lipid accumulation.\u003c/p\u003e \u003cp\u003eTo further verify whether GluOC promotes FAO via the SIRT1/PGC-1α pathway, we performed experiments using PGC-1α inhibitor SR-18292 (SR). GluOC treatment inhibited the acetylated of PGC-1α, the effect of GluOC was attenuated by the addition of SR-18292 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec,d). Subsequently, the MCAD and LCAD protein expression was examined. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee-h, GluOC treatment promoted the MCAD and LCAD protein expression, and the effect of GluOC was attenuated by the addition of SR-18292, indicating that PGC-1α deacetylation was a critical step when GluOC promoted FAO. According to the above results, GluOC upregulates the expression of MCAD and LCAD by promoting PGC-1α deacetylation via SIRT1.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study used OA/PA-induced NCTC1469 cells as a model for NAFLD. GluOC inhibited intracellular lipid accumulation and upregulated SIRT1 expression in hepatocytes. GluOC inhibited DNL by activating AMPK (Thr172) phosphorylation via SIRT1 and promoted FAO by up-regulating PGC-1α deacetylation via SIRT1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). GluOC reduces hepatocyte lipid accumulation via SIRT1/AMPK and SIRT1/PGC1α pathways.\u003c/p\u003e \u003cp\u003eOver the past years, NAFLD prevalence has increased, and this condition results in a serious influence and challenge to human health[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The liver can maintain a number of physiological processes in the body and is the regulatory center for maintaining the balance of lipid metabolism[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The disruption between lipid acquisition and removal leads to hepatic steatosis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The processes involved in hepatic lipid input and output are tightly regulated by complex interactions between various crucial proteins to maintain strict control over hepatic lipid homeostasis, and disruption of these pathways can cause hepatic lipid accumulation and subsequent development of NAFLD[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Naturally, reducing hepatocytes lipid accumulation could alleviate NAFLD symptoms. In this study, NAFLD cell model was established using OA/PA treatment on NCTC 1469 cells. Hepatocytes were stained with BODIPY 493/503 and images were obtained by fluorescence microscopy. The results demonstrate significant hepatocyte lipid accumulation after 12 hours of OA/PA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGluOC, a small molecule protein, functions as an endocrine hormone that can enter the bloodstream[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The potential of GluOC to improve hyperglycemia symptoms in KKAy mice has been demonstrated in previous studies in our laboratory, as well as ameliorate fatty liver and hypertriglyceridemia by inhibiting DNL and promoting FAO[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The present study demonstrated that GluOC improved lipid metabolism induced by OA/PA and reduced intracellular lipid accumulation by promoting FAO as well as inhibiting DNL (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Therefore, GluOC is a new and very promising drug for the therapeutic treatment of NAFLD, and investigation into its underlying mechanism of GluOC in the reduction of hepatocyte lipid accumulation will impact positively on the quality of life for patients with NAFLD.\u003c/p\u003e \u003cp\u003eSIRT1 is essential for hepatic homeostasis as well as the development of hepatic lipid accumulation[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Recent evidence has shown a decreased expression of several sirtuins, including SIRT1, in patients with NAFLD compared with controls[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Additionally, this finding has been supported by various experiments conducted in vivo and in vitro, with hepatic-specific SIRT1 knockout mice resulting in enhanced hepatic lipid accumulation, ultimately resulting in hepatic steatosis on a standard diet[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Showing significant decreases in SIRT1 protein expression levels induced by high-fat diets or cultured hepatocytes[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Additionally, overexpression of SIRT1 ameliorated HFD-induced hepatic steatosis by promoting energy expenditure, improving glucose tolerance, and reducing triglyceride accumulation, thereby demonstrating the SIRT1's critical role in improving hepatocyte lipid metabolism[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. This study demonstrated that NCTC 1469 cells induced by OA/PA exhibited decreased expression of SIRT1, which was reversed by GluOC treatment. Furthermore, knockdown of SIRT1 attenuated the function of GluOC in decreasing hepatocyte lipid accumulation, demonstrating SIRT1 is mediated in alleviating lipid accumulation effect of GluOC.\u003c/p\u003e \u003cp\u003eAMPK maintains energy balance by regulating anabolism and catabolism and regulates hepatic lipid and glucose metabolism[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. SIRT1 activity is correlated with AMPK, and SIRT1 has also been demonstrated to modulate AMPK activation in NAFLD[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Previous studies have shown that GluOC effectively suppresses DNL by activating AMPK in OA/PA-induced hepatocytes[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This study indicated that GluOC promoted p-AMPK expression while inhibiting the ACC and FASN expression. The function of GluOC was attenuated by SIRT1 knockdown, and the FASN and ACC expression increased after treatment with the AMPK inhibitor Compound C. Therefore, it can be concluded that GluOC inhibit DNL through the SIRT1/AMPK signalling pathway, thereby alleviating lipid accumulation in hepatocytes.\u003c/p\u003e \u003cp\u003eSIRT1 acts as a deacetylase that targets PGC-1α[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. PGC-1α facilitates the transport and utilization of fatty acids, including medium, long and very long chain fatty acids by promoting target genes expression, as a transcriptional coactivator, thereby improving fatty acid oxidation[\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The present study suggests that GluOC treatment significantly reduces the acetylation level of PGC1α while increasing expression of the FAO enzymes MCAD and LCAD. However, knockdown of SIRT1 attenuates this effect. Moreover, the results indicate that inhibition of PGC1α with SR18292 leads to a reduction in the expression of LCAD and MCAD. In conclusion, GluOC may reduce hepatic lipid accumulation via SIRT1/PGC1α signaling pathway to enhance FAO. Therefore, GluOC is a promising drug with great potential for further study. At the same time, this study has limitations, and the vivo experiments are required to verify the safety and effectiveness of GluOC.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eOver the past years, NAFLD prevalence has increased, and new drug research is extremely urgent for the increasing population of sufferers. In the present study, GluOC reduced hepatocyte lipid accumulation through both pathways simultaneously. GluOC inhibited the DNL by activating the phosphorylation of AMPK (Thr172) and promoted FAO by activating PGC-1α deacetylation via SIRT1. In summary, the present study indicates that GluOC could significantly reduce hepatocyte lipid accumulation through SIRT1, and SIRT1 as a key target of GluOC, plays a pivotal role in mitigating hepatocyte lipid accumulation. This suggests GluOC is a novel drug candidate for NAFLD, which provides a positive significance for the improvement of patients' quality of life in clinical practice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMedical School, University of Chinese Academy of Sciences, Beijing, China.\u003c/p\u003e\n\u003cp\u003eLei Chen ([email protected]), Miao Zhang ([email protected]), Jiaojiao Xu ([email protected]) and Jianhong Yang* ([email protected])\u003c/p\u003e\n\u003cp\u003e* Correspondence: [email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eL.C., M.Z., J.X. and J.Y. contributed to Provide ideas. L.C., M.Z. design for the entire experiment. L.C. accomplished the experiments and wrote this manuscript. L.C., M.Z., J.X. and J.Y. were responsible for modifying the manuscript.\u0026nbsp;All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFundamental Research Funds for the Central Universities\u0026nbsp;(Grant No. E2E43202X2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFan JG, Wei L, Zhuang H. Guidelines of prevention and treatment of nonalcoholic fatty liver disease (2018, China). J Dig Dis. 2019;20(4):163\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiazi K, Azhari H, Charette JH, Underwood FE, King JA, Afshar EE, Swain MG, Congly SE, Kaplan GG, Shaheen AA. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2022;7(9):851\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan JG, Kim SU, Wong VW. New trends on obesity and NAFLD in Asia. J Hepatol. 2017;67(4):862\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowell EE, Wong VW, Rinella M. Non-alcoholic fatty liver disease. Lancet. 2021;397(10290):2212\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoomba R, Friedman SL, Shulman GI. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell. 2021;184(10):2537\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadmus OO, Hillhouse SA, Anderson CD, Hinds TD, Stec DE. Molecular mechanisms of metabolic associated fatty liver disease (MAFLD): functional analysis of lipid metabolism pathways. Clin Sci (Lond). 2022;136(18):1347\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTownsend SA, Newsome PN. Non-alcoholic fatty liver disease in 2016. Br Med Bull. 2016;119(1):143\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePouwels S, Sakran N, Graham Y, Leal A, Pintar T, Yang W, Kassir R, Singhal R, Mahawar K, Ramnarain D. Non-alcoholic fatty liver disease (NAFLD): a review of pathophysiology, clinical management and effects of weight loss. BMC Endocr Disord. 2022;22(1):63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHauschka PV, Lian JB, Cole DE, Gundberg CM. Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev. 1989;69(3):990\u0026ndash;1047.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHauschka PV, Carr SA. Calcium-dependent alpha-helical structure in osteocalcin. Biochemistry. 1982;21(10):2538\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin R, Mee PJ, McKee MD, Jung DY, et al. Endocrine regulation of energy metabolism by the skeleton. Cell. 2007;130(3):456\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDirckx N, Moorer MC, Clemens TL, Riddle RC. The role of osteoblasts in energy homeostasis. Nat Rev Endocrinol. 2019;15(11):651\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasutake Y, Mizokami A, Kawakubo-Yasukochi T, Chishaki S, Takahashi I, Takeuchi H, Hirata M. Long-term oral administration of osteocalcin induces insulin resistance in male mice fed a high-fat, high-sucrose diet. Am J Physiol Endocrinol Metab. 2016;310(8):E662\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerron M, Hinoi E, Karsenty G, Ducy P. Osteocalcin differentially regulates beta cell and adipocyte gene expression and affects the development of metabolic diseases in wild-type mice. Proc Natl Acad Sci U S A. 2008;105(13):5266\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtani T, Mizokami A, Hayashi Y, Gao J, Mori Y, Nakamura S, Takeuchi H, Hirata M. Signaling pathway for adiponectin expression in adipocytes by osteocalcin. Cell Signal. 2015;27(3):532\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerron M, McKee MD, Levine RL, Ducy P, Karsenty G. Intermittent injections of osteocalcin improve glucose metabolism and prevent type 2 diabetes in mice. Bone. 2012;50(2):568\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Zhang M, Xu J, Yang J. Uncarboxylated Osteocalcin Decreases SCD1 by Activating AMPK to Alleviate Hepatocyte Lipid Accumulation. Molecules. 2023;28(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMariani S, Fiore D, Basciani S, Persichetti A, Contini S, Lubrano C, Salvatori L, Lenzi A, Gnessi L. Plasma levels of SIRT1 associate with non-alcoholic fatty liver disease in obese patients. Endocrine. 2015;49(3):711\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Y, Li JX, Mao TY, Zhao WH, Liu LJ, Wang YL. Targeting Sirt1 in a rat model of high-fat diet-induced non-alcoholic fatty liver disease: Comparison of Gegen Qinlian decoction and resveratrol. Exp Ther Med. 2017;14(5):4279\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Liu M, Yu H, Wang W, Han L, Chen Q, Ruan J, Wen S, Zhang Y, Wang T. Mangiferin Improves Hepatic Lipid Metabolism Mainly Through Its Metabolite-Norathyriol by Modulating SIRT-1/AMPK/SREBP-1c Signaling. Front Pharmacol. 2018;9:201.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhader A, Yang WL, Godwin A, Prince JM, Nicastro JM, Coppa GF, Wang P. Sirtuin 1 Stimulation Attenuates Ischemic Liver Injury and Enhances Mitochondrial Recovery and Autophagy. Crit Care Med. 2016;44(8):e651\u0026ndash;663.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng XQ, Chen LL, Li NX. The expression of SIRT1 in nonalcoholic fatty liver disease induced by high-fat diet in rats. Liver Int. 2007;27(5):708\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiou CJ, Lee YK, Ting NC, Chen YL, Shen SC, Wu SJ, Huang WC. Protective Effects of Licochalcone A Ameliorates Obesity and Non-Alcoholic Fatty Liver Disease Via Promotion of the Sirt-1/AMPK Pathway in Mice Fed a High-Fat Diet. Cells. 2019;8(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Li W, Liu Y, Sun Y, Li Y, Yao Q, Li J, Zhang Q, Gao Y, Gao L, et al. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway. J Nutr Biochem. 2014;25(11):1207\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia D, Hellberg K, Chaix A, Wallace M, Herzig S, Badur MG, Lin T, Shokhirev MN, Pinto AFM, Ross DS, et al. Genetic Liver-Specific AMPK Activation Protects against Diet-Induced Obesity and NAFLD. Cell Rep. 2019;26(1):192\u0026ndash;208e196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Liu S, Zhai A, Zhang B, Tian G. AMPK-Mediated Regulation of Lipid Metabolism by Phosphorylation. Biol Pharm Bull. 2018;41(7):985\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Xu S, Mihaylova MM, Zheng B, Hou X, Jiang B, Park O, Luo Z, Lefai E, Shyy JY, et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011;13(4):376\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott JW, Norman DG, Hawley SA, Kontogiannis L, Hardie DG. Protein kinase substrate recognition studied using the recombinant catalytic domain of AMP-activated protein kinase and a model substrate. J Mol Biol. 2002;317(2):309\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma A, Anand SK, Singh N, Dwarkanath A, Dwivedi UN, Kakkar P. Berbamine induced activation of the SIRT1/LKB1/AMPK signaling axis attenuates the development of hepatic steatosis in high-fat diet-induced NAFLD rats. Food Funct. 2021;12(2):892\u0026ndash;909.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller KN, Clark JP, Anderson RM. Mitochondrial regulator PGC-1a-Modulating the modulator. Curr Opin Endocr Metab Res. 2019;5:37\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou P, Liu L, Zheng LD, Payne KK, Manjili MH, Idowu MO, Zhang J, Schmelz EM, Cheng Z. Coordinated Upregulation of Mitochondrial Biogenesis and Autophagy in Breast Cancer Cells: The Role of Dynamin Related Protein-1 and Implication for Breast Cancer Treatment. Oxid Med Cell Longev. 2016;2016:4085727.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuss JM, Kopp RP, Kelly DP. Peroxisome proliferator-activated receptor coactivator-1alpha (PGC-1alpha) coactivates the cardiac-enriched nuclear receptors estrogen-related receptor-alpha and -gamma. Identification of novel leucine-rich interaction motif within PGC-1alpha. J Biol Chem. 2002;277(43):40265\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng CF, Ku HC, Lin H. PGC-1α as a Pivotal Factor in Lipid and Metabolic Regulation. Int J Mol Sci. 2018;19(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePurushotham A, Schug TT, Xu Q, Surapureddi S, Guo X, Li X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab. 2009;9(4):327\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEspinoza DO, Boros LG, Crunkhorn S, Gami H, Patti ME. Dual modulation of both lipid oxidation and synthesis by peroxisome proliferator-activated receptor-gamma coactivator-1alpha and \u0026ndash;\u0026thinsp;1beta in cultured myotubes. FASEB J. 2010;24(4):1003\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H. HIF-1 suppresses lipid catabolism to promote cancer progression. Mol Cell Oncol. 2015;2(4):e980184.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu D, Liu C, Qin M, Zhang X, Xi T, Yuan S, Hao H, Xiong J. Metabolic dysregulation and emerging therapeutical targets for hepatocellular carcinoma. Acta Pharm Sin B. 2022;12(2):558\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNemoto S, Fergusson MM, Finkel T. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1{alpha}. J Biol Chem. 2005;280(16):16456\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Cui Y, Song J, Cui C, Wang L, Liang K, Wang C, Sha S, He Q, Hu H, et al. Mesenchymal stem cell-conditioned medium improved mitochondrial function and alleviated inflammation and apoptosis in non-alcoholic fatty liver disease by regulating SIRT1. Biochem Biophys Res Commun. 2021;546:74\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X. SIRT1 and energy metabolism. Acta Biochim Biophys Sin (Shanghai). 2013;45(1):51\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Chen D, Gong Q, Xu Q, Pan D, Lu F, Tang Q. Elucidation of SIRT-1/PGC-1α-associated mitochondrial dysfunction and autophagy in nonalcoholic fatty liver disease. Lipids Health Dis. 2021;20(1):40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYounossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology. 2016;64(1):73\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrefts E, Gannon M, Wasserman DH. The liver. Curr Biol. 2017;27(21):R1147\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, DePaoli AM, Taylor SI, Gorden P, et al. Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest. 2002;109(10):1345\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIpsen DH, Lykkesfeldt J, Tveden-Nyborg P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol Life Sci. 2018;75(18):3313\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng H, Ge J, Xu W, Ma H, Chen L, Xia M, Pan B, Lin H, Wang S, Gao X. Type 2 Diabetes Is Causally Associated With Reduced Serum Osteocalcin: A Genomewide Association and Mendelian Randomization Study. J Bone Min Res. 2021;36(9):1694\u0026ndash;707.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang XL, Wang YN, Ma LY, Liu ZS, Ye F, Yang JH. Uncarboxylated osteocalcin ameliorates hepatic glucose and lipid metabolism in KKAy mice via activating insulin signaling pathway. Acta Pharmacol Sin. 2020;41(3):383\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColak Y, Yesil A, Mutlu HH, Caklili OT, Ulasoglu C, Senates E, Takir M, Kostek O, Yilmaz Y, Yilmaz Enc F, et al. A potential treatment of non-alcoholic fatty liver disease with SIRT1 activators. J Gastrointestin Liver Dis. 2014;23(3):311\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T, Liu YH, Fu YC, Liu XM, Zhou XH. Direct evidence of sirtuin downregulation in the liver of non-alcoholic fatty liver disease patients. Ann Clin Lab Sci. 2014;44(4):410\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodgers JT, Puigserver P. Fasting-dependent glucose and lipid metabolic response through hepatic sirtuin 1. Proc Natl Acad Sci U S A. 2007;104(31):12861\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang RH, Li C, Deng CX. Liver steatosis and increased ChREBP expression in mice carrying a liver specific SIRT1 null mutation under a normal feeding condition. Int J Biol Sci. 2010;6(7):682\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaron AZ, He X, Mottawea W, Seifert EL, Jardine K, Dewar-Darch D, Cron GO, Harper ME, Stintzi A, McBurney MW. The SIRT1 deacetylase protects mice against the symptoms of metabolic syndrome. Faseb j. 2014;28(3):1306\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfluger PT, Herranz D, Velasco-Miguel S, Serrano M, Tsch\u0026ouml;p MH. Sirt1 protects against high-fat diet-induced metabolic damage. Proc Natl Acad Sci U S A. 2008;105(28):9793\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo X, Yin X, Liu Z, Wang J. Non-Alcoholic Fatty Liver Disease (NAFLD) Pathogenesis and Natural Products for Prevention and Treatment. Int J Mol Sci. 2022;23(24).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol. 2012;13(4):251\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDogra S, Kar AK, Girdhar K, Daniel PV, Chatterjee S, Choubey A, Ghosh S, Patnaik S, Ghosh D, Mondal P. Zinc oxide nanoparticles attenuate hepatic steatosis development in high-fat-diet fed mice through activated AMPK signaling axis. Nanomedicine. 2019;17:210\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang BL. Sirt1 and the Mitochondria. Mol Cells. 2016;39(2):87\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerhart-Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R, Alt FW, Wu Z, Puigserver P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 2007;26(7):1913\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"uncarboxylated osteocalcin, lipid accumulation, Sirt1, DNL, FAO","lastPublishedDoi":"10.21203/rs.3.rs-3856420/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3856420/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eNon-alcoholic fatty liver disease (NAFLD) is a disease characterized by the hepatic lipids accumulation resulting from genetic susceptibility and metabolic dysfunction. Uncarboxylated osteocalcin (GluOC) is a protein that is synthesized by osteoblasts which performs a vital function in the management of energy balance. Previous studies have shown that GluOC is beneficial for lipid and glucose metabolism in KKAy mice induced fatty liver. GluOC effectively ameliorates hyperglycemia, fatty liver, and hyperlipidemia. Furthermore, it regulates stearyl-coenzyme A desaturase 1 (SCD1) expression through AMP-activated protein kinase (AMPK), which alleviates hepatocyte lipid accumulation. However, the underlying mechanisms by which GluOC alleviates hepatocyte lipid accumulation need further elucidation.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, the NCTC 1469 cells induced by oleic acid (OA) and palmitic acid (PA) were used in the establishment of the NAFLD cell model. Triglyceride (TG) kits and BODIPY 493/503 staining were employed to measure the levels of hepatocyte lipid accumulation. Immunoprecipitation, western blotting, and real-time PCR analyzed the expression of protein and mRNA in the fatty acid oxidation (FAO) and de novo lipogenesis (DNL) pathways.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results indicated that increasing concentrations of GluOC resulted in reduced intracellular lipid accumulation and triglyceride levels. GluOC promoted sirtuin1 (SIRT1) expression, inhibited acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FASN) expression, promoted medium-chain acyl-CoA dehydrogenase (MCAD) and long-chain acyl-CoA dehydrogenase (LCAD) expression. In addition, GluOC activated AMPK phosphorylation and peroxisome proliferator activated receptor γ coactivator-1 α (PGC-1α) deacetylation. si-SIRT1 attenuated the above effects of GluOC, resulting in hepatocyte lipid accumulation.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eGluOC inhibited DNL via SIRT1-AMPK and promoted FAO via SIRT1-PGC-1α to alleviate lipid accumulation in hepatocytes. This provides new insights for further research in NAFLD.\u003c/p\u003e","manuscriptTitle":"Uncarboxylated Osteocalcin Inhibits De Novo Lipogenesis and Promotes Fatty Acid Oxidation via SIRT1 to Alleviate Hepatocyte Lipid Accumulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-02 14:32:49","doi":"10.21203/rs.3.rs-3856420/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"80f1bf51-80e1-4760-9b31-fe3dcdaa719a","owner":[],"postedDate":"February 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-02T14:32:51+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-02 14:32:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3856420","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3856420","identity":"rs-3856420","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0