Comprehensive Analysis of the Expression of the IGF2BPs gene family in Head and Neck Squamous Cell Carcinoma: Association with Prognostic Value and Tumor Immunity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comprehensive Analysis of the Expression of the IGF2BPs gene family in Head and Neck Squamous Cell Carcinoma: Association with Prognostic Value and Tumor Immunity Hai Tang, Jingpeng Liu, Jianjiang Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2820861/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Oct, 2023 Read the published version in Heliyon → Version 1 posted You are reading this latest preprint version Abstract Background: Head and neck squamous cell carcinoma (HNSCC) represents a predominant type of malignant cancer found in the head and neck region, characterized by a high incidence and unfavorable prognosis. The IGF2BPs gene family, which belongs to the RNA-binding protein class, has been critically implicated in several cancers, and its involvement in HNSCC necessitates further exploration. Objective: To explore the clinical significance and potential biological functions of the IGF2BPs gene family in HNSCC. Methods: A bioinformatic methodology was employed to examine the expression profile, diagnostic and prognostic significance, and biological mechanisms of the IGF2BPs gene family in HNSCC, with a particular emphasis on its involvement in the immune function of HNSCC. This was followed by in vitro investigations to unravel the biological roles of the IGF2BPs gene family in HNSCC. Results: This investigation has demonstrated that, in contrast with normal control tissue, HNSCC has a substantial elevation in the expression level of the IGF2BPs gene family. Patients with a high level of IGF2BPs gene family expression demonstrated higher prediction accuracy for HNSCC. Furthermore, patients with HNSCC and elevated IGF2BPs gene family expression levels exhibited poor survival outcomes. The IGF2BPs gene family displayed a significant association with a variety of immune infiltrating cells and immune genes in HNSCC. Studies conducted in vitro have confirmed that IGF2BP2 silencing suppressed the migration, proliferation, and invasion of HNSCC cells. Conclusions: It has been determined that the IGF2BPs gene family plays a crucial part in the onset and progression of HNSCC, and its association with tumor immunity has been established. The IGF2BPs gene family holds promising potential as a diagnostic and prognostic biomarker for HNSCC. Head and neck squamous cell carcinoma IGF2BPs diagnosis prognosis tumor immunity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1. Introduction Head and neck cancer represents a group of malignant tumors that manifest in diverse anatomic areas of the upper gastrointestinal tract. Globally, over 830,000 new cases of head and neck cancer are reported to be diagnosed each year, with head and neck squamous cell carcinoma (HNSCC) accounting for more than 95% of cases. The primary risk contributors to HNSCC are smoking, betel nut consumption, alcohol consumption, genetic susceptibility, and human papillomavirus (HPV) infection 1 . Despite significant progress in HNSCC research and therapy, the primary treatment for HNSCC patients still relies on surgical resection along with radiotherapy, chemotherapy, and immunotherapy 2 . The 5-year survival rate is still below 50% because HNSCC is aggressive, metastatic, and recurring 3 . Gene targeting therapy has demonstrated promise in the treatment of HNSCC in recent years 4 . However, HNSCC development is a complicated process that involves various genes. Therefore, finding new targets is crucial for improving the care and prognosis of individuals with HNSCC. Insulin-like growth factor 2 mRNA binding proteins (IGF2BPs), also known as IMPs, comprise three members: IGF2BP1, IGF2BP2, and IGF2BP3. They belong to the family of oncofetal RNA-binding proteins (RBPs), are encoded by the IGF2BPs gene family, and considerably conserved, and exert significant regulatory control over RNA processing, at various levels, such as localization, translation, and stability 5 . The IGF2BPs gene family is predominantly expressed during mammalian embryonic development, and its contributions to pivotal cellular processes, such as cell proliferation, differentiation, and metabolism, have been established 6 . The scientific community has recently identified the IGF2BPs gene family as being dysregulated in several tumor tissues, including lung, liver, and colon cancers. The dysregulation of the IGF2BPs gene family further enhances the proliferation, migration, and invasive capabilities of tumor cells, thereby establishing a link between the IGF2BPs gene family and a poor prognosis 7 – 14 . However, despite the advancements in cancer research, a limited understanding of the potential mechanisms of the IGF2BPs gene family is available. Consequently, there is a pressing need to unravel its expression patterns and molecular functions in HNSCC. This research used bioinformatics technologies to examine the relationship between three IGF2BPs gene family members and HNSCC. Furthermore, the biological significance of IGF2BP2 in HNSCC was confirmed through in vitro experiments. The present investigation utilized information from the TCGA database, HPA database, and GEPIA2 database to explore the association of 3 genes in the IGF2BPs gene family with expression pattern, clinical characteristics, prognostic value, diagnostic value, associated genes, biofunctional enrichment, and tumor immunity in HNSCC patients. To further examined the malignant biological behavior of the IGF2BPs gene family in HNSCC, the expression of the IGF2BP2 gene was knocked down in HNSCC cell line SCC4 cells using small interfering RNA. The effects of knocking down IGF2BP2 expression levels on the biological functions of the SCC4 cell line were analyzed using CCK8 assay, EDU assay, and transwell migration and invasion assays. The findings of this study revealed that the IGF2BPs gene family may function as a possible diagnostic and predictive biomarker for HNSCC patients, and it exerts a tumor-promoting role in HNSCC. Therefore, the IGF2BPs gene family has the ability to be utilized as a promising biomarker and therapeutic target for the management of HNSCC in the future. 2. Material And Methods 2.1. Expression of the IGF2BPs gene family in Pan-Cancer and HNSCC. A schematic diagram was employed to depict the study structure (Figure 1). The expression profiles of the IGF2BPs gene family, along with the associated clinical data for 44 healthy control tissues and 502 HNSCC tumor samples, were acquired from the TCGA database. The gene expression data in HTSeq-FPKM RNAseq format were subjected to conversion into TPM and log2 transformation. The ggplot2 package in R (v 3.6.3) was used to analyze and visualize the expression data of the IGF2BPs gene family in HNSCC and pan-cancer samples. The Wilcoxon rank-sum test was utilized for unpaired samples. In the case of paired sample analysis, if the sample satisfies the Shapiro-Wilk normality test (p > 0.05), the paired sample t-test was used, otherwise, the Wilcoxon signed rank test was performed. Furthermore, the cBioPortal database was used to get the three-dimensional (3D) protein structures of the IGF2BPs gene family. The HPA database was searched to retrieve the immunohistochemical staining images of the IGF2BPs gene family in healthy control tissues and HNSCC. Furthermore, the pROC package in R was used to produce receiver operating characteristic (ROC) curves and the ggplot2 package for visualization. A logistic regression model was used to evaluate the association between the clinical features (shown in Table 1) and the IGF2BPs gene family expression levels. Table 1. Results of logistic regression illustrated the correlation identified between the expression of the IGF2BPs gene family and clinical features. Characteristics Total (N) IGF2BP1 Odds Ratio(OR) P value Total(N) IGF2BP2 Odds Ratio(OR) P value Total (N) IGF2BP3 Odds Ratio(OR) P value T stage (T3&T4 vs. T1&T2) 487 1.861 (1.282-2.714) 0.001 487 1.647 (1.136-2.396) 0.009 487 1.468 (1.014-2.131) 0.043 N stage (N1&N2&N3 vs. N0) 480 1.000 (0.699-1.431) 1.000 480 1.034 (0.723-1.479) 0.855 480 0.983 (0.687-1.407) 0.926 M stage (M1 vs. M0) 477 0.254 (0.013-1.734) 0.222 477 0.246 (0.013-1.677) 0.211 477 0.236 (0.012-1.607) 0.198 Clinical stage (Stage III&Stage IV vs. Stage I&Stage II) 488 1.498 (0.983-2.296) 0.062 488 1.414 (0.929-2.166) 0.108 488 1.564 (1.026-2.397) 0.039 Radiation therapy (Yes vs. No) 441 1.230 (0.831-1.822) 0.302 441 0.823 (0.556-1.218) 0.331 441 1.438 (0.970-2.138) 0.071 Primary therapy outcome (PR&CR vs. PD&SD) 418 1.417 (0.771-2.645) 0.265 418 0.753 (0.406-1.383) 0.362 418 1.314 (0.715-2.452) 0.382 Gender (Male vs. Female) 502 0.960 (0.646-1.426) 0.840 502 1.130 (0.761-1.681) 0.545 502 1.331 (0.896-1.984) 0.158 Race (Asian&Black or African American vs. White) 485 1.316 (0.757-2.314) 0.333 485 1.238 (0.712-2.168) 0.451 485 1.122 (0.645-1.959) 0.685 Age (>60 vs. <=60) 501 1.164 (0.820-1.653) 0.397 501 0.845 (0.595-1.200) 0.348 501 1.092 (0.769-1.551) 0.624 Histologic grade (G3&G4 vs. G1&G2) 483 1.516 (1.003-2.305) 0.050 483 0.952 (0.630-1.437) 0.813 483 0.995 (0.658-1.502) 0.979 Smoker (Yes vs. No) 492 1.177 (0.771-1.801) 0.450 492 1.177 (0.771-1.801) 0.450 492 1.095 (0.717-1.674) 0.674 Alcohol history (Yes vs. No) 491 0.981 (0.671-1.433) 0.920 491 0.970 (0.664-1.418) 0.876 491 1.168 (0.800-1.708) 0.422 Lymphovascular invasion (Yes vs. No) 341 1.143 (0.733-1.785) 0.556 341 1.082 (0.694-1.690) 0.729 341 1.159 (0.744-1.808) 0.513 Lymphnode neck dissection (Yes vs. No) 499 1.458 (0.922-2.324) 0.109 499 1.742 (1.097-2.795) 0.020 499 0.751 (0.473-1.186) 0.221 2.2. Prognostic Value Estimation of the IGF2BPs gene family in HNSCC. The IGF2BPs gene family in pan-cancer was mapped using the GEPIA2 database for both overall survival and disease-free survival. Three prognostic indicators were investigated for the purpose of ascertaining the prognostic significance of the IGF2BPs gene family in HNSCC: disease-specific survival, overall survival, and progress-free interval survival. Kaplan-Meier curves were generated using the R tool survminer. Furthermore, the Coxph function in R was employed for conducting univariate and multivariate Cox regression analyses to investigate the association between clinical variables and prognosis. The ggplot2 package in R was utilized to construct forest plots. The rms package and survival package in R were used to build nomogram plots and calibration plots. 2.3. Functional Terms Identification of the Associated Genes of the IGF2BPs gene family. The GeneMANIA website was used to develop a gene-gene interaction (GGI) network to examine the interactions between the IGF2BPs gene family and other genes. In order to further explore the genes that are positively and negatively associated with the IGF2BP gene family in HNSCC, a heatmap of the top 10 genes was produced using the R ggplot2 package. Subsequently, 1169 genes closely related to all three members of the IGF2BPs gene family were identified. Using the cluster profile package in R, which assessed the GO terms (cellular components [CCs], biological processes [BPs], molecular functions [MFs]), and KEGG pathways, the biological function enrichment of these 1169 genes was examined 15 . Additionally, the cluster profile package in R was utilized for GSEA. 2.4. The Link between the IGF2BPs gene family and Tumor Immunity in HNSCC. In order to examine the relationship between the IGF2BPs gene family and the tumor immune microenvironment (estimate score, immune score, and stromal score) in HNSCC, this study used the estimate package in R. Moreover, 24 tumor-specific immune infiltrating cells were identified by Professor Bindea, and the GSVA package in R was employed to investigate the association of the IGF2BPs gene family with these infiltrating cells in HNSCC 16,17 . Immune-stimulatory and immune-inhibitory genes that have already been found were taken into consideration for the purpose of better understanding the immunological regulation mechanisms of HNSCC 18 . The link between the IGF2BPs gene family and these immune-regulatory genes was examined using the Pearson correlation coefficient. The ggplot2 tool in R was used to create a heat map to display the above-mentioned outcomes. 2.5. Cell culture and transfection. The human HNSCC cell line SCC4 was obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Gibco, USA) medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C and 5% CO2 in a cell culture incubator. To knock down the expression of the IGF2BP2 gene, small interfering RNA (siRNA) targeting IGF2BP2 was designed and synthesized by RiboBio Biologicals (Guangzhou, China), and transfected using Lipofectamine 3000. The siRNA sequences used for knockdown are as follows: si-NC: sense strand: UUCUCCGAACGUGUCACGUTT, antisense strand: ACGUGACACGUUCGGAGAATT; si-IGF2BP2-1: sense strand: GGCAUCAGUUUGAGAACUATT, antisense strand: UAGUUCUCAAACUGAUGCCTT; si-IGF2BP2-2: sense strand: CGAAGAGAUUCCUCUGAAATT, anti Sense strand: UUUCAGAGGAAUCUCUUCGTT; si-IGF2BP2-3: sense strand: GAAGUGAUCGUCAGAAUUATT, antisense strand: UAAUUCUGACGAUCACUUCTT. 2.6. Real-time Quantitative PCR(RT-qPCR). Total RNA was extracted from the SCC4 cell line and purified using Trizol reagent (Invitrogen, USA), followed by an evaluation of purity and integrity. The cDNA was then synthesized using a cDNA synthesis kit (Vazyme Bio, China) and subjected to real-time quantitative PCR analysis with the aid of the SYBR Green qPCR SuperMix kit (Vazyme Bio, China). The reaction conditions were as follows: 95°C for 5 minutes, 95°C for 15 seconds, and 60°C for 34 seconds, for a total of 40 cycles. The primer sequences required for the experiment were as follows: IGF2BP2:F- GACGTCAGCGAAAGGATGGT, R- GCGCTTCCAGCTTCACTTCT; 18S: F- CCTGGATACCGCAGCTAGGA, R- GCGGCGCAATACGAATGCCCC. The internal reference used was 18S, and relative expression levels were calculated using the 2 - △△ CT method. 2.7. Western Blot. Total protein was isolated from the SCC4 cell line using a complete protein extraction kit supplied by KeyGene Bio (China), and protein concentration was measured using a BCA kit (KeyGene Bio, China). Proteins were separated using 10% SDS-PAGE and then transferred onto PVDF membranes (Beyoime Bio, China). PVDF membranes were subjected to incubation with primary antibodies IGF2BP2 (ab129071, Abcam, 1:1000) and GAPDH (ab128915, Abcam, 1:1000) at 4°C overnight. The membranes were washed using PBS the following day, and the membranes were incubated with secondary antibodies for 1 hour at room temperature. The exposure process was then carried out using an ECL developer (Beyoime Bio, China). 2.8. CCK8 Assay. The SCC4 cells of the si-NC group and the si-IGF2BP2-3 group were cultured routinely. The two sets of cells that had good growth status were chosen, and they were inoculated into a 96-well plate at a density of 3x10 3 cells per well. The cells were collected for 1-3 days, and 10μl of CCK8 reagent (KeyGene Bio, China) was added to each well under light-proof conditions. Following a 1-hour incubation at 37°C, the absorbance (OD) value at 450 nm was determined using an enzyme marker. 2.9. EDU Assay. The above two groups of cells in good growth condition were selected and inoculated in 96-well plates at 3 x 10 3 cells per well. After reaching the log phase, 100 μl of EDU (Beyoime Bio, China) solution was added. The mixture was then incubated for three hours at 37°C and fixed for 20 minutes with 4% paraformaldehyde. Then, glycine and PBS containing 0.5% Triton X-100 were used to wash the cells. The cells were incubated for 30 min after adding 100 μl of ApolloR solution per well (protected from light). The cells were then subjected to additional 30 minutes of incubation after Hoechst (100 μl) was added to each well. Finally, using a fluorescence microscope, the cells were photographed and counted. 2.10. Transwell Migration and Invasion Assay. The SCC4 cells of the si-NC group and si-IGF2BP2-3 group were cultured until good growth status was achieved. These cells were then inoculated into transwell chambers (Corning Incorporated, USA) at a density of 3 x 10 4 per well for the migration assay. In the upper chamber, a serum-free medium was introduced, and in the lower chamber, a complete medium was added. Following a 24-hour incubation period, the transwell chambers were removed. Then, the cells were fixed for 20 minutes in 4% paraformaldehyde and stained in 0.1% crystal violet. The cells were subsequently photographed and counted under a microscope. In the invasion assay, Matrigel gel (Corning Incorporated, USA) was applied to the transwell chambers in advance. 2.11. Statistical methods. Data were collected using Image J and statistically analyzed on GraphPad Prism 8 using a t-test with two independent samples and one-way variance. The threshold for statistical significance was set at P <0.05. ***p<0.001; **p<0.01; and *p<0.05. 3. Results 3.1. The Expression Profile of IGF2BPs gene family in HNSCC. The expression pattern of all members of the IGF2BPs gene family across pan-cancer was examined (Figure 2a). Significant upregulation of IGF2BP1, IGF2BP2, and IGF2BP3 was observed in several malignancies, including BRCA, CESC, CHOL, ESCA, LIHC, COAD, LUSC, HNSC, GBM, PAAD, READ, OV, SKCM, UCEC, STAD, and UCS. The mRNA expression levels of the IGF2BPs gene family were found to be considerably higher in HNSCC samples as compared to healthy oral samples (P < 0.001), as revealed by both unpaired and paired sample analyses (Figure 2c-d). Furthermore, the 3D protein structures of three genes from the IGF2BPs gene family were visualized (Figure 2b). The protein expression levels of the IGF2BPs gene family in both healthy and cancerous tissues were also assessed (Figure 3). The findings showed that the IGF2BP2 and IGF2BP3 protein levels were elevated in HNSCC tissues but lowered in normal tissues, including oral mucosa, tonsils, salivary gland, and thyroid gland. Nevertheless, IGF2BP1 was not observed to be expressed in either HNSCC or healthy tissues. Additionally, to evaluate the diagnostic usefulness of the IGF2BPs gene family in HNSCC, the ROC curve was employed. The variables of IGF2BP1, IGF2BP2, and IGF2BP3 revealed a higher accuracy in distinguishing healthy controls from HNSCC samples (AUC = 0.929, 0.910, and 0.811.) (Figure 4). 3.2. Correlation between Clinicopathologic Features and Expression of the IGF2BPs gene family in HNSCC. The study utilized logistic regression analysis to investigate the association between the clinical characteristics of patients with HNSCC and the mRNA expression of genes in the IGF2BPs gene family (Table 1). The findings revealed a positive association of IGF2BP1 expression with the T stage (P = 0.001). IGF2BP2 expression was also significantly positively correlated with lymph node neck dissection and T stage (P = 0.020 and P = 0.009, respectively). Moreover, there was a positive association of IGF2BP3 expression with the clinical stage (P = 0.039) and T stage (P = 0.043). 3.3. Significance of the IGF2BPs gene family in the Prognosis of HNSCC. The survival heatmaps (Figure 5a-b) depict the prognostic significance of the IGF2BPs gene family for overall survival and disease-free survival in diverse tumor types. The Kaplan–Meier curves (Figure 5c) revealed that HNSCC patients with elevated expression levels of IGF2BP2 displayed a lower overall survival(OS) (p = 0.018), with no considerable link to progression-free interval survival (PFI) and disease-specific survival (DSS). The upregulation of IGF2BP2 was related to a poorer HNSCC prognosis, however, the IGF2BP1 and IGF2BP3 expressions did not reveal any links to DSS, PFI, and OS. The univariate analyses demonstrated that certain clinical characteristics were significant risk factors for mortality in individuals with HNSCC (Figure 6a). The M1 stage (P = 0.002), the lack of radiation therapy (P = 0.002), the SD and PD primary therapy outcomes (P <0.001), and lymphovascular invasion (P = 0.002) were among these. Importantly, the HR value of 1.385 for the high expression level of IGF2BP2 in individuals with HNSCC illustrated that the risk of death increased in this group in comparison to the group with low expression (P = 0.018). The multivariate analyses (Figure 6b) showed that a number of variables, such as high N stage (N1, N2, and N3) (P = 0.047), lack of radiation therapy, and primary therapeutic outcomes of SD and PD (P < 0.001), had an impact on overall survival in individuals with HNSCC. However, the level of IGF2BP2 expression did not have an impact on survival outcomes. Moreover, to illustrate the connection between the IGF2BPs gene family and survival likelihood, a nomogram was created (Figure 7a). The individuals with higher points exhibited poor survival outcomes. Additionally, the calibration curves demonstrated that the nomogram plot exhibited excellent predictive ability for OS over 1 and 3 years (Figure 7b). 3.4. The Associated and Co-expressed Genes of the IGF2BPs gene family. A GGI network of the IGF2BPs gene family was generated using the STRING database (Figure 8a). Furthermore, the top 20 co-expressed genes were considered crucial, highly connected hub node genes, i.e., ELAVL4, MOV10, and YBX1, performing a crucial role in some important biological functions, for instance, negative regulation of cellular amide metabolic process, mRNA catabolic process regulation, and RNA stability regulation. The ten leading genes of the IGF2BPs gene family with the highest levels of positive correlation, including PLAG1, HMGA2, and DDX18, and the top ten genes with the lowest levels of expression, including S100A8, TNFRSF13B, and CST3, were illustrated on a heatmap (Figure 8b). 3.5. Biological function enrichment analysis of the IGF2BPs gene family in HNSCC. The 1169 correlated genes of the IGF2BPs gene family that were selected (Figure 9a) were subjected to GO analysis, KEGG analysis, and gene set enrichment analysis. Bubble charts (Figure 9b-e) were generated to represent the analysis results of GO terms, including cellular components (CC), biological processes (BP), and molecular functions (MF), along with KEGG pathway analysis results. Additionally, the mountain plot (Figure 9f) demonstrated the findings of gene set enrichment analysis (GSEA). Furthermore, the substantially linked genes of the IGF2BPs gene family were predominantly enriched in some specific biological processes, for instance, proteasomal protein catabolic process, regulation of neuron projection development, and process utilizing autophagic mechanism (Figure 9b). The substantially associated genes of the IGF2BPs gene family were predominantly enriched in certain cellular components (Figure 9c), such as the cell leading edge, cell−substrate junction, and focal adhesion. The considerably related genes of the IGF2BPs gene family were mainly enriched in certain molecular functions, i.e., cell adhesion molecule binding, serine/threonine protein kinase activity, and cadherin binding (Figure 9d). The associated genes were primarily linked to the regulation of several cellular processes, including the actin cytoskeleton, endocytosis, focal adhesion, protein processing in the endoplasmic reticulum, and signaling pathways like the Hippo and Wnt pathways, as well as pathogenic Escherichia coli infection, according to the KEGG enrichment analysis (Figure 9e). In addition, the results of GSEA illustrated that substantial enrichment of these associated genes was observed in various signaling pathways, i.e., focal adhesion, PI3K-AKT and MAPK signaling pathways, and epithelial-mesenchymal transition (Figure 9f). 3.6. The correlation between the IGF2BPs gene family and tumor Immunity in HNSCC. The estimate-immune-stromal score was used to assess the relationship between the expression of the IGF2BPs gene family and the tumor immune microenvironment (Figure 10). The scatter plot revealed a considerable negative association between the immune score and the expression of IGF2BP1 (r = -0.176; p<0.001), IGF2BP2 (r = -0.335; p<0.001), and IGF2BP3 (r = -0.242; p<0.001). Furthermore, the estimate score was found to be significantly negatively associated with the expression of IGF2BP1 (r = -0.092; p = 0.040), IGF2BP2 (r = -0.235; p<0.001)), and IGF2BP3 (r = -0.151; p<0.001). However, no significant link was found between the expression of the IGF2BPs gene family and stromal score. Moreover, as per the Pearson correlation study, tumor immune infiltration cells (TIICs) displayed a negative association with the expression of the IGF2BPs gene family, such as T cells, Th17 cells, and Treg (Figure 11a). The study also examined the relationship between the IGF2BPs gene family and genes that promote or suppress the immune system in HNSCC. Immunoinhibitory genes such as NECTIN2, TGFBR1, and VTCN1 were found to correlate significantly with the expression of the IGF2BPs gene family. Immunostimulatory genes such as TMIGD2, TNFRSF13B, and TNFRSF4 were significantly negatively associated with the expression of the IGF2BPs gene family (Figure 11b). 3.7. Knockdown of IGF2BP2 gene expression inhibited SCC4 cell line proliferation, migration, and invasion. To gain further insights into the potential involvement of the IGF2BPs gene family in the malignant progression of HNSCC, the IGF2BP2 gene was subjected to in vitro experiments. To achieve knockdown of IGF2BP2 expression in the SCC4 cell line, siRNA was employed, and the knockdown efficiency was validated by RT-qPCR and western blot assays (Figure 12a–b). The si-IGF2BP2-3 effectively attenuated the expression of the IGF2BP2 gene in the SCC4 cell line when compared to si-NC. Thus, si-IGF2BP2-3 was selected for further experiments. The proliferation ability of the SCC4 cell line was evaluated using CCK8 and EDU assays (Figure 12c-d). The knockdown of the IGF2BP2 gene through siRNA significantly suppressed the DNA replication and proliferation capabilities of the SCC4 cell line when compared to the si-NC treatment. Additionally, the invasion and migration capabilities of the SCC4 cell line were evaluated through a transwell assay (Figure 12e), which showed that the knockdown of the IGF2BP2 gene could effectively suppress the cell migration and invasion abilities. 4. Discussion Despite significant advancements in the treatment of HNSCC, including surgery, radiotherapy, and chemotherapy, the disease remains challenging due to its propensity for metastasis and recurrence. Even though immunotherapy and targeted therapy have emerged as promising treatments for HNSCC in recent years, drug resistance remains a major issue 19 . The IGF2BPs gene family is an RNA-binding protein containing IGF2BP1, IGF2BP2, and IGF2BP3. Previously reported studies have demonstrated that the IGF2BPs gene family is aberrantly expressed in lung, liver, and colorectal cancers and associated with poor prognosis, but its prognostic value and potential biological function in HNSCC have not been revealed 7 – 14 . This study creatively combined bioinformatics analysis with in vitro experiments to reveal the important role of the IGF2BPs gene family in HNSCC and provide a basis for future therapeutic strategies for HNSCC. In this study, the expression level of the IGF2BPs gene family was shown to be significantly higher in HNSCC than in healthy head and neck tissues. Previous studies also showed that IGF2BP2 and IGF2BP3 expression levels were significantly greater in HNSCC tumor tissues compared to healthy control samples, and they were linked to a poor prognosis in HNSCC patients 20 , 21 . Furthermore, the present investigation revealed that the elevated expression level of the IGF2BPs gene family was linked to the clinical stage, T stage, and lymph node neck dissection. Lin and Young et al. also showed that IGF2BP2 and IGF2BP3 in HNSCC were strongly associated with cancer stage and lymph node metastasis in HNSCC 22 , 23 . The findings suggest that overexpression of the IGF2BPs gene family may promote the onset and progression of HNSCC by enhancing lymph node metastasis. Furthermore, through the analysis of ROC curves, it was observed that the IGF2BPs gene family had a high accuracy in distinguishing between HNSCC samples and normal control tissues. In studying preoperative biopsy material from HNSCC patients, Achille et al. studied that IGF2BP3 was closely associated with perineural infiltration in HNSCC patients and could assist in the diagnosis of HNSCC patients and perform accurate preoperative stratification, leading to accurate treatment planning 24 . This evidence suggested that the IGF2BPs gene family may be a diagnostic biomarker for HNSCC. By comparing patients with high IGF2BP2 expression to those with low expression, the examination of patient survival data showed a substantial decline in OS. Univariate regression analysis confirmed IGF2BP2 as an independent risk factor for HNSCC, which is consistent with previous studies 22 , 25 . The association between higher IGF2BP2 expression and worse survival results raises the possibility that IGF2BP2 could be used as an independent biomarker to predict prognosis in HNSCC patients. Based on the combined expression levels of the IGF2BPs gene family and other clinical parameters for predicting 1-, 3-, and 5-year survival, a nomogram plot was created to improve the accuracy of survival prediction. To validate these results, however, additional clinical research with larger cohorts is required. The GGI network revealed coexpression of the genes of the IGF2BPs gene family with some other important genes, i.e., YBX1, which colocalized with IGF2BP1 in the cytoplasm. IGF2BP1 stabilized the YBX1 by correlating with the Coding Region instability Determinant (CRD) 26 . Moreover, YBX1 was upregulated in lung adenocarcinoma and acted as an independent predictor of the prognosis and recurrence of lung adenocarcinoma 27 . The stabilization of YBX1 by IGF2BP1 may be a crucial mechanism in the onset and progression of the disease. The IGF2BPs gene family was found to be enriched in several key biological processes, such as the PI3K-AKT, and MAPK signaling pathways, as well as epithelial-mesenchymal transition. In colorectal cancer, METTL3 targeted EphA2 and VEGFA via different IGF2BPs-dependent mechanisms were found to promote vasculogenic mimicry formation via PI3K/AKT/mTOR signaling 28 . The levels of expression of IGF2BP3 were considerably elevated in Glioblastoma in comparison to healthy tissues. The effects of IGF2BP3 were exerted on Glioblastoma through IGF-2, leading to the activation of MAPK signaling, which eventually promoted the progression of Glioblastoma 29 . CircIGHG was significantly elevated in HNSCC and associated with poor prognosis. CircIGHG could target miR-142-5p to enhance IGF2BP3 activity and promote HNSCC progression through the epithelial-mesenchymal transition 21 . In conclusion, the IGF2BPs gene family may promote tumor development and metastasis through various pathways including the PI3K-AKT signaling pathway, MAPK signaling pathway, and epithelial-mesenchymal transition. Tumor immunotherapy has long been approved for patients with recurrent and metastatic HNSCC. The tumor immune microenvironment has been shown to be potentially involved in the response to tumor immunotherapy 30 . It was found that the IGF2BPs gene family was negatively associated with the tumor immune microenvironment in HNSCC. Yang et al. conducted a study demonstrating the close association of IGF2BP1 with the immune microenvironment in hepatocellular carcinoma. Their findings revealed that IGF2BP1 knockdown considerably increased the infiltration of immune cells such as T cells, NK cells, and macrophages in tumors and decreased the expression of PD-L1. Hence, IGF2BP1 could hold value as a target for immunotherapy in patients with hepatocellular carcinoma 31 . As a result of the suppressed tumor immune microenvironment, these findings show that high expression of the IGF2BPs gene family may promote tumor advancement. Additionally, the study revealed that the IGF2BPs gene family has a strong association with T cells and other immune infiltrating cells, which are vital in anti-tumor activities during immunotherapy. Exhausted T cells are known to contribute to uncontrollable tumor growth 32 . Wan et al. demonstrated that inhibiting IGF2BP3 expression in breast cancer leads to T cell activation, thereby improving immune regulation in tumors 33 . These findings indicated that high expression of the IGF2BPs gene family may lead to accelerated tumor progression by inhibiting tumor immune infiltrating cells. In addition, it was also revealed that the IGF2BPs gene family was substantially associated with quite a few immune inhibitory genes, i.e., TGFB1, and some immune-stimulatory genes, i.e., TNFRSF4. Cancer-associated fibroblasts (CAFs) within the tumor microenvironment in HNSCC contributed to promoting immunosuppression and evasion from immune surveillance. Moreover, CAFs had a greater TGFB1 expression level 34 . These investigations suggested that the IGF2BPs gene family can accelerate the development of HNSCC by controlling immune inhibitory genes. Lower levels of expression of TNFRSF4 were linked to poor survival, and it can play a key role in HNSCC outcomes 35 . The IGF2BPs gene family can stimulate the development of HNSCC by attenuating the expression of these immune-stimulatory genes. In conclusion, the IGF2BPs gene family has a close association with tumor immunity in HNSCC, suggesting that further research on this gene family may provide a new foundation for the development of immunotherapy for HNSCC. Finally, in vitro research was conducted to determine how the IGF2BPs gene family affects the biological functioning of HNSCC. IGF2BP2 expression was knocked down in the HNSCC cell line SCC4, and several functional tests were carried out to investigate the function of IGF2BP2 in HNSCC. Subsequent to knocking down the expression level of IGF2BP2, the migration, cell proliferation, and invasion abilities of SCC4 were found to have considerably reduced. The outcomes of Ke et al. were consistent with the current study, where a considerable attenuation in the proliferation and migration abilities of HNSCC cells was studied following a knockdown of IGF2BP2 expression 20 . These results imply that IGF2BP2 might play a significant role in the development of HNSCC and may act as a future therapeutic target for HNSCC treatment. The objective of the current investigation was to examine the expression pattern and diagnostic and prognostic significance of the IGF2BPs gene family in HNSCC, along with investigating its relationship with tumor immunity to enhance comprehension of its regulation of the tumor microenvironment. In addition, it was verified by in vitro experiments that IGF2BP2 could promote HNSCC development. Nonetheless, there are several shortcomings in the study that must be addressed. Additional research is required to validate the biological significance of the IGF2BPs gene family in HNSCC and clarify the underlying mechanisms. Secondly, the prognostic role of the IGF2BPs gene family in HNSCC needs to be further validated by clinical large cohort studies. Finally, more research on the link between HNSCC immunity and the IGF2BPs gene family is required. 5. Conclusion The current investigation revealed that the IGF2BPs gene family exhibited high expression levels in HNSCC, and could accurately predict this disease. The results also revealed that patients with HNSCC had a poor prognosis and had a significant expression of the IGF2BPs gene family. Furthermore, this research showed a direct link between the immunological microenvironment of HNSCC and the IGF2BPs gene family, and in vitro tests showed that IGF2BP2 knockdown could efficiently inhibit HNSCC cells from proliferating, and migrating, as well as limit their invasive capacities. According to these findings, the IGF2BPs gene family may be a useful biomarker and therapeutic target for HNSCC. To validate and facilitate the therapeutic application of these findings, additional research is needed. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Data Availability Statement The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author/s. Competing interests The authors declare that they have no competing interests. Funding Statement This research work is funded by National Natural Science Foundation of China (Grant No.: 82102721), Guangzhou Science and Technology Bureau Project (Grant No.: 2060206), as well as the special basic research project funded by Stomatology Hospital, Southern Medical University (Grant No.: 2060206). Authors contribution statement HT conceptualized the research idea, performed the study design, conducted all bioinformatics analyses, interpreted the results, and wrote the paper. JL and JZ contributed equally as the corresponding authors to the project conception and supervision. Acknowledgements Nothing to declare. References Cohen N, Fedewa S, Chen AY. Epidemiology and Demographics of the Head and Neck Cancer Population. Oral and maxillofacial surgery clinics of North America . Nov 2018;30(4):381-395. doi:10.1016/j.coms.2018.06.001 Caudell JJ, Gillison ML, Maghami E, et al. NCCN Guidelines® Insights: Head and Neck Cancers, Version 1.2022. Journal of the National Comprehensive Cancer Network : JNCCN . Mar 2022;20(3):224-234. doi:10.6004/jnccn.2022.0016 Marur S, Forastiere AA. Head and Neck Squamous Cell Carcinoma: Update on Epidemiology, Diagnosis, and Treatment. Mayo Clinic proceedings . Mar 2016;91(3):386-96. doi:10.1016/j.mayocp.2015.12.017 Li H, Zhang Y, Xu M, Yang D. Current trends of targeted therapy for oral squamous cell carcinoma. Journal of cancer research and clinical oncology . Sep 2022;148(9):2169-2186. doi:10.1007/s00432-022-04028-8 Degrauwe N, Suvà ML, Janiszewska M, Riggi N, Stamenkovic I. IMPs: an RNA-binding protein family that provides a link between stem cell maintenance in normal development and cancer. Genes & development . Nov 15 2016;30(22):2459-2474. doi:10.1101/gad.287540.116 Bell JL, Wächter K, Mühleck B, et al. Insulin-like growth factor 2 mRNA-binding proteins (IGF2BPs): post-transcriptional drivers of cancer progression? Cellular and molecular life sciences : CMLS . Aug 2013;70(15):2657-75. doi:10.1007/s00018-012-1186-z Kato T, Hayama S, Yamabuki T, et al. Increased expression of insulin-like growth factor-II messenger RNA-binding protein 1 is associated with tumor progression in patients with lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research . Jan 15 2007;13(2 Pt 1):434-42. doi:10.1158/1078-0432.Ccr-06-1297 Guo W, Huai Q, Wan H, et al. Prognostic Impact of IGF2BP3 Expression in Patients with Surgically Resected Lung Adenocarcinoma. DNA and cell biology . Feb 2021;40(2):316-331. doi:10.1089/dna.2020.6136 Gutschner T, Hämmerle M, Pazaitis N, et al. Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) is an important protumorigenic factor in hepatocellular carcinoma. Hepatology (Baltimore, Md) . May 2014;59(5):1900-11. doi:10.1002/hep.26997 Pu J, Wang J, Qin Z, et al. IGF2BP2 Promotes Liver Cancer Growth Through an m6A-FEN1-Dependent Mechanism. Frontiers in oncology . 2020;10:578816. doi:10.3389/fonc.2020.578816 Gao Y, Yang M, Jiang Z, et al. IMP3 expression is associated with poor outcome and epigenetic deregulation in intrahepatic cholangiocarcinoma. Human pathology . Jun 2014;45(6):1184-91. doi:10.1016/j.humpath.2014.01.016 Zhang XL, Li KJ, Feng JX, Liu GJ, Feng YL. Blocking the IGF2BP1-promoted glucose metabolism of colon cancer cells via direct de-stabilizing mRNA of the LDHA enhances anticancer effects. Molecular therapy Nucleic acids . Mar 5 2021;23:835-846. doi:10.1016/j.omtn.2020.12.020 Ye S, Song W, Xu X, Zhao X, Yang L. IGF2BP2 promotes colorectal cancer cell proliferation and survival through interfering with RAF-1 degradation by miR-195. FEBS letters . Jun 2016;590(11):1641-50. doi:10.1002/1873-3468.12205 Xu W, Sheng Y, Guo Y, et al. Increased IGF2BP3 expression promotes the aggressive phenotypes of colorectal cancer cells in vitro and vivo. Journal of cellular physiology . Aug 2019;234(10):18466-18479. doi:10.1002/jcp.28483 Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics : a journal of integrative biology . May 2012;16(5):284-7. doi:10.1089/omi.2011.0118 Bindea G, Mlecnik B, Tosolini M, et al. Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. Immunity . Oct 17 2013;39(4):782-95. doi:10.1016/j.immuni.2013.10.003 Hänzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis for microarray and RNA-seq data. BMC bioinformatics . Jan 16 2013;14:7. doi:10.1186/1471-2105-14-7 Veigas F, Mahmoud YD, Merlo J, Rinflerch A, Rabinovich GA, Girotti MR. Immune Checkpoints Pathways in Head and Neck Squamous Cell Carcinoma. Cancers . Mar 1 2021;13(5)doi:10.3390/cancers13051018 Amaral MN, Faísca P, Ferreira HA, Gaspar MM, Reis CP. Current Insights and Progress in the Clinical Management of Head and Neck Cancer. Cancers . Dec 10 2022;14(24)doi:10.3390/cancers14246079 Xu K, Dai X, Wu J, Wen K. N(6)-methyladenosine (m(6)A) reader IGF2BP2 stabilizes HK2 stability to accelerate the Warburg effect of oral squamous cell carcinoma progression. Journal of cancer research and clinical oncology . Dec 2022;148(12):3375-3384. doi:10.1007/s00432-022-04093-z Liu J, Jiang X, Zou A, et al. circIGHG-Induced Epithelial-to-Mesenchymal Transition Promotes Oral Squamous Cell Carcinoma Progression via miR-142-5p/IGF2BP3 Signaling. Cancer research . Jan 15 2021;81(2):344-355. doi:10.1158/0008-5472.Can-20-0554 Lin SH, Lin CW, Lu JW, et al. Cytoplasmic IGF2BP2 Protein Expression in Human Patients with Oral Squamous Cell Carcinoma: Prognostic and Clinical Implications. International journal of medical sciences . 2022;19(7):1198-1204. doi:10.7150/ijms.74751 Hwang YS, Ahn SY, Moon S, et al. Insulin-like growth factor-II mRNA binding protein-3 and podoplanin expression are associated with bone invasion and prognosis in oral squamous cell carcinoma. Archives of oral biology . Sep 2016;69:25-32. doi:10.1016/j.archoralbio.2016.05.008 Tarsitano A, Asioli S, Morandi L, et al. Laminin-5 and insulin-like growth factor-II mRNA binding protein-3 (IMP3) expression in preoperative biopsy specimens from oral cancer patients: Their role in neural spread risk and survival stratification. Journal of cranio-maxillo-facial surgery : official publication of the European Association for Cranio-Maxillo-Facial Surgery . Dec 2016;44(12):1896-1902. doi:10.1016/j.jcms.2016.07.012 Wu ZH, Yue JX, Zhou T, Xiao HJ. Integrated analysis of the prognostic values of RNA-binding proteins in head and neck squamous cell carcinoma. BioFactors (Oxford, England) . May 2021;47(3):478-488. doi:10.1002/biof.1722 Weidensdorfer D, Stöhr N, Baude A, et al. Control of c-myc mRNA stability by IGF2BP1-associated cytoplasmic RNPs. RNA (New York, NY) . Jan 2009;15(1):104-15. doi:10.1261/rna.1175909 Xie Q, Zhao S, Liu W, et al. YBX1 Enhances Metastasis and Stemness by Transcriptionally Regulating MUC1 in Lung Adenocarcinoma. Frontiers in oncology . 2021;11:702491. doi:10.3389/fonc.2021.702491 Liu X, He H, Zhang F, et al. m6A methylated EphA2 and VEGFA through IGF2BP2/3 regulation promotes vasculogenic mimicry in colorectal cancer via PI3K/AKT and ERK1/2 signaling. Cell death & disease . May 21 2022;13(5):483. doi:10.1038/s41419-022-04950-2 Suvasini R, Shruti B, Thota B, et al. Insulin growth factor-2 binding protein 3 (IGF2BP3) is a glioblastoma-specific marker that activates phosphatidylinositol 3-kinase/mitogen-activated protein kinase (PI3K/MAPK) pathways by modulating IGF-2. The Journal of biological chemistry . Jul 22 2011;286(29):25882-90. doi:10.1074/jbc.M110.178012 Pitt JM, Marabelle A, Eggermont A, Soria JC, Kroemer G, Zitvogel L. Targeting the tumor microenvironment: removing obstruction to anticancer immune responses and immunotherapy. Annals of oncology : official journal of the European Society for Medical Oncology . Aug 2016;27(8):1482-92. doi:10.1093/annonc/mdw168 Liu Y, Guo Q, Yang H, et al. Allosteric Regulation of IGF2BP1 as a Novel Strategy for the Activation of Tumor Immune Microenvironment. ACS central science . Aug 24 2022;8(8):1102-1115. doi:10.1021/acscentsci.2c00107 Wang Q, Qin Y, Li B. CD8(+) T cell exhaustion and cancer immunotherapy. Cancer letters . Apr 10 2023;559:216043. doi:10.1016/j.canlet.2022.216043 Wan W, Ao X, Chen Q, et al. METTL3/IGF2BP3 axis inhibits tumor immune surveillance by upregulating N(6)-methyladenosine modification of PD-L1 mRNA in breast cancer. Molecular cancer . Feb 23 2022;21(1):60. doi:10.1186/s12943-021-01447-y Takahashi H, Sakakura K, Kawabata-Iwakawa R, et al. Immunosuppressive activity of cancer-associated fibroblasts in head and neck squamous cell carcinoma. Cancer immunology, immunotherapy : CII . Nov 2015;64(11):1407-17. doi:10.1007/s00262-015-1742-0 Qi Z, Liu Y, Mints M, et al. Single-Cell Deconvolution of Head and Neck Squamous Cell Carcinoma. Cancers . Mar 11 2021;13(6)doi:10.3390/cancers13061230 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Oct, 2023 Read the published version in Heliyon → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2820861","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":193790937,"identity":"6d0b95bd-76de-467e-83ae-3b674ae1b66c","order_by":0,"name":"Hai Tang","email":"","orcid":"","institution":"Southern Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hai","middleName":"","lastName":"Tang","suffix":""},{"id":193790938,"identity":"7283659d-455d-4dfc-b25f-42a9a59048da","order_by":1,"name":"Jingpeng Liu","email":"","orcid":"","institution":"Southern Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jingpeng","middleName":"","lastName":"Liu","suffix":""},{"id":193790939,"identity":"64a1b839-73cc-4168-b61c-d10c7ae97912","order_by":2,"name":"Jianjiang Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYFCCA4mPf1RIyDEwk6Al2ZjhjIUxKVoY2KQZ2yoSG4hWL9944IF0AZtE+vx23oMfGGpsoglqYWw4kGA8g0cid8NhvmQJhmNpuQStY2Y4kJDAIwHUwsxjIMHYcJiwFjaglgNAxenyzTzGP4jSwgMM5GaeBIkEhsM8ZsTZIgEMZMYZByQMNwC1WCQQ4xf5GWfSf3z8Vycv33/G+MaHGhvCWhgkziQgOAm4VKEA/vYDRKkbBaNgFIyCEQwA9jE9Tpdnk60AAAAASUVORK5CYII=","orcid":"","institution":"Southern Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jianjiang","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2023-04-15 13:14:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2820861/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2820861/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1016/j.heliyon.2023.e20659","type":"published","date":"2023-10-01T07:56:09+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":36274857,"identity":"ffe4802d-c89b-4af1-a291-db584afba450","added_by":"auto","created_at":"2023-04-25 13:14:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":147959,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe current study design was illustrated using a schematic diagram.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/d7cc442fb8e88c18df6af049.png"},{"id":36275580,"identity":"db3c541f-4e36-4209-b563-edf6ad8d2192","added_by":"auto","created_at":"2023-04-25 13:22:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":486175,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe pattern of expression of the IGF2BPs gene family.\u003c/strong\u003e (a) The pattern of expression of the IGF2BPs gene family in pan-cancer. (b) The 3D protein structure of the IGF2BPs gene family. (c-d) The pattern of expression of the IGF2BPs gene family in HNSCC using paired and unpaired sample analysis.\u003c/p\u003e","description":"","filename":"Figure2..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/8896057080c7a4381964ec1a.png"},{"id":36275581,"identity":"63e536c1-3c71-4dc7-8a1c-c263c63f08bb","added_by":"auto","created_at":"2023-04-25 13:22:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":953511,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of the protein of the IGF2BPs gene family in HNSCC. \u003c/strong\u003eImmunohistochemical profiles showed the level of expression of the IGF2BPs gene family in HNSCC and healthy tissues at the protein level.\u003c/p\u003e","description":"","filename":"Figure3..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/20e4dbbbe6ce62e2add72b47.png"},{"id":36274858,"identity":"ef6be65f-8358-440a-a030-6f29bc0ffa68","added_by":"auto","created_at":"2023-04-25 13:14:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":110807,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe diagnostic values of the IGF2BPs gene family in HNSCC were evaluated using ROC curves.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure4..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/24c2355cc44b6506b3e31743.png"},{"id":36274861,"identity":"4e985542-3bfe-4b22-b187-c2b06951922e","added_by":"auto","created_at":"2023-04-25 13:14:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":383057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSurvival analysis findings of the IGF2BPs gene family. \u003c/strong\u003e(a-b) The survival map illustrated the prognosis-predictive values of the IGF2BPs gene family in overall survival (OS) and disease-free survival (DFS) of multiple pan-cancer. (c) The IGF2BPs gene family and three prognostic outcomes—disease-specific survival (DSS), progression-free interval survival (PFI), and overall survival (OS) in individuals with HNSCC—were correlated, as shown by the Kaplan-Meier curves.\u003c/p\u003e","description":"","filename":"Figure5..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/9bc21a2372cab2cccef4f061.png"},{"id":36275582,"identity":"1a503b27-3097-46f1-9a29-b4f412165270","added_by":"auto","created_at":"2023-04-25 13:22:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":388552,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eForrest plots revealed the correlation between the clinical features and the IGF2BPs gene family in HNSCC. \u003c/strong\u003e(a) The Univariate Cox regression analyses. (b) The multivariate Cox regression analyses.\u003c/p\u003e","description":"","filename":"Figure6..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/4165042c951291e99f269f55.png"},{"id":36276002,"identity":"e709142d-8d88-4bb8-9ac3-da290bc6df0b","added_by":"auto","created_at":"2023-04-25 13:30:46","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":309469,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe nomogram and calibration plots. \u003c/strong\u003e(a) The nomogram plots were utilized to assess the OS over 1, 3, and 5 years for HNSCC patients. (C) The calibration plots were utilized to predict the accuracy of the nomogram model of 1, 3, and 5- years.\u003c/p\u003e","description":"","filename":"Figure7..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/adcbd65f0c1d9f929353116d.png"},{"id":36274865,"identity":"7af5ed58-6a55-4a85-96c0-3139a8c3bf41","added_by":"auto","created_at":"2023-04-25 13:14:47","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":658678,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe co-expressed and associated genes of the IGF2BPs gene family.\u003c/strong\u003e (a) Gene-gene interaction (GGI) network. (b) Top 10 genes positively and negatively correlated with IGF2BPs gene family in HNSCC.\u003c/p\u003e","description":"","filename":"Figure8..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/b731d6cf09d1047a49487eef.png"},{"id":36274864,"identity":"38566096-8df7-419a-9a1c-9c4becbf5b3d","added_by":"auto","created_at":"2023-04-25 13:14:46","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":618226,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiological function enrichment analysis. \u003c/strong\u003e(a) The Venn diagram illustrated the associated genes in the IGF2BPs gene family. (b) The biological processes (BP) in GO terms. (c) The cellular components (CC) in GO terms. (d) The molecular functions (MF) in GO terms. (e) The KEGG signaling pathways. (f) The gene set enrichment analysis.\u003c/p\u003e","description":"","filename":"Figure9..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/c5ae81f23f628e89c74be078.png"},{"id":36275585,"identity":"2641839e-1872-4119-95a8-68ce00cde5f7","added_by":"auto","created_at":"2023-04-25 13:22:47","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":716829,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe link between the IGF2BPs gene family and tumor microenvironment by evaluation of the Estimate-Immune-Stromal score in HNSCC.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure10..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/b504165d729ba196d97c776c.png"},{"id":36276130,"identity":"55458530-d528-422c-8a4f-a54ccce0006b","added_by":"auto","created_at":"2023-04-25 13:38:46","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":343000,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe link between the IGF2BPs gene family and tumor immunity in HNSCC. \u003c/strong\u003e(a) The link between immune cell infiltration and the IGF2BPs gene family in HNSCC. (b) The link between immune inhibitory/stimulatory genes and the IGF2BPs gene family in HNSCC.\u003c/p\u003e","description":"","filename":"Figure11..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/2540314b369b1bd009c83230.png"},{"id":36274867,"identity":"db689861-d491-4db9-8498-b1b8799288fa","added_by":"auto","created_at":"2023-04-25 13:14:47","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":813889,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe proliferation, migration, and invasion capacities of the SCC4 cell line were inhibited by the knockdown of IGF2BP2 expression.\u003c/strong\u003e (a-b) The expression of IGF2BP2 in the SCC4 cell line was knocked down by siRNA and the knockdown efficiency was verified by RT-qPCR and western blot assays. (c-d) CCK8 and EDU proliferation assays revealed that the knockdown of IGF2BP2 expression considerably inhibited the proliferation behavior in SCC4 cell lines compared to si-NC. (e) Transwell assay showed that knockdown of IGF2BP2 expression significantly inhibited migration and invasion behavior in the SCC4 cell line compared to si-NC. (*p\u0026lt;0.05, **p\u0026lt;0.01, and ***p\u0026lt;0.001)\u003c/p\u003e","description":"","filename":"Figure12..png","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/e9d1ba6627f51059d4a21de5.png"},{"id":54276492,"identity":"45243c9b-b26a-4094-bca5-ec12a1a98c33","added_by":"auto","created_at":"2024-04-08 07:56:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6614399,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2820861/v1/b8097e06-ed9e-4c58-9303-d143114d0402.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comprehensive Analysis of the Expression of the IGF2BPs gene family in Head and Neck Squamous Cell Carcinoma: Association with Prognostic Value and Tumor Immunity","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHead and neck cancer represents a group of malignant tumors that manifest in diverse anatomic areas of the upper gastrointestinal tract. Globally, over 830,000 new cases of head and neck cancer are reported to be diagnosed each year, with head and neck squamous cell carcinoma (HNSCC) accounting for more than 95% of cases. The primary risk contributors to HNSCC are smoking, betel nut consumption, alcohol consumption, genetic susceptibility, and human papillomavirus (HPV) infection\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Despite significant progress in HNSCC research and therapy, the primary treatment for HNSCC patients still relies on surgical resection along with radiotherapy, chemotherapy, and immunotherapy\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The 5-year survival rate is still below 50% because HNSCC is aggressive, metastatic, and recurring\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Gene targeting therapy has demonstrated promise in the treatment of HNSCC in recent years\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. However, HNSCC development is a complicated process that involves various genes. Therefore, finding new targets is crucial for improving the care and prognosis of individuals with HNSCC.\u003c/p\u003e \u003cp\u003eInsulin-like growth factor 2 mRNA binding proteins (IGF2BPs), also known as IMPs, comprise three members: IGF2BP1, IGF2BP2, and IGF2BP3. They belong to the family of oncofetal RNA-binding proteins (RBPs), are encoded by the IGF2BPs gene family, and considerably conserved, and exert significant regulatory control over RNA processing, at various levels, such as localization, translation, and stability\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The IGF2BPs gene family is predominantly expressed during mammalian embryonic development, and its contributions to pivotal cellular processes, such as cell proliferation, differentiation, and metabolism, have been established\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The scientific community has recently identified the IGF2BPs gene family as being dysregulated in several tumor tissues, including lung, liver, and colon cancers. The dysregulation of the IGF2BPs gene family further enhances the proliferation, migration, and invasive capabilities of tumor cells, thereby establishing a link between the IGF2BPs gene family and a poor prognosis\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11 CR12 CR13\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. However, despite the advancements in cancer research, a limited understanding of the potential mechanisms of the IGF2BPs gene family is available. Consequently, there is a pressing need to unravel its expression patterns and molecular functions in HNSCC.\u003c/p\u003e \u003cp\u003eThis research used bioinformatics technologies to examine the relationship between three IGF2BPs gene family members and HNSCC. Furthermore, the biological significance of IGF2BP2 in HNSCC was confirmed through in vitro experiments. The present investigation utilized information from the TCGA database, HPA database, and GEPIA2 database to explore the association of 3 genes in the IGF2BPs gene family with expression pattern, clinical characteristics, prognostic value, diagnostic value, associated genes, biofunctional enrichment, and tumor immunity in HNSCC patients. To further examined the malignant biological behavior of the IGF2BPs gene family in HNSCC, the expression of the IGF2BP2 gene was knocked down in HNSCC cell line SCC4 cells using small interfering RNA. The effects of knocking down IGF2BP2 expression levels on the biological functions of the SCC4 cell line were analyzed using CCK8 assay, EDU assay, and transwell migration and invasion assays. The findings of this study revealed that the IGF2BPs gene family may function as a possible diagnostic and predictive biomarker for HNSCC patients, and it exerts a tumor-promoting role in HNSCC. Therefore, the IGF2BPs gene family has the ability to be utilized as a promising biomarker and therapeutic target for the management of HNSCC in the future.\u003c/p\u003e"},{"header":"2. Material And Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Expression of the IGF2BPs gene family in Pan-Cancer and HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA schematic diagram was employed to depict the study structure (Figure 1). The expression profiles of the IGF2BPs gene family, along with the associated clinical data for 44 healthy control tissues and 502 HNSCC tumor samples, were acquired from the TCGA database. The gene expression data in HTSeq-FPKM RNAseq format were subjected to conversion into TPM and log2 transformation. The ggplot2 package in R (v 3.6.3) was used to analyze and visualize the expression data of the IGF2BPs gene family in HNSCC and pan-cancer samples. The Wilcoxon rank-sum test was utilized for unpaired samples. In the case of paired sample analysis, if the sample satisfies the Shapiro-Wilk normality test (p \u0026gt; 0.05), the paired sample t-test was used, otherwise, the Wilcoxon signed rank test was performed. Furthermore, the cBioPortal database was used to get the three-dimensional (3D) protein structures of the IGF2BPs gene family. The HPA database was searched to retrieve the immunohistochemical staining images of the IGF2BPs gene family in healthy control tissues and HNSCC. Furthermore, the pROC package in R was used to produce receiver operating characteristic (ROC) curves and the ggplot2 package for visualization. A logistic regression model was used to evaluate the association between the clinical features (shown in Table 1) and the IGF2BPs gene family expression levels.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. Results of logistic regression illustrated the correlation identified between the expression of the IGF2BPs gene family and clinical features.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"994\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003cp\u003e(N)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003eIGF2BP1\u003c/p\u003e\n \u003cp\u003eOdds Ratio(OR)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\" valign=\"top\"\u003e\n \u003cp\u003eTotal(N)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\" valign=\"top\"\u003e\n \u003cp\u003eIGF2BP2\u003c/p\u003e\n \u003cp\u003eOdds Ratio(OR)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\" valign=\"top\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\" valign=\"top\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003cp\u003e(N)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003eIGF2BP3\u003c/p\u003e\n \u003cp\u003eOdds Ratio(OR)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\" valign=\"top\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eT stage (T3\u0026amp;T4 vs. T1\u0026amp;T2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e487\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.861 (1.282-2.714)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e487\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.647 (1.136-2.396)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.009\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e487\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.468 (1.014-2.131)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.043\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eN stage (N1\u0026amp;N2\u0026amp;N3 vs. N0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e480\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.000 (0.699-1.431)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e480\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.034 (0.723-1.479)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.855\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e480\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e0.983 (0.687-1.407)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.926\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eM stage (M1 vs. M0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e477\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.254 (0.013-1.734)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e477\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.246 (0.013-1.677)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.211\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e477\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e0.236 (0.012-1.607)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.198\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eClinical stage (Stage III\u0026amp;Stage IV vs. Stage I\u0026amp;Stage II)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.498 (0.983-2.296)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.062\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.414 (0.929-2.166)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.564 (1.026-2.397)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.039\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eRadiation therapy (Yes vs. No)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.230 (0.831-1.822)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.302\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.823 (0.556-1.218)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.331\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.438 (0.970-2.138)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.071\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003ePrimary therapy outcome (PR\u0026amp;CR vs. PD\u0026amp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e418\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.417 (0.771-2.645)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.265\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e418\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.753 (0.406-1.383)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.362\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e418\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.314 (0.715-2.452)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.382\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eGender (Male vs. Female)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e502\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.960 (0.646-1.426)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.840\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e502\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.130 (0.761-1.681)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.545\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e502\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.331 (0.896-1.984)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.158\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eRace (Asian\u0026amp;Black or African American vs. White)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e485\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.316 (0.757-2.314)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.333\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e485\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.238 (0.712-2.168)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.451\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e485\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.122 (0.645-1.959)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.685\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eAge (\u0026gt;60 vs. \u0026lt;=60)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e501\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.164 (0.820-1.653)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.397\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e501\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.845 (0.595-1.200)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.348\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e501\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.092 (0.769-1.551)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.624\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eHistologic grade (G3\u0026amp;G4 vs. G1\u0026amp;G2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e483\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.516 (1.003-2.305)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.050\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e483\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.952 (0.630-1.437)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.813\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e483\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e0.995 (0.658-1.502)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.979\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eSmoker (Yes vs. No)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e492\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.177 (0.771-1.801)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.450\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e492\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.177 (0.771-1.801)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.450\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e492\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.095 (0.717-1.674)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.674\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eAlcohol history (Yes vs. No)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.981 (0.671-1.433)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.920\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e0.970 (0.664-1.418)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.876\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.168 (0.800-1.708)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.422\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eLymphovascular invasion (Yes vs. No)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e341\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.143 (0.733-1.785)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.556\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e341\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.082 (0.694-1.690)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e0.729\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e341\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e1.159 (0.744-1.808)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.513\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.919517102615693%\"\u003e\n \u003cp\u003eLymphnode neck dissection (Yes vs. No)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e499\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.458 (0.922-2.324)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e0.109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e499\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.191146881287727%\"\u003e\n \u003cp\u003e1.742 (1.097-2.795)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.639839034205232%\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.020\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.73440643863179%\"\u003e\n \u003cp\u003e499\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e0.751 (0.473-1.186)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.835010060362173%\"\u003e\n \u003cp\u003e0.221\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Prognostic Value Estimation of the IGF2BPs gene family in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe IGF2BPs gene family in pan-cancer was mapped using the GEPIA2 database for both overall survival and disease-free survival. Three prognostic indicators were investigated for the purpose of ascertaining the prognostic significance of the IGF2BPs gene family in HNSCC: disease-specific survival, overall survival, and progress-free interval survival. Kaplan-Meier curves were generated using the R tool survminer. Furthermore, the Coxph function in R was employed for conducting univariate and multivariate Cox regression analyses to investigate the association between clinical variables and prognosis. The ggplot2 package in R was utilized to construct forest plots. The rms package and survival package in R were used to build nomogram plots and calibration plots.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Functional Terms Identification of the Associated Genes of the IGF2BPs gene family.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe GeneMANIA website was used to develop a gene-gene interaction (GGI) network to examine\u0026nbsp;the interactions between the IGF2BPs gene family and other genes. In order to further explore the genes that are positively and negatively associated with the IGF2BP gene family in HNSCC, a heatmap of the top 10 genes was produced using the R ggplot2 package. Subsequently, 1169 genes closely related to all three members of the IGF2BPs gene family were identified. Using the cluster profile package in R, which assessed the GO terms (cellular components [CCs], biological processes [BPs], molecular functions [MFs]), and KEGG pathways, the biological function enrichment of these 1169 genes was examined\u003csup\u003e15\u003c/sup\u003e. Additionally, the cluster profile package in R was utilized for GSEA.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. The Link between the IGF2BPs gene family and Tumor Immunity in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to examine the relationship between the IGF2BPs gene family and the tumor immune microenvironment (estimate score, immune score, and stromal score) in HNSCC, this study used the estimate package in R. Moreover, 24 tumor-specific immune infiltrating cells were identified by Professor Bindea, and the GSVA package in R was employed to investigate the association of the IGF2BPs gene family with these infiltrating cells in HNSCC\u003csup\u003e16,17\u003c/sup\u003e. Immune-stimulatory and immune-inhibitory genes that have already been found were taken into consideration for the purpose of better understanding the immunological regulation mechanisms of HNSCC\u003csup\u003e18\u003c/sup\u003e. The link between the IGF2BPs gene family and these immune-regulatory genes was examined using the Pearson correlation coefficient. The ggplot2 tool in R was used to create a heat map to display the above-mentioned outcomes.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Cell culture and transfection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human HNSCC cell line SCC4 was obtained from the American Type Culture Collection (ATCC) and cultured in DMEM (Gibco, USA) medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin at 37\u0026deg;C and 5% CO2 in a cell culture incubator. To knock down the expression of the IGF2BP2 gene, small interfering RNA (siRNA) targeting IGF2BP2 was designed and synthesized by RiboBio Biologicals (Guangzhou, China), and transfected using Lipofectamine 3000. The siRNA sequences used for knockdown are as follows:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003esi-NC: sense strand: UUCUCCGAACGUGUCACGUTT, antisense strand: ACGUGACACGUUCGGAGAATT; si-IGF2BP2-1: sense strand: GGCAUCAGUUUGAGAACUATT, antisense strand: UAGUUCUCAAACUGAUGCCTT; si-IGF2BP2-2: sense strand: CGAAGAGAUUCCUCUGAAATT, anti Sense strand: UUUCAGAGGAAUCUCUUCGTT; si-IGF2BP2-3: sense strand: GAAGUGAUCGUCAGAAUUATT, antisense strand: UAAUUCUGACGAUCACUUCTT.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6. Real-time Quantitative PCR(RT-qPCR).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from the SCC4 cell line and purified using Trizol reagent (Invitrogen, USA), followed by an evaluation of purity and integrity. The cDNA was then synthesized using a cDNA synthesis kit (Vazyme Bio, China) and subjected to real-time quantitative PCR analysis with the aid of the SYBR Green qPCR SuperMix kit (Vazyme Bio, China). The reaction conditions were as follows: 95\u0026deg;C for 5 minutes, 95\u0026deg;C for 15 seconds, and 60\u0026deg;C for 34 seconds, for a total of 40 cycles. The primer sequences required for the experiment were as follows: IGF2BP2:F- GACGTCAGCGAAAGGATGGT, R- GCGCTTCCAGCTTCACTTCT; 18S: F- CCTGGATACCGCAGCTAGGA, R- GCGGCGCAATACGAATGCCCC. The internal reference used was 18S, and relative expression levels were calculated using the 2 \u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCT\u003c/sup\u003e method.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. Western Blot.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein was isolated from the SCC4 cell line using a complete protein extraction kit supplied by KeyGene Bio (China), and protein concentration was measured using a BCA kit (KeyGene Bio, China). Proteins were separated using 10% SDS-PAGE and then transferred onto PVDF membranes (Beyoime Bio, China). PVDF membranes were subjected to incubation with primary antibodies IGF2BP2 (ab129071, Abcam, 1:1000) and GAPDH (ab128915, Abcam, 1:1000) at 4\u0026deg;C overnight. The membranes were washed using PBS the following day, and the membranes were incubated with secondary antibodies for 1 hour at room temperature. The exposure process was then carried out using an ECL developer (Beyoime Bio, China).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. CCK8 Assay.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe SCC4 cells of the si-NC group and the si-IGF2BP2-3 group were cultured routinely. The two sets of cells that had good growth status were chosen, and they were inoculated into a 96-well plate at a density of 3x10\u003csup\u003e3\u003c/sup\u003e cells per well. The cells were collected for 1-3 days, and 10\u0026mu;l of CCK8 reagent (KeyGene Bio, China) was added to each well under light-proof conditions. Following a 1-hour incubation at 37\u0026deg;C, the absorbance (OD) value at 450 nm was determined using an enzyme marker.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. EDU Assay.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe above two groups of cells in good growth condition were selected and inoculated in 96-well plates at 3 x 10\u003csup\u003e3\u003c/sup\u003e cells per well. After reaching the log phase, 100 \u0026mu;l of EDU (Beyoime Bio, China) solution was added. The mixture was then incubated for three hours at 37\u0026deg;C and fixed for 20 minutes with 4% paraformaldehyde. Then, glycine and PBS containing 0.5% Triton X-100 were used to wash the cells. The cells were incubated for 30 min after adding 100 \u0026mu;l of ApolloR solution per well (protected from light). The cells were then subjected to additional 30 minutes of incubation after Hoechst (100 \u0026mu;l) was added to each well. Finally, using a fluorescence microscope, the cells were photographed and counted.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. Transwell Migration and Invasion Assay.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe SCC4 cells of the si-NC group and si-IGF2BP2-3 group were cultured until good growth status was achieved. These cells were then inoculated into transwell chambers (Corning Incorporated, USA) at a density of 3 x 10\u003csup\u003e4\u003c/sup\u003e per well for the migration assay. In the upper chamber, a serum-free medium was introduced, and in the lower chamber, a complete medium was added. Following a 24-hour incubation period, the transwell chambers were removed. Then, the cells were fixed for 20 minutes in 4% paraformaldehyde and stained in 0.1% crystal violet. The cells were subsequently photographed and counted under a microscope. In the invasion assay, Matrigel gel (Corning Incorporated, USA) was applied to the transwell chambers in advance.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11. Statistical methods.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were collected using Image J and statistically analyzed on GraphPad Prism 8 using a t-test with two independent samples and one-way variance. The threshold for statistical significance was set at P \u0026lt;0.05. ***p\u0026lt;0.001; **p\u0026lt;0.01; and *p\u0026lt;0.05.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1. The Expression Profile of IGF2BPs gene family in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression pattern of all members of the IGF2BPs gene family across pan-cancer was examined (Figure 2a). Significant upregulation of IGF2BP1, IGF2BP2, and IGF2BP3 was observed in several malignancies, including BRCA, CESC, CHOL, ESCA, LIHC, COAD, LUSC, HNSC, GBM, PAAD, READ, OV, SKCM, UCEC, STAD, and UCS. The mRNA expression levels of the IGF2BPs gene family were found to be considerably higher in HNSCC samples as compared to healthy oral samples (P \u0026lt; 0.001), as revealed by both unpaired and paired sample analyses (Figure 2c-d).\u003c/p\u003e\n\u003cp\u003eFurthermore, the 3D protein structures of three genes from the IGF2BPs gene family were visualized (Figure 2b). The protein expression levels of the IGF2BPs gene family in both healthy and cancerous tissues were also assessed (Figure 3). The findings showed that the IGF2BP2 and IGF2BP3 protein levels were elevated in HNSCC tissues but lowered in normal tissues, including oral mucosa, tonsils, salivary gland, and thyroid gland. Nevertheless, IGF2BP1 was not observed to be expressed in either HNSCC or healthy tissues.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditionally, to evaluate the diagnostic usefulness of the IGF2BPs gene family in HNSCC, the ROC curve was employed. The variables of IGF2BP1, IGF2BP2, and IGF2BP3 revealed a higher accuracy in distinguishing healthy controls from HNSCC samples (AUC = 0.929, 0.910, and 0.811.) (Figure 4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Correlation between Clinicopathologic Features and Expression of the IGF2BPs gene family in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study utilized logistic regression analysis to investigate the association between the clinical characteristics of patients with HNSCC and the mRNA expression of genes in the IGF2BPs gene family (Table 1). The findings revealed a positive association of IGF2BP1 expression with the T stage (P = 0.001). IGF2BP2 expression was also significantly positively correlated with lymph node neck dissection and T stage (P = 0.020 and P = 0.009, respectively). Moreover, there was a positive association of IGF2BP3 expression with the clinical stage (P = 0.039) and T stage (P = 0.043).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Significance of the IGF2BPs gene family in the Prognosis of HNSCC.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe survival heatmaps (Figure 5a-b) depict the prognostic significance of the IGF2BPs gene family for overall survival and disease-free survival in diverse tumor types.\u003c/p\u003e\n\u003cp\u003eThe Kaplan\u0026ndash;Meier curves (Figure 5c) revealed that HNSCC patients with elevated expression levels of IGF2BP2 displayed a lower overall survival(OS) (p = 0.018), with no considerable link to progression-free interval survival (PFI) and disease-specific survival (DSS). The upregulation of IGF2BP2 was related to a poorer HNSCC prognosis, however, the IGF2BP1 and IGF2BP3 expressions did not reveal any links to DSS, PFI, and OS.\u003c/p\u003e\n\u003cp\u003eThe univariate analyses demonstrated that certain clinical characteristics were significant risk factors for mortality in individuals with HNSCC (Figure 6a). The M1 stage (P = 0.002), the lack of radiation therapy (P = 0.002), the SD and PD primary therapy outcomes (P \u0026lt;0.001), and lymphovascular invasion (P = 0.002) were among these. Importantly, the HR value of 1.385 for the high expression level of IGF2BP2 in individuals with HNSCC illustrated that the risk of death increased in this group in comparison to the group with low expression (P = 0.018). The multivariate analyses (Figure 6b) showed that a number of variables, such as high N stage (N1, N2, and N3) (P = 0.047), lack of radiation therapy, and primary therapeutic outcomes of SD and PD (P \u0026lt;\u0026nbsp;0.001), had an impact on overall survival in individuals with HNSCC. However, the level of IGF2BP2 expression did not have an impact on survival outcomes.\u003c/p\u003e\n\u003cp\u003eMoreover, to illustrate the connection between the IGF2BPs gene family and survival likelihood, a nomogram was created (Figure 7a). The individuals with higher points exhibited poor survival outcomes. Additionally, the calibration curves demonstrated that the nomogram plot exhibited excellent predictive ability for OS over 1 and 3 years (Figure 7b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. The Associated and Co-expressed Genes of the IGF2BPs gene family.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA GGI network of the IGF2BPs gene family was generated using the STRING database (Figure 8a). Furthermore, the top 20 co-expressed genes were considered crucial, highly connected hub node genes, i.e., ELAVL4, MOV10, and YBX1, performing a crucial role in some important biological functions, for instance, negative regulation of cellular amide metabolic process, mRNA catabolic process regulation, and RNA stability regulation.\u003c/p\u003e\n\u003cp\u003eThe ten leading genes of the IGF2BPs gene family with the highest levels of positive correlation, including PLAG1, HMGA2, and DDX18, and the top ten genes with the lowest levels of expression, including S100A8, TNFRSF13B, and CST3, were illustrated on a heatmap (Figure 8b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5. Biological function enrichment analysis of the IGF2BPs gene family in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 1169 correlated genes of the IGF2BPs gene family that were selected (Figure 9a) were subjected to GO analysis, KEGG analysis, and gene set enrichment analysis. Bubble charts (Figure 9b-e) were generated to represent the analysis results of GO terms, including cellular components (CC), biological processes (BP), and molecular functions (MF), along with KEGG pathway analysis results. Additionally, the mountain plot (Figure 9f) demonstrated the findings of gene set enrichment analysis (GSEA).\u003c/p\u003e\n\u003cp\u003eFurthermore, the substantially linked genes of the IGF2BPs gene family were predominantly enriched in some specific biological processes, for instance, proteasomal protein catabolic process, regulation of neuron projection development, and process utilizing autophagic mechanism (Figure 9b). The substantially associated genes of the IGF2BPs gene family were predominantly enriched in certain cellular components (Figure 9c), such as the cell leading edge, cell\u0026minus;substrate junction, and focal adhesion. The considerably related genes of the IGF2BPs gene family were mainly enriched in certain molecular functions, i.e., cell adhesion molecule binding, serine/threonine protein kinase activity, and cadherin binding (Figure 9d). The associated genes were primarily linked to the regulation of several cellular processes, including the actin cytoskeleton, endocytosis, focal adhesion, protein processing in the endoplasmic reticulum, and signaling pathways like the Hippo and Wnt pathways, as well as pathogenic Escherichia coli infection, according to the KEGG enrichment analysis (Figure 9e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn addition, the results of GSEA illustrated that substantial enrichment of these associated genes was observed in various signaling pathways, i.e., focal adhesion, PI3K-AKT and MAPK signaling pathways, and epithelial-mesenchymal transition (Figure 9f).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. The correlation between the IGF2BPs gene family and tumor Immunity in HNSCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe estimate-immune-stromal score was used to assess the relationship between the expression of the IGF2BPs gene family and the tumor immune microenvironment (Figure 10). The scatter plot revealed a considerable negative association between the immune score and the expression of IGF2BP1 (r = -0.176; p<0.001), IGF2BP2 (r = -0.335; p<0.001), and IGF2BP3 (r = -0.242; p<0.001). Furthermore, the estimate score was found to be significantly negatively associated with the expression of IGF2BP1 (r = -0.092; p = 0.040), IGF2BP2 (r = -0.235; p<0.001)), and IGF2BP3 (r = -0.151; p<0.001). However, no significant link was found between the expression of the IGF2BPs gene family and stromal score.\u003c/p\u003e\n\u003cp\u003eMoreover, as per the Pearson correlation study, tumor immune infiltration cells (TIICs) displayed a negative association with the expression of the IGF2BPs gene family, such as T cells, Th17 cells, and Treg (Figure 11a).\u003c/p\u003e\n\u003cp\u003eThe study also examined the relationship between the IGF2BPs gene family and genes that promote or suppress the immune system in HNSCC. Immunoinhibitory genes such as NECTIN2, TGFBR1, and VTCN1 were found to correlate significantly with the expression of the IGF2BPs gene family. Immunostimulatory genes such as TMIGD2, TNFRSF13B, and TNFRSF4 were significantly negatively associated with the expression of the IGF2BPs gene family (Figure 11b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7. Knockdown of IGF2BP2 gene expression inhibited SCC4 cell line proliferation, migration, and invasion.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain further insights into the potential involvement of the IGF2BPs gene family in the malignant progression of HNSCC, the IGF2BP2 gene was subjected to in vitro experiments. To achieve knockdown of IGF2BP2 expression in the SCC4 cell line, siRNA was employed, and the knockdown efficiency was validated by RT-qPCR and western blot assays (Figure 12a\u0026ndash;b). The si-IGF2BP2-3 effectively attenuated the expression of the IGF2BP2 gene in the SCC4 cell line when compared to si-NC. Thus, si-IGF2BP2-3 was selected for further experiments. The proliferation ability of the SCC4 cell line was evaluated using CCK8 and EDU assays (Figure 12c-d). The knockdown of the IGF2BP2 gene through siRNA significantly suppressed the DNA replication and proliferation capabilities of the SCC4 cell line when compared to the si-NC treatment. Additionally, the invasion and migration capabilities of the SCC4 cell line were evaluated through a transwell assay (Figure 12e), which showed that the knockdown of the IGF2BP2 gene could effectively suppress the cell migration and invasion abilities.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eDespite significant advancements in the treatment of HNSCC, including surgery, radiotherapy, and chemotherapy, the disease remains challenging due to its propensity for metastasis and recurrence. Even though immunotherapy and targeted therapy have emerged as promising treatments for HNSCC in recent years, drug resistance remains a major issue\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The IGF2BPs gene family is an RNA-binding protein containing IGF2BP1, IGF2BP2, and IGF2BP3. Previously reported studies have demonstrated that the IGF2BPs gene family is aberrantly expressed in lung, liver, and colorectal cancers and associated with poor prognosis, but its prognostic value and potential biological function in HNSCC have not been revealed\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11 CR12 CR13\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. This study creatively combined bioinformatics analysis with in vitro experiments to reveal the important role of the IGF2BPs gene family in HNSCC and provide a basis for future therapeutic strategies for HNSCC.\u003c/p\u003e \u003cp\u003eIn this study, the expression level of the IGF2BPs gene family was shown to be significantly higher in HNSCC than in healthy head and neck tissues. Previous studies also showed that IGF2BP2 and IGF2BP3 expression levels were significantly greater in HNSCC tumor tissues compared to healthy control samples, and they were linked to a poor prognosis in HNSCC patients\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Furthermore, the present investigation revealed that the elevated expression level of the IGF2BPs gene family was linked to the clinical stage, T stage, and lymph node neck dissection. Lin and Young et al. also showed that IGF2BP2 and IGF2BP3 in HNSCC were strongly associated with cancer stage and lymph node metastasis in HNSCC\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The findings suggest that overexpression of the IGF2BPs gene family may promote the onset and progression of HNSCC by enhancing lymph node metastasis.\u003c/p\u003e \u003cp\u003eFurthermore, through the analysis of ROC curves, it was observed that the IGF2BPs gene family had a high accuracy in distinguishing between HNSCC samples and normal control tissues. In studying preoperative biopsy material from HNSCC patients, Achille et al. studied that IGF2BP3 was closely associated with perineural infiltration in HNSCC patients and could assist in the diagnosis of HNSCC patients and perform accurate preoperative stratification, leading to accurate treatment planning\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. This evidence suggested that the IGF2BPs gene family may be a diagnostic biomarker for HNSCC.\u003c/p\u003e \u003cp\u003eBy comparing patients with high IGF2BP2 expression to those with low expression, the examination of patient survival data showed a substantial decline in OS. Univariate regression analysis confirmed IGF2BP2 as an independent risk factor for HNSCC, which is consistent with previous studies\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. The association between higher IGF2BP2 expression and worse survival results raises the possibility that IGF2BP2 could be used as an independent biomarker to predict prognosis in HNSCC patients. Based on the combined expression levels of the IGF2BPs gene family and other clinical parameters for predicting 1-, 3-, and 5-year survival, a nomogram plot was created to improve the accuracy of survival prediction. To validate these results, however, additional clinical research with larger cohorts is required.\u003c/p\u003e \u003cp\u003eThe GGI network revealed coexpression of the genes of the IGF2BPs gene family with some other important genes, i.e., YBX1, which colocalized with IGF2BP1 in the cytoplasm. IGF2BP1 stabilized the YBX1 by correlating with the Coding Region instability Determinant (CRD)\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Moreover, YBX1 was upregulated in lung adenocarcinoma and acted as an independent predictor of the prognosis and recurrence of lung adenocarcinoma\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The stabilization of YBX1 by IGF2BP1 may be a crucial mechanism in the onset and progression of the disease.\u003c/p\u003e \u003cp\u003eThe IGF2BPs gene family was found to be enriched in several key biological processes, such as the PI3K-AKT, and MAPK signaling pathways, as well as epithelial-mesenchymal transition. In colorectal cancer, METTL3 targeted EphA2 and VEGFA via different IGF2BPs-dependent mechanisms were found to promote vasculogenic mimicry formation via PI3K/AKT/mTOR signaling\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. The levels of expression of IGF2BP3 were considerably elevated in Glioblastoma in comparison to healthy tissues. The effects of IGF2BP3 were exerted on Glioblastoma through IGF-2, leading to the activation of MAPK signaling, which eventually promoted the progression of Glioblastoma\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. CircIGHG was significantly elevated in HNSCC and associated with poor prognosis. CircIGHG could target miR-142-5p to enhance IGF2BP3 activity and promote HNSCC progression through the epithelial-mesenchymal transition\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. In conclusion, the IGF2BPs gene family may promote tumor development and metastasis through various pathways including the PI3K-AKT signaling pathway, MAPK signaling pathway, and epithelial-mesenchymal transition.\u003c/p\u003e \u003cp\u003eTumor immunotherapy has long been approved for patients with recurrent and metastatic HNSCC. The tumor immune microenvironment has been shown to be potentially involved in the response to tumor immunotherapy\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. It was found that the IGF2BPs gene family was negatively associated with the tumor immune microenvironment in HNSCC. Yang et al. conducted a study demonstrating the close association of IGF2BP1 with the immune microenvironment in hepatocellular carcinoma. Their findings revealed that IGF2BP1 knockdown considerably increased the infiltration of immune cells such as T cells, NK cells, and macrophages in tumors and decreased the expression of PD-L1. Hence, IGF2BP1 could hold value as a target for immunotherapy in patients with hepatocellular carcinoma\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. As a result of the suppressed tumor immune microenvironment, these findings show that high expression of the IGF2BPs gene family may promote tumor advancement.\u003c/p\u003e \u003cp\u003eAdditionally, the study revealed that the IGF2BPs gene family has a strong association with T cells and other immune infiltrating cells, which are vital in anti-tumor activities during immunotherapy. Exhausted T cells are known to contribute to uncontrollable tumor growth\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Wan et al. demonstrated that inhibiting IGF2BP3 expression in breast cancer leads to T cell activation, thereby improving immune regulation in tumors\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. These findings indicated that high expression of the IGF2BPs gene family may lead to accelerated tumor progression by inhibiting tumor immune infiltrating cells. In addition, it was also revealed that the IGF2BPs gene family was substantially associated with quite a few immune inhibitory genes, i.e., TGFB1, and some immune-stimulatory genes, i.e., TNFRSF4. Cancer-associated fibroblasts (CAFs) within the tumor microenvironment in HNSCC contributed to promoting immunosuppression and evasion from immune surveillance. Moreover, CAFs had a greater TGFB1 expression level\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These investigations suggested that the IGF2BPs gene family can accelerate the development of HNSCC by controlling immune inhibitory genes. Lower levels of expression of TNFRSF4 were linked to poor survival, and it can play a key role in HNSCC outcomes\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. The IGF2BPs gene family can stimulate the development of HNSCC by attenuating the expression of these immune-stimulatory genes. In conclusion, the IGF2BPs gene family has a close association with tumor immunity in HNSCC, suggesting that further research on this gene family may provide a new foundation for the development of immunotherapy for HNSCC.\u003c/p\u003e \u003cp\u003eFinally, in vitro research was conducted to determine how the IGF2BPs gene family affects the biological functioning of HNSCC. IGF2BP2 expression was knocked down in the HNSCC cell line SCC4, and several functional tests were carried out to investigate the function of IGF2BP2 in HNSCC. Subsequent to knocking down the expression level of IGF2BP2, the migration, cell proliferation, and invasion abilities of SCC4 were found to have considerably reduced. The outcomes of Ke et al. were consistent with the current study, where a considerable attenuation in the proliferation and migration abilities of HNSCC cells was studied following a knockdown of IGF2BP2 expression\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. These results imply that IGF2BP2 might play a significant role in the development of HNSCC and may act as a future therapeutic target for HNSCC treatment.\u003c/p\u003e \u003cp\u003eThe objective of the current investigation was to examine the expression pattern and diagnostic and prognostic significance of the IGF2BPs gene family in HNSCC, along with investigating its relationship with tumor immunity to enhance comprehension of its regulation of the tumor microenvironment. In addition, it was verified by in vitro experiments that IGF2BP2 could promote HNSCC development. Nonetheless, there are several shortcomings in the study that must be addressed. Additional research is required to validate the biological significance of the IGF2BPs gene family in HNSCC and clarify the underlying mechanisms. Secondly, the prognostic role of the IGF2BPs gene family in HNSCC needs to be further validated by clinical large cohort studies. Finally, more research on the link between HNSCC immunity and the IGF2BPs gene family is required.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe current investigation revealed that the IGF2BPs gene family exhibited high expression levels in HNSCC, and could accurately predict this disease. The results also revealed that patients with HNSCC had a poor prognosis and had a significant expression of the IGF2BPs gene family. Furthermore, this research showed a direct link between the immunological microenvironment of HNSCC and the IGF2BPs gene family, and in vitro tests showed that IGF2BP2 knockdown could efficiently inhibit HNSCC cells from proliferating, and migrating, as well as limit their invasive capacities. According to these findings, the IGF2BPs gene family may be a useful biomarker and therapeutic target for HNSCC. To validate and facilitate the therapeutic application of these findings, additional research is needed.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author/s.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research work is funded by National Natural Science Foundation of China (Grant No.: 82102721), Guangzhou Science and Technology Bureau Project (Grant No.: 2060206), as well as the special basic research project funded by Stomatology Hospital, Southern Medical University (Grant No.: 2060206).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHT conceptualized the research idea, performed the study design, conducted all bioinformatics analyses, interpreted the results, and wrote the paper. JL and JZ contributed equally as the corresponding authors to the project conception and supervision.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNothing to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCohen N, Fedewa S, Chen AY. Epidemiology and Demographics of the Head and Neck Cancer Population. \u003cem\u003eOral and maxillofacial surgery clinics of North America\u003c/em\u003e. Nov 2018;30(4):381-395. doi:10.1016/j.coms.2018.06.001\u003c/li\u003e\n\u003cli\u003eCaudell JJ, Gillison ML, Maghami E, et al. NCCN Guidelines\u0026reg; Insights: Head and Neck Cancers, Version 1.2022. \u003cem\u003eJournal of the National Comprehensive Cancer Network : JNCCN\u003c/em\u003e. Mar 2022;20(3):224-234. doi:10.6004/jnccn.2022.0016\u003c/li\u003e\n\u003cli\u003eMarur S, Forastiere AA. Head and Neck Squamous Cell Carcinoma: Update on Epidemiology, Diagnosis, and Treatment. \u003cem\u003eMayo Clinic proceedings\u003c/em\u003e. Mar 2016;91(3):386-96. doi:10.1016/j.mayocp.2015.12.017\u003c/li\u003e\n\u003cli\u003eLi H, Zhang Y, Xu M, Yang D. Current trends of targeted therapy for oral squamous cell carcinoma. \u003cem\u003eJournal of cancer research and clinical oncology\u003c/em\u003e. Sep 2022;148(9):2169-2186. doi:10.1007/s00432-022-04028-8\u003c/li\u003e\n\u003cli\u003eDegrauwe N, Suv\u0026agrave; ML, Janiszewska M, Riggi N, Stamenkovic I. IMPs: an RNA-binding protein family that provides a link between stem cell maintenance in normal development and cancer. \u003cem\u003eGenes \u0026amp; development\u003c/em\u003e. Nov 15 2016;30(22):2459-2474. doi:10.1101/gad.287540.116\u003c/li\u003e\n\u003cli\u003eBell JL, W\u0026auml;chter K, M\u0026uuml;hleck B, et al. Insulin-like growth factor 2 mRNA-binding proteins (IGF2BPs): post-transcriptional drivers of cancer progression? \u003cem\u003eCellular and molecular life sciences : CMLS\u003c/em\u003e. Aug 2013;70(15):2657-75. doi:10.1007/s00018-012-1186-z\u003c/li\u003e\n\u003cli\u003eKato T, Hayama S, Yamabuki T, et al. Increased expression of insulin-like growth factor-II messenger RNA-binding protein 1 is associated with tumor progression in patients with lung cancer. \u003cem\u003eClinical cancer research : an official journal of the American Association for Cancer Research\u003c/em\u003e. Jan 15 2007;13(2 Pt 1):434-42. doi:10.1158/1078-0432.Ccr-06-1297\u003c/li\u003e\n\u003cli\u003eGuo W, Huai Q, Wan H, et al. Prognostic Impact of IGF2BP3 Expression in Patients with Surgically Resected Lung Adenocarcinoma. \u003cem\u003eDNA and cell biology\u003c/em\u003e. Feb 2021;40(2):316-331. doi:10.1089/dna.2020.6136\u003c/li\u003e\n\u003cli\u003eGutschner T, H\u0026auml;mmerle M, Pazaitis N, et al. Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) is an important protumorigenic factor in hepatocellular carcinoma. \u003cem\u003eHepatology (Baltimore, Md)\u003c/em\u003e. May 2014;59(5):1900-11. doi:10.1002/hep.26997\u003c/li\u003e\n\u003cli\u003ePu J, Wang J, Qin Z, et al. IGF2BP2 Promotes Liver Cancer Growth Through an m6A-FEN1-Dependent Mechanism. \u003cem\u003eFrontiers in oncology\u003c/em\u003e. 2020;10:578816. doi:10.3389/fonc.2020.578816\u003c/li\u003e\n\u003cli\u003eGao Y, Yang M, Jiang Z, et al. IMP3 expression is associated with poor outcome and epigenetic deregulation in intrahepatic cholangiocarcinoma. \u003cem\u003eHuman pathology\u003c/em\u003e. Jun 2014;45(6):1184-91. doi:10.1016/j.humpath.2014.01.016\u003c/li\u003e\n\u003cli\u003eZhang XL, Li KJ, Feng JX, Liu GJ, Feng YL. Blocking the IGF2BP1-promoted glucose metabolism of colon cancer cells via direct de-stabilizing mRNA of the LDHA enhances anticancer effects. \u003cem\u003eMolecular therapy Nucleic acids\u003c/em\u003e. Mar 5 2021;23:835-846. doi:10.1016/j.omtn.2020.12.020\u003c/li\u003e\n\u003cli\u003eYe S, Song W, Xu X, Zhao X, Yang L. IGF2BP2 promotes colorectal cancer cell proliferation and survival through interfering with RAF-1 degradation by miR-195. \u003cem\u003eFEBS letters\u003c/em\u003e. Jun 2016;590(11):1641-50. doi:10.1002/1873-3468.12205\u003c/li\u003e\n\u003cli\u003eXu W, Sheng Y, Guo Y, et al. Increased IGF2BP3 expression promotes the aggressive phenotypes of colorectal cancer cells in vitro and vivo. \u003cem\u003eJournal of cellular physiology\u003c/em\u003e. Aug 2019;234(10):18466-18479. doi:10.1002/jcp.28483\u003c/li\u003e\n\u003cli\u003eYu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. \u003cem\u003eOmics : a journal of integrative biology\u003c/em\u003e. May 2012;16(5):284-7. doi:10.1089/omi.2011.0118\u003c/li\u003e\n\u003cli\u003eBindea G, Mlecnik B, Tosolini M, et al. Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. \u003cem\u003eImmunity\u003c/em\u003e. Oct 17 2013;39(4):782-95. doi:10.1016/j.immuni.2013.10.003\u003c/li\u003e\n\u003cli\u003eH\u0026auml;nzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis for microarray and RNA-seq data. \u003cem\u003eBMC bioinformatics\u003c/em\u003e. Jan 16 2013;14:7. doi:10.1186/1471-2105-14-7\u003c/li\u003e\n\u003cli\u003eVeigas F, Mahmoud YD, Merlo J, Rinflerch A, Rabinovich GA, Girotti MR. Immune Checkpoints Pathways in Head and Neck Squamous Cell Carcinoma. \u003cem\u003eCancers\u003c/em\u003e. Mar 1 2021;13(5)doi:10.3390/cancers13051018\u003c/li\u003e\n\u003cli\u003eAmaral MN, Fa\u0026iacute;sca P, Ferreira HA, Gaspar MM, Reis CP. Current Insights and Progress in the Clinical Management of Head and Neck Cancer. \u003cem\u003eCancers\u003c/em\u003e. Dec 10 2022;14(24)doi:10.3390/cancers14246079\u003c/li\u003e\n\u003cli\u003eXu K, Dai X, Wu J, Wen K. N(6)-methyladenosine (m(6)A) reader IGF2BP2 stabilizes HK2 stability to accelerate the Warburg effect of oral squamous cell carcinoma progression. \u003cem\u003eJournal of cancer research and clinical oncology\u003c/em\u003e. Dec 2022;148(12):3375-3384. doi:10.1007/s00432-022-04093-z\u003c/li\u003e\n\u003cli\u003eLiu J, Jiang X, Zou A, et al. circIGHG-Induced Epithelial-to-Mesenchymal Transition Promotes Oral Squamous Cell Carcinoma Progression via miR-142-5p/IGF2BP3 Signaling. \u003cem\u003eCancer research\u003c/em\u003e. Jan 15 2021;81(2):344-355. doi:10.1158/0008-5472.Can-20-0554\u003c/li\u003e\n\u003cli\u003eLin SH, Lin CW, Lu JW, et al. Cytoplasmic IGF2BP2 Protein Expression in Human Patients with Oral Squamous Cell Carcinoma: Prognostic and Clinical Implications. \u003cem\u003eInternational journal of medical sciences\u003c/em\u003e. 2022;19(7):1198-1204. doi:10.7150/ijms.74751\u003c/li\u003e\n\u003cli\u003eHwang YS, Ahn SY, Moon S, et al. Insulin-like growth factor-II mRNA binding protein-3 and podoplanin expression are associated with bone invasion and prognosis in oral squamous cell carcinoma. \u003cem\u003eArchives of oral biology\u003c/em\u003e. Sep 2016;69:25-32. doi:10.1016/j.archoralbio.2016.05.008\u003c/li\u003e\n\u003cli\u003eTarsitano A, Asioli S, Morandi L, et al. Laminin-5 and insulin-like growth factor-II mRNA binding protein-3 (IMP3) expression in preoperative biopsy specimens from oral cancer patients: Their role in neural spread risk and survival stratification. \u003cem\u003eJournal of cranio-maxillo-facial surgery : official publication of the European Association for Cranio-Maxillo-Facial Surgery\u003c/em\u003e. Dec 2016;44(12):1896-1902. doi:10.1016/j.jcms.2016.07.012\u003c/li\u003e\n\u003cli\u003eWu ZH, Yue JX, Zhou T, Xiao HJ. Integrated analysis of the prognostic values of RNA-binding proteins in head and neck squamous cell carcinoma. \u003cem\u003eBioFactors (Oxford, England)\u003c/em\u003e. May 2021;47(3):478-488. doi:10.1002/biof.1722\u003c/li\u003e\n\u003cli\u003eWeidensdorfer D, St\u0026ouml;hr N, Baude A, et al. Control of c-myc mRNA stability by IGF2BP1-associated cytoplasmic RNPs. \u003cem\u003eRNA (New York, NY)\u003c/em\u003e. Jan 2009;15(1):104-15. doi:10.1261/rna.1175909\u003c/li\u003e\n\u003cli\u003eXie Q, Zhao S, Liu W, et al. YBX1 Enhances Metastasis and Stemness by Transcriptionally Regulating MUC1 in Lung Adenocarcinoma. \u003cem\u003eFrontiers in oncology\u003c/em\u003e. 2021;11:702491. doi:10.3389/fonc.2021.702491\u003c/li\u003e\n\u003cli\u003eLiu X, He H, Zhang F, et al. m6A methylated EphA2 and VEGFA through IGF2BP2/3 regulation promotes vasculogenic mimicry in colorectal cancer via PI3K/AKT and ERK1/2 signaling. \u003cem\u003eCell death \u0026amp; disease\u003c/em\u003e. May 21 2022;13(5):483. doi:10.1038/s41419-022-04950-2\u003c/li\u003e\n\u003cli\u003eSuvasini R, Shruti B, Thota B, et al. Insulin growth factor-2 binding protein 3 (IGF2BP3) is a glioblastoma-specific marker that activates phosphatidylinositol 3-kinase/mitogen-activated protein kinase (PI3K/MAPK) pathways by modulating IGF-2. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e. Jul 22 2011;286(29):25882-90. doi:10.1074/jbc.M110.178012\u003c/li\u003e\n\u003cli\u003ePitt JM, Marabelle A, Eggermont A, Soria JC, Kroemer G, Zitvogel L. Targeting the tumor microenvironment: removing obstruction to anticancer immune responses and immunotherapy. \u003cem\u003eAnnals of oncology : official journal of the European Society for Medical Oncology\u003c/em\u003e. Aug 2016;27(8):1482-92. doi:10.1093/annonc/mdw168\u003c/li\u003e\n\u003cli\u003eLiu Y, Guo Q, Yang H, et al. Allosteric Regulation of IGF2BP1 as a Novel Strategy for the Activation of Tumor Immune Microenvironment. \u003cem\u003eACS central science\u003c/em\u003e. Aug 24 2022;8(8):1102-1115. doi:10.1021/acscentsci.2c00107\u003c/li\u003e\n\u003cli\u003eWang Q, Qin Y, Li B. CD8(+) T cell exhaustion and cancer immunotherapy. \u003cem\u003eCancer letters\u003c/em\u003e. Apr 10 2023;559:216043. doi:10.1016/j.canlet.2022.216043\u003c/li\u003e\n\u003cli\u003eWan W, Ao X, Chen Q, et al. METTL3/IGF2BP3 axis inhibits tumor immune surveillance by upregulating N(6)-methyladenosine modification of PD-L1 mRNA in breast cancer. \u003cem\u003eMolecular cancer\u003c/em\u003e. Feb 23 2022;21(1):60. doi:10.1186/s12943-021-01447-y\u003c/li\u003e\n\u003cli\u003eTakahashi H, Sakakura K, Kawabata-Iwakawa R, et al. Immunosuppressive activity of cancer-associated fibroblasts in head and neck squamous cell carcinoma. \u003cem\u003eCancer immunology, immunotherapy : CII\u003c/em\u003e. Nov 2015;64(11):1407-17. doi:10.1007/s00262-015-1742-0\u003c/li\u003e\n\u003cli\u003eQi Z, Liu Y, Mints M, et al. Single-Cell Deconvolution of Head and Neck Squamous Cell Carcinoma. \u003cem\u003eCancers\u003c/em\u003e. Mar 11 2021;13(6)doi:10.3390/cancers13061230 \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Head and neck squamous cell carcinoma, IGF2BPs, diagnosis, prognosis, tumor immunity","lastPublishedDoi":"10.21203/rs.3.rs-2820861/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2820861/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHead and neck squamous cell carcinoma (HNSCC) represents a predominant type of malignant cancer found in the head and neck region, characterized by a high incidence and unfavorable prognosis. The IGF2BPs gene family, which belongs to the RNA-binding protein class, has been critically implicated in several cancers, and its involvement in HNSCC necessitates further exploration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the clinical significance and potential biological functions of the IGF2BPs gene family in HNSCC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA bioinformatic methodology was employed to examine the expression profile, diagnostic and prognostic significance, and biological mechanisms of the IGF2BPs gene family in HNSCC, with a particular emphasis on its involvement in the immune function of HNSCC. This was followed by in vitro investigations to unravel the biological roles of the IGF2BPs gene family in HNSCC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis investigation has demonstrated that, in contrast with normal control tissue, HNSCC has a substantial elevation in the expression level of the IGF2BPs gene family. Patients with a high level of IGF2BPs gene family expression demonstrated higher prediction accuracy for HNSCC. Furthermore, patients with HNSCC and elevated IGF2BPs gene family expression levels exhibited poor survival outcomes. The IGF2BPs gene family displayed a significant association with a variety of immune infiltrating cells and immune genes in HNSCC. Studies conducted in vitro have confirmed that IGF2BP2 silencing suppressed the migration, proliferation, and invasion of HNSCC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt has been determined that the IGF2BPs gene family plays a crucial part in the onset and progression of HNSCC, and its association with tumor immunity has been established. The IGF2BPs gene family holds promising potential as a diagnostic and prognostic biomarker for HNSCC.\u003c/p\u003e","manuscriptTitle":"Comprehensive Analysis of the Expression of the IGF2BPs gene family in Head and Neck Squamous Cell Carcinoma: Association with Prognostic Value and Tumor Immunity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-04-25 13:14:41","doi":"10.21203/rs.3.rs-2820861/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e6017436-282e-4d48-b949-09cb98a6f674","owner":[],"postedDate":"April 25th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-04-08T07:56:09+00:00","versionOfRecord":{"articleIdentity":"rs-2820861","link":"https://doi.org/10.1016/j.heliyon.2023.e20659","journal":{"identity":"heliyon","isVorOnly":true,"title":"Heliyon"},"publishedOn":"2023-10-01 07:56:09","publishedOnDateReadable":"October 1st, 2023"},"versionCreatedAt":"2023-04-25 13:14:41","video":"","vorDoi":"10.1016/j.heliyon.2023.e20659","vorDoiUrl":"https://doi.org/10.1016/j.heliyon.2023.e20659","workflowStages":[]},"version":"v1","identity":"rs-2820861","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2820861","identity":"rs-2820861","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.