Xuesaitong injection paired with enriched environment displays neuroprotective effects and promotes functional rehabilitation by activating the PI3K/AKT/mTOR pathway

Xuesaitong injection paired with enriched environment displays neuroprotective effects and promotes functional rehabilitation by activating the PI3K/AKT/mTOR pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Xuesaitong injection paired with enriched environment displays neuroprotective effects and promotes functional rehabilitation by activating the PI3K/AKT/mTOR pathway Yonggang Zhang, He Liu, Sheng Qiu, Yuntao Li, Shehong Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8033676/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Xuesaitong injection (XST), a well-known traditional Chinese patent medicine, has been widely used in the treatment of cardiovascular and cerebrovascular diseases. Enriched environment (EE) has been shown to play pivotal roles in functional rehabilitation following brain injury. However, the effects and exact underlying mechanisms of combination administration of XST with EE before and after ischemic stroke remain to be thoroughly elucidated. Purpose : This study aims to investigate the effects and the potential mechanisms of XST injection combined with EE on ischemic stroke. Methods : In the current study, a tMCAO (transient middle cerebral artery occlusion) mouse model was established, and then the experimental animals were intervened with XST injection combined with EE for consecutive 7 days before and after MCAO surgery respectively. Subsequently, the effects and the potential molecular mechanisms on the functional rehabilitation of the mice with stroke were further explored. Results : Animal experiments demonstrated that administration of XST combined with EE before and after the onset of acute ischemic stroke could exert protective effects against stroke initial injure and improve overall function rehabilitation. Furthermore, the inhibition of PI3K/AKT pathway by LY294002 abolished these curative effects of the intervention on brain injury, neuroinflammation, and neuron apoptosis following ischemic stroke. Conclusion : The current study provides a novel therapeutic strategy by which XST combined with EE alleviates brain injury and promotes the outcome of ischemic stroke. The PI3K/AKT/mTOR signaling pathway was highly considered as a vital role in the neuroprotective effects of XST paired with EE on ischemic brain injury. Ischemic stroke Rehabilitation the PI3K/AKT/mTOR signaling pathway Neuroinflammation Apoptosis Enriched environment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Stroke is reported to be the second leading cause of death [ 1 ] and remains the third-most cause of disability-adjusted life years in the world [ 2 ], despite remarkable improvement in the diagnosis and treatment of acute ischemic stroke, which has a great impact on public health in the world. The prevalence of mild and major cognitive impairments appears to vary from 14 to 29% and from 11 to 42%, respectively, depending on the method adopted to define post-stroke neurocognitive disorder after three months suffered from stroke [ 3 ]. Incident stroke is associated with an increased risk of acute decline in cognitive function [ 4 ]. An aging population coupled with the burden of accumulating risk factors contributes to such increase in lifetime risk of stroke. In addition, increasing socioeconomic status in the developing countries has led to an epidemic rise in the risk factors for stroke in younger adults [ 5 ], which contributed to the increase of the rates of post-stroke disability. However, unfortunately, treatment of cerebral ischemic stroke is limited since the only verified treatment, recombinant tissue plasminogen activator must be administered within 4.5h after the onset of stroke to ensure its effectiveness[ 6 ]. Therefore, developing novel therapeutic paradigm or strategy to improve general functional rehabilitation in people with the attack of stroke remains to be a huge challenge. Cell apoptosis is a significant pathological mechanism in ischemic reperfusion cerebral injury and primarily occurs in the penumbra and core zone of cerebral ischemia, where neuronal cells initiate apoptosis in response to multifaceted harmful stimuli following the onset of ischemic stroke[ 7 ]. When ischemia occurs, pro-apoptotic proteins are released to activate the caspase family of proteins, thereby executing the apoptotic program[ 8 ]. Therefore, there is necessity to investigate a novel and effective therapeutic paradigm to alleviate brain injury and functional impairment, and enhance prognosis. It is well-documented that an enriched environment (EE) is a non-invasive complex stimulus by equipping the environment with more attractive physical activity, more social interaction, introduction to novel different toys, and a larger housing space than a normal cage. EE has been demonstrated to play significant roles in improving brain plasticity, angiogenesis, and neurogenesis, eventually attaching a beneficial influence on the recovery of cognitive and motor function after brain injury [ 9 – 11 ] and our previous studies on this subject have showed that EE treatment following ischemic stroke in elder mice promoted outcome of elder mice with ischemic brain injury by inhibiting neuroinflammation and improving the central immune environment and enhanced cognitive and motor function [ 12 ]. With the rapid advancement of traditional Chinese medicine (TCM), clinical therapeutic effects of it, especially that of promoting blood circulation and removing blood stasis, provide a new approach for the treatment of ischemic stroke. The curative effect of Xuesaitong injection (XST), a world renowned Chinese patent medicine, mainly comes from Panax notoginseng saponins (PNS), which is a mixture composed of Rb1, Rc, Rd, Re, Rg1 and Rh1 [ 13 ] and is the main constituents responsible for its pharmacological activities of improving hemorheology, preventing platelet aggregation and maintaining normal circulation[ 14 , 15 ]. Given its therapeutic advantages like promoting blood circulation for removing stasis and unclogging the meridians, and few adverse reactions, “Xuesaitong” (XST) has been widely used in the treatment of acute stroke induced by ischemia and reperfusion damage[ 14 – 17 ]. However, the possible influence of prophylactic administration of XST coupled with EE on the prognosis of ischemic stroke before and after the onset of acute ischemic stroke have not been confirmed. The previous studies suggested that Phosphatidylinositol 3-kinase (PI3K) could induce conformational changes in downstream proteins like AKT, activate and eventuate in the phosphorylation and activation of AKT, thereby regulating the process of cell survival [ 17 ] and that PI3K/AKT signaling exerts a significant role in the pathology of ischemic stroke [ 18 ]. Here we hypothesize that prophylactic administration of XST combined with EE could inhibit neuronal apoptosis and inflammation, reduce the severity of acute stroke and improve prognosis by regulating the PI3K/AKT/mTOR pathway, and we then validate our hypothesis on ischemic stroke model by transient middle cerebral artery occlusion (tMCAO) at the present study, providing novel therapeutic paradigm and a significant theoretical basis for stroke. 2. Materials and methods 2.1 Animals 12-week-old C57BL/6 male mice were purchased from Shanghai Laboratory Animal Center and housed in a controllable environment ((25 ± 2℃; 12:12-h light/dark cycle, 50–60% relative humidity) in which animal could freely acquire filtered clean water and standard laboratory diet for 7 days to habituate themselves with the surrounding environment prior to initiating experimental procedure. All the tests of behaviour were carried out between 9 and 17 AM. All of the animal experimental protocols were approved by Huzhou Central Hospital Animal Care and Use Committee and were complete congruent with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Registration number: 202212001, Dec. 23, 2022). Housing conditions for enriched environment (EE) and standard environment (SE) were set up according to our previous work [ 12 , 19 ]. 2.2 Transient MCAO model Construction and Experimental Grouping In order to simulate the occurrence of acute ischemic stroke, the Middle Cerebral Artery Occlusion (MCAO) model was established as previously described [ 12 ]. Briefly, anesthesia was induced and kept with 2% isoflurane. Next, we occluded the left middle cerebral artery with a suture (Doccol, Corp, Redlands) for one hour. Then, the suture was removed after one hour to restore cerebral blood flow. At last, the experimental animals were carefully placed in the previous housing cages when the wound was stitched and disinfected. Sham-operated mice were subject to the similar surgical operation except for ligation induced by the suture. After finishing surgery, the experimental mice were randomly divided into two parts: the one part of animals were divided into five groups: (1)sham-group; (2)MCAO + SE group; (3)MCAO + XST group; (4)MCAO + EE group; (5) MCAO + EE + XST group; the other part of animals were divided into four groups: (1)MCAO (+ SE-vehicle) group; (2)MCAO + LY294002 group; (3)MCAO + EE + XST group; (4) MCAO + EE + XST + LY294002 group. 2.3 Drug Intervention Protocol and Administration In this study, Xuesaitong injection was purchased from KPC Pharmaceuticals, Inc, (Z20026438, Yunnan, China) and was freshly dissolved with 5% glucose injection to a concentration of 1.5mg/ml according to the previous report with slight changes [ 20 ]. Xuesaitong was administrated at a volume of 0.1mL/10g (15µg/g/day) via caudal vein for 1h after MCAO surgery, for 14 consecutive days. Sham and vehicle-treated mice were injected with the equal volume of 5% glucose injection in the same way. All assessments were conducted by investigators blinded to experimental group assignments. 2.4 Animal Behavioral Experiments Open Field Test (OFT) Anxiety-like behavior and the ability of locomotion of mice were determined by using open field test according to previously described [ 12 ]. Each mouse was carefully placed in the center of a test chamber (40 × 40 × 50 cm) of the experimental equipment with a camera, and the movement trace of the mouse was recorded for 10 min during the whole course of the test. Parameters, including the distance of movement, the time spent in the different zones, latency to the different zones, were analyzed with Tracking Master software v5.0.6 (Zhongshi Science and Technology, Beijing, China). Y-maze Test To evaluate the function of learning and memory, experimental mice were performed Y maze test in the study according to our previous report [ 12 ]. Each mouse was allowed to freely explore for 6 min, meanwhile, the behavior of mouse was recorded with the camera. The data were finally analyzed with the software above mentioned. 2.5 Immunohistochemical and Immunofluorescence Analysis of Protein Expression Brains of mice were carefully collected after perfusion and then placed into a small vessel and fixed in 4% PFA and were deposited in 30% sucrose at 4°C the next day. Brain slices were blocked with 2% BSA solution for one hour at room temperature, and incubated with the primary antibodies indicated at 4°C overnight. Primary antibodies were shown in Table 1 . On the following day, the slice samples were rinsed for three times with neutral PBS, and incubated with relevant secondary antibodies for 1.5 hour at room temperature in the special dark boxes. The nuclei were then stained with DAPI (4,6-diamino-2-phenylindole, 1:1000) for 20 minutes. Fluorescence images were captured using an fluorescence microscope (Olympus Optical, Japan), and were analyzed with Image J software. Table 1 Primary antibodies used in this study. Reagents Source Catalog number Application details Bcl2 Cell Signaling Technology 3498 IB 1:1000 Bax Cell Signaling Technology 2772 IB 1:1000 Cleaved-caspase3 Cell Signaling Technology 9661 IB 1:1000 p-PI3K Cell Signaling Technology 4228 IB 1:1000 PI3K Cell Signaling Technology 4292 IB 1:1000 p-AKT Cell Signaling Technology 4060 IB 1:1000 AKT Cell Signaling Technology 9272 IB 1:1000 p-mTOR Cell Signaling Technology 2971 IB 1:1000 mTOR Cell Signaling Technology 2972 IB 1:1000 CD31 Cell Signaling Technology 77699 IF 1:200 NeuN Cell Signaling Technology 24307 IF 1:200 IBA1 Cell Signaling Technology 17198 IF 1:200 GFAP Cell Signaling Technology 12389 IF 1:200 GAPDH Proteintech 10494-1-AP IB 1:1000 2.6 Hematoxylin-Eosin (H&E) Staining for Histopathological Analysis As previously reported [ 19 ], pathological samples of brain tissue and the other internal tissues were collected from each group of mice after completing the whole experimental protocol. The tissues were fixed in 10% neutral buffered formalin for 24h in order to preserve organizational ultrastructure. The samples were then processed through a series of alcohol and xylene washes to dehydrate the tissue before being embedded in paraffin. Subsequently, the embedded tissues were cut into thin sections with 5 µm thick, which were placed on glass slides and stained with hematoxylin (staining cell nuclei, displayed in blue) and eosin (counterstaining the chtoplasm and cell membranes, displayed in pink) at room temperature for histopathological observation. 2.7 Western Blot Analysis Mice were sacrificed with overdose isoflurane and the brains were harvested. The designed brain tissues of mice at the special time point were carefully separated. Western blot was performed according to standard protocol with proper antibodies, as previously reported [ 12 ]. In brief, proteins from fresh brain tissues were homogenized using RIPA lysis buffer (Bioworld, USA), and the concentration of the protein was quantified using a BCA protein assay kit (Invitrogen, USA). Equal amounts of protein in each sample were then electrophoresed separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Massachusetts, USA). 5% milk solution was used to block the membranes for 1.5 h at room temperature and then incubated with the primary antibodies at 4°C overnight. On the next day, membranes were rinsed for three times with neutral PBST, and incubated with relevant secondary antibodies for 1h at room temperature. After that, the membranes were exposed to the mixed enhanced chemiluminescence (ECL) solution prior to visualizing using a GelPro System. Finally, The density value of the protein bands was analyzed by using Image J software. 2.8 Real-Time Polymerase Chain Reaction To analyze mRNA expression level, total RNA was extracted from the ipsilateral hemisphere of the brains from each group mice with Trizol (Invitrogen) in turn. Then 1 µg total RNA was reverse transcribed using a SuperScript™ III Reverse Transcriptase kit with oligo (dT) primers (Invitrogen). cDNA synthesis, RT-PCR, and qPCR were conducted as described in detail in a previous study [ 21 ]. Cycle time values were normalized against the GAPDH values of the same sample. The primer sequences used in this study are listed in Table 2 . Table 2 the primer sequences used in the current study Target gene Forward primer Reverse primer IL-1β CAGGATGAGGACATGAGCACC CTCTGCAGACTCAAACTCCAC IL-6 GCCTTCTTGGGATGATGCT TGGAAATTGGGGTAGGAAGGAC TNF-α CTG AAC TTC GGG GTG ATC GG GGC TTG TCA CTC GAA TTT TGA GA IL-4 TCTCTCTGAAGGACTCTGGCT CTTTGCCCACGGACACAACT IL-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG TGF-β CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG GAPDH CACTCACGGCAAATTCAACGGCA GACTCCACGACATACTCAGCAC 2.9 the PI3K/AKT/mTOR Pathway Inhibition Assay To determine whether the neuroprotective role of XST combined with EE against ischemic stroke are dependent on the PI3K/AKT/mTOR signaling axis, experimental mice were pretreated with the PI3K inhibitor, LY294002, at 10 mg/kg/day (Selleck, #S1105) via caudal vein for 2 h before XST injection in experimental mice, which was dissolved in dimethyl sulfoxide (DMSO) (Sigma-Aldrich; Merck KGaA) as previously reported [21.] 2.10 Statistical Analysis Statistical analysis in this study was performed using GraphPad Prism software version 9 (GraphPad Software, Inc., San Diego, CA). All cases were analyzed by using one-way ANOVA with Tukey test for multiple comparisons. The behavioral tests were compared using a two-way analysis of variance. All data are presented as the mean ± standard deviation (SD) and value of P < 0.05 was considered statistically significant. 3. Results 3.1 Effect of XST paired with EE on behavior analysis in MCAO mice To investigate how the stroke mice responds to the treatment of XST combined with EE, we conducted behavior analysis in the first stage of the experimental protocol. As designed in Figure 1, we performed OFT and Y-maze test in mice 8 days after MCAO. In OFT, movement track and heatmap were shown in Figure 1 A , while the data analysis were shown in the figure 1C-G. As can be seen from Figure 1C-G, in the XST combined with EE group, movement total distance and entries times through the center zone both were the highest, contrast to the other three MCAO groups. Interestingly, there was significant difference only in the parameter of the distance in periphery between the XST+EE treatment group and the EE group as shown in figure 1E. In Y-maze test, the highest total distance, total arm entries and alternation rate were observed in XST+EE treated mice as shown in the figure 1H-J, contrast to the other three MCAO groups. Taken together, the results in OFT and Y-maze test indicated that these three groups treated by XST-group, EE-group, and XST+EE group respectively, all improved the behaviour outcomes. 3.2 Xuesaitong C ombined with EE P rotects against M orphological I njury and N euronal Apoptosis in MCAO Mice Apoptosis may be responsible for a large proportion of neuron death following acute brain ischemia, to investigate the effect and the underlying mechanisms of XST combined with EE on the ischemic stroke, we performed Histomorphological and Western blotting determination to examine the level apoptosis of neurons and morphological injury in surrounding area of ischemic lesion. It can be seen in the figure 2A-C that ischemia contributed to a significant numbers of death neurons with an decreased number of NeuN+ cells, and the treatment with XST, EE, and XST+EE attenuated these brain injuries, and that there was no significant difference in the HE evaluation between the EE treated group and XST+EE combination treatment group, while there was a significant difference between the XST treated group and the XST+EE combination treatment group; unlike this, regarding to the number of NeuN+ cells, we observed significant difference not only between all these groups. In the meantime, pro-apoptotic protein like Bax and Cleaved-caspase 3 were increased in MCAO mice, decreased anti-apoptosis protein, Bcl2, was observed after stroke surgery. We also found that XST significantly reversed the change of proteins related to apoptosis as shown in the figure 2D-G. 3.3 the treatment XST Combined with EE Suppresses Activation of Glial C ells and Inflammation Neurons apoptosis may be responsible for the release of pro-inflammatory cytokines from microglia following acute ischemic stroke [20]. To further investigate whether xuesaitong improves inflammatory environment derived from microglia and astrocytes, we carried out IF staining and mRNA measure to examine the expression levels of proteins IBA1 and GFAP and factors related to inflammation including IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β. the results demonstrated that XST improved inflammatory environment with decrease of IBA1 and GFAP proteins (figure 3A-C), and decreased pro-inflammatory cytokines like IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β, while increased anti-inflammatory cytokines such as IL-4, IL-10 and TGF-β (figure 3D-I). All the data showed that the treatment XST combined with EE displayed the strongest influence on the stroke injuries. 3.4 XST Promotes Post-ischemic Angiogenesis and Activate the PI3K/AKT/mTOR Signaling Pathway To investigate the effect of XST on angiogenesis, the levels of VEGFA and VEGFR2, penumbra brain tissue were examined at 8 days after MCAO with IF staining and ELISA assay. As shown in the figure 4A-4B, we observed that XST remarkably enhanced Density of neovascularization with the increase of CD31 expression. The obvious enhancement of factors related to angiogenesis like VEGFA and VEGFR were also observed in the figure 4C-4D following the treatment of XST and EE. Interestingly, there was an remarkably difference between the sham group and vehicle group after 8 days of stroke, indicating that cerebral ischemia, to some extent, could induce its own vascular repair . However, after treatment with XST and EE, the levels of VEGFA and VEGFR were further increased, and more increased vascular density in penumbral area was observed compared with the vehicle group which were shown in the figure 4A-4D. To examine whether XST promotes angiogenesis through these core targets, we performed Western blot assay to measure the levels of p-PI3K, p-AKT, and p-mTOR proteins expression, and the findings demonstrated that, similarly, the activation of the PI3K/AKT/mTOR signaling was observed with the increase of p-PI3K, p-AKT, and p-mTOR proteins in the above experimental administration. 3.5 XST Combined with EE Improves Neurological Function in Mice after Ischemic Stroke via the PI3K/AKT/mTOR Pathway In order verify our hypothesis that the treatment of XST combined with EE promotes functional recovery in stroke mice dependent on the PI3K/AKT/mTOR pathway, we performed behaviour test and histopathological evaluation once more following administration of inhibitor of the pathway, LY294002. The results demonstrated that LY294002 obviously abolished the effect of XST combined with EE on the stroke mice as shown in the figure 5A-5J. In the OFT, as shown in the figure 5C-5G, the total distance, distance in center and in periphery, entries in the center and peripheries zone, all these parameters were significantly decreased after administration of LY294002, which suggested that both motor function and the willingness of mice to explore were significantly decreased after administration of LY294002. In the meantime, we observed in the Y-maze test that administration of LY294002 also remarkably abolished the cognitive function and motor function as shown in the figure 5B, 5I-5J. to our surprise was that LY294002, the inhibitor of the PI3K/AKT, deteriorated the stroke injuries compared with MCAO group. The morphological evaluation with HE staining and IF staining of NeuN showed the similar changes with the above behaviour test. All these results suggested that the PI3K/AKT/mTOR pathway is involved in ischemic stroke injuries and the necessary to the protection against stroke injury of XST combined with EE. 3.6 the treatment of XST Combined with EE Alleviates Neuroinflammation and Angiogenesis in Stroke Mice via the PI3K/AKT/mTOR Pathway According to the published literature, classical pathway like the PI3K/AKT/mTOR pathway is closely related to neuroinflammation [22]. In order to elucidate the mechanisms of cerebral angiogenesis and inflammtory, we performed IF staining, western blot, and mRNA assay in mice with ischemic stroke. RT-PCR analysis demonstrated that after following administration of LY294002, the inhibitor of PI3K/AKT axis, brain injuries were exacerbated in turn by releasing pro-inflammatory cytokines such as IL-1β, IL-6, and tumor necrosis factor (TNF-α), from glia cells with IBA1 and GFAP positive, while alternatively inhibited anti-inflammatory trophic factors like IL-4, IL-10 and TGF-β. Similarly, CD31, and its dependent VEGFA/VEGFR pathway undergone corresponding changed by the administration of LY294002. At last, we carried out western blot to determine apoptosis and the PI3K/AKT/mTOR signaling pathway. As shown in the figure 6M-6S, the inhibition of the PI3K/AKT/mTOR signaling pathway aggravated apoptosis of neurons and in turn abolished the protecting roles of treatment of XST combined with EE on the neurons of stroke mice, suggesting which was dependent on the PI3K/AKT/mTOR signaling pathway. 3.7 XST activates the PI3K/AKT/mTOR pathway in vitro To simulate ischemic stroke, the oxygen-glucose deprivation/reperfusion ( OGD / R ) cell model was established. As shown in the figure 7 A-D, we could observe that the phosphorylation levels of PI3K, AKT, and mTOR were significantly increased in the XST administration group compared to the vehicle group, while LY294002 significantly abolished these changes. And RT-PCR analysis showed that compared with the vehicle group, XST treatment decreased the expression levels of pro-inflammatory factors and increased the expression levels of trophic factors accordingly. The present in vitro experiments showed that in comparison with XST-treated group, LY294002, the inhibitor of PI3K/AKT axis, significantly abolished these protective effects of XST with the similar way in the experimental group of XST combined with LY294002 by regulating the PI3K/AKT/mTOR signaling pathway, which is consistent with the results of in vivo experiments. 3.8 the Administration of XST did not Cause Side Effects on the Other Organs The side effect of XST with therapeutic dose on the stroke mice still remains a challenge in the clinical treatment, here we performed histopathological evaluation of heart, liver, spleen, lung, and kidney. The results suggested that no significant difference between the sham and the other treatment groups was observed in all these tissues as shown in the figure 8. Discussion According to the theory of Traditional Chinese Medicine, blood stasis is the most important pathological product of acute ischemic stroke, which account for about 98% [ 23 ]. Therefore, promoting blood circulation and removing blood stasis, the vital mechanism in the treatment of ischemic stroke, have peculiar advantages [ 23 ]. Panax notoginseng saponins (PNS) are extracted from the traditional Chinese medicinal herb P. notoginseng (Sanqi), which have a unique effect of promoting blood circulation and removing blood stasis. In China, a series of commercial preparations of PNS have been extensively researched and used, such as XST, which has been shown to alleviate brain edema in animals suffering from focal cerebral ischemia/reperfusion injury through suppressing the expression of ICAM-1 protein and neutrophil infiltration during the acute phase of stroke onset [ 24 ]. However, the effects of prophylactic administration of XST before and after the onset of ischemic stroke remain to be explored. The MCAO mice model surgery was established to investigate and validate the curative effects and mechanisms of XST on acute ischemia, primarily in ischemic core and penumbra areas of the infarct focus. The expression of NeuN protein and HE injury score in brain tissue in MCAO mice were measured by using method of histochemical and immunofluorescence staining. The results indicated that the expression of NeuN protein was significantly increased in the (MCAO + XST + EE) group and HE tissue damage score decreased correspondingly in the this group. Moreover, Proteins related to apoptosis, cleaved-capasise 3, bcl2, and Bax, were decreased, while the ratio of Bax/Bcl2 proteins increased in the the (MCAO + XST + EE) group, which suggesting that XST combined with EE inhibited apoptosis of neurons after the attack of stroke. For the first time, we reported the preventive effects of the XST injection combined with EE, a component of traditional Chinese medicine (TCM), which the main component is a total saponins preparation of Panax notoginseng , on ischemic stroke. Firstly, prophylactic administration of XST before the onset of ischemic stroke can prevent motor and cognitive function impairment and protect mice against MCAO injury. Secondly, it can enhance the neuroprotective effects and functional rehabilitation of enriched environment on stroke mice. Thirdly, XST can reduce inflammation factors levels and inhibiting neuronal apoptosis by rugulatin the PI3K/Akt/mTOR signaling. A recent study reported that PNS attenuated inflammation in the infarct area [ 25 ], and ameliorate damage induced by ischemic stroke via suppressing inflammation [ 26 , 27 ]. Consistent with previous reports, XST alleviated MCAO symptoms, reduced the expression of pro-inflammatory cytokines like IL-1β, IL-6, and TNF-α, and increased the expression of anti-inflammatory cytokines like IL-4, IL-10, and TGF-β, which suggesting that prophylactic administration of XST combined with EE before and after the onset of ischemic stroke could exert protective effects against stroke initial injure and improve overall function rehabilitation. Meanwhile, the expression levels of IBA1 and GFAP proteins appeared the same trend of change as the inflammatory response. Extending these findings, we, therefore, investigated whether XST play anti-inflammatory effects on ischemic stroke through playing an effect on angiogenesis, like vascular growth factor VEGFA and VEGR2, and CD31 protein. We observed that XST combined with EE considerably enhanced the expression level of CD31, VEGFA, and VEGR2, while these positive effects were offset by LY294002, a PI3K inhibitor, administration. Correspondingly, we conducted behavioral tests like OFT and Y-maze. In OFT, we observed that the administration of XST significantly increased the mobility time and the average speed of the mice and spent more activity time and covered more distance in the center of field, indicating that their desire to survive and explore increased in the mice. Similarly, all of these curative effects were markedly abolished by LY294002 administration. These results suggested that XST combined with EE counteracted acute ischemic stroke damage and improved neurological functional outcomes in the first 7 days after MCAO surgery. Additionally, no side effects on the other organs was observed following the administration of XST in stroke mice. Therefore, XST may be as a prophylactic medicine against stroke occurrence in the future and be used with the other physicotherapy. Studies have suggested that PI3K/AKT signaling pathway is involved in the neuroprotective effect of cerebral ischemic injury and plays a pivotal role in this process [ 28 , 29 ]. The activation of PI3K/Akt signaling pathway can mediate the occurrence and development of cerebral ischemia/reperfusion injury (CIRI) by modulating various pathological processes, such as inflammatory response, oxidative stress, apoptosis, and so on [ 30 – 32 ]. Studies suggest that various cell death mechanisms can be instigated by I/R-related pathology through processes such as apoptosis [ 32 ]. Apoptosis is a programmed cell death process and is the main pathological feature of CIRI [ 33 ]. This study suggested that XST combined with EE inhibited apoptosis of neurons and then improved cognitive function, by observing the ratio of Bax/Bcl2 proteins in hippocampal neurons and the expression of caspase-3 protein, and these effects are significantly stronger than the group of single treatment with EE or XST. Furthermore, these protective roles can be reversed when LY294002, a PI3K inhibitor, was administered to block the PI3K/Akt signaling pathway. Although our study provides initial evidence of the effects of prophylactic administration of XST before and after the onset of acute stroke surgery, there still are some limitations need to acknowledgment. Considering that this study is an animal experiment, validating the study in human clinical trials is essential. In addition, how to manage the usage accurate time of XST should be further explored in future research. Conclusions In this study, we investigated the efficacy of XST paired with EE on functional outcomes after stroke. Worsened neurobiological injury and increased cognitive impairment were observed in control group compared with the group of pre-treatment mice with XST combined with EE. We administered XST combined with EE for 14 persistent days, including 7 days before and 7 days after stroke surgery respectively. Prophylactic administration of XST combined with EE one week before and after stroke surgery prevents the development and progression of stroke injury, not only relieving anxiety symptoms, but also improving motor and cognitive function, potentially through the inhibition of neuron apoptosis via the PI3K/Akt/mTOR signaling pathway. In addition, no side effects on the other main organs was observed. We, therefore, conclude that prophylactic administration of xuesaitong combined with EE before and after ischemic stroke may be used as preventive approach for ischemic stroke and can enhance function rehabilitation induced by EE. Declarations Ethics statement The Experimental Animal Centre and the Animal Ethics Committee of the Second Affiliated Hospital of Guangzhou Medical University examined and approved the animal study. Clinical trial number: Not applicable. This study involved animal experiments and did not include human participants. CRediT authorship contribution statement SheHong Zhang: Writing – original draft, Methodology, Formal analysis, Data curation, review & editing, Supervision, Project Conceptualization and administration, Funding acquisition. YongGang Zhang: Project administration, Writing – original draft, Validation, Methodology. He Liu: Methodology, Formal analysis, Data curation, review, Supervision. Sheng Qiu: Methodology, Formal analysis, Data curation, review, Supervision. Yuntao Li: Formal analysis, Data curation, review & editing, Supervision. Funding information This work was supported by the Traditional Chinese Medicine Science and Technology Plan Project, Administration of Traditional Chinese Medicine of Zhejiang Province (2023ZL172 to Shehong Zhang) and the Natural Science Fund Project,Huzhou Science and Technology Bureau (No. 2021YZ01 to Shehong Zhang). Declaration of competing interest The authors declare that there are no conflicts of interest regarding the publication of this article. Data availability The data that support the findings of this study are available from the corresponding author upon request. References Chen Z, Jiang B, Ru X, Sun H, Sun D, Liu X, Li Y, Li D, Guo X, Wang W (2017) Mortality of Stroke and Its Subtypes in China: Results from a Nationwide Population-Based Survey. Neuroepidemiology 48(3–4):95–102 Murray CJ, Vos T, Lozano R, Naghavi M, Flaxman AD, Michaud C et al (2012) Disability-adjusted life years (DALYs) for 291 diseases and injuries in 21 regions, 1990–2010: a systematic analysis for the global burden of disease study 2010. Lancet 380(9859):2197–2223 Munthe-Kaas R, Aam S, Ihle-hansen H, Lydersen S, Knapskog A-B, Wyller T et al (2020) Impact of different methods defining post-stroke neurocognitive disorder: The Nor-COAST study. Alzheimers Dement 6(1):e12000–e12000 Tang EY, Amiesimaka O, Harrison SL, Green E, Price C, Robinson L, Siervo M, Stephan BC (2018) Longitudinal Effect of Stroke on Cognition: A Systematic Review. J Am Heart Assoc 7(2):e006443 Katan M, Luft A (2018) Global Burden of Stroke. Semin Neurol 38(2):208–211 Berge E, Whiteley W, Audebert H, De Marchis GM, Fonseca AC, Padiglioni C, de la Ossa NP, Strbian D, Tsivgoulis G, Turc G (2021) European Stroke Organisation (ESO) guidelines on intravenous thrombolysis for acute ischaemic stroke. Eur Stroke J 6(1):I–LXII Radak D, Katsiki N, Resanovic I, Jovanovic A, Sudar-Milovanovic E, Zafirovic S, Mousad SA, Isenovic ER (2017) Apoptosis and Acute Brain Ischemia in Ischemic Stroke. Curr Vasc Pharmacol 15(2):115–122 Uzdensky AB (2019) Apoptosis regulation in the penumbra after ischemic stroke: expression of pro- and antiapoptotic proteins. Apoptosis 24(9–10):687–702 Langhorne P, Wu O, Rodgers H, Ashburn A, Bernhardt J (2017) A Very Early Rehabilitation Trial after stroke (AVERT): a Phase III, multicentre, randomised controlled trial. Health Technol Assess 21(54):1–120 Kempermann G (2020) Delayed gratification in the adult brain. Elife 9:e59786 Zhang X, Chen XP, Lin JB, Xiong Y, Liao WJ, Wan Q (2017) Effect of enriched environment on angiogenesis and neurological functions in rats with focal cerebral ischemia. Brain Res 1655:176–185 Zhang S, Zhang Y, Liu H, Wu F, Wang Z, Li L, Huang H, Qiu S, Li Y (2023) Enriched environment remodels the central immune environment and improves the prognosis of acute ischemic stroke in elderly mice with chronic ischemia. Front Immunol 14:1114596 Duan L, Xiong X, Hu J, Liu Y, Li J, Wang J (2017) Panax notoginseng Saponins for Treating Coronary Artery Disease: A Functional and Mechanistic Overview. Front Pharmacol 8:702 Huang YD, Cheng JX, Shi Y, Gao ZH, Hu YY, Kang R, Wang Y, Liu Y, Ma SC (2022) Panax notoginseng: a review on chemical components, chromatographic analysis, P. notoginseng extracts, and pharmacology in recent five years. Zhongguo Zhong Yao Za Zhi 47(10):2584–2596 Yan S, Xiong H, Shao F, Zhang W, Yang F, Qi Z, Chen S, He L, Jiang M, Su Y, Zhu H, Qin S, Zhu Q, Luo X, Xing Q (2019) HLA-C*12:02 is strongly associated with Xuesaitong-induced cutaneous adverse drug reactions. Pharmacogenomics J 19(3):277–285 Guo H, Adah D, James PB, Liu Q, Li G, Ahmadu P, Chai L, Wang S, Liu Y, Hu L (2018) Xueshuantong Injection (Lyophilized) Attenuates Cerebral Ischemia/Reperfusion Injury by the Activation of Nrf2-VEGF Pathway. Neurochem Res 43(5):1096–1103 Vidal S, Bouzaher YH, El Motiam A, Seoane R, Rivas C (2022) Overview of the regulation of the class IA PI3K/AKT pathway by SUMO. Semin Cell Dev Biol 132:51–61 Zheng T, Jiang T, Ma H, Zhu Y, Wang M (2024) Targeting PI3K/Akt in Cerebral Ischemia Reperfusion Injury Alleviation: From Signaling Networks to Targeted Therapy. Mol Neurobiol 61(10):7930–7949 Zhang S, Si W, Yu Q, Wang Y, Wu Y (2019) Therapeutic effects of combination environmental enrichment with necrostatin-1 on cognition following vascular cognitive impairment in mice. Eur J Inflamm. ;17 Li F, Zhao H, Han Z, Wang R, Tao Z, Fan Z, Zhang S, Li G, Chen Z, Luo Y (2019) Xuesaitong May Protect Against Ischemic Stroke by Modulating Microglial Phenotypes and Inhibiting Neuronal Cell Apoptosis via the STAT3 Signaling Pathway. CNS Neurol Disord Drug Targets 18(2):115–123 Lin Y, Zhu X, Li Y, Dou Y, Wang J, Qi R, Ma L (2023) LY294002 ameliorates psoriatic skin inflammation in mice via blocking the Notch1/Hes1-PTEN/AKT/IL-17A feedback loop. Clin Exp Immunol 213(1):114–124 Zhang G, Lu J, Zheng J, Mei S, Li H, Zhang X, Ping A, Gao S, Fang Y, Yu J (2024) Spi1 regulates the microglial/macrophage inflammatory response via the PI3K/AKT/mTOR signaling pathway after intracerebral hemorrhage. Neural Regen Res 19(1):161–170 Cheng SC, Lin CH, Chang YJ, Lee TH, Ryu SJ, Chen CH, Chang HK, Chang CJ, Hu WL, Hung YC (2013) Fire-heat and Qi deficiency syndromes as predictors of short-term prognosis of acute ischemic stroke. J Altern Complement Med 19(8):721–728 He W, Xu XJ (2006) Attenuation of brain inflammatory response after focal cerebral ischemia/reperfusion with Xuesaitong injection in rats. Chin J Integr Med 12(3):203–206 Zhang J, Guo F, Zhou R, Xiang C, Zhang Y, Gao J, Cao G, Yang H (2021) Proteomics and transcriptome reveal the key transcription factors mediating the protection of Panax notoginseng saponins (PNS) against cerebral ischemia/reperfusion injury. Phytomedicine 92:153613 Wang L, Zhao H, Zhai ZZ, Qu LX (2018) Protective effect and mechanism of ginsenoside Rg1 in cerebral ischaemia-reperfusion injury in mice. Biomed Pharmacother 99:876–882 Zheng T, Jiang T, Ma H, Zhu Y, Wang M (2024) Targeting PI3K/Akt in Cerebral Ischemia Reperfusion Injury Alleviation: From Signaling Networks to Targeted Therapy. Mol Neurobiol 61(10):7930–7949 Zhang Q, Yao M, Qi J, Song R, Wang L, Li J, Zhou X, Chang D, Huang Q, Li L, Wang N (2023) Puerarin inhibited oxidative stress and alleviated cerebral ischemia-reperfusion injury through PI3K/Akt/Nrf2 signaling pathway. Front Pharmacol 14:1134380 Yuan Y, Sheng P, Ma B, Xue B, Shen M, Zhang L, Li D, Hou J, Ren J, Liu J, Yan BC, Jiang Y (2023) Elucidation of the mechanism of Yiqi Tongluo Granule against cerebral ischemia/reperfusion injury based on a combined strategy of network pharmacology, multi-omics and molecular biology. Phytomedicine 118:154934 Meng J, Ma H, Zhu Y, Zhao Q (2021) Dehydrocostuslactone attenuated oxygen and glucose deprivation/reperfusion-induced PC12 cell injury through inhibition of apoptosis and autophagy by activating the PI3K/AKT/mTOR pathway. Eur J Pharmacol 911:174554 Noshita N, Lewén A, Sugawara T, Chan PH (2001) Evidence of phosphorylation of Akt and neuronal survival after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab 21(12):1442–1450 Lopez-Neblina F, Toledo AH, Toledo-Pereyra LH (2005) Molecular biology of apoptosis in ischemia and reperfusion. J Invest Surg 18(6):335–350 Zhang QZ, Guo YD, Li HM, Wang RZ, Guo SG, Du YF (2017) Protection against cerebral infarction by Withaferin A involves inhibition of neuronal apoptosis, activation of PI3K/Akt signaling pathway, and reduced intimal hyperplasia via inhibition of VSMC migration and matrix metalloproteinases. Adv Med Sci 62(1):186–192 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8033676","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":553012582,"identity":"c989c36e-b6cb-4b3d-bc3d-25c2a5d8ceb4","order_by":0,"name":"Yonggang Zhang","email":"","orcid":"","institution":"Huzhou Central Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yonggang","middleName":"","lastName":"Zhang","suffix":""},{"id":553012583,"identity":"fa9b5859-3b7c-4164-ba01-badd0bd22ced","order_by":1,"name":"He Liu","email":"","orcid":"","institution":"Huzhou Central Hospital, The Fifth School of Clinical Medicine of Zhejiang Chinese Medical University","correspondingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Liu","suffix":""},{"id":553012584,"identity":"d9d3cf60-5a55-4941-baeb-c2ff71827292","order_by":2,"name":"Sheng Qiu","email":"","orcid":"","institution":"Huzhou Central Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sheng","middleName":"","lastName":"Qiu","suffix":""},{"id":553012585,"identity":"649e73f2-0ac3-4dfe-a6f5-ad5acc6dc6d0","order_by":3,"name":"Yuntao Li","email":"","orcid":"","institution":"Huzhou Central Hospital, Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuntao","middleName":"","lastName":"Li","suffix":""},{"id":553012586,"identity":"543a82b6-4ba0-4222-b23b-da832565db86","order_by":4,"name":"Shehong Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYDACCTB5gMEARCUYSMixsbcfIEHLhwoLYz6eMwnEa2GccaYicZ6EgwFeHfKzm589/PLnjpw5e+/h17xtEultEgwJDD8qtuHUwjjnmLmxbNszY8uec2nWQC25bdKNBxh7ztzGqYVZIsFMWrLhcOKGGzlmxmAtMgcSmBnbcGthk0j/Ji3x53A9TEs6m0SCAV4tPBI5ZpIf2A4nGNzIMX4444xEAkEtEhI5ZdKMbYcNN5w5YwYMZAnDNmAgH8TnF/kZ6dskf/w5LG9wvMf4Q4JBnbx8e/vBBz8qcGsBBwEPzF8wkQN41QMB4w+o1g+EVI6CUTAKRsHIBABaw1tL8mpRXgAAAABJRU5ErkJggg==","orcid":"","institution":"Huzhou Central Hospital, Zhejiang University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Shehong","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-11-05 03:23:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8033676/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8033676/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98762792,"identity":"1e52f313-dddc-4f23-9bf7-de1091c1d7a8","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7741668,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/5c7acfe800483a3266c89f3f.docx"},{"id":98779687,"identity":"5f727ad6-8370-4005-a224-67bbde7c8cc9","added_by":"auto","created_at":"2025-12-22 12:30:36","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7080,"visible":true,"origin":"","legend":"","description":"","filename":"31220dec75ac47448a03ef387a8aa9ea.json","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/324d5ebcfa4c7a2a9fc65d1e.json"},{"id":98762807,"identity":"fbbf7a87-76c9-45c4-8fa6-cbe2d25f0a0f","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"doc","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36173312,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2uncroppedblots.doc","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/ac31314dacb24197375df7e4.doc"},{"id":98780655,"identity":"a1e18bbd-ade7-4b67-b002-fe2784d62cf9","added_by":"auto","created_at":"2025-12-22 12:31:32","extension":"doc","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54704128,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4uncroppedblots.doc","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/96c62058fd2e2dac7e8efaa7.doc"},{"id":98762820,"identity":"51f597fd-5aec-4de5-8af0-99edbb9fb157","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"doc","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76541952,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6uncroppedblots.doc","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/45b63fb17edd3029a3afc1de.doc"},{"id":98762817,"identity":"1aab4677-8580-4f44-8f9b-aa5f162e31ce","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"doc","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58400256,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7uncroppedblots.doc","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/68dde8eb5b4217422848f78d.doc"},{"id":98779917,"identity":"43a32e72-5af8-4e15-af25-e93df4ce8f88","added_by":"auto","created_at":"2025-12-22 12:30:56","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114609,"visible":true,"origin":"","legend":"","description":"","filename":"31220dec75ac47448a03ef387a8aa9ea1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/5c5b44d14d5ccbcdbbea6f24.xml"},{"id":98777979,"identity":"403d805e-fa8e-46e5-a5aa-356158d72232","added_by":"auto","created_at":"2025-12-22 12:28:46","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1426528,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/4dc89aa80557507f6a68bb21.jpeg"},{"id":98780020,"identity":"e9bf0d47-2b0b-4c3f-92e1-33846c088ad6","added_by":"auto","created_at":"2025-12-22 12:30:59","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1388814,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/12dd6aa272e8f8edaf16f4f0.jpeg"},{"id":98762815,"identity":"92fc4d6f-963d-409f-a692-ac25fcb9a76b","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":889828,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/489359263b764c328bf4e5cd.jpeg"},{"id":98778286,"identity":"7e3c5d64-8a66-4006-a072-9f23f3341be6","added_by":"auto","created_at":"2025-12-22 12:29:07","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":509480,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/8b8d5eb9e70439db30d97258.jpeg"},{"id":98762803,"identity":"7d9b2f4f-e8f0-463d-b5a9-25e7a919e14b","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1927580,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/d615a2ba1316cb3aaf10628f.jpeg"},{"id":98762813,"identity":"4d7d10f0-c6be-452e-a237-950d6494480c","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":857364,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/54790565716f13dc52699554.jpeg"},{"id":98762800,"identity":"f570fcd0-602b-4b6c-9854-6fd37fcca792","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":411582,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/b48ce9fc290b5b997184dde3.jpeg"},{"id":98762798,"identity":"0f51bd7e-d4ad-4738-9963-cda463bb6939","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":743632,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/a1e64885da5dc32933a8885b.jpeg"},{"id":98762811,"identity":"887a1001-ec29-4912-9928-bf6089dbc3ac","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161001,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/40b85d0b35b68451f949057a.png"},{"id":98762812,"identity":"a2081e1e-59a9-4be8-8ba8-970353d4316a","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":203172,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/2a41350be564623e1c11946c.png"},{"id":98762802,"identity":"4c3b5f95-72e0-47f3-8a7a-6f5f8fef3246","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136185,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/f0cc81ebdb8a054f88f66d7e.png"},{"id":98762808,"identity":"0cd20450-a07b-4b2f-b459-c5c4ddb340ec","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65552,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/4ea80f5ccdb68d6b5737c19f.png"},{"id":98778896,"identity":"e78deda1-4203-49f1-b07f-cca1557c819e","added_by":"auto","created_at":"2025-12-22 12:29:47","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":269028,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/e50ce4c7b8b2e59dec463342.png"},{"id":98762805,"identity":"400e73e9-b9dd-49ca-90c5-15aacbbf49ba","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":131995,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/5887a59be27d7222e502ea6f.png"},{"id":98780654,"identity":"4b8a95ee-fee7-4854-898d-9d639e4fd9d3","added_by":"auto","created_at":"2025-12-22 12:31:32","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68905,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/47ea07e1563f73ea562d89a9.png"},{"id":98762816,"identity":"7802af04-169f-47c1-b5bb-a08a7ae7dabf","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":365606,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/924214be02b8e58db6810a7e.png"},{"id":98762819,"identity":"dc92a1fb-6232-4910-8f6c-bb47d8fc0318","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"xml","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":112463,"visible":true,"origin":"","legend":"","description":"","filename":"31220dec75ac47448a03ef387a8aa9ea1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/2751546cd5d247662230d044.xml"},{"id":98779253,"identity":"c4279b8a-8618-479c-9a09-1a0d7cdd15bf","added_by":"auto","created_at":"2025-12-22 12:30:06","extension":"html","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124632,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/6d1e54024bef404ff0348b27.html"},{"id":98762789,"identity":"72b34926-e22e-4360-b9ca-68ceaf10c171","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":270997,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXuesetong (XST) combined with environmental enrichment (EE) improves behavioral manifestations in mice with ischemic stroke\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Route map (top) and heat map (bottom) of mouse movement in the open field test. (B) Route map (top) and heat map (bottom) of mouse movement in the Y-maze test. (C-G) Quantification of OFT, including total distance (C), distance in center (D), distance in periphery (E), center zone entries (F) and periphery zone entries (G). (H-J) Quantification of Y maze, including total distance (H), total arm entries (I) and alternation rates (J). All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/5fbfd37dff7f627a6064d490.png"},{"id":98762787,"identity":"aff7c29b-efb1-451e-96ef-6f37ec82fe7e","added_by":"auto","created_at":"2025-12-22 10:02:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":374486,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST combined with EE improves neuronal outcomes in mice with ischemic stroke\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Representative images of HE (top) and IF staining (bottom). (B) Quantification of HE score. (C) Quantification of NeuN-positive cells. (D). WB analysis of Bcl2, Bax and Cleaved-caspase3 in the brain tissue. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/b5484eaed2b3e25c3e87afaf.png"},{"id":98780684,"identity":"ca27eaaf-fc9f-4ef7-b983-a5958e4ede13","added_by":"auto","created_at":"2025-12-22 12:31:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":220854,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST combined with EE alleviates neuroinflammation in mice with ischemic stroke\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Representative images of IBA1 (top) and GFAP (bottom), scale bar, 50μm. (B) Relative intensity of IBA1-positive cells, n=5. (C) Relative intensity of GFAP-positive cells, n=5. (D-I) Relative mRNA expression of inflammatory factors, including IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β, n=5. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/22d1cf64f494ee4bb16c3511.png"},{"id":98780804,"identity":"cf85ef01-1616-4a89-b19b-e06501a61062","added_by":"auto","created_at":"2025-12-22 12:31:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":175815,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST combined with EE enhances angiogenesis and PI3K/AKT/mTOR pathway in mice with ischemic stroke\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Representative images of CD31, scale bar, 50μm. (B) Relative intensity of GFAP-positive cells, n=5. (C-D) The VEGFA (C) and VEGFR2 (D) content in brain tissue, n=5. (E-H) WB analysis of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/ mTOR in the brain tissue, n=5. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/56f8e33ae9595fac1194162b.png"},{"id":98779989,"identity":"446a65a1-fb70-427e-bb27-96364e4f179a","added_by":"auto","created_at":"2025-12-22 12:30:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":455208,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST combined with EE improves neurological function in mice after ischemic stroke via the PI3K/AKT/mTOR pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Route map (top) and heat map (bottom) of mouse movement in the open field test. (B) Route map (top) and heat map (bottom) of mouse movement in the Y-maze test. (C-G) Quantification of OFT, including total distance (C), distance in center (D), distance in periphery (E), center zone entries (F) and periphery zone entries (G). (H-J) Quantification of Y maze, including total distance (H), total arm entries (I) and alternation rates (J). (K-M) Representative images of HE staining and NeuN.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/77dd5c5f205890e1eb232840.png"},{"id":98762795,"identity":"894d7cc4-2efe-4abd-9064-6ace9d79e9c9","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":304276,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST combined with EE alleviates neuroinflammation and enhances angiogenesis in mice after ischemic stroke via the PI3K/AKT/mTOR pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A) Representative images of IBA1 (top), GFAP (middle) and GFAP (bottom), scale bar, 50μm. (B-D) Relative intensity of IBA1, GFAP and CD31. (E-J) Relative mRNA expression of inflammatory factors, including IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β, n=5. (K-L) The VEGFA and VEGFR2 content in brain tissue, n=5. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance. (M-S) WB analysis of Bcl2, Bax and Cleaved-caspase3, p-PI3K/PI3K, p-AKT/AKT and p-mTOR/ mTOR in the brain tissue, n=5. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/85a03846a375524fb835e224.png"},{"id":98762794,"identity":"286db6a3-15ef-4f34-a126-22e2650f401c","added_by":"auto","created_at":"2025-12-22 10:02:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":142020,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eXST alleviates OGD/R-induced BV2 inflammation via the PI3K/AKT/mTOR pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: (A-D) WB analysis of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/ mTOR in BV2 cells, n=3. (E-J) Relative mRNA expression of inflammatory factors, including IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β in BV2 cells, n=3. All values represent mean ± SD. \u003cem\u003ens\u003c/em\u003e, no significance.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/c71d2c0b897b83d74a3ccbd9.png"},{"id":98779570,"identity":"042dfddb-6910-4729-a2bd-855ecca8d21d","added_by":"auto","created_at":"2025-12-22 12:30:27","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":733852,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHE staining of heart, liver, spleen, lung and kidney.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNote: the histopathological evaluation of heart, liver, spleen, lung, and kidney by HE staining analysis following treatment with XST, EE, and XST combined with EE, for 14 days including 7 days before and after stroke surgery respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S2. HE staining of heart, liver, spleen, lung and kidney.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/170d4a0b0399b8a717b1d891.png"},{"id":101250272,"identity":"28779ed0-c0a4-45f1-88af-836bafa77e10","added_by":"auto","created_at":"2026-01-27 17:25:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3746046,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8033676/v1/88f61561-d181-42a4-9a87-2b64ed4e3d85.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Xuesaitong injection paired with enriched environment displays neuroprotective effects and promotes functional rehabilitation by activating the PI3K/AKT/mTOR pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eStroke is reported to be the second leading cause of death [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and remains the third-most cause of disability-adjusted life years in the world [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], despite remarkable improvement in the diagnosis and treatment of acute ischemic stroke, which has a great impact on public health in the world. The prevalence of mild and major cognitive impairments appears to vary from 14 to 29% and from 11 to 42%, respectively, depending on the method adopted to define post-stroke neurocognitive disorder after three months suffered from stroke [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Incident stroke is associated with an increased risk of acute decline in cognitive function [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. An aging population coupled with the burden of accumulating risk factors contributes to such increase in lifetime risk of stroke. In addition, increasing socioeconomic status in the developing countries has led to an epidemic rise in the risk factors for stroke in younger adults [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], which contributed to the increase of the rates of post-stroke disability. However, unfortunately, treatment of cerebral ischemic stroke is limited since the only verified treatment, recombinant tissue plasminogen activator must be administered within 4.5h after the onset of stroke to ensure its effectiveness[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therefore, developing novel therapeutic paradigm or strategy to improve general functional rehabilitation in people with the attack of stroke remains to be a huge challenge.\u003c/p\u003e \u003cp\u003eCell apoptosis is a significant pathological mechanism in ischemic reperfusion cerebral injury and primarily occurs in the penumbra and core zone of cerebral ischemia, where neuronal cells initiate apoptosis in response to multifaceted harmful stimuli following the onset of ischemic stroke[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. When ischemia occurs, pro-apoptotic proteins are released to activate the caspase family of proteins, thereby executing the apoptotic program[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, there is necessity to investigate a novel and effective therapeutic paradigm to alleviate brain injury and functional impairment, and enhance prognosis.\u003c/p\u003e \u003cp\u003eIt is well-documented that an enriched environment (EE) is a non-invasive complex stimulus by equipping the environment with more attractive physical activity, more social interaction, introduction to novel different toys, and a larger housing space than a normal cage. EE has been demonstrated to play significant roles in improving brain plasticity, angiogenesis, and neurogenesis, eventually attaching a beneficial influence on the recovery of cognitive and motor function after brain injury [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] and our previous studies on this subject have showed that EE treatment following ischemic stroke in elder mice promoted outcome of elder mice with ischemic brain injury by inhibiting neuroinflammation and improving the central immune environment and enhanced cognitive and motor function [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWith the rapid advancement of traditional Chinese medicine (TCM), clinical therapeutic effects of it, especially that of promoting blood circulation and removing blood stasis, provide a new approach for the treatment of ischemic stroke. The curative effect of Xuesaitong injection (XST), a world renowned Chinese patent medicine, mainly comes from Panax notoginseng saponins (PNS), which is a mixture composed of Rb1, Rc, Rd, Re, Rg1 and Rh1 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and is the main constituents responsible for its pharmacological activities of improving hemorheology, preventing platelet aggregation and maintaining normal circulation[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Given its therapeutic advantages like promoting blood circulation for removing stasis and unclogging the meridians, and few adverse reactions, \u0026ldquo;Xuesaitong\u0026rdquo; (XST) has been widely used in the treatment of acute stroke induced by ischemia and reperfusion damage[\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, the possible influence of prophylactic administration of XST coupled with EE on the prognosis of ischemic stroke before and after the onset of acute ischemic stroke have not been confirmed. The previous studies suggested that Phosphatidylinositol 3-kinase (PI3K) could induce conformational changes in downstream proteins like AKT, activate and eventuate in the phosphorylation and activation of AKT, thereby regulating the process of cell survival [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and that PI3K/AKT signaling exerts a significant role in the pathology of ischemic stroke [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Here we hypothesize that prophylactic administration of XST combined with EE could inhibit neuronal apoptosis and inflammation, reduce the severity of acute stroke and improve prognosis by regulating the PI3K/AKT/mTOR pathway, and we then validate our hypothesis on ischemic stroke model by transient middle cerebral artery occlusion (tMCAO) at the present study, providing novel therapeutic paradigm and a significant theoretical basis for stroke.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals\u003c/h2\u003e \u003cp\u003e12-week-old C57BL/6 male mice were purchased from Shanghai Laboratory Animal Center and housed in a controllable environment ((25\u0026thinsp;\u0026plusmn;\u0026thinsp;2℃; 12:12-h light/dark cycle, 50\u0026ndash;60% relative humidity) in which animal could freely acquire filtered clean water and standard laboratory diet for 7 days to habituate themselves with the surrounding environment prior to initiating experimental procedure. All the tests of behaviour were carried out between 9 and 17 AM. All of the animal experimental protocols were approved by Huzhou Central Hospital Animal Care and Use Committee and were complete congruent with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Registration number: 202212001, Dec. 23, 2022). Housing conditions for enriched environment (EE) and standard environment (SE) were set up according to our previous work [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Transient MCAO model Construction and Experimental Grouping\u003c/h2\u003e \u003cp\u003eIn order to simulate the occurrence of acute ischemic stroke, the Middle Cerebral Artery Occlusion (MCAO) model was established as previously described [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Briefly, anesthesia was induced and kept with 2% isoflurane. Next, we occluded the left middle cerebral artery with a suture (Doccol, Corp, Redlands) for one hour. Then, the suture was removed after one hour to restore cerebral blood flow. At last, the experimental animals were carefully placed in the previous housing cages when the wound was stitched and disinfected. Sham-operated mice were subject to the similar surgical operation except for ligation induced by the suture. After finishing surgery, the experimental mice were randomly divided into two parts: the one part of animals were divided into five groups: (1)sham-group; (2)MCAO\u0026thinsp;+\u0026thinsp;SE group; (3)MCAO\u0026thinsp;+\u0026thinsp;XST group; (4)MCAO\u0026thinsp;+\u0026thinsp;EE group; (5) MCAO\u0026thinsp;+\u0026thinsp;EE\u0026thinsp;+\u0026thinsp;XST group; the other part of animals were divided into four groups: (1)MCAO (+\u0026thinsp;SE-vehicle) group; (2)MCAO\u0026thinsp;+\u0026thinsp;LY294002 group; (3)MCAO\u0026thinsp;+\u0026thinsp;EE\u0026thinsp;+\u0026thinsp;XST group; (4) MCAO\u0026thinsp;+\u0026thinsp;EE\u0026thinsp;+\u0026thinsp;XST\u0026thinsp;+\u0026thinsp;LY294002 group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Drug Intervention Protocol and Administration\u003c/h2\u003e \u003cp\u003eIn this study, Xuesaitong injection was purchased from KPC Pharmaceuticals, Inc, (Z20026438, Yunnan, China) and was freshly dissolved with 5% glucose injection to a concentration of 1.5mg/ml according to the previous report with slight changes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Xuesaitong was administrated at a volume of 0.1mL/10g (15\u0026micro;g/g/day) via caudal vein for 1h after MCAO surgery, for 14 consecutive days. Sham and vehicle-treated mice were injected with the equal volume of 5% glucose injection in the same way. All assessments were conducted by investigators blinded to experimental group assignments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Animal Behavioral Experiments\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eOpen Field Test (OFT)\u003c/strong\u003e \u003cp\u003eAnxiety-like behavior and the ability of locomotion of mice were determined by using open field test according to previously described [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Each mouse was carefully placed in the center of a test chamber (40 \u0026times; 40 \u0026times; 50 cm) of the experimental equipment with a camera, and the movement trace of the mouse was recorded for 10 min during the whole course of the test. Parameters, including the distance of movement, the time spent in the different zones, latency to the different zones, were analyzed with Tracking Master software v5.0.6 (Zhongshi Science and Technology, Beijing, China).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eY-maze Test\u003c/strong\u003e \u003cp\u003eTo evaluate the function of learning and memory, experimental mice were performed Y maze test in the study according to our previous report [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Each mouse was allowed to freely explore for 6 min, meanwhile, the behavior of mouse was recorded with the camera. The data were finally analyzed with the software above mentioned.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Immunohistochemical and Immunofluorescence Analysis of Protein Expression\u003c/h2\u003e \u003cp\u003eBrains of mice were carefully collected after perfusion and then placed into a small vessel and fixed in 4% PFA and were deposited in 30% sucrose at 4\u0026deg;C the next day. Brain slices were blocked with 2% BSA solution for one hour at room temperature, and incubated with the primary antibodies indicated at 4\u0026deg;C overnight. Primary antibodies were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. On the following day, the slice samples were rinsed for three times with neutral PBS, and incubated with relevant secondary antibodies for 1.5 hour at room temperature in the special dark boxes. The nuclei were then stained with DAPI (4,6-diamino-2-phenylindole, 1:1000) for 20 minutes. Fluorescence images were captured using an fluorescence microscope (Olympus Optical, Japan), and were analyzed with Image J software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimary antibodies used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReagents\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCatalog number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eApplication details\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3498\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2772\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCleaved-caspase3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9661\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep-PI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4228\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePI3K\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep-AKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4060\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep-mTOR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2971\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emTOR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2972\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e77699\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIF 1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNeuN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIF 1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIBA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIF 1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCell Signaling Technology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12389\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIF 1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10494-1-AP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIB 1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Hematoxylin-Eosin (H\u0026amp;E) Staining for Histopathological Analysis\u003c/h2\u003e \u003cp\u003eAs previously reported [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], pathological samples of brain tissue and the other internal tissues were collected from each group of mice after completing the whole experimental protocol. The tissues were fixed in 10% neutral buffered formalin for 24h in order to preserve organizational ultrastructure. The samples were then processed through a series of alcohol and xylene washes to dehydrate the tissue before being embedded in paraffin. Subsequently, the embedded tissues were cut into thin sections with 5 \u0026micro;m thick, which were placed on glass slides and stained with hematoxylin (staining cell nuclei, displayed in blue) and eosin (counterstaining the chtoplasm and cell membranes, displayed in pink) at room temperature for histopathological observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Western Blot Analysis\u003c/h2\u003e \u003cp\u003eMice were sacrificed with overdose isoflurane and the brains were harvested. The designed brain tissues of mice at the special time point were carefully separated. Western blot was performed according to standard protocol with proper antibodies, as previously reported [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In brief, proteins from fresh brain tissues were homogenized using RIPA lysis buffer (Bioworld, USA), and the concentration of the protein was quantified using a BCA protein assay kit (Invitrogen, USA). Equal amounts of protein in each sample were then electrophoresed separated by sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS\u0026ndash;PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Massachusetts, USA). 5% milk solution was used to block the membranes for 1.5 h at room temperature and then incubated with the primary antibodies at 4\u0026deg;C overnight. On the next day, membranes were rinsed for three times with neutral PBST, and incubated with relevant secondary antibodies for 1h at room temperature. After that, the membranes were exposed to the mixed enhanced chemiluminescence (ECL) solution prior to visualizing using a GelPro System. Finally, The density value of the protein bands was analyzed by using Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Real-Time Polymerase Chain Reaction\u003c/h2\u003e \u003cp\u003eTo analyze mRNA expression level, total RNA was extracted from the ipsilateral hemisphere of the brains from each group mice with Trizol (Invitrogen) in turn. Then 1 \u0026micro;g total RNA was reverse transcribed using a SuperScript\u0026trade; III Reverse Transcriptase kit with oligo (dT) primers (Invitrogen). cDNA synthesis, RT-PCR, and qPCR were conducted as described in detail in a previous study [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Cycle time values were normalized against the GAPDH values of the same sample. The primer sequences used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ethe primer sequences used in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGATGAGGACATGAGCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTGCAGACTCAAACTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTTCTTGGGATGATGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGAAATTGGGGTAGGAAGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTG AAC TTC GGG GTG ATC GG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGC TTG TCA CTC GAA TTT TGA GA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTCTCTGAAGGACTCTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTTGCCCACGGACACAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCTTACTGACTGGCATGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCAGCTCTAGGAGCATGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCCGTGGCTTCTAGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTTAGTTTGGACAGGATCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTCACGGCAAATTCAACGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTCCACGACATACTCAGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 the PI3K/AKT/mTOR Pathway Inhibition Assay\u003c/h2\u003e \u003cp\u003eTo determine whether the neuroprotective role of XST combined with EE against ischemic stroke are dependent on the PI3K/AKT/mTOR signaling axis, experimental mice were pretreated with the PI3K inhibitor, LY294002, at 10 mg/kg/day (Selleck, #S1105) via caudal vein for 2 h before XST injection in experimental mice, which was dissolved in dimethyl sulfoxide (DMSO) (Sigma-Aldrich; Merck KGaA) as previously reported [21.]\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis in this study was performed using GraphPad Prism software version 9 (GraphPad Software, Inc., San Diego, CA). All cases were analyzed by using one-way ANOVA with Tukey test for multiple comparisons. The behavioral tests were compared using a two-way analysis of variance. All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) and value of \u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Effect of XST paired with EE on behavior analysis in MCAO mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate how the stroke mice responds to the treatment of XST combined with EE,\u0026nbsp;we conducted behavior analysis in the first stage of the experimental protocol. As designed in \u003cstrong\u003eFigure 1,\u0026nbsp;\u003c/strong\u003ewe performed OFT and Y-maze test in mice 8 days after MCAO. In OFT, movement track and heatmap were shown in \u003cstrong\u003eFigure 1 A\u003c/strong\u003e, while the data analysis were shown in the figure 1C-G. As can be seen from Figure 1C-G, in the XST combined with EE group, movement total distance and entries times through the center zone both were the highest, contrast to the other three MCAO groups. Interestingly, there was significant difference only in the parameter of the distance in periphery between the XST+EE treatment group and the EE group as shown in figure 1E. In Y-maze test, the highest total distance, total arm entries and alternation rate were observed in XST+EE treated mice as shown in the figure 1H-J, contrast to the other three MCAO groups. Taken together, the results in OFT and Y-maze test indicated that these three groups treated by XST-group, EE-group, and XST+EE group respectively, all improved the behaviour outcomes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Xuesaitong C\u003c/strong\u003e\u003cstrong\u003eombined with EE P\u003c/strong\u003e\u003cstrong\u003erotects against M\u003c/strong\u003e\u003cstrong\u003eorphological\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;I\u003c/strong\u003e\u003cstrong\u003enjury and N\u003c/strong\u003e\u003cstrong\u003eeuronal Apoptosis\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ein MCAO Mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApoptosis may be responsible for a large proportion of neuron death following acute brain ischemia, to investigate the effect and the underlying mechanisms of XST combined with EE on the ischemic stroke, we performed Histomorphological and Western blotting determination to examine the level apoptosis of neurons and\u0026nbsp;morphological injury in surrounding area of ischemic lesion. It can be seen in the figure 2A-C that ischemia contributed to a significant numbers of death neurons with an decreased number of NeuN+ cells, and the treatment with XST, EE, and XST+EE attenuated these brain injuries, and that there was no significant difference in the HE evaluation between the EE treated group and XST+EE combination treatment group, while there was a significant difference between the XST treated group and the XST+EE combination treatment group; unlike this, regarding to the number of NeuN+ cells, we observed significant difference not only between all these groups. In the meantime, pro-apoptotic protein like Bax and Cleaved-caspase 3 were increased in MCAO mice, decreased anti-apoptosis protein, Bcl2, was observed after stroke surgery. We also found that XST significantly reversed the change of proteins related to apoptosis as shown in the figure 2D-G.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 the treatment XST Combined with EE Suppresses Activation of Glial\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;C\u003c/strong\u003e\u003cstrong\u003eells\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and Inflammation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeurons apoptosis may be responsible for the release of pro-inflammatory cytokines from microglia following acute ischemic stroke [20]. To further investigate whether xuesaitong improves inflammatory environment derived from microglia and astrocytes, we carried out IF staining and mRNA measure to examine the expression levels of proteins IBA1 and GFAP and factors related to inflammation including IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β. the results demonstrated that XST improved inflammatory environment with decrease of IBA1 and GFAP proteins (figure 3A-C), and decreased pro-inflammatory cytokines like IL-1β, IL-6, TNF-α, IL-4, IL-10 and TGF-β, while increased anti-inflammatory cytokines such as IL-4, IL-10 and TGF-β (figure 3D-I). All the data showed that the treatment XST combined with EE displayed the strongest influence on the stroke injuries.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 XST Promotes Post-ischemic Angiogenesis and Activate the PI3K/AKT/mTOR Signaling Pathway\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of XST on angiogenesis, the levels of VEGFA and VEGFR2, penumbra brain tissue were examined at 8 days after MCAO with IF staining and ELISA assay. As shown in the figure 4A-4B, we observed that XST remarkably enhanced Density of neovascularization with the increase of CD31 expression. The obvious enhancement of factors related to angiogenesis like VEGFA and VEGFR were also observed in the figure 4C-4D following the treatment of XST and EE. Interestingly, there was an remarkably difference between the sham group and vehicle group after 8 days of stroke, indicating that cerebral ischemia, to some extent, could induce its own vascular repair . However, after treatment with XST and EE, the levels of VEGFA and VEGFR were further increased, and more increased vascular density in penumbral area was observed compared with the vehicle group which were shown in the figure 4A-4D. To examine whether XST promotes angiogenesis through these core targets, we performed Western blot assay to measure the levels of p-PI3K, p-AKT, and p-mTOR proteins expression, and the findings demonstrated that, similarly, the activation of the PI3K/AKT/mTOR signaling was observed with the increase of p-PI3K, p-AKT, and p-mTOR proteins in the above experimental administration.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 XST Combined with EE Improves Neurological Function in Mice after Ischemic Stroke via the PI3K/AKT/mTOR Pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order verify our hypothesis that the treatment of XST combined with EE promotes functional recovery in stroke mice dependent on the PI3K/AKT/mTOR pathway, we performed behaviour test and histopathological evaluation once more following administration of inhibitor of the pathway, LY294002. The results demonstrated that LY294002 obviously abolished the effect of XST combined with EE on the stroke mice as shown in the figure 5A-5J. In the OFT, as shown in the figure 5C-5G, the total distance, distance in center and in periphery, entries in the center and peripheries zone, all these parameters were significantly decreased after administration of LY294002, which suggested that both motor function and the willingness of mice to explore were significantly decreased after administration of LY294002. In the meantime, we observed in the Y-maze test that administration of LY294002 also remarkably abolished the cognitive function and motor function as shown in the figure 5B, 5I-5J. to our surprise was that LY294002, the inhibitor of the PI3K/AKT, deteriorated the stroke injuries compared with MCAO group. The morphological evaluation with HE staining and IF staining of NeuN showed the similar changes with the above behaviour test. All these results suggested that the PI3K/AKT/mTOR pathway is involved in ischemic stroke injuries and the necessary to the protection against stroke injury of XST combined with EE.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 the treatment of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eXST Combined with EE Alleviates Neuroinflammation and Angiogenesis in Stroke Mice via the PI3K/AKT/mTOR Pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the published literature, classical pathway like the PI3K/AKT/mTOR pathway is closely related to neuroinflammation [22].\u0026nbsp;In order to elucidate the\u0026nbsp;mechanisms of cerebral angiogenesis and inflammtory,\u0026nbsp;we performed IF staining, western blot, and mRNA assay in mice with ischemic stroke.\u0026nbsp;RT-PCR analysis demonstrated that after following administration of LY294002, the inhibitor of PI3K/AKT axis, brain injuries were\u0026nbsp;exacerbated in turn by releasing\u0026nbsp;pro-inflammatory cytokines such as IL-1β, IL-6, and tumor necrosis factor\u0026nbsp;(TNF-α), from glia cells with IBA1 and GFAP positive, while alternatively inhibited anti-inflammatory trophic factors like IL-4, IL-10 and TGF-β. Similarly, CD31, and its dependent VEGFA/VEGFR pathway undergone corresponding changed by the administration of LY294002. At last, we carried out western blot to determine apoptosis and the\u0026nbsp;PI3K/AKT/mTOR signaling pathway. As shown in the figure 6M-6S, the inhibition of\u0026nbsp;the\u0026nbsp;PI3K/AKT/mTOR signaling pathway aggravated apoptosis of neurons and in turn abolished the protecting roles of treatment of XST combined with EE on the neurons of stroke mice, suggesting which was dependent on\u0026nbsp;the\u0026nbsp;PI3K/AKT/mTOR signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eXST activates the PI3K/AKT/mTOR pathway in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo simulate ischemic stroke,\u0026nbsp;the oxygen-glucose deprivation/reperfusion (\u003cstrong\u003eOGD\u003c/strong\u003e/\u003cstrong\u003eR\u003c/strong\u003e) cell\u0026nbsp;model was established. As shown in the figure 7 A-D, we could observe that the phosphorylation levels of PI3K, AKT, and mTOR were significantly increased in the XST administration group compared to the vehicle group, while LY294002 significantly abolished these changes. And RT-PCR analysis showed that compared with the vehicle group, XST treatment decreased the expression levels of pro-inflammatory factors and increased the expression levels of trophic factors accordingly. The present in vitro experiments showed that in comparison with XST-treated group, LY294002, the inhibitor of PI3K/AKT axis, significantly abolished these protective effects of XST with the similar way in the experimental group of XST combined with LY294002 by regulating the PI3K/AKT/mTOR signaling pathway, which is consistent with the results of in vivo experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.8 the Administration of XST did not Cause Side Effects on the Other Organs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe side effect of XST with therapeutic dose on the stroke mice still remains a challenge in the clinical treatment, here we performed histopathological evaluation of heart, liver, spleen, lung, and kidney. The results suggested that no significant difference between the sham and the other treatment groups was observed in all these tissues as shown in the figure 8.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAccording to the theory of Traditional Chinese Medicine, blood stasis is the most important pathological product of acute ischemic stroke, which account for about 98% [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Therefore, promoting blood circulation and removing blood stasis, the vital mechanism in the treatment of ischemic stroke, have peculiar advantages [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Panax notoginseng saponins (PNS) are extracted from the traditional Chinese medicinal herb P. notoginseng (Sanqi), which have a unique effect of promoting blood circulation and removing blood stasis. In China, a series of commercial preparations of PNS have been extensively researched and used, such as XST, which has been shown to alleviate brain edema in animals suffering from focal cerebral ischemia/reperfusion injury through suppressing the expression of ICAM-1 protein and neutrophil infiltration during the acute phase of stroke onset [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, the effects of prophylactic administration of XST before and after the onset of ischemic stroke remain to be explored.\u003c/p\u003e \u003cp\u003eThe MCAO mice model surgery was established to investigate and validate the curative effects and mechanisms of XST on acute ischemia, primarily in ischemic core and penumbra areas of the infarct focus. The expression of NeuN protein and HE injury score in brain tissue in MCAO mice were measured by using method of histochemical and immunofluorescence staining. The results indicated that the expression of NeuN protein was significantly increased in the (MCAO\u0026thinsp;+\u0026thinsp;XST\u0026thinsp;+\u0026thinsp;EE) group and HE tissue damage score decreased correspondingly in the this group. Moreover, Proteins related to apoptosis, cleaved-capasise 3, bcl2, and Bax, were decreased, while the ratio of Bax/Bcl2 proteins increased in the the (MCAO\u0026thinsp;+\u0026thinsp;XST\u0026thinsp;+\u0026thinsp;EE) group, which suggesting that XST combined with EE inhibited apoptosis of neurons after the attack of stroke.\u003c/p\u003e \u003cp\u003eFor the first time, we reported the preventive effects of the XST injection combined with EE, a component of traditional Chinese medicine (TCM), which the main component is a total saponins preparation of \u003cem\u003ePanax notoginseng\u003c/em\u003e, on ischemic stroke. Firstly, prophylactic administration of XST before the onset of ischemic stroke can prevent motor and cognitive function impairment and protect mice against MCAO injury. Secondly, it can enhance the neuroprotective effects and functional rehabilitation of enriched environment on stroke mice. Thirdly, XST can reduce inflammation factors levels and inhibiting neuronal apoptosis by rugulatin the PI3K/Akt/mTOR signaling.\u003c/p\u003e \u003cp\u003eA recent study reported that PNS attenuated inflammation in the infarct area [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and ameliorate damage induced by ischemic stroke via suppressing inflammation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Consistent with previous reports, XST alleviated MCAO symptoms, reduced the expression of pro-inflammatory cytokines like IL-1β, IL-6, and TNF-α, and increased the expression of anti-inflammatory cytokines like IL-4, IL-10, and TGF-β, which suggesting that prophylactic administration of XST combined with EE before and after the onset of ischemic stroke could exert protective effects against stroke initial injure and improve overall function rehabilitation. Meanwhile, the expression levels of IBA1 and GFAP proteins appeared the same trend of change as the inflammatory response.\u003c/p\u003e \u003cp\u003eExtending these findings, we, therefore, investigated whether XST play anti-inflammatory effects on ischemic stroke through playing an effect on angiogenesis, like vascular growth factor VEGFA and VEGR2, and CD31 protein. We observed that XST combined with EE considerably enhanced the expression level of CD31, VEGFA, and VEGR2, while these positive effects were offset by LY294002, a PI3K inhibitor, administration. Correspondingly, we conducted behavioral tests like OFT and Y-maze. In OFT, we observed that the administration of XST significantly increased the mobility time and the average speed of the mice and spent more activity time and covered more distance in the center of field, indicating that their desire to survive and explore increased in the mice. Similarly, all of these curative effects were markedly abolished by LY294002 administration. These results suggested that XST combined with EE counteracted acute ischemic stroke damage and improved neurological functional outcomes in the first 7 days after MCAO surgery. Additionally, no side effects on the other organs was observed following the administration of XST in stroke mice. Therefore, XST may be as a prophylactic medicine against stroke occurrence in the future and be used with the other physicotherapy.\u003c/p\u003e \u003cp\u003eStudies have suggested that PI3K/AKT signaling pathway is involved in the neuroprotective effect of cerebral ischemic injury and plays a pivotal role in this process [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The activation of PI3K/Akt signaling pathway can mediate the occurrence and development of cerebral ischemia/reperfusion injury (CIRI) by modulating various pathological processes, such as inflammatory response, oxidative stress, apoptosis, and so on [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Studies suggest that various cell death mechanisms can be instigated by I/R-related pathology through processes such as apoptosis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Apoptosis is a programmed cell death process and is the main pathological feature of CIRI [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. This study suggested that XST combined with EE inhibited apoptosis of neurons and then improved cognitive function, by observing the ratio of Bax/Bcl2 proteins in hippocampal neurons and the expression of caspase-3 protein, and these effects are significantly stronger than the group of single treatment with EE or XST. Furthermore, these protective roles can be reversed when LY294002, a PI3K inhibitor, was administered to block the PI3K/Akt signaling pathway.\u003c/p\u003e \u003cp\u003eAlthough our study provides initial evidence of the effects of prophylactic administration of XST before and after the onset of acute stroke surgery, there still are some limitations need to acknowledgment. Considering that this study is an animal experiment, validating the study in human clinical trials is essential. In addition, how to manage the usage accurate time of XST should be further explored in future research.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we investigated the efficacy of XST paired with EE on functional outcomes after stroke. Worsened neurobiological injury and increased cognitive impairment were observed in control group compared with the group of pre-treatment mice with XST combined with EE. We administered XST combined with EE for 14 persistent days, including 7 days before and 7 days after stroke surgery respectively. Prophylactic administration of XST combined with EE one week before and after stroke surgery prevents the development and progression of stroke injury, not only relieving anxiety symptoms, but also improving motor and cognitive function, potentially through the inhibition of neuron apoptosis via the PI3K/Akt/mTOR signaling pathway. In addition, no side effects on the other main organs was observed. We, therefore, conclude that prophylactic administration of xuesaitong combined with EE before and after ischemic stroke may be used as preventive approach for ischemic stroke and can enhance function rehabilitation induced by EE.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Experimental Animal Centre and the Animal Ethics Committee of the Second Affiliated Hospital of Guangzhou Medical University examined and approved the animal study.\u003c/p\u003e\n\u003cp\u003eClinical trial number: Not applicable. This study involved animal experiments and did not include human participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSheHong Zhang: Writing – original draft, Methodology, Formal analysis, Data curation, review \u0026amp; editing, Supervision, Project Conceptualization and administration, Funding acquisition. YongGang Zhang: Project administration, Writing – original draft, Validation, Methodology. He Liu: Methodology, Formal analysis, Data curation, review, Supervision. Sheng Qiu: Methodology, Formal analysis, Data curation, review, Supervision. Yuntao Li: Formal analysis, Data curation, review \u0026amp; editing, Supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Traditional Chinese Medicine Science and Technology Plan Project, Administration of Traditional Chinese Medicine of Zhejiang Province (2023ZL172 to Shehong Zhang) and the Natural Science Fund Project,Huzhou Science and Technology Bureau (No. 2021YZ01 to Shehong Zhang).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest regarding the publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChen Z, Jiang B, Ru X, Sun H, Sun D, Liu X, Li Y, Li D, Guo X, Wang W (2017) Mortality of Stroke and Its Subtypes in China: Results from a Nationwide Population-Based Survey. Neuroepidemiology 48(3\u0026ndash;4):95\u0026ndash;102\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurray CJ, Vos T, Lozano R, Naghavi M, Flaxman AD, Michaud C et al (2012) Disability-adjusted life years (DALYs) for 291 diseases and injuries in 21 regions, 1990\u0026ndash;2010: a systematic analysis for the global burden of disease study 2010. Lancet 380(9859):2197\u0026ndash;2223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunthe-Kaas R, Aam S, Ihle-hansen H, Lydersen S, Knapskog A-B, Wyller T et al (2020) Impact of different methods defining post-stroke neurocognitive disorder: The Nor-COAST study. Alzheimers Dement 6(1):e12000\u0026ndash;e12000\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang EY, Amiesimaka O, Harrison SL, Green E, Price C, Robinson L, Siervo M, Stephan BC (2018) Longitudinal Effect of Stroke on Cognition: A Systematic Review. J Am Heart Assoc 7(2):e006443\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatan M, Luft A (2018) Global Burden of Stroke. Semin Neurol 38(2):208\u0026ndash;211\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerge E, Whiteley W, Audebert H, De Marchis GM, Fonseca AC, Padiglioni C, de la Ossa NP, Strbian D, Tsivgoulis G, Turc G (2021) European Stroke Organisation (ESO) guidelines on intravenous thrombolysis for acute ischaemic stroke. Eur Stroke J 6(1):I\u0026ndash;LXII\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadak D, Katsiki N, Resanovic I, Jovanovic A, Sudar-Milovanovic E, Zafirovic S, Mousad SA, Isenovic ER (2017) Apoptosis and Acute Brain Ischemia in Ischemic Stroke. Curr Vasc Pharmacol 15(2):115\u0026ndash;122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUzdensky AB (2019) Apoptosis regulation in the penumbra after ischemic stroke: expression of pro- and antiapoptotic proteins. Apoptosis 24(9\u0026ndash;10):687\u0026ndash;702\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanghorne P, Wu O, Rodgers H, Ashburn A, Bernhardt J (2017) A Very Early Rehabilitation Trial after stroke (AVERT): a Phase III, multicentre, randomised controlled trial. Health Technol Assess 21(54):1\u0026ndash;120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKempermann G (2020) Delayed gratification in the adult brain. Elife 9:e59786\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Chen XP, Lin JB, Xiong Y, Liao WJ, Wan Q (2017) Effect of enriched environment on angiogenesis and neurological functions in rats with focal cerebral ischemia. Brain Res 1655:176\u0026ndash;185\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Zhang Y, Liu H, Wu F, Wang Z, Li L, Huang H, Qiu S, Li Y (2023) Enriched environment remodels the central immune environment and improves the prognosis of acute ischemic stroke in elderly mice with chronic ischemia. Front Immunol 14:1114596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan L, Xiong X, Hu J, Liu Y, Li J, Wang J (2017) \u003cem\u003ePanax notoginseng\u003c/em\u003e Saponins for Treating Coronary Artery Disease: A Functional and Mechanistic Overview. Front Pharmacol 8:702\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang YD, Cheng JX, Shi Y, Gao ZH, Hu YY, Kang R, Wang Y, Liu Y, Ma SC (2022) Panax notoginseng: a review on chemical components, chromatographic analysis, P. notoginseng extracts, and pharmacology in recent five years. Zhongguo Zhong Yao Za Zhi 47(10):2584\u0026ndash;2596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan S, Xiong H, Shao F, Zhang W, Yang F, Qi Z, Chen S, He L, Jiang M, Su Y, Zhu H, Qin S, Zhu Q, Luo X, Xing Q (2019) HLA-C*12:02 is strongly associated with Xuesaitong-induced cutaneous adverse drug reactions. Pharmacogenomics J 19(3):277\u0026ndash;285\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo H, Adah D, James PB, Liu Q, Li G, Ahmadu P, Chai L, Wang S, Liu Y, Hu L (2018) Xueshuantong Injection (Lyophilized) Attenuates Cerebral Ischemia/Reperfusion Injury by the Activation of Nrf2-VEGF Pathway. Neurochem Res 43(5):1096\u0026ndash;1103\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVidal S, Bouzaher YH, El Motiam A, Seoane R, Rivas C (2022) Overview of the regulation of the class IA PI3K/AKT pathway by SUMO. Semin Cell Dev Biol 132:51\u0026ndash;61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng T, Jiang T, Ma H, Zhu Y, Wang M (2024) Targeting PI3K/Akt in Cerebral Ischemia Reperfusion Injury Alleviation: From Signaling Networks to Targeted Therapy. Mol Neurobiol 61(10):7930\u0026ndash;7949\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Si W, Yu Q, Wang Y, Wu Y (2019) Therapeutic effects of combination environmental enrichment with necrostatin-1 on cognition following vascular cognitive impairment in mice. Eur J Inflamm. ;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi F, Zhao H, Han Z, Wang R, Tao Z, Fan Z, Zhang S, Li G, Chen Z, Luo Y (2019) Xuesaitong May Protect Against Ischemic Stroke by Modulating Microglial Phenotypes and Inhibiting Neuronal Cell Apoptosis via the STAT3 Signaling Pathway. CNS Neurol Disord Drug Targets 18(2):115\u0026ndash;123\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Y, Zhu X, Li Y, Dou Y, Wang J, Qi R, Ma L (2023) LY294002 ameliorates psoriatic skin inflammation in mice via blocking the Notch1/Hes1-PTEN/AKT/IL-17A feedback loop. Clin Exp Immunol 213(1):114\u0026ndash;124\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang G, Lu J, Zheng J, Mei S, Li H, Zhang X, Ping A, Gao S, Fang Y, Yu J (2024) Spi1 regulates the microglial/macrophage inflammatory response via the PI3K/AKT/mTOR signaling pathway after intracerebral hemorrhage. Neural Regen Res 19(1):161\u0026ndash;170\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng SC, Lin CH, Chang YJ, Lee TH, Ryu SJ, Chen CH, Chang HK, Chang CJ, Hu WL, Hung YC (2013) Fire-heat and Qi deficiency syndromes as predictors of short-term prognosis of acute ischemic stroke. J Altern Complement Med 19(8):721\u0026ndash;728\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe W, Xu XJ (2006) Attenuation of brain inflammatory response after focal cerebral ischemia/reperfusion with Xuesaitong injection in rats. Chin J Integr Med 12(3):203\u0026ndash;206\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Guo F, Zhou R, Xiang C, Zhang Y, Gao J, Cao G, Yang H (2021) Proteomics and transcriptome reveal the key transcription factors mediating the protection of Panax notoginseng saponins (PNS) against cerebral ischemia/reperfusion injury. Phytomedicine 92:153613\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Zhao H, Zhai ZZ, Qu LX (2018) Protective effect and mechanism of ginsenoside Rg1 in cerebral ischaemia-reperfusion injury in mice. Biomed Pharmacother 99:876\u0026ndash;882\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng T, Jiang T, Ma H, Zhu Y, Wang M (2024) Targeting PI3K/Akt in Cerebral Ischemia Reperfusion Injury Alleviation: From Signaling Networks to Targeted Therapy. Mol Neurobiol 61(10):7930\u0026ndash;7949\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Q, Yao M, Qi J, Song R, Wang L, Li J, Zhou X, Chang D, Huang Q, Li L, Wang N (2023) Puerarin inhibited oxidative stress and alleviated cerebral ischemia-reperfusion injury through PI3K/Akt/Nrf2 signaling pathway. Front Pharmacol 14:1134380\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Y, Sheng P, Ma B, Xue B, Shen M, Zhang L, Li D, Hou J, Ren J, Liu J, Yan BC, Jiang Y (2023) Elucidation of the mechanism of Yiqi Tongluo Granule against cerebral ischemia/reperfusion injury based on a combined strategy of network pharmacology, multi-omics and molecular biology. Phytomedicine 118:154934\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng J, Ma H, Zhu Y, Zhao Q (2021) Dehydrocostuslactone attenuated oxygen and glucose deprivation/reperfusion-induced PC12 cell injury through inhibition of apoptosis and autophagy by activating the PI3K/AKT/mTOR pathway. Eur J Pharmacol 911:174554\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoshita N, Lew\u0026eacute;n A, Sugawara T, Chan PH (2001) Evidence of phosphorylation of Akt and neuronal survival after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab 21(12):1442\u0026ndash;1450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Neblina F, Toledo AH, Toledo-Pereyra LH (2005) Molecular biology of apoptosis in ischemia and reperfusion. J Invest Surg 18(6):335\u0026ndash;350\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang QZ, Guo YD, Li HM, Wang RZ, Guo SG, Du YF (2017) Protection against cerebral infarction by Withaferin A involves inhibition of neuronal apoptosis, activation of PI3K/Akt signaling pathway, and reduced intimal hyperplasia via inhibition of VSMC migration and matrix metalloproteinases. Adv Med Sci 62(1):186\u0026ndash;192\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ischemic stroke, Rehabilitation, the PI3K/AKT/mTOR signaling pathway, Neuroinflammation, Apoptosis, Enriched environment","lastPublishedDoi":"10.21203/rs.3.rs-8033676/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8033676/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: \u003c/em\u003eXuesaitong injection (XST), a well-known traditional Chinese patent medicine, has been widely used in the treatment of cardiovascular and cerebrovascular diseases. Enriched environment (EE) has been shown to play pivotal roles in functional rehabilitation following brain injury. However, the effects and exact underlying mechanisms of combination administration of XST with EE before and after ischemic stroke remain to be thoroughly elucidated.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003ePurpose\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: \u003c/em\u003eThis study aims to investigate the effects and the potential mechanisms of XST injection combined with EE on ischemic stroke.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: \u003c/em\u003eIn the current study, a tMCAO (transient middle cerebral artery occlusion) mouse model was established, and then the experimental animals were intervened with XST injection combined with EE for consecutive 7 days before and after MCAO surgery respectively. Subsequently, the effects and the potential molecular mechanisms on the functional rehabilitation of the mice with stroke were further explored.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: \u003c/em\u003eAnimal experiments demonstrated that administration of XST combined with EE before and after the onset of acute ischemic stroke could exert protective effects against stroke initial injure and improve overall function rehabilitation. Furthermore, the inhibition of PI3K/AKT pathway by LY294002 abolished these curative effects of the intervention on brain injury, neuroinflammation, and neuron apoptosis following ischemic stroke.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: \u003c/em\u003eThe current study provides a novel therapeutic strategy by which XST combined with EE alleviates brain injury and promotes the outcome of ischemic stroke. The PI3K/AKT/mTOR signaling pathway was highly considered as a vital role in the neuroprotective effects of XST paired with EE on ischemic brain injury.\u003c/p\u003e","manuscriptTitle":"Xuesaitong injection paired with enriched environment displays neuroprotective effects and promotes functional rehabilitation by activating the PI3K/AKT/mTOR pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 10:02:05","doi":"10.21203/rs.3.rs-8033676/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a2958b3d-7406-4f2e-90f9-26098601fa82","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-27T17:24:49+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-22 10:02:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8033676","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8033676","identity":"rs-8033676","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}