The Deepest Podasconidae (Cryptoniscoidea, Epicaridea) from the Japan Trench | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report The Deepest Podasconidae (Cryptoniscoidea, Epicaridea) from the Japan Trench Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4746896/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose The Podasconidae, which are parasitic on the Amphipoda, are poorly studied taxa within marine isopods. Consequently, information on occurrence has been limited to shallower waters and molecular sequence data are not available. Here we report first podasconid specimens from amphipods collected from abyssal and hadal depths. In this study, these podasconids were characterised through morphological and molecular analyses. Methods Podasconids were detected from amphipods sampled from abyssal and hadal depths of the Japan and Kuril-Kamchatka Trenches. Newly collected podasconids were observed under a stereoscopic microscope. Partial sequences of nuclear 18S and mitochondrial 16S rRNA genes were determined for all parasites, whilst those of mitochondrial COI gene were provided for the host amphipods. Results In total, seven podasconids were found from three species of benthic amphipods, Aristias sp. , Byblisoides arcillis and Epimeria abyssalis , collected at 4556–6539 m of the Japan Trench. Differences in body size and morphology of uropods and article 1 of antennule were observed among parasites. 18S phylogenetic tree, constructed with other cryptoniscoid sequences from the GenBank, agreed with morphological analyses. As a result, we have assigned three morphospecies for the present podasconid samples whilst the non-monophyletic nature of Podasconidae was also indicated. Conclusion This study identified three novel amphipod hosts of Podasconidae and extends the known geographical and bathymetrical distribution of Podasconidae to include the abyssal and hadal depths. Additionally, our results indicated a high diversity of Podasconidae in the deep water, with an inference to potentially complex diversification of cryptoniscoids. Amphipoda Deep-sea Isopoda Northwest Pacific Hadal zone Figures Figure 1 Figure 2 Figure 3 Figure 4 Main body Isopods of the superfamily Cryptoniscoidea, which belong to the suborder Epicaridea, are ectoparasites of various crustaceans [1]. Believed to be heteroxenous, they infect calanoid copepods during the pelagic juvenile stage before parasitising on its definitive host and feeds on host haemolymph and ovarian fluids [1]. Amphipods are the definitive hosts of cryptoniscoid isopods in the family Podasconidae. It consists of two genera and four described species, Podascon chevereuxi Giard & Bonnier, 1895 , Po. dellavallei Giard & Bonnier, 1889 , Po. haploopis Giard & Bonnier, 1895 and Parapodascon stebbingi (Giard & Bonnier, 1895) [2], typically attaching to the gills or oostegites of their amphipod hosts [3, 4]. Genus Podascon was first established for Po. dellavallei by Giard and Bonnier (1889) [5], based on parasitic specimens found from Ampelisca diadema (Ampeliscidae). The two congeneric species are also parasites of ampeliscid amphipods: Po. chevreuxi was found from A. spinimana , and Po. haploopis was from Haploops tubicola [3]. The description of the latter two species was accompanied by the establishment of the family Podasconidae [3]. On the other hand, Pa. stebbingi was originally described from Onisimus plautus of Uristidae, under the genus Podascon [3]. Shortly after, Hansen (1916) [4] established a new genus Parapodascon based on podasconid specimens which parasitised the uristid O. leucopis collected from 1618 m deep at the northeast of Iceland and north of the Faroe Islands, Denmark. Hansen [4] argued that Po. stebbingi described by Giard and Bonnier (1895) [3] exhibited a high degree of morphological similarity to the collected specimens, hence decided to assign it to the new genus. Additionally, an undescribed Parapodascon individual was discovered within the marsupium of the uristid species Anonyx nugax [4]. Barnard (1961) [6] later reported an unidentified female isopod parasite in the marsupium of Paroediceroides trepadora of Oedicerotidae, collected from 875 m of the Gulf of Panama. Lastly, Vader (1967) [7] documented isopod parasites infesting the uristid O. normani collected from Norwegian waters, with 14 out of 79 (17.7% infection rate) specimens carrying one or more podasconids, albeit no further identification was conducted for them. Amphipods serve as hosts to a diverse array of parasites, ranging from microparasites to macroparasites, such as rotifers and crustaceans [8]. Reports of these parasites are abundant in freshwater and intertidal environments and rare in the deep sea, especially below abyssal depths (3500–6500 m). A description of a parasitic nematode from the body cavity of Hirondellea gigas of Hirondelleidae is one of the rare records of parasites of amphipods at the hadal depth [9]. Here, we report for the first time amphipods infested by parasitic isopods of Podasconidae from the abyssal and hadal (> 6500 m) depths, also documenting previously unreported amphipod hosts. Partial nucleotide sequences of the mitochondrial 16S and nuclear18S ribosomal DNAs (16S and 18S) are provided for all podasconid specimens and their phylogenetic positions are investigated, whilst those of the mitochondrial cytochrome c oxidase subunit I (COI) gene are provided for all amphipod hosts. During the expedition KH-23-5 by R/V Hakuho-maru in September 2023, amphipods were sampled from abyssal (3500–6500 m) and hadal depths (>6500 m) of the Japan and the Kuril–Kamchatka Trenches (Fig. 1), using a beam trawl and an epibenthic sledge. All amphipods were briefly sorted and identified onboard and were fixed with 80% ethanol and kept in 99% ethanol. The samples were stored at 4°C until transferred to the Atmosphere and Ocean Research Institute, The University of Tokyo (AORI) for more detailed sorting and searching for amphipods infested by podasconids. The identification of amphipods followed Barnard (1961), Barnard and Karaman. (1991a; 1991b), and Shimomura and Tomikawa (2016) [5, 10–12] Among the 2134 amphipods collected, with over 50 amphipod genera, four individuals (0.0019% infection rate) harboured a total of seven male podasconid parasites. The parasite familial assignment followed Williams and Boyko (2012) and Boyko et al. (2013) [1, 13]. Present male specimens showed no contradiction in the morphological characteristics with available descriptions [3, 4], for the familial assignment. The gross morphology of these parasites allowed us to assign them to three morphospecies. Five out of seven podasconid specimens (Podasconidae sp. A) were obtained from two females of Aristias sp. (Aristiidae), and the remaining podasconids, Podasconidae sp. B and sp. C were obtained from Byblisoides arcillis (Ampeliscidae, male) and Epimeria abyssalis (Epimeriidae, male). These host species were collected from stations F5 (4556–4565 m, 39º32.516'N; 143º51.305'E), F9 (6539–6523 m, 39º32.540'N; 144º09.524'E) and F14 (5804–5802 m, 39º27.983'N; 144º48.982'E), respectively (Fig. 1; Fig. 2). Two amphipod hosts are exclusively benthic species; B. arcillis possesses a silk gland for tube building and E. abyssalis is referred to a “reptantic” form, adapted for walking on the seafloor [14–15]; Aristias sp. is also considered a benthic species, as it is often found associated with other sessile invertebrates [16]. Aristias sp. obtained in this study was possibly dislodged from biotic substrates during a collection. Notably, one specimen of Aristias sp. was infested by four podasconids and the others were infested by one (Fig. 2). All podasconids were found attaching to the host tissue probably using the oral cone, antennule and first few pereopods (Fig. 2). They were attached to the gills of the host amphipods, except Podasconidae sp. B to the base of the pleopod rami of B. arcillis (Fig. 2). These morphospecies were distinguished from each other by their body size and morphology of the uropod and article 1 of antennule. Podasconidae sp. B exhibited straight sympods compared to the slender sympods of uropods, which were narrower distally, of Podasconidae sp. A and sp. C (Fig. 3). Podasconidae sp. A exhibited serration on article 1 of antennule, bearing seven teeth, however, sp. B and sp. C exhibited no teeth. Although Podasconidae sp. A and sp. C were morphologically similar to each other, but sp. C is 31% and 62% longer in dorsal length to sp. A and sp. B, respectively (sp. A: 2.09 mm; sp. B: 1.04 mm; sp. C: 2.74 mm) (Fig. 3). These morphological discrepancies would warrant further investigation, to definitively determine if they represent different species. However, the identification of isopod parasites was left at the family level, due to the limited numbers of the specimens and the difficulties in distinguishing Podascon and Parapodascon, particularly from a male specimen [4]. In this study, we prioritized getting genetic data and detailed morphological analysis is required in future. Total DNA was extracted, using a DNeasy Blood and Tissue Kit (QIAGEN, Germany), from whole podasconid specimens, except Podasconidae sp. C, in which a few appendages (pereopods and pleopods) were removed to extract DNA. The exoskeleton was mounted for a future morphological study after dissolving its content as post-extraction specimens with the whole body. The preparation was done using Hoyer’s medium. Total DNA was also extracted from four amphipod hosts, by removing two pleopods from the right side, except for E. abyssalis , where a single pleopod was adequate. Partial nucleotide sequences of the mitochondrial 16S and nuclear 18S were determined for all podasconids. Those of the mitochondrial COI gene were determined for host amphipods. Primers used in this study are listed in Table 1. Amplifications of 16S were performed by using a DNA thermal cycler with reaction conditions following Lörz et al. (2018) [17] and amplifications of COI were by reaction conditions following Hou et al. (2007) [18], while these reactions were performed using TaKaRa ExTaq HS (TaKaRa Bio, Japan). For 18S, amplifications were performed with KOD FX Neo (TOYOBO Life Science, Japan) and reaction conditions were 94°C for 2 min; 45 cycles of 98°C for 10 s, 52°C for 30 s, and 68°C for 120 s; and 68°C for 3 min. All PCR products were diluted with double-distilled water by 10 folds and purified using Exo-SAP Express (Thermo Fisher Scientific, USA). Purified samples were used for sequencing reaction using a BigDye Terminator Cycle Sequence Kit v3.1 (Thermo Fisher Scientific, USA). For 18S, eight additional internal primers were used (Table 1). Products of sequencing reactions were further purified using a BigDye Xterminator Purification Kit (Thermo Fisher Scientific, USA) and the nucleotide sequences were determined using ABI 3500 XL DNA sequencer at the AORI. Obtained sequences were deposited in the DDBJ/GenBank/EMBL databases with accession numbers: Amphipods COI, LC823198–LC823201; Podasconidae 18S, LC823202–LC823208; Podasconidae 16S, LC823209–LC823215. Table 1 List of primers used in this study Primers Sequence (5’-3’) References 18S 18S-a1F Forward GGYGAAACCGYGAAWGGYTC Kakui et al. (2011) [34] 18S-b3F Forward CCTGAGAAACGGCTACCACAT Kakui and Shimada (2017) [35] 18S-b4F Forward TGCGGTTAAAAAGCTCGTAGTTG Kakui et al. (2011) [34] 18S-b4R Reverse TCCAACTACGAGCTTTTTAACC Kakui et al. (2011) [34] 18S-b5F Forward GATCGAAGGCGATYAGATACC Kakui et al. (2011) [34] 18S-b6F Forward CCTGCGGCTTAATTTGACTC Kakui et al. (2011) [34] 18S-a6R Reverse AACGGCCATGCACCAC Kakui et al. (2011) [34] 18S-b8R Reverse TCTAAGGGCATCACAGACCTG Kakui et al. (2011) [34] 18S-b8F Forward GGTCTGTGATGCCCTTAGATG Kakui et al. (2011) [34] 18S-a9R Reverse CCTTGTTACGACTTTTAGTTCC Kakui et al. (2011) [34] 16S 16SFt_amp Forward GCRGTATIYTRACYGTGCTAAGG Lörz et al. (2018) [17] 16SRt_amp2 Reverse CTGGCTTAAACCGRTYTGAACTC Lörz et al. (2018) [17] COI LCO1490-JJ Forward CHACWAAYCATAAAGATATYGG Astrin and Stüben, (2008) [36] HCO2198-JJ Reverse AWACTTCVGGRTGVCCAAARAATCA Astrin and Stüben, (2008) [36] Seven 18S sequences of the present Podasconidae were aligned with those of 15 Bopyroidea, 4 other Cryptoniscoidea and 2 outgroup taxa, which were retrieved from the GenBank, using MAFFT ver. 7 [19] with the “Q-INS-I” strategy [20]. Alignment ambiguous sites were removed with Gblocks 0.91b [21] with a “relaxed” parameter [22], resulting in the final matrix of 28 taxa and 1483 sites. Phylogenetic analyses were performed using the Bayesian Inference approach using MrBayes 3.2.7 [23] under the GTR+G+I substitution model for 5000000 generations of four Markov chains with a sampling frequency of 100, and the first 25% as burn-in fractions. Alignment, masking of alignment ambiguous sites and the Bayesian phylogenetic analysis were done on NGPhylogeny.fr [24]. Additionally, the Maximum-Likelihood (ML) tree was built using the GTR+G+I model, determined by the ModelTest-NG [25] integrated in raxmlGUI 2.0 [26], estimating nodal support from bootstrap proportion values (BS) in 1000 pseudoreplicates. The ML and Bayesian phylogenetic analyses for the 18S dataset have constructed trees that are almost identical in topology. Podasconidae sp. A and sp. C formed a robust clade [BS = 100%, Bayesian posterior probability (PP) = 1]. Podasconidae sp. B was sister to Cryptoniscoidea sp. which was found on an ostracod [13] with sufficient support values (76%, 0.98) (Fig. 4). The monophyly of these two clades was supported with the maximum BS and PP. The results of phylogenetic analyses therefore inferred the non-monophyletic nature of Podasconidae (Fig. 4). The pairwise p-distance for sequences of the seven present podasconids were then calculated based on both 18S (1891 sites after the removal of any gaps and missing sites) and 16S (421 sites), using MEGA11 [27]. The pairwise p-distance between individuals of Podasconidae sp. A was 0.00% for 18S, whilst it ranged between 0.24%–1.2% for 16S. Pairwise 18S p-distances among the three species were 6.50% (sp. A–sp. B), 2.64% (sp. A–sp. C) and 6.38% (sp. B–sp. C). Pairwise 18S p-distances of present podasconids and other cryptoniscoids were from 5.85% (sp. B–Cryptoniscoidea sp.) to 15.1% (sp. B– Zonophoryxus dodecapus ) [13]. Pairwise 16S p-distances were 23.2%–24.2% (sp. A–sp. B), 47.8%–49.2% (sp. A–sp. C) and 48.8% (sp. B–sp. C). Previously, the Podasconidae have been reported from shallower waters, up to the bathyal depths (200–3500 m) in the Northern Atlantic Ocean and Western Pacific Ocean. This study presents the first record of three podasconid species from three amphipod hosts ( Aristias sp., B. arcillis and E. abyssalis ) that have never been reported previously. Furthermore, this research significantly extends the depth record of Podasconidae to the hadal depths. Podasconids inhabiting the abyssal and hadal depths may be more speciose, as highly diverse amphipod taxa were collected from such depths and different species of podasconids parasitised different amphipods. The observed morphological characters (Figs. 2, 3) and a close phylogenetic relationship with Cryptoniscoidea sp., which was found on an ostracod (Fig. 4), suggest Podasconidae sp. B belongs to a different genus to the sp. A or sp. C. Morphologically, sp. B showed a resemblance to male Parapodascon in the shape and length of the biramous uropod sympods, however, the attachment site and the number of teeth at the antennule basis of sp. B differed from species of Parapodascon or Podascon . Furthermore, distinguishing adult male cryptoniscoids and cryptoniscus larvae is challenging due to their similar morphology. This raises the possibility that the present podasconid specimens to be juvenile cryptoniscoid, especially sp. B. In that case, although speculative, it might be suggested that B. arcillis could serve as intermediate hosts. Additionally, cryptoniscoids were also found infesting the abdomen of cumaceans of families Bodotoridae and Leuconidae caught from abyssal depths of the present expedition (K. Okamoto, pers. comm.). Similarly, the German–Russian joint expedition KuramBio II has retrieved juveniles of cryptoniscoids attached to the Ascothoracidae (Dendrogastrida, Thestraca) and cumaceans, collected from the abyssal depth (5120–5741 m) of the Kuril–Kamchatka Trench [28]. In addition, they were juveniles, cryptoniscus larvae also were collected at a depth of 8738.9 m, which is the current deepest record of Epicaridea [28]. The penetration of parasites to the deepest of the trenches in the Northwest Pacific region appears to be a consistent pattern, as also observed in the digenean parasite [29]. The high surface productivity observed in the Japan and Kuril-Kamchatka Trenches [28, 30] might explain the successful penetration of parasites into the abyssal and hadal depths. Increased productivity supports a higher abundance and diversity of organisms, which creates a more favourable environment for parasites to encounter and infect suitable hosts. Such a convenient environment may have induced cryptoniscoids to diversify via host-switching among distantly related crustaceans or between different species of amphipods with varying lifestyles. Further sampling efforts in other productive hadal zones, like the Atacama Trench [31], could provide crucial insights into large-scale patterns of deep-sea parasitism and how these interactions influence biodiversity in extreme environments. This study provided 16S and 18S ribosomal DNA sequences of the Podasconidae collected from abyssal and hadal oceans, confirming the diversity of these epicaridean isopods in the abyssal and hadal environments. The present study indicated podasconid parasites of amphipods are non-monophyletic and accumulation of DNA sequences and the Cryptoniscoidea from other crustacean groups are worthy of investigation to untangle the phylogenetic relationship of cryptoniscoid families. Moreover, studying the interaction of these parasitic isopods with the other Peracarida could reveal new interactions in the deep sea. Declarations Acknowledgements The authors express their sincere gratitude to the officers and crew of the R/V Hakuho-maru for their invaluable assistance during the research cruise. Our sincere thanks also go to the scientists onboard the two expeditions who diligently conducted the sampling and sorting of organisms. We extend our thanks to Dr. Keiichi Kakui and Mr. Shoki Shiraki for their extensive advice on sample preparation and molecular procedure as well as for valuable discussions during the preparation of this publication. Authors’ Contribution Conceptualization : Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; Methodology : Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; Formal analysis and investigation : Daiki Yamamoto; Writing - original draft preparation : Daiki Yamamoto; Writing - review and editing : Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; Visualisation : Daiki Yamamoto; Funding acquisition : Shigeaki Kojima; Resources : Daiki Yamamoto; Supervision : Shigeaki Kojima. Funding This work was supported by JSPS KAKENHI Grant Number JP19H00999. Conflict of Interest The authors declare that there are no competing interests or conflicts of interest relevant to this article's content. Ethical Approval Not applicable to the present studies. References Williams JD, Boyko CB (2012) The global diversity of parasitic isopods associated with crustacean hosts (Isopoda: Bopyroidea and Cryptoniscoidea). PLoS ONE 7:e35350. https://doi.org/10.1371/journal.pone.0035350 Boyko CB, Bruce NL, Hadfield KA, Merrin KL, Ota Y, Poore GCB, Taiti S (Eds) WoRMS - World Register of Marine Species - Podasconidae Giard & Bonnier, 1895. In: WoRMS - World Regist. Mar. Species. https://www.marinespecies.org/aphia.php?p=taxdetails&id=147079. Accessed 27 Jun 2024 Giard A, Bonnier J (1895) Contributions a l’étude des épicarides. XX. Sur les épicarides parasites des arthrostracés et sur quelques copépodes symbiotes de ces épicarides. Bull Sci Fr Belg 25:417–493 Hansen HJ (1916) Crustacea Malacostraca. III. V. The order Isopoda. Dan Ingolf–Expedition 3:iii+ 262 pp., 16 pls. Giard A, Bonnier J (1889) Sur un épicaride parasite d’un amphipode et sur un copépode parasite d’un épicaride. Comptes Rendus Hebd Séances Académies Sci 108:902–905 Barnard JL (1961) Gammaridean Amphipoda from depths of 400–6000 m. Galathea Rep 5:23–128 Vader W (1967) Notes on Norwegian marine amphipods 1-3. Sarsia 29:283–294 Boyko J, Ovcharenko M (2019) Pathogens and other symbionts of the Amphipoda: Taxonomic diversity and pathological significance. Dis Aquat Organ 136:3–36. https://doi.org/10.3354/dao03321 Leduc D, Wilson J (2016) Benthimermithid nematode parasites of the amphipod Hirondellea dubia in the Kermadec Trench. Parasitol Res 115:1675–1682. https://doi.org/10.1007/s00436-016-4907-7 Barnard JL, Karaman GS (1991a) The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 1. Rec Aust Mus Suppl 13:1–417. https://doi.org/10.3853/j.0812-7387.13.1991.91 Barnard JL, Karaman GS (1991b) The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 2. Rec Aust Mus Suppl 13:419–866. https://doi.org/10.3853/j.0812-7387.13.1991.367 Shimomura M, Tomikawa K (2016) Epimeria abyssalis sp. n. from the Kuril-Kamchatka Trench (Crustacea, Amphipoda, Epimeriidae). ZooKeys 125–142. https://doi.org/10.3897/zookeys.638.10329 Boyko CB, Moss J, Williams JD, Shields JD (2013) A molecular phylogeny of Bopyroidea and Cryptoniscoidea (Crustacea: Isopoda). Syst Biodivers 11:495–506. https://doi.org/10.1080/14772000.2013.865679 Kamenskaya OE (1995) Gammaridean amphipods from hadal trenches of the Pacific Ocean. Pol Arch Hydrobiol 42:327–334 Thurston M (2000) Benthic Gammaridea [Crustacea: Amphipoda] in the deep sea. Pol Arch Hydrobiol 47:353–377 Stoddart HE, Lowry JK (2010) The family Aristiidae (Crustacea: Amphipoda: Lysianassoidea) in Australian waters. Zootaxa 2549:31–53. https://doi.org/10.11646/zootaxa.2549.1.2 Lörz A-N, Tandberg AHS, Willassen E, Driskell A (2018) Rhachotropis (Eusiroidea, Amphipoda) from the North East Atlantic. ZooKeys 75–101. https://doi.org/10.3897/zookeys.731.19814 Hou Z, Fu J, Li S (2007) A molecular phylogeny of the genus Gammarus (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Mol Phylogenet Evol 45:596–611. https://doi.org/10.1016/j.ympev.2007.06.006 Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software Version 7: Improvements in performance and usability. Mol Biol Evol 30:772–780. https://doi.org/10.1093/molbev/mst010 Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286–298. https://doi.org/10.1093/bib/bbn013 Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17:540–552. https://doi.org/10.1093/oxfordjournals.molbev.a026334 Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol 56:564–577. https://doi.org/10.1080/10635150701472164 Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755. https://doi.org/10.1093/bioinformatics/17.8.754 Lemoine F, Correia D, Lefort V, Doppelt-Azeroual O, Mareuil F, Cohen-Boulakia S, Gascuel O (2019) NGPhylogeny.fr: New generation phylogenetic services for non-specialists. Nucleic Acids Res 47:W260–W265. https://doi.org/10.1093/nar/gkz303 Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2020) ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Mol Biol Evol 37:291–294. https://doi.org/10.1093/molbev/msz189 Edler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373–377. https://doi.org/10.1111/2041-210X.13512 Tamura K, Stecher G, Kumar S (2021) MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol 38:3022–3027. https://doi.org/10.1093/molbev/msab120 Brandt A, Martinez Arbizu P, Malyutina M, Alalykina I, Błażewicz M, Bober J, Brenke N, Brix S, Bruhn M, Chernyshev A, Cordier T, Duncker M, Eichsteller A, Fuchs M, Fukumori H, Gatzemeier N, Shinohara G, Golovan O, Heitland N, Hyunsu Y (2016) Kuril Kamchatka Biodiversity Studies II - RV Sonne SO250, Tomakomai-Yokohama (Japan), 16.08.-26.09.2016. https://www.researchgate.net/publication/310065216_Kuril_Kamchatka_Biodiversity_Studies_II_-_RV_Sonne_SO250_Tomakomai-Yokohama_Japan_1608-26092016 Takano T, Fukumori H, Kuramochi T, Kano Y (2023) Deepest digenean parasite: Molecular evidence of infection in a lower abyssal gastropod at 6,200 m. Deep Sea Res I 198:104078. https://doi.org/10.1016/j.dsr.2023.104078 Ichino MC, Clark MR, Drazen JC, Jamieson A, Jones DOB, Martin AP, Rowden AA, Shank TM, Yancey PH, Ruhl HA (2015) The distribution of benthic biomass in hadal trenches: A modelling approach to investigate the effect of vertical and lateral organic matter transport to the seafloor. Deep Sea Res I 100:21–33. https://doi.org/10.1016/j.dsr.2015.01.010 Jamieson A (2015) The Hadal Zone: Life in the Deepest Oceans. Cambridge University Press, Cambridge Wessel P, Luis JF, Uieda L, Scharroo R, Wobbe F, Smith WHF, Tian D (2019) The Generic Mapping Tools Version 6. Geochem Geophys Geosystems 20:5556–5564. https://doi.org/10.1029/2019GC008515 Amante C, Eakins BW (2009) ETOPO1 Arc-minute Global Relief Model : Procedures, Data Sources and Analysis. NOAA technical memorandum NESDIS NGDC, 24. https://repository.library.noaa.gov/view/noaa/1163 Kakui K, Katoh T, Hiruta SF, Kobayashi N, Kajihara H (2011) Molecular systematics of tanaidacea (Crustacea: Peracarida) based on 18S sequence data, with an amendment of suborder/superfamily-level classification. Zool Sci 28:749–757. https://doi.org/10.2108/zsj.28.749 Kakui K, Shimada D (2017) A new species of Tanaopsis (Crustacea: Tanaidacea) from Japan, with remarks on the functions of serial ridges and grooves on the appendages. Zootaxa 4282:324–336. https://doi.org/10.11646/zootaxa.4282.2.6 Astrin JJ, Stüben PE (2008) Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera : Curculionidae). Invertebr Syst 22:503–522. https://doi.org/10.1071/IS07057 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4746896","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":334987238,"identity":"7e363b60-3af9-4300-8b0a-2f7003ec8cec","order_by":0,"name":"Daiki Yamamoto","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABXklEQVRIie2Rv2vCQBTHXwjEJZj1giX2T3hy4FKp/0pCIC4JFQolY6CQLv4B6X+hBJwvCDo06BpwaIPgVMF26FKHXhrbmP7AtZR8huM9eJ+7790BVFT8bXSIPOwUXYbg7Vv8No4finWoiMcVPjD5RTmcnd0Zz4m706BmplHQX3ShcT1dyWABMiVKb/0OKDcMLvuFEjthw46RgrzGaIhLwzuZ9qgMNldEsTXyLSCxDjQoFOYMG46Phkd0jB5wqQOx22oALuD9SlJTn0dNAPgmn8piE77mSm/LlXkXyMVLrjAxV5pflMQZ70+xs2BM4IVEtnkwSR1xBcuKmmzGZ3ZMqSQ/9qMATcMnVpts0ZJVJtJWMLfkVmx4B3epL5xwabuaptR64dNgd95ViLkmumtqdSak6eCqo2mzyZQWL3bK9oUEpQIhTyJIWSH4tPiX5g9/VWL3voqrI2MVFRUV/5k3biSAgiVCtzsAAAAASUVORK5CYII=","orcid":"","institution":"The University of Tokyo","correspondingAuthor":true,"prefix":"","firstName":"Daiki","middleName":"","lastName":"Yamamoto","suffix":""},{"id":334987239,"identity":"13e0210b-b371-4732-a0c2-8becf85f1604","order_by":1,"name":"Tsuyoshi Takano","email":"","orcid":"","institution":"Meguro Parasitological Museum","correspondingAuthor":false,"prefix":"","firstName":"Tsuyoshi","middleName":"","lastName":"Takano","suffix":""},{"id":334987240,"identity":"3cae4460-fca0-4c60-81d9-89ff44eb1645","order_by":2,"name":"Shigeaki Kojima","email":"","orcid":"","institution":"The University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Shigeaki","middleName":"","lastName":"Kojima","suffix":""}],"badges":[],"createdAt":"2024-07-16 04:14:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4746896/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4746896/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":62119999,"identity":"6ae610b3-43be-45aa-a71a-219a8c3e6eaf","added_by":"auto","created_at":"2024-08-09 13:46:34","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":581174,"visible":true,"origin":"","legend":"\u003cp\u003eMap of sampling stations in the Japan Trench (KH-23-5 expedition, stations F5, F9 and F14). The map was created by GMT 6 [32] based on the bathymetry data from ETOPO1 [33]\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4746896/v1/af9fbad703ab7549e7394fe4.jpeg"},{"id":62119998,"identity":"6a8e94b6-0504-413b-9fa4-aec6c880df3f","added_by":"auto","created_at":"2024-08-09 13:46:34","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":210568,"visible":true,"origin":"","legend":"\u003cp\u003ePhotos of amphipods parasitised by podasconids. \u003cstrong\u003ea\u003c/strong\u003eFemale \u003cem\u003eAristias \u003c/em\u003esp. (station F5, 4556–4565 m). \u003cstrong\u003eb\u003c/strong\u003e Male podasconids infesting on the gills of \u003cem\u003eAristias \u003c/em\u003esp. One podasconid was removed for an individual photo. \u003cstrong\u003ec\u003c/strong\u003e Male \u003cem\u003eByblisoides arcillis\u003c/em\u003e (F9, 6539–6523 m). \u003cstrong\u003ed\u003c/strong\u003e Male podasconid infesting on the pleopod 1 of \u003cem\u003eB. arcillis\u003c/em\u003e. \u003cstrong\u003ee\u003c/strong\u003eMale \u003cem\u003eEpimeria abyssalis\u003c/em\u003e (F14, 5804–5802 m). \u003cstrong\u003ef\u003c/strong\u003e Male podasconid infesting on the gill attached to pereopod 7 of \u003cem\u003eE. abyssalis\u003c/em\u003e. Red triangles indicate the podasconids parasitising. Scales = 1mm, apart from (e) \u003cem\u003eE. abyssalis,\u003c/em\u003e as indicated\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4746896/v1/83a5b0deb693a86b7b2b5f89.jpeg"},{"id":62119996,"identity":"66ffd08d-950a-4109-bd93-8e809fd20ca5","added_by":"auto","created_at":"2024-08-09 13:46:34","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":199272,"visible":true,"origin":"","legend":"\u003cp\u003ePhotos of Podasconidae. \u003cstrong\u003ea–c\u003c/strong\u003eLateral, dorsal and ventral view of male Podasconidae sp. Afound from \u003cem\u003eAristias \u003c/em\u003esp. (2.09 mm in dorsal length, tip of the head to the end of uropod). \u003cstrong\u003ed–f\u003c/strong\u003eLateral, dorsal and ventral view of male Podasconidae sp. Bfound from \u003cem\u003eB. arcillis\u003c/em\u003e (1.04 mm in dorsal length, tip of the head to the end of uropod). \u003cstrong\u003eg–i\u003c/strong\u003eLateral, dorsal and ventral view of male Podasconidae sp. Cfound from \u003cem\u003eE. abyssalis \u003c/em\u003e(2.74 mm in dorsal length, tip of the head to the end of uropod). Scales = 1mm\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4746896/v1/94cb37a3e9793bcea6dfa5fa.jpeg"},{"id":62120713,"identity":"9674631f-d53d-4ed8-a763-0bfaa4e2006c","added_by":"auto","created_at":"2024-08-09 13:54:34","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":296108,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum-Likelihood phylogenetic tree of Cryptoniscoidea based on 18S rDNA sequences (1483 sites), with two species of Cymothoida as outgroup taxa. Sequences obtained in this research are highlighted in bold. GenBank accession number is noted next to species names. The numbers below the branches represents the Maximum-Likelihood bootstrap proportion values as percentages (left, \u0026gt; 50% shown) and posterior probability (right, \u0026gt; 0.7)\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4746896/v1/fb64f0fd27b80696466ade89.jpeg"},{"id":63440141,"identity":"e64c66d6-fcfe-4401-80b4-28100ae34458","added_by":"auto","created_at":"2024-08-28 07:16:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1652284,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4746896/v1/d1e20d5c-5dff-4c14-947c-d3b9b1389a70.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Deepest Podasconidae (Cryptoniscoidea, Epicaridea) from the Japan Trench","fulltext":[{"header":"Main body","content":"\u003cp\u003eIsopods of the superfamily Cryptoniscoidea, which belong to the suborder Epicaridea, are ectoparasites of various crustaceans\u0026nbsp;[1]. Believed to be heteroxenous, they infect calanoid copepods during the pelagic juvenile stage before parasitising on its definitive host and feeds on host haemolymph and ovarian fluids\u0026nbsp;[1]. Amphipods are the definitive hosts of cryptoniscoid isopods in the family Podasconidae. It consists of two genera and four described species, \u003cem\u003ePodascon chevereuxi\u0026nbsp;\u003c/em\u003eGiard \u0026amp; Bonnier, 1895\u003cem\u003e, Po. dellavallei\u0026nbsp;\u003c/em\u003eGiard \u0026amp; Bonnier, 1889\u003cem\u003e, Po. haploopis\u0026nbsp;\u003c/em\u003eGiard \u0026amp; Bonnier, 1895 and\u003cem\u003e\u0026nbsp;Parapodascon stebbingi\u0026nbsp;\u003c/em\u003e(Giard \u0026amp; Bonnier, 1895)\u0026nbsp;[2], typically attaching to the gills or oostegites of their amphipod hosts\u0026nbsp;[3, 4]. Genus \u003cem\u003ePodascon\u003c/em\u003e was first established for \u003cem\u003ePo. dellavallei\u003c/em\u003e by Giard and Bonnier (1889)\u0026nbsp;[5], based on parasitic specimens found from \u003cem\u003eAmpelisca diadema\u0026nbsp;\u003c/em\u003e(Ampeliscidae). The two congeneric species are also parasites of ampeliscid amphipods: \u003cem\u003ePo. chevreuxi\u003c/em\u003e was found from\u003cem\u003e\u0026nbsp;A. spinimana\u003c/em\u003e, and \u003cem\u003ePo. haploopis\u0026nbsp;\u003c/em\u003ewas from \u003cem\u003eHaploops tubicola\u0026nbsp;\u003c/em\u003e[3]. The description of the latter two species was accompanied by the establishment of the family Podasconidae\u0026nbsp;[3]. On the other hand, \u003cem\u003ePa. stebbingi\u0026nbsp;\u003c/em\u003ewas originally described from \u003cem\u003eOnisimus plautus\u003c/em\u003e of Uristidae, under the genus \u003cem\u003ePodascon\u0026nbsp;\u003c/em\u003e[3]. Shortly after, Hansen (1916)\u0026nbsp;[4]\u0026nbsp;established a new genus \u003cem\u003eParapodascon\u003c/em\u003e based on podasconid specimens which parasitised the uristid \u003cem\u003eO. leucopis\u003c/em\u003e collected from 1618 m deep at the northeast of Iceland and north of the Faroe Islands, Denmark. Hansen [4] argued that \u003cem\u003ePo. stebbingi\u003c/em\u003e described by Giard and Bonnier (1895)\u0026nbsp;[3]\u0026nbsp;exhibited a high degree of morphological similarity to the collected specimens, hence decided to assign it to the new genus. Additionally, an undescribed \u003cem\u003eParapodascon\u003c/em\u003e individual was discovered within the marsupium of the uristid species \u003cem\u003eAnonyx nugax\u003c/em\u003e [4]. Barnard (1961)\u0026nbsp;[6]\u0026nbsp;later reported an unidentified female isopod parasite in the marsupium of\u003cem\u003e\u0026nbsp;Paroediceroides trepadora\u003c/em\u003e of Oedicerotidae, collected from 875 m of the Gulf of Panama. Lastly, Vader (1967)\u0026nbsp;[7]\u0026nbsp;documented isopod parasites infesting the uristid \u003cem\u003eO. normani\u003c/em\u003e collected from Norwegian waters, with 14 out of 79 (17.7% infection rate) specimens carrying one or more podasconids, albeit no further identification was conducted for them.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAmphipods serve as hosts to a diverse array of parasites, ranging from microparasites to macroparasites, such as rotifers and crustaceans\u0026nbsp;[8]. Reports of these parasites are abundant in freshwater and intertidal environments and rare in the deep sea, especially below abyssal depths (3500\u0026ndash;6500 m). A description of a parasitic nematode from the body cavity of \u003cem\u003eHirondellea gigas\u003c/em\u003e of Hirondelleidae is one of the rare records of parasites of amphipods at the hadal depth\u0026nbsp;[9]. Here, we report for the first time amphipods infested by parasitic isopods of Podasconidae from the abyssal and hadal (\u0026gt; 6500 m) depths, also documenting previously unreported amphipod hosts. Partial nucleotide sequences of the mitochondrial 16S and nuclear18S ribosomal DNAs (16S and 18S) are provided for all podasconid specimens and their phylogenetic positions are investigated, whilst those of the mitochondrial cytochrome \u003cem\u003ec\u003c/em\u003e oxidase subunit I (COI) gene are provided for all amphipod hosts.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDuring the expedition KH-23-5 by R/V \u003cem\u003eHakuho-maru\u003c/em\u003e in September 2023, amphipods were sampled from abyssal (3500\u0026ndash;6500 m) and hadal depths (\u0026gt;6500 m) of the Japan and the Kuril\u0026ndash;Kamchatka Trenches (Fig. 1), using a beam trawl and an epibenthic sledge. All amphipods were briefly sorted and identified onboard and were fixed with 80% ethanol and kept in 99% ethanol. The samples were stored at 4\u0026deg;C until transferred to the Atmosphere and Ocean Research Institute, The University of Tokyo (AORI) for more detailed sorting and searching for amphipods infested by podasconids. The identification of amphipods followed Barnard (1961), Barnard and Karaman. (1991a; 1991b), and Shimomura and Tomikawa (2016) [5, 10\u0026ndash;12]\u003c/p\u003e\n\u003cp\u003eAmong the 2134 amphipods collected, with over 50 amphipod genera, four individuals (0.0019% infection rate) harboured a total of seven male podasconid parasites. The parasite familial assignment followed Williams and Boyko (2012) and Boyko et al. (2013)\u0026nbsp;[1, 13]. Present male specimens showed no contradiction in the morphological characteristics with available descriptions\u0026nbsp;[3, 4], for the familial assignment. The gross morphology of these parasites allowed us to assign them to three morphospecies. Five out of seven podasconid specimens (Podasconidae sp. A) were obtained from two females of \u003cem\u003eAristias\u003c/em\u003e sp. (Aristiidae), and the remaining podasconids, Podasconidae sp. B and sp. C were obtained from \u003cem\u003eByblisoides arcillis\u003c/em\u003e (Ampeliscidae, male) and \u003cem\u003eEpimeria abyssalis\u003c/em\u003e (Epimeriidae, male). These host species were collected from stations F5 (4556\u0026ndash;4565 m, 39\u0026ordm;32.516\u0026apos;N; 143\u0026ordm;51.305\u0026apos;E), F9 (6539\u0026ndash;6523 m, 39\u0026ordm;32.540\u0026apos;N; 144\u0026ordm;09.524\u0026apos;E) and F14 (5804\u0026ndash;5802 m, 39\u0026ordm;27.983\u0026apos;N; 144\u0026ordm;48.982\u0026apos;E), respectively (Fig. 1; Fig. 2).\u0026nbsp;Two amphipod hosts are exclusively benthic species; \u003cem\u003eB. arcillis\u003c/em\u003e possesses a silk gland for tube building and \u003cem\u003eE. abyssalis\u003c/em\u003e is referred to a \u0026ldquo;reptantic\u0026rdquo; form, adapted for walking on the seafloor\u0026nbsp;[14\u0026ndash;15]; \u003cem\u003eAristias\u003c/em\u003e sp. is also considered a benthic species, as it is often found associated with other sessile invertebrates\u0026nbsp;[16]. \u003cem\u003eAristias\u003c/em\u003e sp. obtained in this study was possibly dislodged from biotic substrates during a collection.\u0026nbsp;Notably, one specimen of \u003cem\u003eAristias\u0026nbsp;\u003c/em\u003esp. was infested by four podasconids and the others were infested by one (Fig. 2). All podasconids were found attaching to the host tissue probably using the oral cone, antennule and first few pereopods (Fig. 2). They were attached to the gills of the host amphipods, except Podasconidae sp. B to the base of the pleopod rami of\u0026nbsp;\u003cem\u003eB. arcillis\u003c/em\u003e (Fig. 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThese morphospecies were distinguished from each other by their body size and morphology of the uropod and article 1 of antennule. Podasconidae sp. B exhibited straight sympods compared to the slender sympods of uropods, which were narrower distally, of Podasconidae sp. A and sp. C (Fig. 3). Podasconidae sp. A exhibited serration on article 1 of antennule, bearing seven teeth, however, sp. B and sp. C exhibited no teeth. Although Podasconidae sp. A and sp. C were morphologically similar to each other, but sp. C is 31% and 62% longer in dorsal length to sp. A and sp. B, respectively (sp. A: 2.09 mm; sp. B: 1.04 mm; sp. C: 2.74 mm) (Fig. 3). These morphological discrepancies would warrant further investigation, to definitively determine if they represent different species. However, the identification of isopod parasites was left at the family level, due to the limited numbers of the specimens and the difficulties in distinguishing \u003cem\u003ePodascon\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Parapodascon,\u0026nbsp;\u003c/em\u003eparticularly from a male specimen [4]. In this study, we prioritized getting genetic data and detailed morphological analysis is required in future.\u003c/p\u003e\n\u003cp\u003eTotal\u0026nbsp;DNA was extracted, using a DNeasy Blood and Tissue Kit (QIAGEN, Germany), from whole podasconid specimens, except\u0026nbsp;Podasconidae sp. C, in which a few appendages (pereopods and pleopods) were removed to extract DNA. The exoskeleton was mounted for a future morphological study after dissolving its content as post-extraction specimens with the whole body. The preparation was done using Hoyer\u0026rsquo;s medium. Total DNA was also extracted from four amphipod hosts, by removing two pleopods from the right side, except for \u003cem\u003eE. abyssalis\u003c/em\u003e, where a single pleopod was adequate.\u003c/p\u003e\n\u003cp\u003ePartial nucleotide sequences of the mitochondrial 16S and nuclear 18S were determined for all podasconids. Those of the mitochondrial COI gene were determined for host amphipods. Primers used in this study are listed in Table 1. Amplifications of 16S were performed by using a DNA thermal cycler with reaction conditions following L\u0026ouml;rz et al. (2018) [17] and amplifications of COI were by reaction conditions following Hou et al. (2007) [18], while these reactions were performed using TaKaRa ExTaq HS (TaKaRa Bio, Japan). For 18S, amplifications were performed with KOD FX Neo (TOYOBO Life Science, Japan) and reaction conditions were 94\u0026deg;C for 2 min; 45 cycles of 98\u0026deg;C for 10 s, 52\u0026deg;C for 30 s, and 68\u0026deg;C for 120 s; and 68\u0026deg;C for 3 min. All PCR products were diluted with double-distilled water by 10 folds and purified using Exo-SAP Express (Thermo Fisher Scientific, USA). Purified samples were used for sequencing reaction using a BigDye Terminator Cycle Sequence Kit v3.1 (Thermo Fisher Scientific, USA). For 18S, eight additional internal primers were used (Table 1). Products of sequencing reactions were further purified using a BigDye Xterminator Purification Kit (Thermo Fisher Scientific, USA) and the nucleotide sequences were determined using ABI 3500 XL DNA sequencer at the AORI. Obtained sequences were deposited in the DDBJ/GenBank/EMBL databases with accession numbers: Amphipods COI, LC823198\u0026ndash;LC823201; Podasconidae 18S, LC823202\u0026ndash;LC823208; Podasconidae 16S, LC823209\u0026ndash;LC823215.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e List of primers used in this study\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"822\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.613138686131386%\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9464720194647203%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.557177615571776%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.068126520681265%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.88807785888078%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3114355231143553%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.61557177615572%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u003cstrong\u003e18S\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-a1F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eGGYGAAACCGYGAAWGGYTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b3F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eCCTGAGAAACGGCTACCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui and Shimada (2017) [35]\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b4F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eTGCGGTTAAAAAGCTCGTAGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b4R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eTCCAACTACGAGCTTTTTAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b5F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eGATCGAAGGCGATYAGATACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b6F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eCCTGCGGCTTAATTTGACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-a6R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eAACGGCCATGCACCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b8R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eTCTAAGGGCATCACAGACCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-b8F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eGGTCTGTGATGCCCTTAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e18S-a9R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eCCTTGTTACGACTTTTAGTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eKakui et al. (2011)\u0026nbsp;[34]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u003cstrong\u003e16S\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e16SFt_amp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eGCRGTATIYTRACYGTGCTAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eL\u0026ouml;rz\u0026nbsp;et al. (2018)\u0026nbsp;[17]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003e16SRt_amp2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eCTGGCTTAAACCGRTYTGAACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eL\u0026ouml;rz\u0026nbsp;et al. (2018)\u0026nbsp;[17]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCOI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003eLCO1490-JJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eCHACWAAYCATAAAGATATYGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eAstrin and St\u0026uuml;ben, (2008)\u0026nbsp;[36]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.439854191980559%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.272174969623329%\"\u003e\n \u003cp\u003eHCO2198-JJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.9441069258809234%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.543134872417983%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.0656136087484813%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.84447144592953%\"\u003e\n \u003cp\u003eAWACTTCVGGRTGVCCAAARAATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.3086269744835968%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.5820170109356%\"\u003e\n \u003cp\u003eAstrin and St\u0026uuml;ben, (2008)\u0026nbsp;[36]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eSeven 18S sequences of the present Podasconidae were aligned with those of 15 Bopyroidea, 4 other Cryptoniscoidea and 2 outgroup taxa, which were retrieved from the GenBank, using MAFFT ver. 7 [19] with the \u0026ldquo;Q-INS-I\u0026rdquo; strategy [20]. Alignment ambiguous sites were removed with Gblocks 0.91b [21] with a \u0026ldquo;relaxed\u0026rdquo; parameter [22], resulting in the final matrix of 28 taxa and 1483 sites. Phylogenetic analyses were performed using the Bayesian Inference approach using MrBayes 3.2.7 [23] under the GTR+G+I substitution model for 5000000 generations of four Markov chains with a sampling frequency of 100, and the first 25% as burn-in fractions. Alignment, masking of alignment ambiguous sites and the Bayesian phylogenetic analysis were done on NGPhylogeny.fr [24]. Additionally, the Maximum-Likelihood (ML) tree was built using the GTR+G+I model, determined by the ModelTest-NG [25] integrated in raxmlGUI 2.0 [26], estimating nodal support from bootstrap proportion values (BS) in 1000 pseudoreplicates.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe ML and Bayesian phylogenetic analyses for the 18S dataset have constructed trees that are almost identical in topology. Podasconidae sp. A and sp. C formed a robust clade [BS = 100%, Bayesian posterior probability (PP) = 1]. Podasconidae sp. B was sister to Cryptoniscoidea sp. which was found on an ostracod\u0026nbsp;[13]\u0026nbsp;with sufficient support values (76%, 0.98) (Fig. 4). The monophyly of these two clades was supported with the maximum BS and PP. The results of phylogenetic analyses therefore inferred the\u0026nbsp;non-monophyletic nature of Podasconidae (Fig. 4). The pairwise p-distance for sequences of the seven present podasconids were then calculated based on both 18S (1891 sites after the removal of any gaps and missing sites) and 16S (421 sites), using MEGA11\u0026nbsp;[27]. The pairwise p-distance between individuals of Podasconidae sp. A was 0.00% for 18S, whilst it ranged between 0.24%\u0026ndash;1.2% for 16S. Pairwise 18S p-distances among the three species were 6.50% (sp. A\u0026ndash;sp. B), 2.64% (sp. A\u0026ndash;sp. C) and 6.38% (sp. B\u0026ndash;sp. C). Pairwise 18S p-distances of present podasconids and other cryptoniscoids were from 5.85% (sp. B\u0026ndash;Cryptoniscoidea sp.) to 15.1% (sp. B\u0026ndash;\u003cem\u003eZonophoryxus dodecapus\u003c/em\u003e) [13]. Pairwise 16S p-distances were 23.2%\u0026ndash;24.2% (sp. A\u0026ndash;sp. B), 47.8%\u0026ndash;49.2% (sp. A\u0026ndash;sp. C) and 48.8% (sp. B\u0026ndash;sp. C).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePreviously, the Podasconidae have been reported from shallower waters, up to the bathyal depths (200\u0026ndash;3500 m) in the Northern Atlantic Ocean and Western Pacific Ocean. This study presents the first record of three podasconid species from three amphipod hosts (\u003cem\u003eAristias\u003c/em\u003e sp., \u003cem\u003eB. arcillis\u003c/em\u003e and \u003cem\u003eE. abyssalis\u003c/em\u003e) that have never been reported previously. Furthermore, this research significantly extends the depth record of Podasconidae to the hadal depths. Podasconids inhabiting the abyssal and hadal depths may be more speciose, as highly diverse amphipod taxa were collected from such depths and different species of podasconids parasitised different amphipods.\u003c/p\u003e\n\u003cp\u003eThe observed morphological characters\u003cem\u003e\u0026nbsp;\u003c/em\u003e(Figs. 2, 3) and a close phylogenetic relationship with Cryptoniscoidea sp., which was found on an ostracod (Fig. 4), suggest Podasconidae sp. B belongs to a different genus to the sp. A or sp. C. Morphologically, sp. B showed a resemblance to male \u003cem\u003eParapodascon\u003c/em\u003e in the shape and length of the biramous uropod sympods, however, the attachment site and the number of teeth at the antennule basis of sp. B differed from species of \u003cem\u003eParapodascon\u0026nbsp;\u003c/em\u003eor\u003cem\u003e\u0026nbsp;Podascon\u003c/em\u003e.\u0026nbsp;Furthermore, distinguishing adult male cryptoniscoids and cryptoniscus larvae is challenging due to their similar morphology. This raises the possibility that the present podasconid specimens to be juvenile cryptoniscoid, especially sp. B. In that case, although speculative, it might be suggested that \u003cem\u003eB. arcillis\u003c/em\u003e could serve as intermediate hosts.\u0026nbsp;Additionally, cryptoniscoids were also found infesting the abdomen of cumaceans of families Bodotoridae and Leuconidae caught from abyssal depths of the present expedition (K. Okamoto, pers. comm.). Similarly, the German\u0026ndash;Russian joint expedition KuramBio II has retrieved juveniles of cryptoniscoids attached to the Ascothoracidae (Dendrogastrida, Thestraca) and cumaceans, collected from the abyssal depth (5120\u0026ndash;5741 m) of the Kuril\u0026ndash;Kamchatka Trench\u0026nbsp;[28]. In addition, they were juveniles, cryptoniscus larvae also were collected at a depth of 8738.9 m, which is the current deepest record of Epicaridea\u0026nbsp;[28].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe penetration of parasites to the deepest of the trenches in the Northwest Pacific region appears to be a consistent pattern, as also observed in the digenean parasite\u0026nbsp;[29].\u0026nbsp;The high surface productivity observed in the Japan and Kuril-Kamchatka Trenches\u0026nbsp;[28, 30]\u0026nbsp;might explain the successful penetration of parasites into the abyssal and hadal depths. Increased productivity supports a higher abundance and diversity of organisms, which creates a more favourable environment for parasites to encounter and infect suitable hosts. Such a convenient environment\u0026nbsp;may have induced cryptoniscoids to diversify via host-switching among distantly related crustaceans or between different species of amphipods with varying lifestyles.\u0026nbsp;Further sampling efforts in other productive hadal zones, like the Atacama Trench\u0026nbsp;[31], could provide crucial insights into large-scale patterns of deep-sea parasitism and how these interactions influence biodiversity in extreme environments.\u003c/p\u003e\n\u003cp\u003eThis study provided 16S and 18S ribosomal DNA sequences of the Podasconidae collected from abyssal and hadal oceans, confirming the diversity of these epicaridean isopods in the abyssal and hadal environments. The present study indicated podasconid parasites of amphipods are non-monophyletic and accumulation of DNA sequences and the Cryptoniscoidea from other crustacean groups are worthy of investigation to untangle the phylogenetic relationship of cryptoniscoid families. Moreover, studying the interaction of these parasitic isopods with the other Peracarida could reveal new interactions in the deep sea. \u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp; The authors express their sincere gratitude to the officers and crew of the R/V \u003cem\u003eHakuho-maru\u003c/em\u003e for their invaluable assistance during the research cruise. Our sincere thanks also go to the scientists onboard the two expeditions who diligently conducted the sampling and sorting of organisms. We extend our thanks to Dr. Keiichi Kakui and Mr. Shoki Shiraki for their extensive advice on sample preparation and molecular procedure as well as for valuable discussions during the preparation of this publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contribution\u003c/strong\u003e\u003cem\u003e\u0026nbsp; Conceptualization\u003c/em\u003e: Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; \u003cem\u003eMethodology\u003c/em\u003e: Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; \u003cem\u003eFormal analysis and investigation\u003c/em\u003e: Daiki Yamamoto; \u003cem\u003eWriting - original draft preparation\u003c/em\u003e: Daiki Yamamoto; \u003cem\u003eWriting - review and editing\u003c/em\u003e: Daiki Yamamoto, Tsuyoshi Takano, Shigeaki Kojima; \u003cem\u003eVisualisation\u003c/em\u003e: Daiki Yamamoto; \u003cem\u003eFunding acquisition\u003c/em\u003e: Shigeaki Kojima; \u003cem\u003eResources\u003c/em\u003e: Daiki Yamamoto; \u003cem\u003eSupervision\u003c/em\u003e: Shigeaki Kojima.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp; This work was supported by JSPS KAKENHI Grant Number JP19H00999.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e The authors declare that there are no competing interests or conflicts of interest relevant to this article\u0026apos;s content.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e Not applicable to the present studies.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWilliams JD, Boyko CB (2012) The global diversity of parasitic isopods associated with crustacean hosts (Isopoda: Bopyroidea and Cryptoniscoidea). PLoS ONE 7:e35350. https://doi.org/10.1371/journal.pone.0035350\u003c/li\u003e\n\u003cli\u003eBoyko CB, Bruce NL, Hadfield KA, Merrin KL, Ota Y, Poore GCB, Taiti S (Eds) WoRMS - World Register of Marine Species - Podasconidae Giard \u0026amp; Bonnier, 1895. In: WoRMS - World Regist. Mar. Species. https://www.marinespecies.org/aphia.php?p=taxdetails\u0026amp;id=147079. Accessed 27 Jun 2024\u003c/li\u003e\n\u003cli\u003eGiard A, Bonnier J (1895) Contributions a l\u0026rsquo;\u0026eacute;tude des \u0026eacute;picarides. XX. Sur les \u0026eacute;picarides parasites des arthrostrac\u0026eacute;s et sur quelques cop\u0026eacute;podes symbiotes de ces \u0026eacute;picarides. Bull Sci Fr Belg 25:417\u0026ndash;493\u003c/li\u003e\n\u003cli\u003eHansen HJ (1916) Crustacea Malacostraca. III. V. The order Isopoda. Dan Ingolf\u0026ndash;Expedition 3:iii+ 262 pp., 16 pls.\u003c/li\u003e\n\u003cli\u003eGiard A, Bonnier J (1889) Sur un \u0026eacute;picaride parasite d\u0026rsquo;un amphipode et sur un cop\u0026eacute;pode parasite d\u0026rsquo;un \u0026eacute;picaride. Comptes Rendus Hebd S\u0026eacute;ances Acad\u0026eacute;mies Sci 108:902\u0026ndash;905\u003c/li\u003e\n\u003cli\u003eBarnard JL (1961) Gammaridean Amphipoda from depths of 400\u0026ndash;6000 m. Galathea Rep 5:23\u0026ndash;128\u003c/li\u003e\n\u003cli\u003eVader W (1967) Notes on Norwegian marine amphipods 1-3. Sarsia 29:283\u0026ndash;294\u003c/li\u003e\n\u003cli\u003eBoyko J, Ovcharenko M (2019) Pathogens and other symbionts of the Amphipoda: Taxonomic diversity and pathological significance. Dis Aquat Organ 136:3\u0026ndash;36. https://doi.org/10.3354/dao03321\u003c/li\u003e\n\u003cli\u003eLeduc D, Wilson J (2016) Benthimermithid nematode parasites of the amphipod \u003cem\u003eHirondellea dubia\u003c/em\u003e in the Kermadec Trench. Parasitol Res 115:1675\u0026ndash;1682. https://doi.org/10.1007/s00436-016-4907-7\u003c/li\u003e\n\u003cli\u003eBarnard JL, Karaman GS (1991a) The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 1. Rec Aust Mus Suppl 13:1\u0026ndash;417. https://doi.org/10.3853/j.0812-7387.13.1991.91\u003c/li\u003e\n\u003cli\u003eBarnard JL, Karaman GS (1991b) The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 2. Rec Aust Mus Suppl 13:419\u0026ndash;866. https://doi.org/10.3853/j.0812-7387.13.1991.367\u003c/li\u003e\n\u003cli\u003eShimomura M, Tomikawa K (2016) \u003cem\u003eEpimeria abyssalis\u003c/em\u003e sp. n. from the Kuril-Kamchatka Trench (Crustacea, Amphipoda, Epimeriidae). ZooKeys 125\u0026ndash;142. https://doi.org/10.3897/zookeys.638.10329\u003c/li\u003e\n\u003cli\u003eBoyko CB, Moss J, Williams JD, Shields JD (2013) A molecular phylogeny of Bopyroidea and Cryptoniscoidea (Crustacea: Isopoda). Syst Biodivers 11:495\u0026ndash;506. https://doi.org/10.1080/14772000.2013.865679\u003c/li\u003e\n\u003cli\u003eKamenskaya OE (1995) Gammaridean amphipods from hadal trenches of the Pacific Ocean. Pol Arch Hydrobiol 42:327\u0026ndash;334\u003c/li\u003e\n\u003cli\u003eThurston M (2000) Benthic Gammaridea [Crustacea: Amphipoda] in the deep sea. Pol Arch Hydrobiol 47:353\u0026ndash;377\u003c/li\u003e\n\u003cli\u003eStoddart HE, Lowry JK (2010) The family Aristiidae (Crustacea: Amphipoda: Lysianassoidea) in Australian waters. Zootaxa 2549:31\u0026ndash;53. https://doi.org/10.11646/zootaxa.2549.1.2\u003c/li\u003e\n\u003cli\u003eL\u0026ouml;rz A-N, Tandberg AHS, Willassen E, Driskell A (2018) \u003cem\u003eRhachotropis\u003c/em\u003e (Eusiroidea, Amphipoda) from the North East Atlantic. ZooKeys 75\u0026ndash;101. https://doi.org/10.3897/zookeys.731.19814\u003c/li\u003e\n\u003cli\u003eHou Z, Fu J, Li S (2007) A molecular phylogeny of the genus \u003cem\u003eGammarus\u003c/em\u003e (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Mol Phylogenet Evol 45:596\u0026ndash;611. https://doi.org/10.1016/j.ympev.2007.06.006\u003c/li\u003e\n\u003cli\u003eKatoh K, Standley DM (2013) MAFFT multiple sequence alignment software Version 7: Improvements in performance and usability. Mol Biol Evol 30:772\u0026ndash;780. https://doi.org/10.1093/molbev/mst010\u003c/li\u003e\n\u003cli\u003eKatoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286\u0026ndash;298. https://doi.org/10.1093/bib/bbn013\u003c/li\u003e\n\u003cli\u003eCastresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17:540\u0026ndash;552. https://doi.org/10.1093/oxfordjournals.molbev.a026334\u003c/li\u003e\n\u003cli\u003eTalavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol 56:564\u0026ndash;577. https://doi.org/10.1080/10635150701472164\u003c/li\u003e\n\u003cli\u003eHuelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754\u0026ndash;755. https://doi.org/10.1093/bioinformatics/17.8.754\u003c/li\u003e\n\u003cli\u003eLemoine F, Correia D, Lefort V, Doppelt-Azeroual O, Mareuil F, Cohen-Boulakia S, Gascuel O (2019) NGPhylogeny.fr: New generation phylogenetic services for non-specialists. Nucleic Acids Res 47:W260\u0026ndash;W265. https://doi.org/10.1093/nar/gkz303\u003c/li\u003e\n\u003cli\u003eDarriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2020) ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Mol Biol Evol 37:291\u0026ndash;294. https://doi.org/10.1093/molbev/msz189\u003c/li\u003e\n\u003cli\u003eEdler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373\u0026ndash;377. https://doi.org/10.1111/2041-210X.13512\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol 38:3022\u0026ndash;3027. https://doi.org/10.1093/molbev/msab120\u003c/li\u003e\n\u003cli\u003eBrandt A, Martinez Arbizu P, Malyutina M, Alalykina I, Błażewicz M, Bober J, Brenke N, Brix S, Bruhn M, Chernyshev A, Cordier T, Duncker M, Eichsteller A, Fuchs M, Fukumori H, Gatzemeier N, Shinohara G, Golovan O, Heitland N, Hyunsu Y (2016) Kuril Kamchatka Biodiversity Studies II - RV Sonne SO250, Tomakomai-Yokohama (Japan), 16.08.-26.09.2016. https://www.researchgate.net/publication/310065216_Kuril_Kamchatka_Biodiversity_Studies_II_-_RV_Sonne_SO250_Tomakomai-Yokohama_Japan_1608-26092016\u003c/li\u003e\n\u003cli\u003eTakano T, Fukumori H, Kuramochi T, Kano Y (2023) Deepest digenean parasite: Molecular evidence of infection in a lower abyssal gastropod at 6,200 m. Deep Sea Res I 198:104078. https://doi.org/10.1016/j.dsr.2023.104078\u003c/li\u003e\n\u003cli\u003eIchino MC, Clark MR, Drazen JC, Jamieson A, Jones DOB, Martin AP, Rowden AA, Shank TM, Yancey PH, Ruhl HA (2015) The distribution of benthic biomass in hadal trenches: A modelling approach to investigate the effect of vertical and lateral organic matter transport to the seafloor. Deep Sea Res I 100:21\u0026ndash;33. https://doi.org/10.1016/j.dsr.2015.01.010\u003c/li\u003e\n\u003cli\u003eJamieson A (2015) The Hadal Zone: Life in the Deepest Oceans. Cambridge University Press, Cambridge\u003c/li\u003e\n\u003cli\u003eWessel P, Luis JF, Uieda L, Scharroo R, Wobbe F, Smith WHF, Tian D (2019) The Generic Mapping Tools Version 6. Geochem Geophys Geosystems 20:5556\u0026ndash;5564. https://doi.org/10.1029/2019GC008515\u003c/li\u003e\n\u003cli\u003eAmante C, Eakins BW (2009) ETOPO1 Arc-minute Global Relief Model : Procedures, Data Sources and Analysis. NOAA technical memorandum NESDIS NGDC, 24. https://repository.library.noaa.gov/view/noaa/1163\u003c/li\u003e\n\u003cli\u003eKakui K, Katoh T, Hiruta SF, Kobayashi N, Kajihara H (2011) Molecular systematics of tanaidacea (Crustacea: Peracarida) based on 18S sequence data, with an amendment of suborder/superfamily-level classification. Zool Sci 28:749\u0026ndash;757. https://doi.org/10.2108/zsj.28.749\u003c/li\u003e\n\u003cli\u003eKakui K, Shimada D (2017) A new species of \u003cem\u003eTanaopsis\u003c/em\u003e (Crustacea: Tanaidacea) from Japan, with remarks on the functions of serial ridges and grooves on the appendages. Zootaxa 4282:324\u0026ndash;336. https://doi.org/10.11646/zootaxa.4282.2.6\u003c/li\u003e\n\u003cli\u003eAstrin JJ, St\u0026uuml;ben PE (2008) Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera\u0026thinsp;:\u0026thinsp;Curculionidae). Invertebr Syst 22:503\u0026ndash;522. https://doi.org/10.1071/IS07057\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Amphipoda, Deep-sea, Isopoda, Northwest Pacific, Hadal zone","lastPublishedDoi":"10.21203/rs.3.rs-4746896/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4746896/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose \u003c/strong\u003eThe Podasconidae, which are parasitic on the Amphipoda, are poorly studied taxa within marine isopods. Consequently, information on occurrence has been limited to shallower waters and molecular sequence data are not available. Here we report first podasconid specimens from amphipods collected from abyssal and hadal depths. In this study, these podasconids were characterised through morphological and molecular analyses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003ePodasconids were detected from amphipods sampled from abyssal and hadal depths of the Japan and Kuril-Kamchatka Trenches. Newly collected podasconids were observed under a stereoscopic microscope. Partial sequences of nuclear 18S and mitochondrial 16S rRNA genes were determined for all parasites, whilst those of mitochondrial COI gene were provided for the host amphipods.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eIn total, seven podasconids were found from three species of benthic amphipods, \u003cem\u003eAristias\u003c/em\u003esp.\u003cem\u003e, Byblisoides arcillis \u003c/em\u003eand\u003cem\u003e Epimeria abyssalis\u003c/em\u003e, collected at 4556–6539 m of the Japan Trench. Differences in body size and morphology of uropods and article 1 of antennule were observed among parasites. 18S phylogenetic tree, constructed with other cryptoniscoid sequences from the GenBank, agreed with morphological analyses. As a result, we have assigned three morphospecies for the present podasconid samples whilst the non-monophyletic nature of Podasconidae was also indicated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion \u003c/strong\u003eThis study identified three novel amphipod hosts of Podasconidae and extends the known geographical and bathymetrical distribution of Podasconidae to include the abyssal and hadal depths. Additionally, our results indicated a high diversity of Podasconidae in the deep water, with an inference to potentially complex diversification of cryptoniscoids.\u003c/p\u003e","manuscriptTitle":"The Deepest Podasconidae (Cryptoniscoidea, Epicaridea) from the Japan Trench","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-09 13:46:29","doi":"10.21203/rs.3.rs-4746896/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2f99a61a-d447-4199-8408-374e7d78c53a","owner":[],"postedDate":"August 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-28T07:08:17+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-09 13:46:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4746896","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4746896","identity":"rs-4746896","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.