Engineering multiple Cell Co-Culture System with Fucoidan and Beeswax Hydrogels for Cultured Meat Applications | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Engineering multiple Cell Co-Culture System with Fucoidan and Beeswax Hydrogels for Cultured Meat Applications Jihad Kamel, Jun-Yeong Lee, Sadia Afrin, Usha Yadav, Chandra-Jit Yadav, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7863529/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The co-culture of multiple cell types is critical for replicating native muscle complexity in cultured meat production. However, nutrient competition and divergent signaling among cell populations pose major challenges to in vitro tissue formation. This study investigates fucoidan (Fu) and beeswax-based alginate hydrogels (Bw/Algi) as potential scaffolds to address two key challenges: creating a supportive environment for multiple relevant cell types and promoting the formation of muscle-like tissue. We present an indirect 2D and 3D co-culture of C2C12 myoblasts, human endothelial cells (HECs), and mouse embryonic fibroblasts (MEFs), supported by Bw/Algi and Fu/Algi hydrogels. The Bw/Algi hydrogel supported cell adhesion with a pore size increased to 77.57% ± 7.88 versus 54.16% ± 4.64 in Bw. C2C12 cells reached confluency within five days without cytotoxicity. The Fu/Algi hydrogel (20 µg/mL Fu) supported 3D myogenic differentiation, myotube formation (area: 1,494,119 µm² ± 404; length: 20,723.01 µm ± 68). The engineered tissue had 9.825% protein versus 15.875% in native muscle. Thermal analysis confirmed structure retention during cooking. This co-culture system provides a promising platform for functional muscle-like tissue development in cultured meat. While the present study employs well-established model cell lines (C2C12, MEFs, and HECs), these results provide foundational insights into scaffold performance that will guide future validation with primary cells derived from edible species. Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Cell biology Physical sciences/Materials science Biological sciences/Stem cells alginate hydrogel beeswax C2C12 myoblasts culture meat fucoidan fibroblast indirect co-culture Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Cultured meat technology provides a viable approach for developing cell culture scaffolds tailored for meat production, presenting an alternative to conventional animal husbandry [ 1 ]. Recently, meat production needed a huge capacity for animal rearing, which involves environmental pollution, antibiotic consumption, animal caring, and management [ 2 , 3 ]. Accordingly, recent research focuses on green meat technology as a potential solution to these challenges [ 4 ]. Optimizing the environment for cellular meat requires a thorough understanding of the skeletal muscle tissue's extracellular matrix (ECM), as it involves various cell types and their interactions. The cell-to-cell and cell-to-ECM interactions play a crucial role in proliferation, migration, differentiation, and protein production [ 5 , 6 ]. Intercellular interactions are essential for cell growth, new blood vessel formation, differentiation of stem cells, and immune system activation [ 7 , 8 ]. The co-culture system has been investigated to identify cell-encapsulated scaffolds essential for skeletal muscle regeneration [ 9 , 10 ]. Fabricating 3D scaffolds with biomaterials for meat technology or muscle repair is challenging due to the need to support cell growth and maintain key parameters [ 11 , 12 ]. The primary goal of cultured meat production is to eliminate animal slaughter, with plant-based biomaterials being the most common form of 3D culture scaffold technology [ 13 ]. Biomaterials should support the myoblast-to-myogenesis process by providing an appropriate ECM for cell expansion, migration, and proliferation at the injury site [ 14 , 15 ]. Besides, those biomaterials should be nontoxic, flexible, biodegradable, porous, and capable of gelation [ 16 , 17 ]. For example, alginate (Algi) is considered the most widely polysaccharide incorporated with biomaterials for the development of artificial scaffolds. It's isolated from the brown algae ‘’ Laminaria hyperboreans ‘’ and is considered a strongly biocompatible, hygroscopic, tensile, non-toxic biomaterial. Algi possess adhesive peptides and natural polymers, making them a promising material for nutrient delivery. However, its negative charge hinders cell adhesion, necessitating its combination with other biomaterials [ 18 – 20 ]. Fucoidan (Fu) is a sulfated polysaccharide commonly used as a biological scaffold extracted from brown seaweeds ‘’ Fuscus vesiculosus Ecklonia kurome , and Undaria pinnatifida ’’. Fu has been reported to show anticoagulation, anti-inflammatory, cell proliferation, and adhesion properties [ 12 ]. It also has potential in muscle regeneration, particularly for enhancing recovery and muscle performance. Meanwhile, it is indicated that Fu may promote muscle growth by improving muscle size and strength [ 21 ]. Therefore, its ability to improve cellular activities such as proliferation and differentiation is an ideal tissue engineering component [ 22 ]. Beeswax (Bw) is an industrial, green-based wax that has been widely used in food product technology, pharmaceutical, and medicinal applications. It considers coating edible material with a mixture of protein or polysaccharides due to favorable water tolerance and hydrophobic activity [ 23 ]. It has been explored in tissue regeneration due to its biocompatibility, antimicrobial properties, and ability to create a protective barrier to support wound healing [ 24 , 25 ]. Its active components, including long-chain fatty acids, esters, and hydrocarbons, contribute to cell attachment by enhancing surface interactions and promoting cellular adhesion [ 25 , 26 ]. The incorporation of Bw into biomaterial scaffolds has shown promise in enhancing structural stability and creating a supportive environment for cell proliferation and tissue repair [ 25 , 27 – 29 ]. For example, it's combined with chitosan polysaccharide to create a porous, biocompatible, and non-toxic scaffold suitable for bone engineering [ 30 ]. Bw’s hydrophobic properties are more stable in aqueous solution than other biomaterials like soybean, pullulan, and maltodextrin [ 31 ]. The skeletal muscle ECM contains a diverse population of myogenic and non-myogenic cells that interact with growth factors and cytokines crucial for cell growth and regeneration [ 32 ]. In case of muscle injury surrounding ECM and myofibers are damaged and undergo subsequent events [ 10 , 33 ]. Fibroblasts and macrophages are the most common cells that share in the wound-healing process [ 34 ]. During regeneration, fibroblasts infiltrate the tissue and differentiate into myofibroblasts, which secrete cytokines, growth factors, and ECM components vital for activating myoblasts to proliferate at the injury site [ 35 , 36 ]. At the damaged site, the myoblast differentiates into a myotube and starts fusion, forming tissue repair [ 34 ]. As well, various factors of myoblasts induce angiogenesis cascades, which attract progenitors to the damaged area [ 6 ]. Recent studies have developed co-culture systems to understand myogenesis and cell-ECM interactions better. In native muscle tissue, skeletal muscle fibers coexist with fibroblasts, which secrete ECM components, and endothelial cells, which form vascular networks to facilitate nutrient and oxygen transport. Replicating this multicellular architecture is critical, as single-cell systems cannot fully capture the cellular heterogeneity and functional complexity of edible muscle tissue [ 37 , 38 ]. In contrast, the monoculture system only represents the cell growth environment, omitting intercellularly expressed factors [ 39 ]. Intercellular crosstalk, typically regulated by direct intercellular molecules, plays a crucial role in ECM production[ 40 ]. The indirect co-culture system is preferred over the direct one, as it allows the exchange of paracrine signals, proteins, cytokines, and growth factors through a permeable membrane, essential for modulating cell behavior [ 41 , 42 ]. While the indirect co-culture system is preferred as it facilitates the exchange of signals, proteins, and growth factors, crucial for modulating cell behavior [ 32 ]. For example, in a triple direct co-culture system of macrophages, fibroblasts, and C2C12 cells, macrophages hindered the positive effect of fibroblasts on C2C12 cell migration [ 37 ]. The formation of adipose tissue in skeletal muscle is essential for improving meat quality by contributing to marbling, intramuscular fat, tenderness, flavor, and juiciness [ 43 ]. Co-culturing 3T3-L1 adipocytes with C2C12 cells inhibits myogenic differentiation by downregulating myogenic markers and upregulating atrophy-related genes [ 8 ]. Alternatively, a separate culture of differentiated C2C12 cells and 3T3-L1 adipocytes has been conducted using layer-by-layer gelatin-soymilk scaffolds [ 22 ]. The cost-effective large-scale production of high-nutrition lab-grown meat has garnered significant interest. It could be generated by the co-culture of essential cells in muscle engineering, sharing a 3D-appropriate scaffold. This study optimized Bw, a plant lipid source, combined with Algi, to develop a Bw/Algi scaffold. We introduced a 2D quadrate co-culture method to examine the interactions between the myoblast cell line, fibroblast, endothelial cells, and Bw. The co-culture system comprising C2C12 myoblasts, MEFs, and HECs was selected to approximate the multicellular environment of skeletal muscle tissue. Myoblasts represent contractile elements, fibroblasts contribute extracellular matrix support, and endothelial cells mimic vascularization potential. Such an integrated system allows us to evaluate scaffold compatibility in a complex cellular context, providing a relevant model for cultured meat scaffold design. Using the indirect co-culture system, we evaluated the effects of shared cells on C2C12 proliferation, differentiation, and protein production. Given Algi’s poor cellular adhesion properties, we combined it with Fu to create a Fu/Algi hydrogel for the 3D co-culture system. This study is the first to design a 3D skeletal muscle disc with a co-culture of muscle cells, encased by a lipid barrier mimicking the native tissue. This 3D design is expected to be suitable for cultured meat technology and has potential for muscle regeneration studies. This study introduces a co-culture system employing Bw/Algi and Fu/Algi hydrogels designed to support the proliferation and differentiation of muscle cells in vitro. 2. Materials and Methods 2.1 Cell culture Mouse C2C12 cells (CRL-1772, ATCC, Manassas, VA, USA), Mouse Embryonic Fibroblasts (MEF), and EA.HY926 endothelial cells (HECs) (ATCC, Manassas, VA, USA) were co-cultured in both 2D and 3D configurations. The growth media consisting of high-glucose DMEM and 2mM L-glutamine (Thermo Fisher, Waltham, MA, USA), supplemented with 10% (v/v) fetal bovine serum (FBS) (Cytiva, Marlborough, MA, USA) and 1% (v/v) antibiotic-antimycotic (ABAM) (WelGene, Gyeongsan, South Korea) at 37°C with 5% CO 2 . 2.2 Biocomposite Bw/Algi hydrogel 2.2.1 Preparation of the hydrogel The Bw/Algi composite was created by adding 10% refined Bw (Sigma Aldrich, St. Louis, MI, USA) to boiling distilled water (DW), stirring for 30 minutes at 150°C until fully melted, and then transferring to the refrigerator at 4°C to harden. The hardened Bw was then combined with a 1% hot Algi solution (Sigma Aldrich) and 0.5% purified organic coconut oil (TopwiL Organic Pty Ltd., Baulkham Hills, Australia), stirring for 3 hours (h) until the water evaporated, resulting in a highly viscous Bw/Algi mixture. The gelation of the hydrogel was achieved using a 2% of 110 g/L CaCl 2 (Sigma Aldrich) in DW. 2.2.2 Physical characteristics The swelling ratio (SR) was evaluated following the gelation of hydrogels with a thickness of 7 mm. Subsequently, all hydrogels were immersed in fresh culture media for 0 days (immediately after gelation), 3 days, and 7 days. The incubation was carried out under controlled conditions at 37°C with 5% CO₂, with media replacement every two days. At each designated time point, the hydrogels were retrieved, and their wet weight (Wx) was recorded. Then subjected to freeze-drying at -50°C for 24 h to determine the initial dry weight (W0). The swelling ratio was calculated using the following equation: SR(%) = (Wx-W0)/ (W0) ×100 [ 44 ]. To assess the degradation rate, the W0 was obtained using the aforementioned procedure [ 45 ]. The dry weight (W) at different time points was measured after removing the hydrogels from the fresh media and then drying at 60°C for 4 h. The degradation rate (%) was determined using the equation: Degradation Rate(%) = (W0-W)/(W0) × 100. 2.2.3 Cytotoxicity The indirect cytotoxic analysis was conducted using the CCK8 kit (Sigma Aldrich) for 1,3, and 7 days. Briefly, C2C12 cells were cultured in a 35 mm dish with 4 compartments for 1 h, after which a 6×10 mm (Width × Thickness) piece of Bw/Algi was floated in the media in each well. After each point in time, 10% CCK-8 solution was applied to the conditioned media for 4 h. Following incubation, 100 µL from each sample was transferred to a 96-well plate, and absorbance was measured at 450 nm using a NanoQuant plate reader (TECAN Ltd., Männedorf, Switzerland). Then, utilizing the Live/Dead™ Cell Imaging Kit (Thermo Fisher Scientific), 40 µL of Live/Dead staining was added to the conditioned medium for 30 minutes. Imaging was acquired using an inverted fluorescent microscope (OPTINITY, KI-3000F, South Korea). . The positive control was assigned to 2D cell culture without Bw/Algi, while the negative control comprised fresh media. 2.2.4 Cell seeding After preparing Bw/Algi hydrogel, C2C12 cells were seeded on top with 5×10 4 cells per 1 mm thickness of Bw/Algi hydrogel. The growth media DMEM containing 10% FBS and 1% ABAM was used. The proliferation and viability of cells were assessed using 1:1000 DAPI (Sigma Aldrich) and Live/Dead™ Cell Imaging. In this analysis, the control group consisted of Bw biomaterial. For quantification analysis of Bw/Algi DAPI stained images were used for cell counting using Image J software (ImageJ 1.47). 2.2.5 Scanning Electron Microscopy (SEM) To check the pore size of Bw/Algi, it was compared to pure Bw biomaterial. Briefly, both pretreated and dried at room temperature (RT) for 12 h. Then coated with gold via sputter deposition, and the surface morphology was observed using SEM (Gemini 560, Oberkochen, Germany). The magnification was optimized at 5.00 K X. While in the cell attachment profile, the magnification was at 700 X. Image J software was used to obtain the average pore size. 2.2.6 Fourier Transm Infrared Spectrometer (FTIR) FTIR Cary 670 (Main Bench) + Cary 620 (Microscope), (Agilent Technologies, Santa Clara, CA, USA) was employed to analyze the main functional groups of Bw in the Bw/Algi hydrogel. The absorbance value was recorded at 500-4,500 cm -1 with 0.06 cm -1 spectral resolution. 2.3 The 2D indirect co-culture system In a 4-well confocal dish (SPL, Gyeonggi, South Korea), the individual seeding of 3×10 4 C2C12, MEF, and HECs was carried out in each well for 1 h until attachment. Subsequently, a heat-treated 18-gauge needle tip was punched into the central space of the well wall, dividing the plate into four connected compartments (Fig. S1 A). This procedure enables the sharing of conditioned media for 3 days of proliferation. The indirect co-culture method enabled the investigation of interactions between the triple cell types during both the proliferation and differentiation stages, as well as during the differentiation stage alone. Differentiation media consisting of 2% horse serum (HS) and 1% ABAM were utilized. The differentiation process was conducted from 7–10 days, with the media changing every two days. 2.4 3D culture meat scaffold disc After successfully implementing the 2D quadrat co-culture system, we added 20 µg/ml Fu (Sigma Aldrich) to the 1% Algi solution and created a 3D Fu/Algi hydrogel. Using a stainless-steel circular mold in a 10 cm dish, we divided the plate into five chambers (Fig. S1 B). Those chambers were arranged from the border to the center as follows: Chamber 1: Mixture of 6 ml Fu/Algi solution with 2.5×10 5 C2C12 cells. Chamber 2: 6 ml of Bw/Algi solution. Chamber 3: Mixture of 4 ml Fu/Algi solution with 2.5×10 5 MEF cells. Chamber 4: 6 ml of Bw/Algi solution. Chamber 5: Mixture of 2 ml Fu/Algi solution with 2.5×10 5 HECs. Subsequently, 2% CaCl 2 was added to cover all chambers for 15–20 minutes. The CaCl 2 was then replaced once with PBS, and growth media were added for 3 days to facilitate proliferation, followed by differentiation media for 7–10 days, with the media changing every two days. 2.5 Immunofluorescence staining: To assess C2C12 proliferation and differentiation, the expression levels of paired box 7 (PAX-7), desmin, and myosin antibodies were evaluated. The hydrogel was washed with PBS and fixed with BIOFIX HD (BIOGNOST, Zagreb, Croatia) for 20 minutes. Following fixation, the hydrogels were treated with 0.2% Triton X-100 (SAMCHUN, Ulsan, South Korea) for 10 minutes and subsequently washed with PBST. A solution of 1% bovine serum albumin (BSA, Sigma Aldrich) dissolved in 1X PBST was applied for 30 minutes. After removing the BSA, each hydrogel was stained with PAX-7 (1:100, Invitrogen, Waltham, MA, USA), α-desmin (1:100, Sigma Aldrich), and anti-myosin skeletal muscle antibodies (Sigma Aldrich) for 1 h at RT. The samples were then washed three times with PBST and incubated with the secondary antibody, goat anti-mouse IgG (1:500, Invitrogen), for 1 h. Finally, the samples were washed twice with PBST, and the cell nuclei were stained with DAPI (1:1000) for 5 minutes. Desmin images were utilized for quantification of myotube area, length, and width using ImageJ software. Imaging was acquired using an inverted fluorescent microscope. 2.6 Quantitative PCR (qPCR) The RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for RNA isolation, and the RNA concentration was determined using a spectrophotometer. cDNA synthesis was performed using TOPscript™ RT DryMIX (dN6 Plus) (Enzynomics, Daejeon, South Korea). The ΔΔCt method was applied for data analysis, with GAPDH, PAX-7, Mod1, Myogenin, and myosin heavy chain-1 (Myh-1) primers (Table 1 ). The 2D cell cultivation served as the control group. Table 1 Murine primers used in real-time RT –qPCR analysis C2C12 Gene The annealing temp. (°C) Primer sequence (5’-3’) 1 GAPDH 58.0 F:TCCATTTCCCCTGTTCTCCC R:ATTTCCCCTCCTCCCTCTCT 2 PAX7 58.0 F:AAGGGGTGAGAAAGTCGGAG R:GATGAGCCGCCTTTGTACTG 3 Myod1 59.1 F:CCCCTTGAAACTTTCCTCGC R:CTCTGTGAGGGGAGTGGAAG 4 Myogenin 60.0 F:AGAGACATGAGTGCCCTGAC R:TTCCCGGTATCATCAGCACA 5 Myh1 55.0 F:GACTACAACATCGCTGGCTG R:CTTGGCCCCTTTCTTTCCAC 2.7 Protein content evaluation We determined the protein content produced by C2C12 cells in both 2D and 3D co-culture systems. Following a 10-day differentiation period, the detachment of 2D cells was achieved using trypsin EDTA solution (HyClone™, Logan, UT), followed by centrifugation to obtain a cell pellet. Standardizing the C2C12 cell count was determined across all conditions to 1.3×10 5 . For the 3D hydrogel and native mouse muscle, an equivalent dry weight of 0.219 g was obtained following freeze-drying for 24 h. Subsequently, 1 ml of radioimmunoprecipitation assay buffer (RIPA) (Sigma Aldrich) was added to lyse the cells or tissue at 4°C for 30 minutes. The centrifugation was performed at 2700 × g for 10 minutes to extract the protein from the supernatant. Quantification of the extracted protein was performed using a Bicinchoninic Acid Assay Kit (BCA) (iNtRON Biotechnology, Gyeonggi, South Korea). This experiment was conducted independently three times. 2.8 Thermal properties of the 3D scaffold The thermal properties of the 3D hydrogels compared to native meat were assessed. Differential Scanning Calorimetry (DSC) was performed using a Q2000 instrument (TA Instruments, New Castle, DE, USA). Samples were measured in 10–20 mg and placed into 40 µl aluminum pans (PerkinElmer Inc., Waltham, MA, USA) and subjected to heating from 40°C to 180°C at a rate of 50°C per minute for 3 h. 2.9 Statistical analysis The data were presented as means ± standard error (SE). Statistical analysis was conducted using a one-way analysis of variance (ANOVA) in GraphPad Prism 8 (GraphPad Software 10.2.0, MA, USA). A significance threshold of * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001 was applied. 3. Results 3.1 Physical, chemical, and cytotoxic properties of Bw/Algi hydrogel In this study, we aimed to use Bw/Algi hydrogel as a lipid source in 2D and 3D co-culture. First, the SEM analysis showed the inner structure of Bw/Algi with an average pore size percentage of 77.568% ±7.88 compared to Bw 54.164% ±4.64, respectively (Fig. 1 A and B). Although Bw is hydrophobic, after combining with Algi, the pore distribution is significantly increased, which is critical for absorbing nutrients for cell growth. FTIR represented that the esters, hydrocarbons, and hydroxyl amines of Bw are successfully maintained in Bw/Algi at wavelengths of 1500 cm 2 , 3000 cm 2 , and 3000–4000 cm 2, respectively (Fig. 1 C). That indicates the Bw/Algi still owes to the same functional groups of Bw biomaterial, which are essential in cell attachment and bioactive interactions. Physical properties of swelling and biodegradability percentage of Bw/Algi were determined within 7 days. Algi swells triplicate the amount of the media significantly more than Bw/Algi, reaching 606.54% ±13 than 185.01%± 22, respectively (Fig. 1 D). There was no significant change in the biodegradability through the same period of incubation, reaching 14.57% ± 2.03 and 19.06% ±1.2 at Algi and Bw/Algi, respectively (Fig. 1 E). Our results indicate that Bw/Algi hydrogel represents significant porosity to adsorb nutrients, preserving the functional groups of Bw essential in cell attachment, showing swelling, and biodegradable properties. 3.2 Cytotoxicity and cell attachment through Bw/Algi hydrogel C2C12 cells were grown directly and indirectly with Bw/Algi for 5–7 days. First, the circular disc of Bw/Algi shows smooth morphology and flexibility when compressed with the forceps (Fig. 2 A). The indirect coculture showed non-significant cytotoxicity of Bw/Algi up to 7 days through the CCK-8 profile or Live& Dead staining (Fig. 2 B and C). Second, aiming to use Bw/Algi as a scaffold for in vitro meat research, C2C12 cells were seeded on its surface for 5 days. SEM imaging confirmed the attachment of cells after one day (Fig. 2 D). By days 3 & 5, cell proliferation was determined, showing the increase of cell confluency through DAPI or Live/Dead staining (Fig. 2 E). The quantification data of the DAPI staining revealed that the total proliferated cell count at day 3 was 85.33% ± 21.4 while by day 5 was 88.66% ± 15.32 without a significant difference (Fig. 2 F). Those findings suggested that Bw/Algi hydrogels exhibited smooth surfaces and supported initial cell adhesion. 3.3 2D quadrate co-culture system C2C12, MEF, HECs, and Bw/Algi hydrogel were co-cultured indirectly through a 4-compartment plate. The co-culture was conducted without altering C2C12 cell behavior, expressing the PAX-7 antibody (Fig. 3 A). According to qPCR gene analysis, C2C12 cells co-cultured with MEF significantly showed lower proliferation after day 1, with no significant changes observed on days 3 and 5. While the cell growth showed a non-significant change with the other co-cultures at the same time (Fig. 3 B). That indicates all altogether, MEF + HECs + Bw/Algi co-culture had no adverse effect on C2C12 cell proliferation. Differentiation and protein expression profiles were assessed at two different times (Fig. 3 C-G). C2C12 cells grew indirectly with other co-cultures at both Proliferation and differentiation or differentiation time only (Fig. S2). The immunofluorescence staining of desmin was notably expressed compared to the control group. At both differentiation phases, co-cultured C2C12 with HECs showed lower expression of desmin (Fig. 3 C). That may suggest that HECs reduce the intermediate differentiation of C2C12 cells. Myh-1 gene expression showed no significant difference among all cultures at both differentiation phases (Fig. 3 D and E). The protein content extracted from differentiated C2C12 cells during the proliferation and differentiation phase was significantly higher than differentiation phase only (Fig. 3 F and G), Table S1 . Those findings suggested the successful proliferation and differentiation of C2C12 cells through the quadrate coculture (C2C12 co- MEF + HECs + Bw/Algi) with a significant increase in protein content at the proliferation and differentiation phases. 3.4 3D Fu/Algi hydrogel 3.4.1 The effect of Fu concentration on cell growth High and low concentrations of Fu at Fu/Algi hydrogel were determined for their effect on C2C12 cell survival. Live/Dead staining and CCK-8 assay revealed poor proliferation at all concentrations except 100 µg/ml (Fig. S3). At high concentrations, the maximum cell viability over 7 days was 71% ±2.2, 47% ±2.0, and 48% ±1.1, for 1000,3000, and 5000 µg/ml, respectively (Figure S2b). While low concentrations represented 75% ±1.02 and 70% ±3.01 for 100 and 300 µg/ml, respectively, compared to a control group (0µg/ml), 100% ± 14.39858 (Figure S2c). These results suggested that lower concentrations of Fu are expected to enhance cell survival. As a result, combinations of 1, 10, 20, 30, and 50 µg/ml Fu/Algi hydrogel were prepared. The profile of Live & Dead staining showed that cell proliferation capacity was maintained at all concentrations up to 30 µg/ml till day 3. By day 7, most of the cells adopted a spindle shape morphology (Fig. 4 A). The CCK-8 profile further clarified cell proliferation at those concentrations (Fig. 4 B). C2C12 cells reached peak proliferation on day 3, with viability values of 139.8% ± 1.8 at 1 µg/mL, 143.5% ± 2.01 at 10 µg/mL, 99.2% ± 3.8 at 20 µg/mL, and 99.9% ± 3.1 at 30 µg/mL. While 50µg/ml was at 72.05% ± 3.3 and circular cell morphology persisted till day 7. These results denoted that optimal cell proliferation was successful after 3 days, suggesting the lower concentration of Fu from 1–30 µg/ml was effective for cell growth. 3.4.2 The effect of Fu concentration on myogenic differentiation and maturation The immunofluorescence staining of desmin showed similar myotube expression during C2C12 differentiation (Fig. 4 C). There was no significant impact on the gene expression analysis of Myod1, Myogenin, and Myh-1 differentiation markers (Fig. 4 D-F). After analyzing the differentiated myotubes with ImageJ software, we revealed a gradual increase in the myotube area significantly at Fu concentrations 1, 10, and 20 µg/ml, showing 922822.2 µm 2 ± 260.9, 997422.1 µm 2 ± 380.5, and 1494119 µm 2 ± 404, respectively. On the other hand, the myotube area significantly decreased at 30 µg/ml with 684346.1 µm 2 ± 230 compared to Algi as a control group of 156315.6 µm 2 ± 14 (Fig. 4 G). This indicates that the Fu concentration of 20 µg/ml significantly contributed to the highest myotube area. Myotube length significantly increased at 10, 20, and 30 µg/ml, measuring 24,991.28 ± 74, 20,723.01 ± 68, and 19,979.8 ± 75 µm, respectively (Fig. 4 H). In contrast, at 1 µg/ml, myotube length was significantly lower at 731.04 ± 23 µm. This indicates that the Fu concentration of 10, 20, and 30 µg/ml significantly induced the highest myotube length. Myotube diameter significantly increased at 1 µg/ml (34.08 ± 3.7 µm) but decreased at 10 and 30 µg/ml (13.68 ± 2.2 µm and 13.23 ± 3.0 µm, respectively). At 20 µg/ml, the reduction (19.53 ± 2.5 µm) was not significant. Compared to the Algi (26.5 ± 3.3 µm), Fu/Algi at 1 µg/ml promoted the highest myotube diameter (Fig. 4 I). Myotube area and length improved with Fu concentrations up to 20 µg/ml, indicating that Fu enhances C2C12 differentiation compared to the control. We selected 20 µg/ml for the 3D culture meat study due to its significant increase in myotube area and length, with a non-significant reduction in myotube diameter. 3.5 3D culture meat hydrogel disc The 2D co-culture system enabled us to confirm the cytotoxicity profile, proliferation, and intermediate differentiation capacity of C2C12 when co-cultured with MEF, HEC, and Bw/Algi that promoted cell-cell interactions and myofiber formation. Then we performed the hydrogel composition and spatial organization in the 3D co-culture system. The cultured meat disc was designed to incorporate C2C12, MEF, HECs, and Bw/Algi (Fig. 5 ). Using a stainless-steel mold and a 10 cm dish, C2C12, MEF, and HECs were seeded through the light brown Fu/Algi hydrogel disc. The disc was separated by a physical barrier of yellowish Bw/Algi hydrogel. After three days, microscopy revealed that C2C12 cells in the first chamber exhibited longitudinal growth, suggesting that the mold shape promoted cellular alignment (Fig. 5 A). Also, other cells of MEF and HECs showed successful microscopic growth (Fig. 5 A). After 7 days of differentiation, C2C12 cells expressed the anti-myosin skeletal muscle antibody, forming myofibril bundles comparable to 2D cultures and native mouse muscle (Fig. 5 B). A BCA assay quantified the total protein content of C2C12 cells after 10 days of differentiation compared to mouse muscle, yielding 9.825% and 15.875%, respectively (Fig. 5 C). It indicated that C2C12 cells co-cultured successfully in the 3D hydrogel disc expressed their protein content. Compared to beef, our 3D hydrogel disc containing Bw, Algi, and Fu exhibited thermal stability from 63 to 106°C, as determined by DSC analysis over a temperature range of 40–180°C (Fig. 5 D). Beef typically showed thermal properties with endothermic peaks from 101.55 to 113.05°C. In the Bw/Algi hydrogel, Bw began to desaturate at 63.08°C, while Algi at 103.65°C. Subsequently, the Fu and Algi blend was desaturated at 94.92°C and 106.69°C, respectively. Overall, our 3D muscle fiber disc could support C2C12 proliferation, differentiation, and protein production. The biomaterials of the 3D hydrogel disc revealed that Algi, Fu, and Bw will be desaturated nearly at the same time, suggesting adequate cooking as native tissue. 4. Discussion In this study, edible biomaterials such as Bw/Algi and Fu/Algi were developed and applied as scaffolds for the 3D co-culture of C2C12 myoblasts, MEFs, and HECs for cultured meat applications. Previously, the cell-cell interactions were investigated using various co-culture systems to understand the coordination of cell functions [ 38 ]. Indirect co-culture systems allow the exchange of biomolecules between different types of cells [ 32 ]. The development of 3D muscle fibers using biomaterials has significant implications for regenerative medicine, tissue engineering, and the study of muscle physiology [ 46 ]. Although adipose tissue contributes to meat marbling and quality, 3T3-L1 adipocytes suppress muscle cell differentiation in co-culture systems [ 47 ]. To avoid this, we used the plant-based hydrogel Bw/Algi as a lipid source in 2D co-culture and 3D scaffold systems. We also designed a Fu/Algi hydrogel disc encased in a Bw/Algi shell as a 3D scaffold for cultured meat applications. This material combination shows promise in creating functional, biocompatible tissue constructs [ 48 , 49 ]. Co-culturing more than two types of cells is challenging due to interactions during growth. Monoculture systems limit both muscle regeneration and cultured meat development. In muscle regeneration, the absence of support cells like fibroblasts and endothelial cells compromises functionality, vascularization, and mechanical integrity [ 50 ]. The tri-culture systems that include fibroblasts could improve ECM deposition and tissue formation [ 51 , 52 ]. Similarly, in cultured meat production, monoculture does not mimic the complexity of natural muscle, lacking interactions between muscle, fat, and connective tissue. Co-culture systems address these limitations [ 51 ]. Moreover, co-culturing muscle cells with hepatocytes has been explored to manage metabolic waste and mimic physiological conditions [ 51 , 53 ]. We developed a 2D quadrate co-culture system involving C2C12 cells, MEF, HECs, and the lipid-rich Bw. This design facilitated the exchange of cell components, cytokines, and growth factors without direct contact. C2C12 cells proliferated, differentiated, and produced proteins resembling native tissue. HECs alone may suppress C2C12 differentiation, but the inclusion of MEF and Bw/Algi counteracted this effect. Total protein content increased significantly during the proliferation and differentiation phase, indicating that factors secreted during proliferation enhanced differentiation [ 54 ]. Bw has limited utility in tissue regeneration due to its narrow pore size, which restricts infiltration and vascularization [ 55 ]. It also has poor osteoconductivity and suboptimal porosity when used alone [ 55 , 56 ]. In this study, combining Bw with Algi increased internal pore size, allowing better nutrient and cell infiltration. The functional groups responsible for cell attachment remained intact, enhancing C2C12 cell adherence and proliferation. The Bw/Algi hydrogel demonstrated swelling and biodegradability, without cytotoxicity. Its swelling ability was lower than Algi due to the inverse relationship between water solubility and lipid content [ 57 ]. Algi alone has poor cell adhesion properties due to its negative charge. We improved adhesion by blending with Fu, a polysaccharide with better bioactivity [ 58 , 59 ]. We tested various Fu concentrations to assess C2C12 growth. High levels of Fu can cause immune overactivation, inflammation, and hinder regeneration [ 60 ]. Excessive concentrations also impair cell adhesion and proliferation [ 61 ]. Our results showed optimal proliferation at 0–30 µg/ml, with morphological changes from circular to elongated shapes. Increasing Fu from 0–30 µg/ml promoted longer and wider myotubes, with 20 µg/ml yielding the best area and length without reducing diameter. Combining 3D scaffolds and layer-by-layer technology can enhance muscle regeneration and cultured meat fabrication. Traditional scaffolds like collagen or gelatin support myoblast growth but lack cellular diversity [ 62 , 63 ]. Layer-by-layer methods allow integration of muscle cells, adipocytes, and endothelial cells for vascularization and tissue structure [ 63 – 66 ]. However, challenges in seamless layer integration and poor nutrient diffusion still limit scalability [ 67 – 69 ]. Furthermore, poor vascularization and nutrient diffusion remain major obstacles, limiting the scalability and efficiency of these approaches for large-scale applications in cultured meat production [ 70 – 73 ]. We implemented the 2D quadrate design into a 3D disc-shaped culture. The 3D scaffold included Fu/Algi (20 µg/ml) with C2C12, MEF, and HECs enclosed in a Bw/Algi shell. This indirect co-culture promoted directional growth of C2C12 cells, aided by the circular mold, and supported MEF and HEC proliferation. During the proliferation and differentiation phase, myosin skeletal muscle expression was observed in bundled structures, resembling native tissue. The system promoted C2C12 protein production and presents a promising alternative for multicellular cultured meat scaffolds. Thermal stability is vital in cultured meat to replicate the mechanical properties of real meat during cooking [ 74 – 76 ]. Thermal behavior affects protein conformation and meat-like qualities such as texture and mouthfeel [ 67 ]. Thus, thermally stable biomaterials are essential [ 63 ]. Using DSC analysis, we found that our Fu/Algi-Bw/Algi scaffold had thermal properties similar to beef. Bw enhanced thermal resistance, and Algi contributed to structural stability. Compared to tallow, Bw was more stable [ 77 ]. Besides, blending Algi with Fu improved Fu’s thermal performance. This indicates that our scaffolds can endure cooking temperatures and mimic conventional meat [ 78 ]. While these findings demonstrate the potential of Fu/Algi and Bw/Algi scaffolds for cultured meat applications, several challenges remain to be addressed before practical implementation. Future studies should focus on evaluating the long-term mechanical and biochemical stability of these scaffolds during extended culture periods. Also, it's critical to conduct comprehensive sensory evaluations, including texture, flavor, and mouthfeel assessments, to determine consumer acceptance relative to conventional meat products. We employed immortalized cell lines rather than primary cells derived from edible species. However, these model cell lines provide a reproducible platform for systematically evaluating scaffold properties before scaling up to edible-specific systems, which will be the focus of future work. Ultimately, overcoming these limitations will facilitate the translation of this technology from the laboratory to scalable, industrial production, advancing the future of sustainable cultured meat. 5. Conclusions This study established a novel in vitro co-culture system by integrating C2C12 myoblasts, MEFs, and HECs with plant-based hydrogels of Bw/Algi and Fu/Algi. The engineered hydrogels supported cell proliferation, myogenic differentiation, and structural organization in both 2D and 3D models. Notably, the 3D quadrate co-culture system promoted aligned myotube formation, protein content, and thermal stability suitable for meat processing. These findings highlight the potential of multi-cell co-culture and edible biomaterials for scalable, structured cultured meat production. Abbreviations Algi: Alginate Bw: Beeswax Bw/Algi: Beeswax/alginate Fu: Fucoidan Fu/Algi: Fucoidan-alginate MEF: Mouse embryonic fibroblast HECs: Human endothelial cells PAX7: Paired Box 7 Myod1: Myoblast determination protein 1 Myh-1: Myosin heavy chain -1 n: Experimental number Declarations Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, and Forestry (IPET) through the High Value-Added Food Technology Development Program, funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (Grant No. 321027-5). Additional support was provided by the Korean Fund for Regenerative Medicine (KFRM) under Grant No. 22A0101L1-11, funded by the Ministry of Science and ICT and the Ministry of Health and Welfare. Author Contribution Jihad Kamel: conceptualisation, methodology, data curation, writing – original draft, writing – review and editing, visualization, validation, resources, formal analysis, investigation, software. Jun-Yeong Lee: methodology. Sadia Afrin: validation. Usha Yadav: software. Chandra-Jit Yadav: validation. Sung Soo Han: writing – review and editing, funding acquisition, resources. Kyung-Mee Park: conceptualization, supervision, project administration, funding acquisition, resources. Acknowledgement The authors assume complete responsibility for all elements of this study, encompassing its design, data analysis and interpretation, and manuscript writing. Data Availability All data supporting the findings of this study are available within the article and its supplementary information files. Additional data are available from the corresponding author upon reasonable request. References Bomkamp, C., et al., Scaffolding biomaterials for 3D cultivated meat: prospects and challenges. Advanced Science, 2022. 9 (3): p. 2102908. Thomas, K., A.J. Engler, and G.A. Meyer, Extracellular matrix regulation in the muscle satellite cell niche. Connective tissue research, 2015. 56 (1): p. 1-8. Mittelbrunn, M. and F. Sánchez-Madrid, Intercellular communication: diverse structures for exchange of genetic information. Nature reviews Molecular cell biology, 2012. 13 (5): p. 328-335. Venter, C. and C. Niesler, A triple co-culture method to investigate the effect of macrophages and fibroblasts on myoblast proliferation and migration. BioTechniques, 2018. 64 (2): p. 52-58. Dore-Duffy, P., Pericytes: pluripotent cells of the blood brain barrier. Current pharmaceutical design, 2008. 14 (16): p. 1581-1593. Shirasaki, Y., et al., Real-time single-cell imaging of protein secretion. Scientific reports, 2014. 4 (1): p. 4736. Seo, J.W., et al., Development of cultivable alginate fibers for an ideal cell-cultivated meat scaffold and production of hybrid cultured meat. Carbohydrate Polymers, 2023. 321 : p. 121287. Seo, K., et al., Adipocytes suppress differentiation of muscle cells in a co ‐culture system. Animal Science Journal, 2019. 90 (3): p. 423-434. Cronin, E.M., et al., Protein ‐coated poly (L ‐lactic acid) fibers provide a substrate for differentiation of human skeletal muscle cells. Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials, 2004. 69 (3): p. 373-381. Traphagen, S.B., et al., Endothelial invasive response in a co ‐culture model with physically ‐induced osteodifferentiation. Journal of tissue engineering and regenerative medicine, 2013. 7 (8): p. 621-630. Bampi, M., et al., Evaluation of different software tools for deconvolving differential scanning calorimetry thermograms of salted beef. Food Science and Technology, 2016. 36 : p. 694-700. Lunt, S.J., N. Chaudary, and R.P. Hill, The tumor microenvironment and metastatic disease. Clinical & experimental metastasis, 2009. 26 : p. 19-34. Qazi, T.H., et al., Programming hydrogels to probe spatiotemporal cell biology. Cell Stem Cell, 2022. 29 (5): p. 678-691. Baoge, L., et al., Treatment of skeletal muscle injury: a review. International Scholarly Research Notices, 2012. 2012 (1): p. 689012. Park, S., et al., Gelatin MAGIC powder as nutrient-delivering 3D spacer for growing cell sheets into cost-effective cultured meat. Biomaterials, 2021. 278 : p. 121155. Cheng, Y., et al., Controlled fabrication of bioactive microfibers for creating tissue constructs using microfluidic techniques. ACS applied materials & interfaces, 2016. 8 (2): p. 1080-1086. Mann, C.J., et al., Aberrant repair and fibrosis development in skeletal muscle. Skeletal muscle, 2011. 1 : p. 1-20. Aoki, N., et al., Identification and characterization of microvesicles secreted by 3T3-L1 adipocytes: redox-and hormone-dependent induction of milk fat globule-epidermal growth factor 8-associated microvesicles. Endocrinology, 2007. 148 (8): p. 3850-3862. Prisk, V. and J. Huard, Muscle injuries and repair: the role of prostaglandins and inflammation. Histology and histopathology, 2003. Madden, L., et al., Bioengineered human myobundles mimic clinical responses of skeletal muscle to drugs. elife, 2015. 4 : p. e04885. Maimaiti, D., et al., Extracellular matrix-mimicking cryogels composed of methacrylated fucoidan enhance vascularized skeletal muscle regeneration following volumetric muscle loss. International Journal of Biological Macromolecules, 2024. 283 : p. 137122. Li, C.-H., et al., The production of fat-containing cultured meat by stacking aligned muscle layers and adipose layers formed from gelatin-soymilk scaffold. Frontiers in Bioengineering and Biotechnology, 2022. 10 : p. 875069. Yazid, N.S.M., et al., Application of starch and starch-based products in food industry. Journal of Science and Technology, 2018. 10 (2). Neznakomova, M. and N. Todorov, Materials with potentially bioactive properties-preparation and characterization of electrospun poly (vinyl alcohol)/beeswax fiber web. Zastita Materijala, 2015. 56 (2): p. 165-174. Manivannan, K., G. Jaganathan, and M.A. Sithique, Novel beeswax-chitosan/Zinc-hydroxyapatite biocomposite porous scaffolds: Preparation and biological evaluation. Journal of Science: Advanced Materials and Devices, 2021. 6 (2): p. 197-201. Zou, J., et al., Beeswax-inspired superhydrophobic electrospun membranes for peritendinous anti-adhesion. Materials Science and Engineering: C, 2020. 116 : p. 111166. Brito-Pereira, R., et al., Beeswax multifunctional composites with thermal-healing capability and recyclability. Chemical Engineering Journal, 2023. 453 : p. 139840. Sanyal, A., et al., Revolutionizing the use of honeybee products in healthcare: a focused review on using bee pollen as a potential adjunct material for biomaterial functionalization. Journal of Functional Biomaterials, 2023. 14 (7): p. 352. Saretzky, I. and M. Cassini, Enhancing Skin Cicatrization with Natural Sources–The Role of Polyunsaturated Fatty Acids (PUFAs) and Beeswax , in Cosmetic Products and Industry-New Advances and Applications . 2023, IntechOpen. Zuo, Y., et al., Microfluidic-based generation of functional microfibers for biomimetic complex tissue construction. Acta biomaterialia, 2016. 38 : p. 153-162. Kook, Y.-M., et al., Design of biomimetic cellular scaffolds for co-culture system and their application. Journal of tissue engineering, 2017. 8 : p. 2041731417724640. Yılmaz, M.T., M. Karakaya, and N. Aktaş, Composition and thermal properties of cattle fats. European Journal of Lipid Science and Technology, 2010. 112 (3): p. 410-416. Liu, H., et al., The interaction between a combined knitted silk scaffold and microporous silk sponge with human mesenchymal stem cells for ligament tissue engineering. Biomaterials, 2008. 29 (6): p. 662-674. Gruškienė, R., et al., Fucoidan as a carrier of antimicrobial peptide: Preparation and characterization of nisin-loaded particles. Lwt, 2024. 191 : p. 115598. Ben-Arye, T. and S. Levenberg, Tissue engineering for clean meat production. Frontiers in Sustainable Food Systems, 2019. 3 : p. 46. Manz, B.N. and J.T. Groves, Spatial organization and signal transduction at intercellular junctions. Nature Reviews Molecular Cell Biology, 2010. 11 (5): p. 342-352. Kim, K.-J., O.-H. Lee, and B.-Y. Lee, Low-molecular-weight fucoidan regulates myogenic differentiation through the mitogen-activated protein kinase pathway in C2C12 cells. British journal of nutrition, 2011. 106 (12): p. 1836-1844. Crum-Cianflone, N.F., Bacterial, fungal, parasitic, and viral myositis. Clinical microbiology reviews, 2008. 21 (3): p. 473-494. Jain, A. and R. Bansal, Applications of regenerative medicine in organ transplantation. Journal of pharmacy and bioallied sciences, 2015. 7 (3): p. 188-194. Momany, F.A., et al., Structural characterization of α-zein. Journal of agricultural and food chemistry, 2006. 54 (2): p. 543-547. Alencar, G.F., et al., Stem cell pluripotency genes Klf4 and Oct4 regulate complex SMC phenotypic changes critical in late-stage atherosclerotic lesion pathogenesis. Circulation, 2020. 142 (21): p. 2045-2059. Milanović, J.K., et al., Blend of natural waxes as a matrix for aroma encapsulation. Facta Universitatis, Series: Physics, Chemistry and Technology, 2018. 15 (2): p. 103-111. Dzobo, K., et al., Advances in regenerative medicine and tissue engineering: innovation and transformation of medicine. Stem cells international, 2018. 2018 (1): p. 2495848. Genovese, P.C., In Vitro and In Vivo Evaluation of Mesenchymal Stem Cell Spheroids for Skeletal Muscle Regeneration Following Trauma . 2021, Saint Louis University. Singh, P., et al., Unveiling the potential of starch-blended biodegradable polymers for substantializing the eco-friendly innovations. Journal of Agriculture and Food Research, 2024. 15 : p. 101065. Lander, A.D., How cells know where they are. Science, 2013. 339 (6122): p. 923-927. Hata, H., et al., Grafted skeletal myoblast sheets attenuate myocardial remodeling in pacing-induced canine heart failure model. The Journal of thoracic and cardiovascular surgery, 2006. 132 (4): p. 918-924. Abulateefeh, S.R., et al., Synthesis and characterization of new derivatives of alginic acid and evaluation of their iron (III)-crosslinked beads as potential controlled release matrices. Pharmaceutical Development and Technology, 2014. 19 (7): p. 856-867. Chazaud, B., et al., Dual and beneficial roles of macrophages during skeletal muscle regeneration. Exercise and sport sciences reviews, 2009. 37 (1): p. 18-22. Halldorsson, S., et al., Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices. Biosensors and Bioelectronics, 2015. 63 : p. 218-231. David, S., et al., Co-culture approaches for cultivated meat production. Nature Reviews Bioengineering, 2023. 1 (11): p. 817-831. Martins, B., et al., Advances and challenges in cell biology for cultured meat. Annual review of animal biosciences, 2024. 12 (1): p. 345-368. Pierezan, M.D. and S. Verruck, Cattle, swine, poultry and fish cells for meat production: addressing challenges of co-culture and the innovative approaches for muscle and fat integration. Current Opinion in Food Science, 2024: p. 101230. Grabiec, K., et al., Interleukin-1β stimulates early myogenesis of mouse C2C12 myoblasts: the impact on myogenic regulatory factors, extracellular matrix components, IGF binding proteins and protein kinases. Polish Journal of Veterinary Sciences, 2013(2). Rosellini, E. and M.G. Cascone, Microfluidic fabrication of natural polymer-based scaffolds for tissue engineering applications: a review. Biomimetics, 2023. 8 (1): p. 74. Sari, M., et al., Porous carbonated hydroxyapatite-based paraffin wax nanocomposite scaffold for bone tissue engineering: A physicochemical properties and cell viability assay analysis. Coatings, 2021. 11 (10): p. 1189. Zhang, Y., et al., Lipid biomarker evidence for determining the origin and distribution of organic matter in surface sediments of Lake Taihu, Eastern China. Ecological Indicators, 2017. 77 : p. 397-408. Dib, N., et al., Safety and feasibility of autologous myoblast transplantation in patients with ischemic cardiomyopathy: four-year follow-up. Circulation, 2005. 112 (12): p. 1748-1755. Baluska, F., et al., Cytoskeleton-plasma membrane-cell wall continuum in plants. Emerging links revisited. Plant physiology, 2003. 133 (2): p. 482-491. Haggag, Y.A., et al., Fucoidan in pharmaceutical formulations: a comprehensive review for smart drug delivery systems. Marine Drugs, 2023. 21 (2): p. 112. Carvalho, D.N., et al., Marine collagen-chitosan-fucoidan cryogels as cell-laden biocomposites envisaging tissue engineering. Biomedical Materials, 2020. 15 (5): p. 055030. Mertens, J.P., et al., Engineering muscle constructs for the creation of functional engineered musculoskeletal tissue. Regenerative medicine, 2014. 9 (1): p. 89-100. Sahebalzamani, M., et al., Advancing bone tissue engineering one layer at a time: a layer-by-layer assembly approach to 3D bone scaffold materials. Biomaterials Science, 2022. 10 (11): p. 2734-2758. Liu, X., et al., Recent advances in layer-by-layer assembly scaffolds for co-delivery of bioactive molecules for bone regeneration: an updated review. Journal of Translational Medicine, 2024. 22 (1): p. 1001. Borges, J., et al., Recent developments in layer ‐by ‐layer assembly for drug delivery and tissue engineering applications. Advanced Healthcare Materials, 2024. 13 (8): p. 2302713. Funakoshi, T., et al., Application of tissue engineering techniques for rotator cuff regeneration using a chitosan-based hyaluronan hybrid fiber scaffold. The American journal of sports medicine, 2005. 33 (8): p. 1193-1201. Lee, S.-H. and J. Choi, Three-dimensional scaffolds, materials, and fabrication for cultured meat applications: A scoping review and future direction. Food Hydrocolloids, 2024. 152 : p. 109881. Wang, Y., et al., An overview of recent progress in engineering three-dimensional scaffolds for cultured meat production. Foods, 2023. 12 (13): p. 2614. Seah, J.S.H., et al., Scaffolds for the manufacture of cultured meat. Critical Reviews in Biotechnology, 2022. 42 (2): p. 311-323. Gholobova, D., et al., Vascularization of tissue-engineered skeletal muscle constructs. Biomaterials, 2020. 235 : p. 119708. Novosel, E.C., C. Kleinhans, and P.J. Kluger, Vascularization is the key challenge in tissue engineering. Advanced drug delivery reviews, 2011. 63 (4-5): p. 300-311. Bramfeld, H., et al., Scaffold vascularization: a challenge for three-dimensional tissue engineering. Current medicinal chemistry, 2010. 17 (33): p. 3944-3967. Santos, M.I. and R.L. Reis, Vascularization in bone tissue engineering: physiology, current strategies, major hurdles and future challenges. Macromolecular bioscience, 2010. 10 (1): p. 12-27. Bian, W. and N. Bursac, Engineered skeletal muscle tissue networks with controllable architecture. Biomaterials, 2009. 30 (7): p. 1401-1412. Koning, M., et al., Current opportunities and challenges in skeletal muscle tissue engineering. Journal of tissue engineering and regenerative medicine, 2009. 3 (6): p. 407-415. Guex, A., et al., Fine-tuning of substrate architecture and surface chemistry promotes muscle tissue development. Acta biomaterialia, 2012. 8 (4): p. 1481-1489. Goers, L., P. Freemont, and K.M. Polizzi, Co-culture systems and technologies: taking synthetic biology to the next level. Journal of The Royal Society Interface, 2014. 11 (96): p. 20140065. Yılmaz, M.T. and M. Karakaya, Differential scanning calorimetry analysis of goat fats: comparison of chemical composition and thermal properties. Journal of the American Oil Chemists' Society, 2009. 86 (9): p. 877-883. Additional Declarations No competing interests reported. Supplementary Files Suplementrydata.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7863529","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":582017909,"identity":"c3c37f75-1439-4cad-a9a5-d3874ca142c1","order_by":0,"name":"Jihad Kamel","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Jihad","middleName":"","lastName":"Kamel","suffix":""},{"id":582017913,"identity":"74d83762-9f4a-4e18-b3d7-88352d7c4173","order_by":1,"name":"Jun-Yeong Lee","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Jun-Yeong","middleName":"","lastName":"Lee","suffix":""},{"id":582017915,"identity":"0ef4dbd0-8d7a-4807-b0cb-152ea32be037","order_by":2,"name":"Sadia Afrin","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Sadia","middleName":"","lastName":"Afrin","suffix":""},{"id":582017916,"identity":"f031acfe-6f4e-43c0-95cc-be0ecf8a2ae4","order_by":3,"name":"Usha Yadav","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Usha","middleName":"","lastName":"Yadav","suffix":""},{"id":582017918,"identity":"94de780d-0cd4-4241-bc14-d1c16f13907b","order_by":4,"name":"Chandra-Jit Yadav","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Chandra-Jit","middleName":"","lastName":"Yadav","suffix":""},{"id":582017920,"identity":"f950bfc3-b76d-42f5-a064-f5405dcc80f8","order_by":5,"name":"Sung Soo Han","email":"","orcid":"","institution":"Yeungnam University","correspondingAuthor":false,"prefix":"","firstName":"Sung","middleName":"Soo","lastName":"Han","suffix":""},{"id":582017922,"identity":"3e9b8452-6f4b-45b0-a32e-6022e6c3dfc4","order_by":6,"name":"Kyung-Mee Park","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYHACZsYGBhsGAyjPAK9aJC1ppGs5TIIWc/azjw1n5pyXN5fuMWD4UcNgbN5AQItlT7px4sZttw13zjljwNhzjMFM5gABLQYH0pgPPtx2O8HgRo4BAy8wICQIOczg/DOQlnNgLYx/idJyI40Z6LADYC3MQFvMCGqxnPGM2XDmtmTDnTPSCg7LHJMwJqjFnD+NWbJ3m528uUTyxodvamwMZxB0GDLnAAMDQTuIjOxRMApGwSgY4QAAp1w793swTKQAAAAASUVORK5CYII=","orcid":"","institution":"Chungbuk National University","correspondingAuthor":true,"prefix":"","firstName":"Kyung-Mee","middleName":"","lastName":"Park","suffix":""}],"badges":[],"createdAt":"2025-10-15 04:23:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7863529/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7863529/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101406469,"identity":"e2b5455a-c813-46e0-88bf-21607656495c","added_by":"auto","created_at":"2026-01-29 10:52:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":354935,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of surface morphology and physical properties of the Bw/Algi hydrogel. (A, B) SEM images and average pore size measurements for beeswax (Bw) and beeswax/alginate (Bw/Algi) (n=4). Scale bar 2µm. (C) FTIR spectra showing different functional groups in both hydrogels. (D, E) Swelling and degradation behavior of hydrogels for up to 7 days (n=5). Results were presented as mean ± SE, with statistical significance indicated as * for P \u0026lt; 0.05 and *** for P \u0026lt; 0.001. ns represents non-significance, and data were analyzed using a one-way ANOVA test.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/017e68b9fcf08ffe85fa5415.png"},{"id":101751813,"identity":"ceef5630-3866-4eb9-bd71-cc6e383eaf95","added_by":"auto","created_at":"2026-02-03 10:23:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":568333,"visible":true,"origin":"","legend":"\u003cp\u003eCytotoxicity\u003cstrong\u003e, \u003c/strong\u003eattachment, and Proliferation of C2C12 Cells through the Bw/Algi hydrogel\u003cstrong\u003e. \u003c/strong\u003e(A) Smooth morphology of the beeswax/alginate scaffold (Bw/Algi), punched into 6×10 mm (Width × Thickness) and floated on top of C2C12 culture during an indirect cytotoxic analysis. (B, C) Using the CCK-8 assay and Live \u0026amp; Dead staining kit, the cytotoxicity of Bw/Algi was examined (n=4). The control group consisted of 2D C2C12 cells. Viable cells were shown in green, while dead cells were shown in red. (D) SEM images showing C2C12 cell attachment on the surface of the Bw/Algi hydrogel during the proliferation period. White arrows indicate the attached cells, with a scale bar of 10 µm. (E) Proliferation images of C2C12 cells up to 5 days using DAPI and Live \u0026amp; Dead staining. Scale bar of 200 µm. The control group is considered plain beeswax biomaterial (Bw). (F) Quantification of DAPI staining through days 3 and 5 of proliferation using ImageJ software. Results were presented as mean ± SE (n=3).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/030eef1118ce3f1d20f0b57d.png"},{"id":101406473,"identity":"d2f98fec-fd87-4e38-8b26-ea3d0ae55f71","added_by":"auto","created_at":"2026-01-29 10:52:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":609026,"visible":true,"origin":"","legend":"\u003cp\u003eThe quadrate co-culture of C2C12 with MEF, HECs, and Bw/Algi during Proliferation and Differentiation. (A) C2C12 proliferation was assessed by PAX-7 antibody for up to 5 days. Scale bar 100 μm. (B) Gene expression analysis of PAX-7 was determined on days 1, 3, and 5. (C) Immunofluorescence staining of desmin protein in C2C12 cells after 7 days of differentiation in the co-culture system. Scale bar 100 μm. (D, E) mRNA expression of Myh-1 after 10 days of differentiation, during media sharing at proliferation and differentiation, or differentiation only, respectively. (F, G) Analysis of the protein content during the co-culture after 10 days of differentiation, through media sharing at proliferation and differentiation, or differentiation only, respectively. The control group represents C2C12 cells. Results were presented as mean ± SE (n=4), with statistical significance indicated as * for P \u0026lt; 0.05, ** for P \u0026lt; 0.01, *** for P \u0026lt; 0.001, and **** for P \u0026lt; 0.0001, analyzed using a one-way ANOVA test\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/aa5ef97cf252d7fe707fbfe7.png"},{"id":101406472,"identity":"c8c4d469-7379-4fb3-9969-af04fa4432f0","added_by":"auto","created_at":"2026-01-29 10:52:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":468516,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of Fu concentration on proliferation, myogenic differentiation, and maturation of the C2C12 cells in Fu/Algi hydrogel. (A, B) Cytotoxicity profile of C2C12 cells using Live \u0026amp; Dead staining and CCK-8 assay up to 7 days. Scale bar 200 μm. (C) Immunofluorescence staining of desmin antibody after 7 days of differentiation of C2C12 cells. Scale bar 100 μm. (D-F) mRNA expression levels of myogenic differentiation markers Myod1, Myogenin, and Myh-1, respectively within the 10 days of differention. (G-I) Quantitative analysis of myotube area, length, and width following desmin protein expression, respectively, using ImageJ software. Results were presented as mean ± SE (n=4), with statistical significance denoted as * for P \u0026lt; 0.05, ** for P \u0026lt; 0.01, *** for P \u0026lt; 0.001, and **** for P \u0026lt; 0.0001, analyzed using a one-way ANOVA test.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/b94904294752dd8b0ba7f35f.png"},{"id":101406471,"identity":"c4ebab86-697f-4ee2-84f4-d9d18d216fca","added_by":"auto","created_at":"2026-01-29 10:52:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":343617,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of the 3D culture meat disc: differentiation, protein production, and thermal stability of Fu/Algi hydrogel encased in a Bw/Algi shell. (A) 3D quadrate co-culture disc presenting proliferated C2C12 cells (1), MEFs (2), and HECs (3) in Fu/Algi surrounded by a Bw/Algi shell at day 3 of proliferation. Scale bar 200 μm. (B) Immunofluorescence staining of myosin antibody indicates the bundle formation of the differentiated C2C12 cells. 2D C2C12 cells and native tissue served as control groups. Scale bar 100 μm. The differentiation was conducted for 7 days. (C) Protein content was measured after 10 days of differentiated C2C12 cells using a BCA assay kit. (D) DSC analysis describing the thermal properties of the biomaterials compared to native bovine muscle. Results were presented as mean ± SE (n=4), with statistical significance indicated as * for P \u0026lt; 0.05, analyzed using a one-way ANOVA test.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/235f7b991df463a9714dfead.png"},{"id":105901752,"identity":"7831ef91-d40f-45a6-8cc9-7aa5c827ae66","added_by":"auto","created_at":"2026-04-01 09:29:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3442431,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/b25a1232-bf41-450a-9671-d8e3e271c230.pdf"},{"id":101406474,"identity":"21edf31d-f9cb-4981-b09c-a848f8ac48c0","added_by":"auto","created_at":"2026-01-29 10:52:29","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3458852,"visible":true,"origin":"","legend":"","description":"","filename":"Suplementrydata.docx","url":"https://assets-eu.researchsquare.com/files/rs-7863529/v1/7a078dd88b146ebfaf713af0.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Engineering multiple Cell Co-Culture System with Fucoidan and Beeswax Hydrogels for Cultured Meat Applications","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCultured meat technology provides a viable approach for developing cell culture scaffolds tailored for meat production, presenting an alternative to conventional animal husbandry [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Recently, meat production needed a huge capacity for animal rearing, which involves environmental pollution, antibiotic consumption, animal caring, and management [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Accordingly, recent research focuses on green meat technology as a potential solution to these challenges [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Optimizing the environment for cellular meat requires a thorough understanding of the skeletal muscle tissue's extracellular matrix (ECM), as it involves various cell types and their interactions. The cell-to-cell and cell-to-ECM interactions play a crucial role in proliferation, migration, differentiation, and protein production [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Intercellular interactions are essential for cell growth, new blood vessel formation, differentiation of stem cells, and immune system activation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The co-culture system has been investigated to identify cell-encapsulated scaffolds essential for skeletal muscle regeneration [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Fabricating 3D scaffolds with biomaterials for meat technology or muscle repair is challenging due to the need to support cell growth and maintain key parameters [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe primary goal of cultured meat production is to eliminate animal slaughter, with plant-based biomaterials being the most common form of 3D culture scaffold technology [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Biomaterials should support the myoblast-to-myogenesis process by providing an appropriate ECM for cell expansion, migration, and proliferation at the injury site [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Besides, those biomaterials should be nontoxic, flexible, biodegradable, porous, and capable of gelation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. For example, alginate (Algi) is considered the most widely polysaccharide incorporated with biomaterials for the development of artificial scaffolds. It's isolated from the brown algae \u0026lsquo;\u0026rsquo;\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eLaminaria hyperboreans\u003c/span\u003e \u0026lsquo;\u0026rsquo; and is considered a strongly biocompatible, hygroscopic, tensile, non-toxic biomaterial. Algi possess adhesive peptides and natural polymers, making them a promising material for nutrient delivery. However, its negative charge hinders cell adhesion, necessitating its combination with other biomaterials [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFucoidan (Fu) is a sulfated polysaccharide commonly used as a biological scaffold extracted from brown seaweeds \u0026lsquo;\u0026rsquo; \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eFuscus vesiculosus Ecklonia kurome\u003c/span\u003e, and \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eUndaria pinnatifida\u003c/span\u003e\u0026rsquo;\u0026rsquo;. Fu has been reported to show anticoagulation, anti-inflammatory, cell proliferation, and adhesion properties [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It also has potential in muscle regeneration, particularly for enhancing recovery and muscle performance. Meanwhile, it is indicated that Fu may promote muscle growth by improving muscle size and strength [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, its ability to improve cellular activities such as proliferation and differentiation is an ideal tissue engineering component [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBeeswax (Bw) is an industrial, green-based wax that has been widely used in food product technology, pharmaceutical, and medicinal applications. It considers coating edible material with a mixture of protein or polysaccharides due to favorable water tolerance and hydrophobic activity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. It has been explored in tissue regeneration due to its biocompatibility, antimicrobial properties, and ability to create a protective barrier to support wound healing [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Its active components, including long-chain fatty acids, esters, and hydrocarbons, contribute to cell attachment by enhancing surface interactions and promoting cellular adhesion [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The incorporation of Bw into biomaterial scaffolds has shown promise in enhancing structural stability and creating a supportive environment for cell proliferation and tissue repair [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. For example, it's combined with chitosan polysaccharide to create a porous, biocompatible, and non-toxic scaffold suitable for bone engineering [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Bw\u0026rsquo;s hydrophobic properties are more stable in aqueous solution than other biomaterials like soybean, pullulan, and maltodextrin [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The skeletal muscle ECM contains a diverse population of myogenic and non-myogenic cells that interact with growth factors and cytokines crucial for cell growth and regeneration [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In case of muscle injury surrounding ECM and myofibers are damaged and undergo subsequent events [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Fibroblasts and macrophages are the most common cells that share in the wound-healing process [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. During regeneration, fibroblasts infiltrate the tissue and differentiate into myofibroblasts, which secrete cytokines, growth factors, and ECM components vital for activating myoblasts to proliferate at the injury site [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. At the damaged site, the myoblast differentiates into a myotube and starts fusion, forming tissue repair [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. As well, various factors of myoblasts induce angiogenesis cascades, which attract progenitors to the damaged area [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecent studies have developed co-culture systems to understand myogenesis and cell-ECM interactions better. In native muscle tissue, skeletal muscle fibers coexist with fibroblasts, which secrete ECM components, and endothelial cells, which form vascular networks to facilitate nutrient and oxygen transport. Replicating this multicellular architecture is critical, as single-cell systems cannot fully capture the cellular heterogeneity and functional complexity of edible muscle tissue [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In contrast, the monoculture system only represents the cell growth environment, omitting intercellularly expressed factors [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Intercellular crosstalk, typically regulated by direct intercellular molecules, plays a crucial role in ECM production[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The indirect co-culture system is preferred over the direct one, as it allows the exchange of paracrine signals, proteins, cytokines, and growth factors through a permeable membrane, essential for modulating cell behavior [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. While the indirect co-culture system is preferred as it facilitates the exchange of signals, proteins, and growth factors, crucial for modulating cell behavior [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. For example, in a triple direct co-culture system of macrophages, fibroblasts, and C2C12 cells, macrophages hindered the positive effect of fibroblasts on C2C12 cell migration [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The formation of adipose tissue in skeletal muscle is essential for improving meat quality by contributing to marbling, intramuscular fat, tenderness, flavor, and juiciness [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Co-culturing 3T3-L1 adipocytes with C2C12 cells inhibits myogenic differentiation by downregulating myogenic markers and upregulating atrophy-related genes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Alternatively, a separate culture of differentiated C2C12 cells and 3T3-L1 adipocytes has been conducted using layer-by-layer gelatin-soymilk scaffolds [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe cost-effective large-scale production of high-nutrition lab-grown meat has garnered significant interest. It could be generated by the co-culture of essential cells in muscle engineering, sharing a 3D-appropriate scaffold. This study optimized Bw, a plant lipid source, combined with Algi, to develop a Bw/Algi scaffold. We introduced a 2D quadrate co-culture method to examine the interactions between the myoblast cell line, fibroblast, endothelial cells, and Bw. The co-culture system comprising C2C12 myoblasts, MEFs, and HECs was selected to approximate the multicellular environment of skeletal muscle tissue. Myoblasts represent contractile elements, fibroblasts contribute extracellular matrix support, and endothelial cells mimic vascularization potential. Such an integrated system allows us to evaluate scaffold compatibility in a complex cellular context, providing a relevant model for cultured meat scaffold design. Using the indirect co-culture system, we evaluated the effects of shared cells on C2C12 proliferation, differentiation, and protein production. Given Algi\u0026rsquo;s poor cellular adhesion properties, we combined it with Fu to create a Fu/Algi hydrogel for the 3D co-culture system.\u003c/p\u003e \u003cp\u003eThis study is the first to design a 3D skeletal muscle disc with a co-culture of muscle cells, encased by a lipid barrier mimicking the native tissue. This 3D design is expected to be suitable for cultured meat technology and has potential for muscle regeneration studies. This study introduces a co-culture system employing Bw/Algi and Fu/Algi hydrogels designed to support the proliferation and differentiation of muscle cells in vitro.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cell culture\u003c/h2\u003e \u003cp\u003eMouse C2C12 cells (CRL-1772, ATCC, Manassas, VA, USA), Mouse Embryonic Fibroblasts (MEF), and EA.HY926 endothelial cells (HECs) (ATCC, Manassas, VA, USA) were co-cultured in both 2D and 3D configurations. The growth media consisting of high-glucose DMEM and 2mM L-glutamine (Thermo Fisher, Waltham, MA, USA), supplemented with 10% (v/v) fetal bovine serum (FBS) (Cytiva, Marlborough, MA, USA) and 1% (v/v) antibiotic-antimycotic (ABAM) (WelGene, Gyeongsan, South Korea) at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Biocomposite Bw/Algi hydrogel\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Preparation of the hydrogel\u003c/h2\u003e \u003cp\u003eThe Bw/Algi composite was created by adding 10% refined Bw (Sigma Aldrich, St. Louis, MI, USA) to boiling distilled water (DW), stirring for 30 minutes at 150\u0026deg;C until fully melted, and then transferring to the refrigerator at 4\u0026deg;C to harden. The hardened Bw was then combined with a 1% hot Algi solution (Sigma Aldrich) and 0.5% purified organic coconut oil (TopwiL Organic Pty Ltd., Baulkham Hills, Australia), stirring for 3 hours (h) until the water evaporated, resulting in a highly viscous Bw/Algi mixture. The gelation of the hydrogel was achieved using a 2% of 110 g/L CaCl\u003csub\u003e2\u003c/sub\u003e (Sigma Aldrich) in DW.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Physical characteristics\u003c/h2\u003e \u003cp\u003eThe swelling ratio (SR) was evaluated following the gelation of hydrogels with a thickness of 7 mm. Subsequently, all hydrogels were immersed in fresh culture media for 0 days (immediately after gelation), 3 days, and 7 days. The incubation was carried out under controlled conditions at 37\u0026deg;C with 5% CO₂, with media replacement every two days. At each designated time point, the hydrogels were retrieved, and their wet weight (Wx) was recorded. Then subjected to freeze-drying at -50\u0026deg;C for 24 h to determine the initial dry weight (W0). The swelling ratio was calculated using the following equation:\u003c/p\u003e \u003cp\u003eSR(%) = (Wx-W0)/ (W0) \u0026times;100 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo assess the degradation rate, the W0 was obtained using the aforementioned procedure [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The dry weight (W) at different time points was measured after removing the hydrogels from the fresh media and then drying at 60\u0026deg;C for 4 h. The degradation rate (%) was determined using the equation:\u003c/p\u003e \u003cp\u003eDegradation Rate(%) = (W0-W)/(W0) \u0026times; 100.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Cytotoxicity\u003c/h2\u003e \u003cp\u003eThe indirect cytotoxic analysis was conducted using the CCK8 kit (Sigma Aldrich) for 1,3, and 7 days. Briefly, C2C12 cells were cultured in a 35 mm dish with 4 compartments for 1 h, after which a 6\u0026times;10 mm (Width \u0026times; Thickness) piece of Bw/Algi was floated in the media in each well. After each point in time, 10% CCK-8 solution was applied to the conditioned media for 4 h. Following incubation, 100 \u0026micro;L from each sample was transferred to a 96-well plate, and absorbance was measured at 450 nm using a NanoQuant plate reader (TECAN Ltd., M\u0026auml;nnedorf, Switzerland). Then, utilizing the Live/Dead\u0026trade; Cell Imaging Kit (Thermo Fisher Scientific), 40 \u0026micro;L of Live/Dead staining was added to the conditioned medium for 30 minutes. Imaging was acquired using an inverted fluorescent microscope (OPTINITY, KI-3000F, South Korea).\u003c/p\u003e \u003cp\u003e. The positive control was assigned to 2D cell culture without Bw/Algi, while the negative control comprised fresh media.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.2.4 Cell seeding\u003c/h2\u003e \u003cp\u003eAfter preparing Bw/Algi hydrogel, C2C12 cells were seeded on top with 5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per 1 mm thickness of Bw/Algi hydrogel. The growth media DMEM containing 10% FBS and 1% ABAM was used. The proliferation and viability of cells were assessed using 1:1000 DAPI (Sigma Aldrich) and Live/Dead\u0026trade; Cell Imaging. In this analysis, the control group consisted of Bw biomaterial. For quantification analysis of Bw/Algi DAPI stained images were used for cell counting using Image J software (ImageJ 1.47).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.2.5 Scanning Electron Microscopy (SEM)\u003c/h2\u003e \u003cp\u003eTo check the pore size of Bw/Algi, it was compared to pure Bw biomaterial. Briefly, both pretreated and dried at room temperature (RT) for 12 h. Then coated with gold via sputter deposition, and the surface morphology was observed using SEM (Gemini 560, Oberkochen, Germany). The magnification was optimized at 5.00 K X. While in the cell attachment profile, the magnification was at 700 X. Image J software was used to obtain the average pore size.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.6 Fourier Transm Infrared Spectrometer (FTIR)\u003c/h2\u003e \u003cp\u003eFTIR Cary 670 (Main Bench)\u0026thinsp;+\u0026thinsp;Cary 620 (Microscope), (Agilent Technologies, Santa Clara, CA, USA) was employed to analyze the main functional groups of Bw in the Bw/Algi hydrogel. The absorbance value was recorded at 500-4,500 cm\u003csup\u003e-1\u003c/sup\u003e with 0.06 cm\u003csup\u003e-1\u003c/sup\u003e spectral resolution.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.3 The 2D indirect co-culture system\u003c/h2\u003e \u003cp\u003eIn a 4-well confocal dish (SPL, Gyeonggi, South Korea), the individual seeding of 3\u0026times;10\u003csup\u003e4\u003c/sup\u003e C2C12, MEF, and HECs was carried out in each well for 1 h until attachment. Subsequently, a heat-treated 18-gauge needle tip was punched into the central space of the well wall, dividing the plate into four connected compartments (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). This procedure enables the sharing of conditioned media for 3 days of proliferation. The indirect co-culture method enabled the investigation of interactions between the triple cell types during both the proliferation and differentiation stages, as well as during the differentiation stage alone. Differentiation media consisting of 2% horse serum (HS) and 1% ABAM were utilized. The differentiation process was conducted from 7\u0026ndash;10 days, with the media changing every two days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.4 3D culture meat scaffold disc\u003c/h2\u003e \u003cp\u003eAfter successfully implementing the 2D quadrat co-culture system, we added 20 \u0026micro;g/ml Fu (Sigma Aldrich) to the 1% Algi solution and created a 3D Fu/Algi hydrogel. Using a stainless-steel circular mold in a 10 cm dish, we divided the plate into five chambers (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). Those chambers were arranged from the border to the center as follows:\u003c/p\u003e \u003cp\u003eChamber 1: Mixture of 6 ml Fu/Algi solution with 2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e C2C12 cells.\u003c/p\u003e \u003cp\u003eChamber 2: 6 ml of Bw/Algi solution.\u003c/p\u003e \u003cp\u003eChamber 3: Mixture of 4 ml Fu/Algi solution with 2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e MEF cells.\u003c/p\u003e \u003cp\u003eChamber 4: 6 ml of Bw/Algi solution.\u003c/p\u003e \u003cp\u003eChamber 5: Mixture of 2 ml Fu/Algi solution with 2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e HECs.\u003c/p\u003e \u003cp\u003eSubsequently, 2% CaCl\u003csub\u003e2\u003c/sub\u003e was added to cover all chambers for 15\u0026ndash;20 minutes. The CaCl\u003csub\u003e2\u003c/sub\u003e was then replaced once with PBS, and growth media were added for 3 days to facilitate proliferation, followed by differentiation media for 7\u0026ndash;10 days, with the media changing every two days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Immunofluorescence staining:\u003c/h2\u003e \u003cp\u003eTo assess C2C12 proliferation and differentiation, the expression levels of paired box 7 (PAX-7), desmin, and myosin antibodies were evaluated. The hydrogel was washed with PBS and fixed with BIOFIX HD (BIOGNOST, Zagreb, Croatia) for 20 minutes. Following fixation, the hydrogels were treated with 0.2% Triton X-100 (SAMCHUN, Ulsan, South Korea) for 10 minutes and subsequently washed with PBST. A solution of 1% bovine serum albumin (BSA, Sigma Aldrich) dissolved in 1X PBST was applied for 30 minutes. After removing the BSA, each hydrogel was stained with PAX-7 (1:100, Invitrogen, Waltham, MA, USA), α-desmin (1:100, Sigma Aldrich), and anti-myosin skeletal muscle antibodies (Sigma Aldrich) for 1 h at RT. The samples were then washed three times with PBST and incubated with the secondary antibody, goat anti-mouse IgG (1:500, Invitrogen), for 1 h. Finally, the samples were washed twice with PBST, and the cell nuclei were stained with DAPI (1:1000) for 5 minutes. Desmin images were utilized for quantification of myotube area, length, and width using ImageJ software. Imaging was acquired using an inverted fluorescent microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Quantitative PCR (qPCR)\u003c/h2\u003e \u003cp\u003eThe RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for RNA isolation, and the RNA concentration was determined using a spectrophotometer. cDNA synthesis was performed using TOPscript\u0026trade; RT DryMIX (dN6 Plus) (Enzynomics, Daejeon, South Korea). The ΔΔCt method was applied for data analysis, with GAPDH, PAX-7, Mod1, Myogenin, and myosin heavy chain-1 (Myh-1) primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The 2D cell cultivation served as the control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMurine primers used in real-time RT \u0026ndash;qPCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC2C12\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThe annealing temp. (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF:TCCATTTCCCCTGTTCTCCC\u003c/p\u003e \u003cp\u003eR:ATTTCCCCTCCTCCCTCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePAX7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF:AAGGGGTGAGAAAGTCGGAG\u003c/p\u003e \u003cp\u003eR:GATGAGCCGCCTTTGTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMyod1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF:CCCCTTGAAACTTTCCTCGC\u003c/p\u003e \u003cp\u003eR:CTCTGTGAGGGGAGTGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMyogenin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF:AGAGACATGAGTGCCCTGAC\u003c/p\u003e \u003cp\u003eR:TTCCCGGTATCATCAGCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eMyh1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF:GACTACAACATCGCTGGCTG\u003c/p\u003e \u003cp\u003eR:CTTGGCCCCTTTCTTTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Protein content evaluation\u003c/h2\u003e \u003cp\u003eWe determined the protein content produced by C2C12 cells in both 2D and 3D co-culture systems. Following a 10-day differentiation period, the detachment of 2D cells was achieved using trypsin EDTA solution (HyClone\u0026trade;, Logan, UT), followed by centrifugation to obtain a cell pellet. Standardizing the C2C12 cell count was determined across all conditions to 1.3\u0026times;10\u003csup\u003e5\u003c/sup\u003e. For the 3D hydrogel and native mouse muscle, an equivalent dry weight of 0.219 g was obtained following freeze-drying for 24 h. Subsequently, 1 ml of radioimmunoprecipitation assay buffer (RIPA) (Sigma Aldrich) was added to lyse the cells or tissue at 4\u0026deg;C for 30 minutes. The centrifugation was performed at 2700 \u0026times; g for 10 minutes to extract the protein from the supernatant. Quantification of the extracted protein was performed using a Bicinchoninic Acid Assay Kit (BCA) (iNtRON Biotechnology, Gyeonggi, South Korea). This experiment was conducted independently three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Thermal properties of the 3D scaffold\u003c/h2\u003e \u003cp\u003eThe thermal properties of the 3D hydrogels compared to native meat were assessed. Differential Scanning Calorimetry (DSC) was performed using a Q2000 instrument (TA Instruments, New Castle, DE, USA). Samples were measured in 10\u0026ndash;20 mg and placed into 40 \u0026micro;l aluminum pans (PerkinElmer Inc., Waltham, MA, USA) and subjected to heating from 40\u0026deg;C to 180\u0026deg;C at a rate of 50\u0026deg;C per minute for 3 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe data were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE). Statistical analysis was conducted using a one-way analysis of variance (ANOVA) in GraphPad Prism 8 (GraphPad Software 10.2.0, MA, USA). A significance threshold of * P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and **** P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 was applied.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Physical, chemical, and cytotoxic properties of Bw/Algi hydrogel\u003c/h2\u003e \u003cp\u003eIn this study, we aimed to use Bw/Algi hydrogel as a lipid source in 2D and 3D co-culture. First, the SEM analysis showed the inner structure of Bw/Algi with an average pore size percentage of 77.568% \u0026plusmn;7.88 compared to Bw 54.164% \u0026plusmn;4.64, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). Although Bw is hydrophobic, after combining with Algi, the pore distribution is significantly increased, which is critical for absorbing nutrients for cell growth. FTIR represented that the esters, hydrocarbons, and hydroxyl amines of Bw are successfully maintained in Bw/Algi at wavelengths of 1500 cm\u003csup\u003e2\u003c/sup\u003e, 3000 cm\u003csup\u003e2\u003c/sup\u003e, and 3000\u0026ndash;4000 cm\u003csup\u003e2,\u003c/sup\u003e respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). That indicates the Bw/Algi still owes to the same functional groups of Bw biomaterial, which are essential in cell attachment and bioactive interactions. Physical properties of swelling and biodegradability percentage of Bw/Algi were determined within 7 days. Algi swells triplicate the amount of the media significantly more than Bw/Algi, reaching 606.54% \u0026plusmn;13 than 185.01%\u0026plusmn; 22, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). There was no significant change in the biodegradability through the same period of incubation, reaching 14.57% \u0026plusmn; 2.03 and 19.06% \u0026plusmn;1.2 at Algi and Bw/Algi, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Our results indicate that Bw/Algi hydrogel represents significant porosity to adsorb nutrients, preserving the functional groups of Bw essential in cell attachment, showing swelling, and biodegradable properties.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Cytotoxicity and cell attachment through Bw/Algi hydrogel\u003c/h2\u003e \u003cp\u003eC2C12 cells were grown directly and indirectly with Bw/Algi for 5\u0026ndash;7 days. First, the circular disc of Bw/Algi shows smooth morphology and flexibility when compressed with the forceps (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The indirect coculture showed non-significant cytotoxicity of Bw/Algi up to 7 days through the CCK-8 profile or Live\u0026amp; Dead staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and C). Second, aiming to use Bw/Algi as a scaffold for in vitro meat research, C2C12 cells were seeded on its surface for 5 days. SEM imaging confirmed the attachment of cells after one day (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). By days 3 \u0026amp; 5, cell proliferation was determined, showing the increase of cell confluency through DAPI or Live/Dead staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). The quantification data of the DAPI staining revealed that the total proliferated cell count at day 3 was 85.33% \u0026plusmn; 21.4 while by day 5 was 88.66% \u0026plusmn; 15.32 without a significant difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Those findings suggested that Bw/Algi hydrogels exhibited smooth surfaces and supported initial cell adhesion.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.3 2D quadrate co-culture system\u003c/h2\u003e \u003cp\u003eC2C12, MEF, HECs, and Bw/Algi hydrogel were co-cultured indirectly through a 4-compartment plate. The co-culture was conducted without altering C2C12 cell behavior, expressing the PAX-7 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). According to qPCR gene analysis, C2C12 cells co-cultured with MEF significantly showed lower proliferation after day 1, with no significant changes observed on days 3 and 5. While the cell growth showed a non-significant change with the other co-cultures at the same time (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). That indicates all altogether, MEF\u0026thinsp;+\u0026thinsp;HECs\u0026thinsp;+\u0026thinsp;Bw/Algi co-culture had no adverse effect on C2C12 cell proliferation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eDifferentiation and protein expression profiles were assessed at two different times (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-G). C2C12 cells grew indirectly with other co-cultures at both Proliferation and differentiation or differentiation time only (Fig. S2). The immunofluorescence staining of desmin was notably expressed compared to the control group. At both differentiation phases, co-cultured C2C12 with HECs showed lower expression of desmin (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). That may suggest that HECs reduce the intermediate differentiation of C2C12 cells. Myh-1 gene expression showed no significant difference among all cultures at both differentiation phases (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD and E). The protein content extracted from differentiated C2C12 cells during the proliferation and differentiation phase was significantly higher than differentiation phase only (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF and G), Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Those findings suggested the successful proliferation and differentiation of C2C12 cells through the quadrate coculture (C2C12 co- MEF\u0026thinsp;+\u0026thinsp;HECs\u0026thinsp;+\u0026thinsp;Bw/Algi) with a significant increase in protein content at the proliferation and differentiation phases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.4 3D Fu/Algi hydrogel\u003c/h2\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003e3.4.1 The effect of Fu concentration on cell growth\u003c/h2\u003e \u003cp\u003eHigh and low concentrations of Fu at Fu/Algi hydrogel were determined for their effect on C2C12 cell survival. Live/Dead staining and CCK-8 assay revealed poor proliferation at all concentrations except 100 \u0026micro;g/ml (Fig. S3). At high concentrations, the maximum cell viability over 7 days was 71% \u0026plusmn;2.2, 47% \u0026plusmn;2.0, and 48% \u0026plusmn;1.1, for 1000,3000, and 5000 \u0026micro;g/ml, respectively (Figure S2b). While low concentrations represented 75% \u0026plusmn;1.02 and 70% \u0026plusmn;3.01 for 100 and 300 \u0026micro;g/ml, respectively, compared to a control group (0\u0026micro;g/ml), 100% \u0026plusmn; 14.39858 (Figure S2c). These results suggested that lower concentrations of Fu are expected to enhance cell survival.\u003c/p\u003e \u003cp\u003eAs a result, combinations of 1, 10, 20, 30, and 50 \u0026micro;g/ml Fu/Algi hydrogel were prepared. The profile of Live \u0026amp; Dead staining showed that cell proliferation capacity was maintained at all concentrations up to 30 \u0026micro;g/ml till day 3. By day 7, most of the cells adopted a spindle shape morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The CCK-8 profile further clarified cell proliferation at those concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). C2C12 cells reached peak proliferation on day 3, with viability values of 139.8% \u0026plusmn; 1.8 at 1 \u0026micro;g/mL, 143.5% \u0026plusmn; 2.01 at 10 \u0026micro;g/mL, 99.2% \u0026plusmn; 3.8 at 20 \u0026micro;g/mL, and 99.9% \u0026plusmn; 3.1 at 30 \u0026micro;g/mL. While 50\u0026micro;g/ml was at 72.05% \u0026plusmn; 3.3 and circular cell morphology persisted till day 7. These results denoted that optimal cell proliferation was successful after 3 days, suggesting the lower concentration of Fu from 1\u0026ndash;30 \u0026micro;g/ml was effective for cell growth.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e \u003ch2\u003e3.4.2 The effect of Fu concentration on myogenic differentiation and maturation\u003c/h2\u003e \u003cp\u003eThe immunofluorescence staining of desmin showed similar myotube expression during C2C12 differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). There was no significant impact on the gene expression analysis of Myod1, Myogenin, and Myh-1 differentiation markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-F). After analyzing the differentiated myotubes with ImageJ software, we revealed a gradual increase in the myotube area significantly at Fu concentrations 1, 10, and 20 \u0026micro;g/ml, showing 922822.2 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;260.9, 997422.1 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;380.5, and 1494119 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;404, respectively. On the other hand, the myotube area significantly decreased at 30 \u0026micro;g/ml with 684346.1 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;230 compared to Algi as a control group of 156315.6 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). This indicates that the Fu concentration of 20 \u0026micro;g/ml significantly contributed to the highest myotube area.\u003c/p\u003e \u003cp\u003eMyotube length significantly increased at 10, 20, and 30 \u0026micro;g/ml, measuring 24,991.28\u0026thinsp;\u0026plusmn;\u0026thinsp;74, 20,723.01\u0026thinsp;\u0026plusmn;\u0026thinsp;68, and 19,979.8\u0026thinsp;\u0026plusmn;\u0026thinsp;75 \u0026micro;m, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). In contrast, at 1 \u0026micro;g/ml, myotube length was significantly lower at 731.04\u0026thinsp;\u0026plusmn;\u0026thinsp;23 \u0026micro;m. This indicates that the Fu concentration of 10, 20, and 30 \u0026micro;g/ml significantly induced the highest myotube length. Myotube diameter significantly increased at 1 \u0026micro;g/ml (34.08\u0026thinsp;\u0026plusmn;\u0026thinsp;3.7 \u0026micro;m) but decreased at 10 and 30 \u0026micro;g/ml (13.68\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2 \u0026micro;m and 13.23\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0 \u0026micro;m, respectively). At 20 \u0026micro;g/ml, the reduction (19.53\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5 \u0026micro;m) was not significant. Compared to the Algi (26.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.3 \u0026micro;m), Fu/Algi at 1 \u0026micro;g/ml promoted the highest myotube diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). Myotube area and length improved with Fu concentrations up to 20 \u0026micro;g/ml, indicating that Fu enhances C2C12 differentiation compared to the control. We selected 20 \u0026micro;g/ml for the 3D culture meat study due to its significant increase in myotube area and length, with a non-significant reduction in myotube diameter.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.5 3D culture meat hydrogel disc\u003c/h2\u003e \u003cp\u003eThe 2D co-culture system enabled us to confirm the cytotoxicity profile, proliferation, and intermediate differentiation capacity of C2C12 when co-cultured with MEF, HEC, and Bw/Algi that promoted cell-cell interactions and myofiber formation. Then we performed the hydrogel composition and spatial organization in the 3D co-culture system. The cultured meat disc was designed to incorporate C2C12, MEF, HECs, and Bw/Algi (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Using a stainless-steel mold and a 10 cm dish, C2C12, MEF, and HECs were seeded through the light brown Fu/Algi hydrogel disc. The disc was separated by a physical barrier of yellowish Bw/Algi hydrogel. After three days, microscopy revealed that C2C12 cells in the first chamber exhibited longitudinal growth, suggesting that the mold shape promoted cellular alignment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Also, other cells of MEF and HECs showed successful microscopic growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). After 7 days of differentiation, C2C12 cells expressed the anti-myosin skeletal muscle antibody, forming myofibril bundles comparable to 2D cultures and native mouse muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). A BCA assay quantified the total protein content of C2C12 cells after 10 days of differentiation compared to mouse muscle, yielding 9.825% and 15.875%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). It indicated that C2C12 cells co-cultured successfully in the 3D hydrogel disc expressed their protein content.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCompared to beef, our 3D hydrogel disc containing Bw, Algi, and Fu exhibited thermal stability from 63 to 106\u0026deg;C, as determined by DSC analysis over a temperature range of 40\u0026ndash;180\u0026deg;C (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Beef typically showed thermal properties with endothermic peaks from 101.55 to 113.05\u0026deg;C. In the Bw/Algi hydrogel, Bw began to desaturate at 63.08\u0026deg;C, while Algi at 103.65\u0026deg;C. Subsequently, the Fu and Algi blend was desaturated at 94.92\u0026deg;C and 106.69\u0026deg;C, respectively. Overall, our 3D muscle fiber disc could support C2C12 proliferation, differentiation, and protein production. The biomaterials of the 3D hydrogel disc revealed that Algi, Fu, and Bw will be desaturated nearly at the same time, suggesting adequate cooking as native tissue.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, edible biomaterials such as Bw/Algi and Fu/Algi were developed and applied as scaffolds for the 3D co-culture of C2C12 myoblasts, MEFs, and HECs for cultured meat applications. Previously, the cell-cell interactions were investigated using various co-culture systems to understand the coordination of cell functions [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Indirect co-culture systems allow the exchange of biomolecules between different types of cells [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The development of 3D muscle fibers using biomaterials has significant implications for regenerative medicine, tissue engineering, and the study of muscle physiology [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Although adipose tissue contributes to meat marbling and quality, 3T3-L1 adipocytes suppress muscle cell differentiation in co-culture systems [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. To avoid this, we used the plant-based hydrogel Bw/Algi as a lipid source in 2D co-culture and 3D scaffold systems. We also designed a Fu/Algi hydrogel disc encased in a Bw/Algi shell as a 3D scaffold for cultured meat applications. This material combination shows promise in creating functional, biocompatible tissue constructs [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCo-culturing more than two types of cells is challenging due to interactions during growth. Monoculture systems limit both muscle regeneration and cultured meat development. In muscle regeneration, the absence of support cells like fibroblasts and endothelial cells compromises functionality, vascularization, and mechanical integrity [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The tri-culture systems that include fibroblasts could improve ECM deposition and tissue formation [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Similarly, in cultured meat production, monoculture does not mimic the complexity of natural muscle, lacking interactions between muscle, fat, and connective tissue. Co-culture systems address these limitations [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Moreover, co-culturing muscle cells with hepatocytes has been explored to manage metabolic waste and mimic physiological conditions [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe developed a 2D quadrate co-culture system involving C2C12 cells, MEF, HECs, and the lipid-rich Bw. This design facilitated the exchange of cell components, cytokines, and growth factors without direct contact. C2C12 cells proliferated, differentiated, and produced proteins resembling native tissue. HECs alone may suppress C2C12 differentiation, but the inclusion of MEF and Bw/Algi counteracted this effect. Total protein content increased significantly during the proliferation and differentiation phase, indicating that factors secreted during proliferation enhanced differentiation [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBw has limited utility in tissue regeneration due to its narrow pore size, which restricts infiltration and vascularization [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. It also has poor osteoconductivity and suboptimal porosity when used alone [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In this study, combining Bw with Algi increased internal pore size, allowing better nutrient and cell infiltration. The functional groups responsible for cell attachment remained intact, enhancing C2C12 cell adherence and proliferation. The Bw/Algi hydrogel demonstrated swelling and biodegradability, without cytotoxicity. Its swelling ability was lower than Algi due to the inverse relationship between water solubility and lipid content [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlgi alone has poor cell adhesion properties due to its negative charge. We improved adhesion by blending with Fu, a polysaccharide with better bioactivity [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. We tested various Fu concentrations to assess C2C12 growth. High levels of Fu can cause immune overactivation, inflammation, and hinder regeneration [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Excessive concentrations also impair cell adhesion and proliferation [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Our results showed optimal proliferation at 0\u0026ndash;30 \u0026micro;g/ml, with morphological changes from circular to elongated shapes. Increasing Fu from 0\u0026ndash;30 \u0026micro;g/ml promoted longer and wider myotubes, with 20 \u0026micro;g/ml yielding the best area and length without reducing diameter.\u003c/p\u003e \u003cp\u003eCombining 3D scaffolds and layer-by-layer technology can enhance muscle regeneration and cultured meat fabrication. Traditional scaffolds like collagen or gelatin support myoblast growth but lack cellular diversity [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Layer-by-layer methods allow integration of muscle cells, adipocytes, and endothelial cells for vascularization and tissue structure [\u003cspan additionalcitationids=\"CR64 CR65\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. However, challenges in seamless layer integration and poor nutrient diffusion still limit scalability [\u003cspan additionalcitationids=\"CR68\" citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Furthermore, poor vascularization and nutrient diffusion remain major obstacles, limiting the scalability and efficiency of these approaches for large-scale applications in cultured meat production [\u003cspan additionalcitationids=\"CR71 CR72\" citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe implemented the 2D quadrate design into a 3D disc-shaped culture. The 3D scaffold included Fu/Algi (20 \u0026micro;g/ml) with C2C12, MEF, and HECs enclosed in a Bw/Algi shell. This indirect co-culture promoted directional growth of C2C12 cells, aided by the circular mold, and supported MEF and HEC proliferation. During the proliferation and differentiation phase, myosin skeletal muscle expression was observed in bundled structures, resembling native tissue. The system promoted C2C12 protein production and presents a promising alternative for multicellular cultured meat scaffolds.\u003c/p\u003e \u003cp\u003eThermal stability is vital in cultured meat to replicate the mechanical properties of real meat during cooking [\u003cspan additionalcitationids=\"CR75\" citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. Thermal behavior affects protein conformation and meat-like qualities such as texture and mouthfeel [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Thus, thermally stable biomaterials are essential [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Using DSC analysis, we found that our Fu/Algi-Bw/Algi scaffold had thermal properties similar to beef. Bw enhanced thermal resistance, and Algi contributed to structural stability. Compared to tallow, Bw was more stable [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Besides, blending Algi with Fu improved Fu\u0026rsquo;s thermal performance. This indicates that our scaffolds can endure cooking temperatures and mimic conventional meat [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhile these findings demonstrate the potential of Fu/Algi and Bw/Algi scaffolds for cultured meat applications, several challenges remain to be addressed before practical implementation. Future studies should focus on evaluating the long-term mechanical and biochemical stability of these scaffolds during extended culture periods. Also, it's critical to conduct comprehensive sensory evaluations, including texture, flavor, and mouthfeel assessments, to determine consumer acceptance relative to conventional meat products. We employed immortalized cell lines rather than primary cells derived from edible species. However, these model cell lines provide a reproducible platform for systematically evaluating scaffold properties before scaling up to edible-specific systems, which will be the focus of future work. Ultimately, overcoming these limitations will facilitate the translation of this technology from the laboratory to scalable, industrial production, advancing the future of sustainable cultured meat.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThis study established a novel in vitro co-culture system by integrating C2C12 myoblasts, MEFs, and HECs with plant-based hydrogels of Bw/Algi and Fu/Algi. The engineered hydrogels supported cell proliferation, myogenic differentiation, and structural organization in both 2D and 3D models. Notably, the 3D quadrate co-culture system promoted aligned myotube formation, protein content, and thermal stability suitable for meat processing. These findings highlight the potential of multi-cell co-culture and edible biomaterials for scalable, structured cultured meat production.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAlgi: Alginate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBw: Beeswax\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBw/Algi: Beeswax/alginate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFu: Fucoidan\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFu/Algi: Fucoidan-alginate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMEF: Mouse embryonic fibroblast\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHECs: Human endothelial cells\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePAX7: Paired Box 7\u003c/p\u003e\n\u003cp\u003eMyod1: Myoblast determination protein 1\u003c/p\u003e\n\u003cp\u003eMyh-1: Myosin heavy chain -1\u0026nbsp;\u003c/p\u003e\n\u003cp\u003en: Experimental number\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of Competing Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, and Forestry (IPET) through the High Value-Added Food Technology Development Program, funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (Grant No. 321027-5). Additional support was provided by the Korean Fund for Regenerative Medicine (KFRM) under Grant No. 22A0101L1-11, funded by the Ministry of Science and ICT and the Ministry of Health and Welfare.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eJihad Kamel: conceptualisation, methodology, data curation, writing \u0026ndash; original draft, writing \u0026ndash; review and editing, visualization, validation, resources, formal analysis, investigation, software. Jun-Yeong Lee: methodology. Sadia Afrin: validation. Usha Yadav: software. Chandra-Jit Yadav: validation. Sung Soo Han: writing \u0026ndash; review and editing, funding acquisition, resources. Kyung-Mee Park: conceptualization, supervision, project administration, funding acquisition, resources.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors assume complete responsibility for all elements of this study, encompassing its design, data analysis and interpretation, and manuscript writing.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data supporting the findings of this study are available within the article and its supplementary information files. Additional data are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBomkamp, C., et al., \u003cem\u003eScaffolding biomaterials for 3D cultivated meat: prospects and challenges.\u003c/em\u003e Advanced Science, 2022. \u003cstrong\u003e9\u003c/strong\u003e(3): p. 2102908.\u003c/li\u003e\n\u003cli\u003eThomas, K., A.J. Engler, and G.A. Meyer, \u003cem\u003eExtracellular matrix regulation in the muscle satellite cell niche.\u003c/em\u003e Connective tissue research, 2015. \u003cstrong\u003e56\u003c/strong\u003e(1): p. 1-8.\u003c/li\u003e\n\u003cli\u003eMittelbrunn, M. and F. S\u0026aacute;nchez-Madrid, \u003cem\u003eIntercellular communication: diverse structures for exchange of genetic information.\u003c/em\u003e Nature reviews Molecular cell biology, 2012. \u003cstrong\u003e13\u003c/strong\u003e(5): p. 328-335.\u003c/li\u003e\n\u003cli\u003eVenter, C. and C. Niesler, \u003cem\u003eA triple co-culture method to investigate the effect of macrophages and fibroblasts on myoblast proliferation and migration.\u003c/em\u003e BioTechniques, 2018. \u003cstrong\u003e64\u003c/strong\u003e(2): p. 52-58.\u003c/li\u003e\n\u003cli\u003eDore-Duffy, P., \u003cem\u003ePericytes: pluripotent cells of the blood brain barrier.\u003c/em\u003e Current pharmaceutical design, 2008. \u003cstrong\u003e14\u003c/strong\u003e(16): p. 1581-1593.\u003c/li\u003e\n\u003cli\u003eShirasaki, Y., et al., \u003cem\u003eReal-time single-cell imaging of protein secretion.\u003c/em\u003e Scientific reports, 2014. \u003cstrong\u003e4\u003c/strong\u003e(1): p. 4736.\u003c/li\u003e\n\u003cli\u003eSeo, J.W., et al., \u003cem\u003eDevelopment of cultivable alginate fibers for an ideal cell-cultivated meat scaffold and production of hybrid cultured meat.\u003c/em\u003e Carbohydrate Polymers, 2023. \u003cstrong\u003e321\u003c/strong\u003e: p. 121287.\u003c/li\u003e\n\u003cli\u003eSeo, K., et al., \u003cem\u003eAdipocytes suppress differentiation of muscle cells in a co\u003c/em\u003e\u003cem\u003e‐culture system.\u003c/em\u003e Animal Science Journal, 2019. \u003cstrong\u003e90\u003c/strong\u003e(3): p. 423-434.\u003c/li\u003e\n\u003cli\u003eCronin, E.M., et al., \u003cem\u003eProtein\u003c/em\u003e\u003cem\u003e‐coated poly (L\u003c/em\u003e\u003cem\u003e‐lactic acid) fibers provide a substrate for differentiation of human skeletal muscle cells.\u003c/em\u003e Journal of Biomedical Materials Research Part A: An Official Journal of The Society for Biomaterials, The Japanese Society for Biomaterials, and The Australian Society for Biomaterials and the Korean Society for Biomaterials, 2004. \u003cstrong\u003e69\u003c/strong\u003e(3): p. 373-381.\u003c/li\u003e\n\u003cli\u003eTraphagen, S.B., et al., \u003cem\u003eEndothelial invasive response in a co\u003c/em\u003e\u003cem\u003e‐culture model with physically\u003c/em\u003e\u003cem\u003e‐induced osteodifferentiation.\u003c/em\u003e Journal of tissue engineering and regenerative medicine, 2013. \u003cstrong\u003e7\u003c/strong\u003e(8): p. 621-630.\u003c/li\u003e\n\u003cli\u003eBampi, M., et al., \u003cem\u003eEvaluation of different software tools for deconvolving differential scanning calorimetry thermograms of salted beef.\u003c/em\u003e Food Science and Technology, 2016. \u003cstrong\u003e36\u003c/strong\u003e: p. 694-700.\u003c/li\u003e\n\u003cli\u003eLunt, S.J., N. Chaudary, and R.P. Hill, \u003cem\u003eThe tumor microenvironment and metastatic disease.\u003c/em\u003e Clinical \u0026amp; experimental metastasis, 2009. \u003cstrong\u003e26\u003c/strong\u003e: p. 19-34.\u003c/li\u003e\n\u003cli\u003eQazi, T.H., et al., \u003cem\u003eProgramming hydrogels to probe spatiotemporal cell biology.\u003c/em\u003e Cell Stem Cell, 2022. \u003cstrong\u003e29\u003c/strong\u003e(5): p. 678-691.\u003c/li\u003e\n\u003cli\u003eBaoge, L., et al., \u003cem\u003eTreatment of skeletal muscle injury: a review.\u003c/em\u003e International Scholarly Research Notices, 2012. \u003cstrong\u003e2012\u003c/strong\u003e(1): p. 689012.\u003c/li\u003e\n\u003cli\u003ePark, S., et al., \u003cem\u003eGelatin MAGIC powder as nutrient-delivering 3D spacer for growing cell sheets into cost-effective cultured meat.\u003c/em\u003e Biomaterials, 2021. \u003cstrong\u003e278\u003c/strong\u003e: p. 121155.\u003c/li\u003e\n\u003cli\u003eCheng, Y., et al., \u003cem\u003eControlled fabrication of bioactive microfibers for creating tissue constructs using microfluidic techniques.\u003c/em\u003e ACS applied materials \u0026amp; interfaces, 2016. \u003cstrong\u003e8\u003c/strong\u003e(2): p. 1080-1086.\u003c/li\u003e\n\u003cli\u003eMann, C.J., et al., \u003cem\u003eAberrant repair and fibrosis development in skeletal muscle.\u003c/em\u003e Skeletal muscle, 2011. \u003cstrong\u003e1\u003c/strong\u003e: p. 1-20.\u003c/li\u003e\n\u003cli\u003eAoki, N., et al., \u003cem\u003eIdentification and characterization of microvesicles secreted by 3T3-L1 adipocytes: redox-and hormone-dependent induction of milk fat globule-epidermal growth factor 8-associated microvesicles.\u003c/em\u003e Endocrinology, 2007. \u003cstrong\u003e148\u003c/strong\u003e(8): p. 3850-3862.\u003c/li\u003e\n\u003cli\u003ePrisk, V. and J. Huard, \u003cem\u003eMuscle injuries and repair: the role of prostaglandins and inflammation.\u003c/em\u003e Histology and histopathology, 2003.\u003c/li\u003e\n\u003cli\u003eMadden, L., et al., \u003cem\u003eBioengineered human myobundles mimic clinical responses of skeletal muscle to drugs.\u003c/em\u003e elife, 2015. \u003cstrong\u003e4\u003c/strong\u003e: p. e04885.\u003c/li\u003e\n\u003cli\u003eMaimaiti, D., et al., \u003cem\u003eExtracellular matrix-mimicking cryogels composed of methacrylated fucoidan enhance vascularized skeletal muscle regeneration following volumetric muscle loss.\u003c/em\u003e International Journal of Biological Macromolecules, 2024. \u003cstrong\u003e283\u003c/strong\u003e: p. 137122.\u003c/li\u003e\n\u003cli\u003eLi, C.-H., et al., \u003cem\u003eThe production of fat-containing cultured meat by stacking aligned muscle layers and adipose layers formed from gelatin-soymilk scaffold.\u003c/em\u003e Frontiers in Bioengineering and Biotechnology, 2022. \u003cstrong\u003e10\u003c/strong\u003e: p. 875069.\u003c/li\u003e\n\u003cli\u003eYazid, N.S.M., et al., \u003cem\u003eApplication of starch and starch-based products in food industry.\u003c/em\u003e Journal of Science and Technology, 2018. \u003cstrong\u003e10\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eNeznakomova, M. and N. Todorov, \u003cem\u003eMaterials with potentially bioactive properties-preparation and characterization of electrospun poly (vinyl alcohol)/beeswax fiber web.\u003c/em\u003e Zastita Materijala, 2015. \u003cstrong\u003e56\u003c/strong\u003e(2): p. 165-174.\u003c/li\u003e\n\u003cli\u003eManivannan, K., G. Jaganathan, and M.A. Sithique, \u003cem\u003eNovel beeswax-chitosan/Zinc-hydroxyapatite biocomposite porous scaffolds: Preparation and biological evaluation.\u003c/em\u003e Journal of Science: Advanced Materials and Devices, 2021. \u003cstrong\u003e6\u003c/strong\u003e(2): p. 197-201.\u003c/li\u003e\n\u003cli\u003eZou, J., et al., \u003cem\u003eBeeswax-inspired superhydrophobic electrospun membranes for peritendinous anti-adhesion.\u003c/em\u003e Materials Science and Engineering: C, 2020. \u003cstrong\u003e116\u003c/strong\u003e: p. 111166.\u003c/li\u003e\n\u003cli\u003eBrito-Pereira, R., et al., \u003cem\u003eBeeswax multifunctional composites with thermal-healing capability and recyclability.\u003c/em\u003e Chemical Engineering Journal, 2023. \u003cstrong\u003e453\u003c/strong\u003e: p. 139840.\u003c/li\u003e\n\u003cli\u003eSanyal, A., et al., \u003cem\u003eRevolutionizing the use of honeybee products in healthcare: a focused review on using bee pollen as a potential adjunct material for biomaterial functionalization.\u003c/em\u003e Journal of Functional Biomaterials, 2023. \u003cstrong\u003e14\u003c/strong\u003e(7): p. 352.\u003c/li\u003e\n\u003cli\u003eSaretzky, I. and M. Cassini, \u003cem\u003eEnhancing Skin Cicatrization with Natural Sources\u0026ndash;The Role of Polyunsaturated Fatty Acids (PUFAs) and Beeswax\u003c/em\u003e, in \u003cem\u003eCosmetic Products and Industry-New Advances and Applications\u003c/em\u003e. 2023, IntechOpen.\u003c/li\u003e\n\u003cli\u003eZuo, Y., et al., \u003cem\u003eMicrofluidic-based generation of functional microfibers for biomimetic complex tissue construction.\u003c/em\u003e Acta biomaterialia, 2016. \u003cstrong\u003e38\u003c/strong\u003e: p. 153-162.\u003c/li\u003e\n\u003cli\u003eKook, Y.-M., et al., \u003cem\u003eDesign of biomimetic cellular scaffolds for co-culture system and their application.\u003c/em\u003e Journal of tissue engineering, 2017. \u003cstrong\u003e8\u003c/strong\u003e: p. 2041731417724640.\u003c/li\u003e\n\u003cli\u003eYılmaz, M.T., M. Karakaya, and N. Aktaş, \u003cem\u003eComposition and thermal properties of cattle fats.\u003c/em\u003e European Journal of Lipid Science and Technology, 2010. \u003cstrong\u003e112\u003c/strong\u003e(3): p. 410-416.\u003c/li\u003e\n\u003cli\u003eLiu, H., et al., \u003cem\u003eThe interaction between a combined knitted silk scaffold and microporous silk sponge with human mesenchymal stem cells for ligament tissue engineering.\u003c/em\u003e Biomaterials, 2008. \u003cstrong\u003e29\u003c/strong\u003e(6): p. 662-674.\u003c/li\u003e\n\u003cli\u003eGru\u0026scaron;kienė, R., et al., \u003cem\u003eFucoidan as a carrier of antimicrobial peptide: Preparation and characterization of nisin-loaded particles.\u003c/em\u003e Lwt, 2024. \u003cstrong\u003e191\u003c/strong\u003e: p. 115598.\u003c/li\u003e\n\u003cli\u003eBen-Arye, T. and S. Levenberg, \u003cem\u003eTissue engineering for clean meat production.\u003c/em\u003e Frontiers in Sustainable Food Systems, 2019. \u003cstrong\u003e3\u003c/strong\u003e: p. 46.\u003c/li\u003e\n\u003cli\u003eManz, B.N. and J.T. Groves, \u003cem\u003eSpatial organization and signal transduction at intercellular junctions.\u003c/em\u003e Nature Reviews Molecular Cell Biology, 2010. \u003cstrong\u003e11\u003c/strong\u003e(5): p. 342-352.\u003c/li\u003e\n\u003cli\u003eKim, K.-J., O.-H. Lee, and B.-Y. Lee, \u003cem\u003eLow-molecular-weight fucoidan regulates myogenic differentiation through the mitogen-activated protein kinase pathway in C2C12 cells.\u003c/em\u003e British journal of nutrition, 2011. \u003cstrong\u003e106\u003c/strong\u003e(12): p. 1836-1844.\u003c/li\u003e\n\u003cli\u003eCrum-Cianflone, N.F., \u003cem\u003eBacterial, fungal, parasitic, and viral myositis.\u003c/em\u003e Clinical microbiology reviews, 2008. \u003cstrong\u003e21\u003c/strong\u003e(3): p. 473-494.\u003c/li\u003e\n\u003cli\u003eJain, A. and R. Bansal, \u003cem\u003eApplications of regenerative medicine in organ transplantation.\u003c/em\u003e Journal of pharmacy and bioallied sciences, 2015. \u003cstrong\u003e7\u003c/strong\u003e(3): p. 188-194.\u003c/li\u003e\n\u003cli\u003eMomany, F.A., et al., \u003cem\u003eStructural characterization of \u0026alpha;-zein.\u003c/em\u003e Journal of agricultural and food chemistry, 2006. \u003cstrong\u003e54\u003c/strong\u003e(2): p. 543-547.\u003c/li\u003e\n\u003cli\u003eAlencar, G.F., et al., \u003cem\u003eStem cell pluripotency genes Klf4 and Oct4 regulate complex SMC phenotypic changes critical in late-stage atherosclerotic lesion pathogenesis.\u003c/em\u003e Circulation, 2020. \u003cstrong\u003e142\u003c/strong\u003e(21): p. 2045-2059.\u003c/li\u003e\n\u003cli\u003eMilanović, J.K., et al., \u003cem\u003eBlend of natural waxes as a matrix for aroma encapsulation.\u003c/em\u003e Facta Universitatis, Series: Physics, Chemistry and Technology, 2018. \u003cstrong\u003e15\u003c/strong\u003e(2): p. 103-111.\u003c/li\u003e\n\u003cli\u003eDzobo, K., et al., \u003cem\u003eAdvances in regenerative medicine and tissue engineering: innovation and transformation of medicine.\u003c/em\u003e Stem cells international, 2018. \u003cstrong\u003e2018\u003c/strong\u003e(1): p. 2495848.\u003c/li\u003e\n\u003cli\u003eGenovese, P.C., \u003cem\u003eIn Vitro and In Vivo Evaluation of Mesenchymal Stem Cell Spheroids for Skeletal Muscle Regeneration Following Trauma\u003c/em\u003e. 2021, Saint Louis University.\u003c/li\u003e\n\u003cli\u003eSingh, P., et al., \u003cem\u003eUnveiling the potential of starch-blended biodegradable polymers for substantializing the eco-friendly innovations.\u003c/em\u003e Journal of Agriculture and Food Research, 2024. \u003cstrong\u003e15\u003c/strong\u003e: p. 101065.\u003c/li\u003e\n\u003cli\u003eLander, A.D., \u003cem\u003eHow cells know where they are.\u003c/em\u003e Science, 2013. \u003cstrong\u003e339\u003c/strong\u003e(6122): p. 923-927.\u003c/li\u003e\n\u003cli\u003eHata, H., et al., \u003cem\u003eGrafted skeletal myoblast sheets attenuate myocardial remodeling in pacing-induced canine heart failure model.\u003c/em\u003e The Journal of thoracic and cardiovascular surgery, 2006. \u003cstrong\u003e132\u003c/strong\u003e(4): p. 918-924.\u003c/li\u003e\n\u003cli\u003eAbulateefeh, S.R., et al., \u003cem\u003eSynthesis and characterization of new derivatives of alginic acid and evaluation of their iron (III)-crosslinked beads as potential controlled release matrices.\u003c/em\u003e Pharmaceutical Development and Technology, 2014. \u003cstrong\u003e19\u003c/strong\u003e(7): p. 856-867.\u003c/li\u003e\n\u003cli\u003eChazaud, B., et al., \u003cem\u003eDual and beneficial roles of macrophages during skeletal muscle regeneration.\u003c/em\u003e Exercise and sport sciences reviews, 2009. \u003cstrong\u003e37\u003c/strong\u003e(1): p. 18-22.\u003c/li\u003e\n\u003cli\u003eHalldorsson, S., et al., \u003cem\u003eAdvantages and challenges of microfluidic cell culture in polydimethylsiloxane devices.\u003c/em\u003e Biosensors and Bioelectronics, 2015. \u003cstrong\u003e63\u003c/strong\u003e: p. 218-231.\u003c/li\u003e\n\u003cli\u003eDavid, S., et al., \u003cem\u003eCo-culture approaches for cultivated meat production.\u003c/em\u003e Nature Reviews Bioengineering, 2023. \u003cstrong\u003e1\u003c/strong\u003e(11): p. 817-831.\u003c/li\u003e\n\u003cli\u003eMartins, B., et al., \u003cem\u003eAdvances and challenges in cell biology for cultured meat.\u003c/em\u003e Annual review of animal biosciences, 2024. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 345-368.\u003c/li\u003e\n\u003cli\u003ePierezan, M.D. and S. Verruck, \u003cem\u003eCattle, swine, poultry and fish cells for meat production: addressing challenges of co-culture and the innovative approaches for muscle and fat integration.\u003c/em\u003e Current Opinion in Food Science, 2024: p. 101230.\u003c/li\u003e\n\u003cli\u003eGrabiec, K., et al., \u003cem\u003eInterleukin-1\u0026beta; stimulates early myogenesis of mouse C2C12 myoblasts: the impact on myogenic regulatory factors, extracellular matrix components, IGF binding proteins and protein kinases.\u003c/em\u003e Polish Journal of Veterinary Sciences, 2013(2).\u003c/li\u003e\n\u003cli\u003eRosellini, E. and M.G. Cascone, \u003cem\u003eMicrofluidic fabrication of natural polymer-based scaffolds for tissue engineering applications: a review.\u003c/em\u003e Biomimetics, 2023. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 74.\u003c/li\u003e\n\u003cli\u003eSari, M., et al., \u003cem\u003ePorous carbonated hydroxyapatite-based paraffin wax nanocomposite scaffold for bone tissue engineering: A physicochemical properties and cell viability assay analysis.\u003c/em\u003e Coatings, 2021. \u003cstrong\u003e11\u003c/strong\u003e(10): p. 1189.\u003c/li\u003e\n\u003cli\u003eZhang, Y., et al., \u003cem\u003eLipid biomarker evidence for determining the origin and distribution of organic matter in surface sediments of Lake Taihu, Eastern China.\u003c/em\u003e Ecological Indicators, 2017. \u003cstrong\u003e77\u003c/strong\u003e: p. 397-408.\u003c/li\u003e\n\u003cli\u003eDib, N., et al., \u003cem\u003eSafety and feasibility of autologous myoblast transplantation in patients with ischemic cardiomyopathy: four-year follow-up.\u003c/em\u003e Circulation, 2005. \u003cstrong\u003e112\u003c/strong\u003e(12): p. 1748-1755.\u003c/li\u003e\n\u003cli\u003eBaluska, F., et al., \u003cem\u003eCytoskeleton-plasma membrane-cell wall continuum in plants. Emerging links revisited.\u003c/em\u003e Plant physiology, 2003. \u003cstrong\u003e133\u003c/strong\u003e(2): p. 482-491.\u003c/li\u003e\n\u003cli\u003eHaggag, Y.A., et al., \u003cem\u003eFucoidan in pharmaceutical formulations: a comprehensive review for smart drug delivery systems.\u003c/em\u003e Marine Drugs, 2023. \u003cstrong\u003e21\u003c/strong\u003e(2): p. 112.\u003c/li\u003e\n\u003cli\u003eCarvalho, D.N., et al., \u003cem\u003eMarine collagen-chitosan-fucoidan cryogels as cell-laden biocomposites envisaging tissue engineering.\u003c/em\u003e Biomedical Materials, 2020. \u003cstrong\u003e15\u003c/strong\u003e(5): p. 055030.\u003c/li\u003e\n\u003cli\u003eMertens, J.P., et al., \u003cem\u003eEngineering muscle constructs for the creation of functional engineered musculoskeletal tissue.\u003c/em\u003e Regenerative medicine, 2014. \u003cstrong\u003e9\u003c/strong\u003e(1): p. 89-100.\u003c/li\u003e\n\u003cli\u003eSahebalzamani, M., et al., \u003cem\u003eAdvancing bone tissue engineering one layer at a time: a layer-by-layer assembly approach to 3D bone scaffold materials.\u003c/em\u003e Biomaterials Science, 2022. \u003cstrong\u003e10\u003c/strong\u003e(11): p. 2734-2758.\u003c/li\u003e\n\u003cli\u003eLiu, X., et al., \u003cem\u003eRecent advances in layer-by-layer assembly scaffolds for co-delivery of bioactive molecules for bone regeneration: an updated review.\u003c/em\u003e Journal of Translational Medicine, 2024. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 1001.\u003c/li\u003e\n\u003cli\u003eBorges, J., et al., \u003cem\u003eRecent developments in layer\u003c/em\u003e\u003cem\u003e‐by\u003c/em\u003e\u003cem\u003e‐layer assembly for drug delivery and tissue engineering applications.\u003c/em\u003e Advanced Healthcare Materials, 2024. \u003cstrong\u003e13\u003c/strong\u003e(8): p. 2302713.\u003c/li\u003e\n\u003cli\u003eFunakoshi, T., et al., \u003cem\u003eApplication of tissue engineering techniques for rotator cuff regeneration using a chitosan-based hyaluronan hybrid fiber scaffold.\u003c/em\u003e The American journal of sports medicine, 2005. \u003cstrong\u003e33\u003c/strong\u003e(8): p. 1193-1201.\u003c/li\u003e\n\u003cli\u003eLee, S.-H. and J. Choi, \u003cem\u003eThree-dimensional scaffolds, materials, and fabrication for cultured meat applications: A scoping review and future direction.\u003c/em\u003e Food Hydrocolloids, 2024. \u003cstrong\u003e152\u003c/strong\u003e: p. 109881.\u003c/li\u003e\n\u003cli\u003eWang, Y., et al., \u003cem\u003eAn overview of recent progress in engineering three-dimensional scaffolds for cultured meat production.\u003c/em\u003e Foods, 2023. \u003cstrong\u003e12\u003c/strong\u003e(13): p. 2614.\u003c/li\u003e\n\u003cli\u003eSeah, J.S.H., et al., \u003cem\u003eScaffolds for the manufacture of cultured meat.\u003c/em\u003e Critical Reviews in Biotechnology, 2022. \u003cstrong\u003e42\u003c/strong\u003e(2): p. 311-323.\u003c/li\u003e\n\u003cli\u003eGholobova, D., et al., \u003cem\u003eVascularization of tissue-engineered skeletal muscle constructs.\u003c/em\u003e Biomaterials, 2020. \u003cstrong\u003e235\u003c/strong\u003e: p. 119708.\u003c/li\u003e\n\u003cli\u003eNovosel, E.C., C. Kleinhans, and P.J. Kluger, \u003cem\u003eVascularization is the key challenge in tissue engineering.\u003c/em\u003e Advanced drug delivery reviews, 2011. \u003cstrong\u003e63\u003c/strong\u003e(4-5): p. 300-311.\u003c/li\u003e\n\u003cli\u003eBramfeld, H., et al., \u003cem\u003eScaffold vascularization: a challenge for three-dimensional tissue engineering.\u003c/em\u003e Current medicinal chemistry, 2010. \u003cstrong\u003e17\u003c/strong\u003e(33): p. 3944-3967.\u003c/li\u003e\n\u003cli\u003eSantos, M.I. and R.L. Reis, \u003cem\u003eVascularization in bone tissue engineering: physiology, current strategies, major hurdles and future challenges.\u003c/em\u003e Macromolecular bioscience, 2010. \u003cstrong\u003e10\u003c/strong\u003e(1): p. 12-27.\u003c/li\u003e\n\u003cli\u003eBian, W. and N. Bursac, \u003cem\u003eEngineered skeletal muscle tissue networks with controllable architecture.\u003c/em\u003e Biomaterials, 2009. \u003cstrong\u003e30\u003c/strong\u003e(7): p. 1401-1412.\u003c/li\u003e\n\u003cli\u003eKoning, M., et al., \u003cem\u003eCurrent opportunities and challenges in skeletal muscle tissue engineering.\u003c/em\u003e Journal of tissue engineering and regenerative medicine, 2009. \u003cstrong\u003e3\u003c/strong\u003e(6): p. 407-415.\u003c/li\u003e\n\u003cli\u003eGuex, A., et al., \u003cem\u003eFine-tuning of substrate architecture and surface chemistry promotes muscle tissue development.\u003c/em\u003e Acta biomaterialia, 2012. \u003cstrong\u003e8\u003c/strong\u003e(4): p. 1481-1489.\u003c/li\u003e\n\u003cli\u003eGoers, L., P. Freemont, and K.M. Polizzi, \u003cem\u003eCo-culture systems and technologies: taking synthetic biology to the next level.\u003c/em\u003e Journal of The Royal Society Interface, 2014. \u003cstrong\u003e11\u003c/strong\u003e(96): p. 20140065.\u003c/li\u003e\n\u003cli\u003eYılmaz, M.T. and M. Karakaya, \u003cem\u003eDifferential scanning calorimetry analysis of goat fats: comparison of chemical composition and thermal properties.\u003c/em\u003e Journal of the American Oil Chemists\u0026apos; Society, 2009. \u003cstrong\u003e86\u003c/strong\u003e(9): p. 877-883.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"alginate hydrogel, beeswax, C2C12 myoblasts, culture meat, fucoidan, fibroblast, indirect co-culture","lastPublishedDoi":"10.21203/rs.3.rs-7863529/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7863529/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe co-culture of multiple cell types is critical for replicating native muscle complexity in cultured meat production. However, nutrient competition and divergent signaling among cell populations pose major challenges to in vitro tissue formation. This study investigates fucoidan (Fu) and beeswax-based alginate hydrogels (Bw/Algi) as potential scaffolds to address two key challenges: creating a supportive environment for multiple relevant cell types and promoting the formation of muscle-like tissue. We present an indirect 2D and 3D co-culture of C2C12 myoblasts, human endothelial cells (HECs), and mouse embryonic fibroblasts (MEFs), supported by Bw/Algi and Fu/Algi hydrogels. The Bw/Algi hydrogel supported cell adhesion with a pore size increased to 77.57% \u0026plusmn; 7.88 versus 54.16% \u0026plusmn; 4.64 in Bw. C2C12 cells reached confluency within five days without cytotoxicity. The Fu/Algi hydrogel (20 \u0026micro;g/mL Fu) supported 3D myogenic differentiation, myotube formation (area: 1,494,119 \u0026micro;m\u0026sup2; \u0026plusmn; 404; length: 20,723.01 \u0026micro;m\u0026thinsp;\u0026plusmn;\u0026thinsp;68). The engineered tissue had 9.825% protein versus 15.875% in native muscle. Thermal analysis confirmed structure retention during cooking. This co-culture system provides a promising platform for functional muscle-like tissue development in cultured meat. While the present study employs well-established model cell lines (C2C12, MEFs, and HECs), these results provide foundational insights into scaffold performance that will guide future validation with primary cells derived from edible species.\u003c/p\u003e","manuscriptTitle":"Engineering multiple Cell Co-Culture System with Fucoidan and Beeswax Hydrogels for Cultured Meat Applications","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-29 10:52:24","doi":"10.21203/rs.3.rs-7863529/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"597e7176-d09f-4106-9bc7-4d5ab4eb2f21","owner":[],"postedDate":"January 29th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":61922907,"name":"Biological sciences/Biological techniques"},{"id":61922908,"name":"Biological sciences/Biotechnology"},{"id":61922909,"name":"Biological sciences/Cell biology"},{"id":61922910,"name":"Physical sciences/Materials science"},{"id":61922911,"name":"Biological sciences/Stem cells"}],"tags":[],"updatedAt":"2026-04-01T09:28:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-29 10:52:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7863529","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7863529","identity":"rs-7863529","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.