Development of Amino Acid Metabolism-Related Prognostic Model and Immune Infiltration Analysis in Patients with Stomach Adenocarcinoma

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Stomach adenocarcinoma (STAD) is a major contributor to cancer mortality worldwide. Alterations in amino acid metabolism have been reported in various tumors. However, the prognostic value of amino acid metabolism-related genes in STAD deserves to be further elucidated. In this study, we constructed a prognostic risk model consisting of 3 amino acid metabolism-related genes (SERPINE1, NRP1, MATN3) in STAD. Based on the median risk score, STAD patients were divided into high- and low-risk groups. The patients with high-risk scores had a worse prognosis. A nomogram consisting of risk score and various clinical characteristics accurately predicted the 1-, 3-, and 5-year survival time of STAD patients. Notably, KEGG pathway enrichment analysis indicated immune-related pathways enriched in the high-risk group. High-risk scores were significantly related to C6 (TGF-β dominant type), while low-risk scores were significantly related to C4 (lymphocyte-depleted type). The higher risk score was associated with higher immune infiltration, immune-related function, lower tumor purity and worse response to immunotherapy. In addition, the model genes were correlated with antitumor drug sensitivity. Finally, functional assays confirmed that interference of model gene MATN3 inhibited the proliferation and migration of STAD cells. In conclusion, the amino acid metabolism-related prognostic model might be used as a biomarker to predict the prognosis and guide immunotherapy for STAD patients.
Full text 178,075 characters · extracted from preprint-html · click to expand
Development of Amino Acid Metabolism-Related Prognostic Model and Immune Infiltration Analysis in Patients with Stomach Adenocarcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of Amino Acid Metabolism-Related Prognostic Model and Immune Infiltration Analysis in Patients with Stomach Adenocarcinoma Wenjun Zhu, Min Fu, Qianxia Li, Xin Chen, Xiaoyu Li, Na Luo, Wenhua Tang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2754183/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Stomach adenocarcinoma (STAD) is a major contributor to cancer mortality worldwide. Alterations in amino acid metabolism have been reported in various tumors. However, the prognostic value of amino acid metabolism-related genes in STAD deserves to be further elucidated. In this study, we constructed a prognostic risk model consisting of 3 amino acid metabolism-related genes (SERPINE1, NRP1, MATN3) in STAD. Based on the median risk score, STAD patients were divided into high- and low-risk groups. The patients with high-risk scores had a worse prognosis. A nomogram consisting of risk score and various clinical characteristics accurately predicted the 1-, 3-, and 5-year survival time of STAD patients. Notably, KEGG pathway enrichment analysis indicated immune-related pathways enriched in the high-risk group. High-risk scores were significantly related to C6 (TGF-β dominant type), while low-risk scores were significantly related to C4 (lymphocyte-depleted type). The higher risk score was associated with higher immune infiltration, immune-related function, lower tumor purity and worse response to immunotherapy. In addition, the model genes were correlated with antitumor drug sensitivity. Finally, functional assays confirmed that interference of model gene MATN3 inhibited the proliferation and migration of STAD cells. In conclusion, the amino acid metabolism-related prognostic model might be used as a biomarker to predict the prognosis and guide immunotherapy for STAD patients. Bioinformatics Amino acid metabolism Stomach adenocarcinoma Prognosis Immunity Drug sensitivity MATN3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction According to the Global Cancer Statistics 2020, the incidence of gastric cancer ranked fifth and mortality ranked third worldwide, with over 1 million new cases and about 769,000 deaths in 2020 [ 1 ] . Despite the diagnosis and treatment of gastric cancer having made great progress in recent decades, a lot of patients still failed to be diagnosed until advanced stages, with a 5-year survival rate of around 30%, while it reaches 60% in the early-to-middle stage patients [ 2 , 3 ] , hence it is an urgent need for sensitive biomarkers for early diagnosis and prognostic prediction. Amino acids, the basic units of proteins, are involved in energy production, hormones and neurotransmitters generation, and methylation [ 4 ] . In the late 1930s, Wargurg first discovered the phenomenon of glucose metabolism reprogramming in tumor cells, namely the Warburg effect, which opened up a new direction for the study of tumor development from the perspective of metabolism [ 5 ] . The in-depth study of tumor metabolism found that tumor cells usually reprogram substance and energy metabolism to meet the energy demand of proliferation [ 6 ] . In addition to glucose metabolism providing energy for tumor cells proliferation, amino acid metabolism reprogramming also plays a crucial role in tumor growth. Amino acid metabolic reprogramming refers to the abnormal process of amino acid uptake rate, metabolites, metabolic key enzymes or amino acid metabolic pathway in tumor cells [ 7 ] . In recent years, more and more studies have focused on the amino acid metabolism of tumors, including stomach cancer, colon cancer, hepatocellular carcinoma, kidney clear cell carcinoma, breast cancer, ovarian cancer, etc [ 7 – 12 ] . Amino acids promote cancer cells survival and proliferation under oxidative, genotoxic, and nutritional stress [ 13 ] . Therefore, targeting amino acid metabolism is emerging as a potential therapeutic measure for cancer patients. In stomach cancer, various amino acids metabolism is abnormal. The levels of L-glutamine, L-isoleucine and serine were elevated in gastric cancer tissue compared to non-malignant tissue, and higher levels of L-cysteine and L-tyrosine were detected in the invasive (T3 and T4) gastric cancers than non-invasive (T1 and T2) cancers [ 14 ] . The activation of kynurenine pathway in tryptophan metabolism was reported in gastric cancer and kynurenic acid in gastric juice and serum might serve as a biomarker for gastric cancer [ 15 ] . Aromatic amino acids in gastric juice could serve as potential diagnostic biomarkers to monitor gastric malignancies [ 16 ] . Proline and serine metabolisms played an important role in gastric cancer metastasis [ 17 ] . Significantly higher levels of amino acids (e.g., alanine, glycolate, arginine, methionine, phenylalanine, glycine, and tyrosine) were excreted in GC patients urine and the levels of alanine, phenylacetylglycine, arginine and glycine increased significantly with T stage [ 18 ] . Changes in amino acid metabolism in gastric cancer have been supported by many studies, but the mechanism remains unclear. Alanine-serine,-cysteine transporter 2 (SLC1A5; ASCT2), the main glutamine transporter, determines intracellular glutamine level [ 19 ] . Knockdown of SLC1A5 in gastric cancer cells suppressed cell proliferation, migration and invasion partly by inactivated mTOR/p-70S6K1 signaling pathway and also inhibited the relative volume of xenografted tumor in vivo [ 20 ] . Cai et al. also found lactate dehydrogenase A (LDH-A) downregulation and pyruvate dehydrogenase B (PDH-B) overexpression could inhibit gastric cancer cell growth and migration by forcing pyruvate into the Krebs cycle instead of the glycolysis process [ 21 ] . Furthermore, amino acid metabolism has also been reported to play an important role in the regulation of tumor immunity [ 22 – 25 ] . Immune cells have specific requirements for amino acid. The activation of CD8 + T cells in the presence of interleukin (IL)-2 resulted in increased cell surface densities of Slc1a5 and Slc7a5 [ 26 ] . Glutamine is necessary for T cell activation, as T cells cannot proliferate and produce IL-2 or IFN-γ when cultured without glutamine [ 27 ] . Myc-dependent natural killer cell activation induced by IL-2/IL-12 requires Slc7a5-mediated glutamine uptake [ 28 ] . Lipopolysaccharide supports cytokine production in proinflammatory macrophages by increasing Slc7a5 expression and leucine uptake [ 29 ] . Gls1 deficiency impairs the differentiation of Th17 cell through limiting αKG supply [ 30 ] . Thus, targeting amino acid metabolism might be helpful to guide the immunotherapy and improve existing therapeutic methods. Based on the importance of amino acid metabolism in tumor development and immunity, in this paper, we focused on the role of amino acid metabolism-related genes in STAD and its involvement in tumor immunity to provide potential biomarkers for prognostic prediction, guide for immunotherapy and develop new therapeutic targets for further breakthroughs in the field of amino acid metabolism in STAD. Material And Methods 2.1. Data Collection We downloaded transcriptomic gene expression data and corresponding clinical information of 380 patients with STAD (Table 1 ) from the TCGA database ( https://portal.gdc.cancer.gov/ ) [ 31 ] . The data were from STAD patients after primary surgical resection (patients with missing clinical data were excluded). The gene expression data (GSE84433 series matrix) and corresponding clinical information of 357 patients with STAD from the GEO database ( https://www.ncbi.nlm.nih.gov ) were employed to perform model validation [ 32 ] . The samples in this study were initial STAD after primary surgical resection (samples with missing clinical information were excluded). The flowchart of the data analysis was shown in Fig. 1 . Table 1 Clinical characteristics of STAD patients in the TCGA database. Characteristics Total % All 380 100.00 Age (y) ≥ 65 218 57.37 < 65 162 42.63 Gender Male 239 62.89 Female 141 37.11 Grade G1 8 2.11 G2 129 33.95 G3 243 63.95 Stage I 50 13.16 II 120 31.58 III 169 44.47 IV 41 10.79 T stage T1 18 4.74 T2 77 20.26 T3 180 47.37 T4 105 27.63 M stage M0 353 92.89 M1 27 7.11 N stage N0 122 32.11 N1 100 26.32 N2 79 20.79 N3 79 20.79 Table 2. Multivariate Cox regression analysis results of model genes. Gene Coef HR HR.95L HR.95H P value SERPINE1 0.0224577911629626 1.199456 1.094436 1.314553 0.0001 NRP1 0.0463621851393052 1.970686 1.412392 2.749666 6.56E-05 MATN3 0.0531597548577127 1.883591 1.396202 2.541119 3.40E-05 2.2. Acquisition of Differentially Expressed Amino Acid Metabolism Genes (DEAAMGs) Amino acid metabolism-related genes were extracted from GSEA ( http://www.gsea-msigdb.org/gsea/index.jsp ) [ 33 ] . To obtain differentially expressed amino acid metabolism-related genes, we employed the “bioconductor limma” R package to analyze the STAD tumor tissues and normal gastric tissues. The fold change > 0.5 and false discovery rate < 0.05 were considered as the criteria for DEAAMGs. 2.3. Construction and Validation of Amino Acid Metabolism Genes-Related Prognostic Model We used the LASSO regression analysis method to construct the best prognostic model [ 34 ] . Univariate cox regression analysis was used to screen for DEAAMGs related to OS through the “survival” R package. P < 0.05 was a criterion for the prognosis-related gene. Then, we used the LASSO algorithm to avoid overfitting the model and screen out the optimal prognostic genes for constructing the amino acid metabolism-related prognostic model. The risk score in the model is the sum of the expression of each prognosis-related gene, multiplied by the corresponding regression coefficient. All STAD patients in TCGA were divided into high- and low-risk groups according to the median risk score. Next, we performed PCA and t-SNE analysis to investigate the distribution of patients in the high- and low-risk groups using “ggplot2” and “Rtsne” R packages. KM analysis was used to analyze the OS between the high- and low-risk groups. Furthermore, a nomogram comprised age, gender, grade, stage and risk score was plotted using “regplot” and “rms” R packages. The calibration curve was used to detect the predictive accuracy of the nomogram. The relationship of risk score with tumor grade and stage was analyzed using Spearman correlation analysis. 2.4. Functional Enrichment Analysis To further investigate the potential mechanism of model genes affecting the prognosis of STAD patients, we performed Kyoto Gene and Genome Encyclopedia (KEGG) pathway enrichment analysis by GSEA 4.1.0 software [ 33 ] . Firstly, we downloaded “c2.cp.kegg.v7.1.symbols.gmt” set from Molecular Signatures Database. Then, we used “GSEA” software to analyze the enriched pathways in the high- and low-risk groups. The “ggplot2” R package was applied to visualize the top 5 significantly enriched biological pathways in the high- and low-risk groups. The pathways at p < 0.05 were considered statistically significant. 2.5. Immune Infiltration Analysis We applied the “GSVA” R package for single sample genomic enrichment analysis (ssGSEA) to analyze the immune cell infiltration and immune-related function [ 35 ] . A box plot was drawn to visualize the differences in the immune infiltration subtypes between high- and low-risk groups. 2-way ANOVA analysis was used to test the relationship between risk score and immune infiltration subtypes. In addition, we used Spearman correlation analysis to determine the correlation of risk scores with immune cell scores, stromal cell scores, ESTIMATE scores and tumor purity [ 36 ] . 2.6. Immunotherapy Response Evaluation and Model Comparison To further investigate the efficacy of our prognostic risk model for assessing immunotherapy response, we analyzed immunotherapy biomarkers based on the TCGA data. We uploaded TCGA sample expression profiles to the TIDE database ( http://tide.dfci.harvard.edu/ ) to obtain dysfunction, exclusion, TIDE, and microsatellite instability (MSI) scores for each sample [ 37 ] . Next, we used the ROC curve to compare the predictive efficacy of the risk score with the TIDE and tumor inflammatory marker (TIS) score [ 38 ] . 2.7. Drug Sensitivity Analysis We downloaded transcriptomic gene expression data and FDA-certified drug sensitivity data from the CellMiner database ( https://discover.nci.nih.gov/cellminer/ ) and used Pearson correlation analysis to investigate the correlation of the sensitivity of 216 FDA-certified drugs (Supplementary Table 1) with prognosis-related gene expression. 2.8. Cell Culture and siRNA Treatment Gastric mucosal epithelial cells (GES1), STAD cells (AGS, MKN45, BGC-823, SNU-216, MGC-803, SGC-7901, N87 and HGC-27) were from the American Type Culture Collection (Manassas, VA, USA). Lipofectamine 3000 (Invitrogen, California, USA) was used to transfect MATN3 siRNA (RiboBio, Guangzhou, China) into cells. 2.9. WB Analysis We extracted proteins from BGC-823 and AGS cells using RIPA lysis buffer (Servicebio, China) and separated the protein samples using 10% SDS-polyacrylamide gel electrophoresis [ 39 ] . Then we transferred the protein to polyvinylidene fluoride membranes. After being blocked with skim milk, membranes were incubated overnight at 4°C with the following primary antibodies: MATN3 (Abclonal, China), GAPDH (Proteintech, USA), then followed by the secondary antibody at 25°C for 1 hour. Finally, the proteins were detected by West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, USA). 2.10. qRT-PCR TRIzol reagent (TaKaRa, Japan) was used to extract cellular RNA. Hi Script II QRT SuperMix (Vazyme, China) was employed to synthesize cDNA, then qRT-RCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). The primers were as follows: MATN3-Forward: ACATGGCGTCCCTCAAGATG; MATN3-Reverse: GCACAGAAGGTTTCCTGGAATC; GAPDH-Forward: GACCACAGTCCATGCCATCA; GAPDH-Reverse: GTCAAAGGTGGAGGAGTGGG. 2.11. CCK8 and Colony Formation Assays After being transfected with MATN3 siRNA for 48 h, BGC-823 and AGS cells were seeded into 96-well plates. Then we added the CCK8 reagent (MCE, USA) according to the manufacturer's instructions and detected the OD450 values using a microplate reader (BioTek, USA). For colony formation assay, BGC-823 and AGS cells were inoculated in 6-well plates and cultured for 2 weeks, and the number of cell clones per well was counted after crystalline violet staining. 2.12. Wound Healing Assay BGC-823 and AGS cells were seeded into a 24-well-plate and then scraped with a 10 µl pipette tip. Images of cell migration were captured at 0, 24, and 48 hours after scratching. 2.13. Transwell Migration Assay Cells were cultured in the upper chamber with 200 µl medium without serum, and the lower chamber was added to 500 µl medium containing 20% fetal bovine serum. After incubation for 24 h at 37°, the cells in the lower chamber were fixed with methanol and stained with 1% crystal violet, and then the cells were counted with light microscopy. 2.14. Statistical Analysis The gene differences between tumor tissue and normal tissue were analyzed by the Wilcoxon test. R software (version 4.0.4) and GraphPad Prism 7 software (version 7.0) were used to perform the statistical analysis. P < 0.05 was considered statistically significant. Results 3.1. Acquisition of Differentially Expressed Amino Acid Metabolism Genes (DEAAMGs) related to OS in TCGA Cohort Differential expression analysis of the gene expression and clinical data in the TCGA cohort identified a total of 2495 DEAAMGs between normal tissue and tumor tissue of STAD patients, including 574 down-regulated and 1921 up-regulated genes in STAD tissue (Fig. 2 , Supplementary Table 2). Next, 294 DEAAMGs were found to be related to OS by Univariate cox regression analysis, including 161 high-risk genes and 133 low-risk genes (Supplementary Table 3). 3.2. Construction of an Amino Acid Metabolism Genes-Related Prognostic Model in TCGA Cohort Through analyzing the 294 prognosis-related DEAAMGs and excluding the relatively unimportant genes from the model through LASSO Cox regression analysis, we screened 3 genes (SERPINE1, NRP1, MATN3) to develop a prognostic risk model (Fig. 3 A, B). Risk score = 0.022458 × SERPINE1 + 0.046362 × NRP1 + 0.053160 × MATN3 (Table 2). In this model, SERPINE1, NRP1 and MATN3 were indicators of the poor prognosis. The median cut-off value of risk score divided STAD patients into high-risk and low-risk groups (Fig. 3 C). The results of PCA and t-SNE analyses demonstrated that the high-risk and low-risk groups could be separated based on the expression of 3 prognostic DEAAMGs (Fig. 3 D, E). In addition, the survival status scatter plots suggested that high-risk patients were more likely to have a poor prognosis (Fig. 3 F). Similarly, KM survival analysis results also demonstrated that patients in the low-risk group had a longer OS ( p < 0.0001) (Fig. 3 G). Furthermore, we plotted a nomogram to precisely predict the prognosis for each patient according to the risk score and clinical characteristics. For example, the total points of the patient in the nomogram were 327, which represented the 1, 3 and 5-year survival rates were 75.4%, 43.4% and 31.2%, respectively (Fig. 3 H). The calibration curve showed the high predictive accuracy of the nomogram (Fig. 3 I). 3.3. Validation of the 3-Gene Prognostic Model in the GEO Cohort To test the predictive stability of this prognostic model, we downloaded transcriptomic gene expression data and clinical data of STAD patients from the GEO database as external validation. Similarly, we divided STAD patients into high- and low-risk groups based on the above median cut-off value of risk score (Fig. 4 A). PCA and t-SNE analysis revealed that the expression of the model genes could separate the high- and low-risk groups in the GEO cohort well (Fig. 4 B, C). Besides, scatter plots and KM survival analyses showed that high-risk patients were prone to have a poorer prognosis (Fig. 4 D) and shorter OS ( p < 0.001) compared to low-risk patients (Fig. 4 E). In addition, we analyzed the clinical characteristics and found that the risk scores were higher in the patients with tumor grade 3 compared to those with grade 1–2 ( p < 0.01) (Fig. 4 F), and patients with tumor stage III-IV also had higher risk scores than those with stage I-II ( p < 0.01) (Fig. 4 G). 3.4. KEGG Pathway Enrichment Analysis To explore the potential mechanism of the model genes regulating the prognosis, we used GSEA to perform the KEGG pathway enrichment analysis and found that the focal adhesion and ECM receptor interaction pathways were significantly enriched in the high-risk group, while the low-risk group was mainly enriched in the spliceosome and oxidative phosphorylation pathways (Fig. 5 A). In addition, we found that tumor-associated pathways were mainly enriched in the high-risk group, such as the MAPK signaling pathway, JAK-STAT signaling pathway and TGF-β signaling pathway (Fig. 5 B-D). Notably, we noticed 4 immune-related pathways, such as cytokine-cytokine receptor interaction, toll like receptor (TLR) signaling pathway, chemokine signaling pathway and nod like receptor signaling pathway were also significantly enriched in the high-risk group (Fig. 5 E-H), indicating that amino acid metabolism genes might be associated with the progression of STAD through regulating the immune-related pathways. 3.5. Immune Infiltration Analysis Thus, to further explore the correlation between amino acid metabolism and immune infiltration in STAD, we performed immune cell subtypes and immune-related functions analysis by ssGSEA. We found that aDCs, DCs, iDCs, pDCs, B cells, CD8 + T cells, macrophages, mast cells, neutrophils, T helper cells, Tfh, Th1 cells, TIL and Treg cells were significantly increased in the high-risk group than low-risk group ( p < 0.01) (Fig. 6 A). In addition, immune-related function analysis showed that inflammation-promoting, parainflammation, APC co-inhibition, APC co-stimulation, T cell co-inhibition, T-cell co-stimulation, CCR, check-point, cytolytic activity, HLA, Type I IFN response and Type II IFN response were significantly increased in the high-risk group than low-risk group (Fig. 6 B). There were six types of immune infiltration in human tumors, namely C1 (wound healing type), C2 (IFN-gamma dominant type), C3 (inflammatory type), C4 (lymphocyte depleted type), C5 (immunologically quiet type) and C6 (TGF-β dominant type) [ 40 ] . Among them, the STAD patients belonging to the C5 immune subtype in the TCGA dataset were not sufficient for study, therefore, we analyzed the other five immune subtypes. We found that high-risk scores were significantly related to C6, while low-risk scores were significantly related to C4 (Fig. 6 C). Furthermore, Spearman correlation analysis showed that high risk score was associated with high immune score (p < 0.0001) (Fig. 6 D), ESTIMATE score ( p < 0.0001) (Fig. 6 E), stromal score ( p < 0.0001) (Fig. 6 F), and low tumor purity ( p < 0.0001) (Fig. 6 G), suggesting that the higher immune composition and lower tumor purity predicted the poorer prognosis for STAD patients. 3.6. Immunotherapy Response Evaluation and Model Comparison Given that the risk score was related to immune cell infiltration according to the above results, we analyzed immunotherapy biomarkers based on the TCGA dataset to further investigate whether our prognostic model could be used to predict immunotherapy response. The results showed a higher dysfunction score ( p < 0 .001) (Fig. 7 A), exclusion score ( p < 0 .001) (Fig. 7 B), TIDE score ( p < 0.001) (Fig. 7 C) and a lower MSI score ( p < 0.001) (Fig. 7 D) in high-risk group, suggesting that high-risk group had a higher immune escape potential and a less benefit from immunotherapy. Furthermore, compared with the TIDE score and TIS score, our risk score had the largest area under the curve value, indicating a higher prognostic predictive efficacy than the TIDE score and TIS score (Fig. 7 E). 3.7. Drug Sensitivity Analysis To investigate the availability of our prognostic model in chemotherapy and targeted therapy, we analyzed the correlation between our model genes and FDA-approved drug sensitivity. The results demonstrated that the expression of NRP1 was positively correlated with the treatment sensitivity of dasatinib, simvastatin, idelalisib and midostaurin ( p < 0.001) (Fig. 8 ), and negatively correlated with the treatment sensitivity of tamoxifen ( p < 0.001) (Fig. 8 ). The expression of MATN3 was negatively correlated with the treatment sensitivity of eribulin mesilate, vinblastine, pipamperone, paclitaxel and vinorelbine ( p < 0.001) (Fig. 8 ) and positively correlated with the treatment sensitivity of erlotinib and dacomitinib (p < 0.001) (Fig. 8 ). SERPINE1 expression was negatively correlated with tamoxifen and nilotinib sensitivity ( p < 0.001) (Fig. 8 ), and positively correlated with simvastatin and lenvatinib sensitivity (p < 0.001) (Fig. 8 ). 3.8. Interference with MATN3 Expression Inhibits Proliferation and Migration of STAD Cells To further increase the credibility of our prognostic model, we conducted functional validation through in vitro experiments. Since previous studies have reported the role of SERPINE1 and NRP1 in promoting the proliferation and migration of gastric cancer cells, thus, we selected MATN3 for subsequent functional validation [ 41 , 42 ] . We detected the expression of MATN3 mRNA in gastric mucosal epithelial cell line GES1 and STAD cell lines AGS, BGC-823, SNU-216, MKN45, SGC-7901, MGC-803, N87 and HGC-27. The results showed that MATN3 expression was highest in AGS ( p < 0.05) and BGC-823 cells (Fig. 9 A), thus we used AGS and BGC-823 cells for subsequent experiments. The expression of MATN3 in BGC-823 and AGS cells was successfully interfered with siRNA and confirmed by qRT-PCR ( p < 0.05) and WB (Fig. 9 B, C). The CCK8 assay showed that MATN3 interference significantly inhibited BGC-823 and AGS cell proliferation ( p < 0.05) (Fig. 9 D). The colony formation assay revealed that MATN3 interference significantly inhibited colony formation in BGC-823 and AGS cells ( p < 0.05) (Supplementary Fig. 1A, B). Subsequently, we used wound healing and transwell migration assays to explore the effect of MATN3 interference on the migration ability of STAD cells. The results showed that interference of MATN3 significantly inhibited the migration ability of BGC-823 and AGS cells ( p < 0.001) (Fig. 9 E-H). Taken together, interference of MATN3 expression inhibited STAD cell proliferation and migration, further confirming the predictive credibility of our prognostic model. Discussion The important role of metabolism in tumors is gradually being recognized. Increasing evidence has proven that abnormal metabolic features exist in tumors [ 43 , 44 ] . Dysfunctional metabolic activities can promote tumor cell proliferation, recurrence and metastasis, affecting the immunosuppressive properties and malignant phenotype of tumors [ 45 – 48 ] . With the rapid development of bioinformatics technology, more and more studies have illustrated the metabolism-related risk profile of the tumor, including STAD [ 49 – 51 ] . However, there is still a lack of study on amino acid metabolism-related genes in STAD. Thus, in this study, we analyzed the characteristic of amino acid metabolism-related genes in STAD. We firstly extracted prognosis-related amino acid metabolism genes by analyzing transcriptomic gene expression data and clinical parameters of STAD patients in TCGA and successfully constructed an amino acid metabolism genes-related prognostic model, consisting of 3 genes (SERPINE1, NRP1, MATN3). SERPINE1, a member of the serine protease inhibitor family, has been reported to promote tumor progression and metastasis [ 52 – 54 ] . Recent studies have reported that SERPINE1 is a reliable prognostic marker for gastric cancer, breast cancer, ovarian cancer, colorectal cancer, bladder cancer and many other cancers [ 55 – 61 ] . Our study identified SERPINE1 as a prognostic marker in STAD and found the potential role of SERPINE1 in regulating the immune cells infiltration, which is consistent with previous studies [ 62 , 63 ] . NRP-1, a transmembrane protein, acts as a multifunctional coreceptor involved in cancer initiation, growth and metastasis [ 64 ] . NRP-1 is a potential target in cancer therapy and negatively correlates with the prognosis of esophageal squamous cell carcinoma, hepatocellular carcinoma and colorectal cancer [ 65 – 67 ] . In gastric cancer, NRP-1 promotes the gastric cancer cells proliferation and migration of and is associated with the clinicopathological staging [ 42 ] . In our study, we further confirmed its role in predicting the prognosis and immunotherapy efficacy of STAD patients. MATN3, a protein-encoding gene, has been mainly focused on its role in cartilage and skeletal development in past studies [ 68 ] . Recently, MATN3 was reported to be highly expressed in STAD patients [ 69 ] . However, the role of MATN3 in the prognosis of STAD patients was still unclear. In our study, we found that MATN3 might influence the prognosis of STAD patients by involving in the metabolism acid metabolism and immune infiltration in the tumor microenvironment. In addition, we further confirmed the importance of MATN3 in promoting the proliferation and migration ability in gastric cancer through in vitro studies. Immunometabolism provides an understanding of the relationship between immune response and metabolism [ 70 ] . Amino acids, as the main raw materials for protein synthesis, regulate the immune function through energy metabolism, redox balance, epigenetic modification and protein post-translational modification [ 71 ] . Tumor cells require a continuous supply of amino acids, which leads to a metabolic competition between tumor cells and immune cells [ 22 ] . Metabolic remodeling of immune cells in the tumor microenvironment plays a potential role in the progression and metastasis of the tumor [ 24 , 72 ] . We explored the role of amino acid metabolism-related model in immune infiltration in STAD. In this study, we found immune-related pathways, such as cytokine-cytokine receptor interaction, TLR signaling pathway, chemokine signaling pathway and nod like receptor signaling pathway were significantly enriched in the high-risk group. Further analysis demonstrated that the high-risk scores were associated with higher immune cell infiltration and TGF-β dominant immune subtype, demonstrating that amino acid metabolism-related genes might influence STAD patient prognosis through regulating immune-related pathways and TGF-β dominant immune subtype cell infiltration. In gastric cancer, CXC chemokines and their receptors regulate cell transport into and out of tumor microenvironment, influence tumorigenesis indirectly by regulating tumor growth, survival, transformation, invasion, and metastasis, as well as indirectly by modulating tumor-leukocyte interactions and angiogenesis [ 73 ] . TLRs are key innate immunopathogenic sensors mediating chronic inflammation and carcinogenic responses. TLR9 promotes gastric cancer initiation and the gastric inflammation and hyperplasia induced by Helicobacter pylori [ 74 ] . Nod like receptor family are patterns recognition receptors related with innate immunity. NLRX1, a member of the nod like receptor family, is reported to be associated with increased risk of Helicobacter pylori infection, which is common risk factor for developing gastric cancer [ 75 ] . TGF-β, a key factor of immune homeostasis and tolerance, inhibits the expansion and function of the immune system [ 76 ] . TGF-β signaling has dual roles in the development and progression of gastrointestinal tumor as both a suppressor and promoter [ 77 ] . Furthermore, we revealed that the high-risk group had a higher immune escape potential, indicating a poorer immunotherapy effect, which provided a potential reference for applying immunotherapy in STAD patients. KEGG functional enrichment analysis revealed the possible mechanisms of amino acid metabolism genes in STAD. We found that the tumor-associated pathways, such as the JAK-STAT signaling pathway, TGF-β signaling pathway and MAPK signaling pathway were enriched in the high-risk group, suggesting that amino acid metabolism genes may affect STAD prognosis through these pathways. The relationship between MAPK signaling pathway and amino acid metabolism has been reported. A previous study showed that L-Glutamine deficiency disturbed amino acid metabolism and attenuated mTOR and MAPK/ERK signaling pathways, thereby affecting protein synthesis and cell proliferation [ 78 ] . The JAK-STAT signaling pathway is related with varieties of physiological processes such as cell proliferation, immune response, and stem cell self-renewal [ 79 – 81 ] . Aberrant activation of the JAK/STAT pathway has also been reported to be related to gastric cancer progression [ 82 ] . Inhibition of STAT3 significantly reduces the expression of the anti-apoptotic protein survivin, which promotes gastric cancer cell death [ 83 ] . TGF-β signaling pathway can affect cancer progression by regulating the immune response, tumor microenvironment, epithelial-mesenchymal transition, and cancer cell stemness [ 84 – 86 ] . A previous study showed that TGF-β expression was elevated in the tumor tissue of gastric cancer patients and was associated with a poorer prognosis [ 87 ] . To further increase the clinical translational value of our study, we performed the FDA-approved drug sensitivity analysis. By analyzing data from the CellMiner database, we found that our model genes were associated with the patient’s sensitivity to many FDA-approved drugs. The expression of SERPINE1 was positively correlated with the therapeutic sensitivity to lenvatinib. It has been reported that the combination of lenvatinib with pembrolizumab has promising antitumor activity in patients with advanced gastric cancer [ 88 ] . In addition, our study found that MATN3 expression was positively correlated with the therapeutic sensitivity to dacomitinib. In a previous clinical trial, dacomitinib showed good efficacy in HER2-positive gastric cancer patients [ 89 ] . Therefore, our study may provide a potential reference for drug selection in STAD patients. Conclusions In this study, we developed a prognostic model of amino acid metabolism in STAD and demonstrated its high efficiency through the external validation. KEGG pathway enrichment analysis, immune infiltration analysis, immunotherapy efficacy prediction and drug sensitivity analysis further revealed that this model is highly correlated with immunity, discovered the potential mechanism, and enhanced the clinical application value. Finally, in vitro experiment demonstrated that model gene MATN3 promoted the proliferation and migration in gastric cancer, providing the basis for further study on the amino acid metabolism in STAD. In conclusion, our study revealed that targeting amino acid metabolism might be a potential therapeutic method to improve STAD patients’ prognosis and provides a personalized predictive tool for prognosis and immunotherapy response in STAD. Abbreviations Differentially expressed amino acid metabolism genes (DEAAMGs) Gene Expression Omnibus (GEO) Gastric mucosal epithelial cells (GES1) Gene Set Enrichment Analysis (GSEA) Indoleamine 2,3-dioxygenase (IDO) Kyoto Gene and Genome Encyclopedia (KEGG) Kaplan-Meier (KM) Least absolute shrinkage and selection operator (LASSO) Microsatellite instability (MSI) Quantitative real-time polymerase chain reaction (qRT-PCR) Single sample genomic enrichment analysis (ssGSEA) Stomach adenocarcinoma (STAD) The Cancer Genome Atlas (TCGA) Tumor immune dysfunction and exclusion (TIDE) Tumor inflammatory marker (TIS) Western blot (WB) Declarations Authors' contributions Guangyuan Hu, Xiaohong Peng and Yuanyuan Zhang conceived of the study. Wenjun Zhu, Min Fu, Qianxia Li and Xin Chen searched the literature, conducted data analysis and experiments, and produced the manuscript. Xiaoyu Li, Na Luo, Wenhua Tang, Feng Yang, Ziqi Chen and Yiling Zhang revised the manuscript. All authors have read and approved the manuscript. Acknowledgments Thanks to the TCGA and GEO databases for the availability of the above data. Thanks to the Huazhong University of Science & Technology Analytical & Testing center for the technical support. Funding The study was funded by the National Natural Sciences Foundation of China (Grant No. 82003312, 82173311). Availability of data and materials All data generated and analyzed in this study are included in this article and its supplementary files. The transcriptomic gene expression data (TCGA and GSE84433 series matrix) and corresponding clinical information were downloaded from the TCGA database (https://portal.gdc.cancer.gov/) and GEO database (https://www.ncbi.nlm.nih.gov/). Ethics approval and consent to participate Not applicable Consent for publication Not applicable Competing interests The authors declare that they have no competing interests. Supplementary information All the supplementary files have been properly named and uploaded. References Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries [J]. CA Cancer J Clin. 2021;71(3):209–49. 10.3322/caac.21660 . Smyth EC, Nilsson M, Grabsch HI, et al. Gastric cancer [J]. Lancet (London England). 2020;396(10251):635–48. 10.1016/S0140-6736(20)31288-5 . Karimi P, Islami F, Anandasabapathy S, et al. Gastric cancer: descriptive epidemiology, risk factors, screening, and prevention [J]. Cancer Epidemiol Biomarkers Prev. 2014;23(5):700–13. 10.1158/1055-9965.EPI-13-1057 . Butler M, Van Der Meer LT, Van Leeuwen FN. Amino Acid Depletion Therapies: Starving Cancer Cells to Death [J]. Trends Endocrinol Metab. 2021;32(6):367–81. 10.1016/j.tem.2021.03.003 . Warburg O. On the origin of cancer cells [J]. Science. 1956;123(3191):309–14. Hanahan D. Hallmarks of Cancer: New Dimensions [J]. Cancer Discov. 2022;12(1):31–46. 10.1158/2159-8290.CD-21-1059 . Najumudeen AK, Ceteci F, Fey SK, et al. The amino acid transporter SLC7A5 is required for efficient growth of KRAS-mutant colorectal cancer [J]. Nat Genet. 2021;53(1):16–26. 10.1038/s41588-020-00753-3 . Xu L, Chen J, Jia L, et al. SLC1A3 promotes gastric cancer progression via the PI3K/AKT signalling pathway [J]. J Cell Mol Med. 2020;24(24):14392–404. 10.1111/jcmm.16060 . Okuda K, Umemura A, Kataoka S, et al. Enhanced Antitumor Effect in Liver Cancer by Amino Acid Depletion-Induced Oxidative Stress [J]. Front Oncol. 2021;11(758549). 10.3389/fonc.2021.758549 . Qu Y-Y, Zhao R, Zhang H-L, et al. Inactivation of the AMPK-GATA3-ECHS1 Pathway Induces Fatty Acid Synthesis That Promotes Clear Cell Renal Cell Carcinoma Growth [J]. Cancer Res. 2020;80(2):319–33. 10.1158/0008-5472.CAN-19-1023 . Zhang L, Han J. Branched-chain amino acid transaminase 1 (BCAT1) promotes the growth of breast cancer cells through improving mTOR-mediated mitochondrial biogenesis and function [J]. Biochem Biophys Res Commun. 2017;486(2):224–31. 10.1016/j.bbrc.2017.02.101 . Wang Z-Q, Faddaoui A, Bachvarova M, et al. BCAT1 expression associates with ovarian cancer progression: possible implications in altered disease metabolism [J]. Oncotarget. 2015;6(31):31522–43. 10.18632/oncotarget.5159 . Wei Z, Liu X, Cheng C, et al. Metabolism of Amino Acids in Cancer [J]. Front Cell Dev Biol. 2020;8(603837). 10.3389/fcell.2020.603837 . Wu H, Xue R, Tang Z, et al. Metabolomic investigation of gastric cancer tissue using gas chromatography/mass spectrometry [J]. Anal Bioanal Chem. 2010;396(4):1385–95. 10.1007/s00216-009-3317-4 . Choi JM, Park WS, Song KY, et al. Development of simultaneous analysis of tryptophan metabolites in serum and gastric juice - an investigation towards establishing a biomarker test for gastric cancer diagnosis [J]. Biomed Chromatogr. 2016;30(12):1963–74. 10.1002/bmc.3773 . Deng K, Lin S, Zhou L, et al. Three aromatic amino acids in gastric juice as potential biomarkers for gastric malignancies [J]. Anal Chim Acta. 2011;694(1–2):100–7. 10.1016/j.aca.2011.03.053 . Chen J-L, Tang H-Q, Hu J-D, et al. Metabolomics of gastric cancer metastasis detected by gas chromatography and mass spectrometry [J]. World J Gastroenterol. 2010;16(46):5874–80. Jung J, Jung Y, Bang EJ et al. Noninvasive diagnosis and evaluation of curative surgery for gastric cancer by using NMR-based metabolomic profiling [J]. Ann Surg Oncol, 2014, 21 Suppl 4(S736-S742. doi: 10.1245/s10434-014-3886-0 Esslinger CS, Cybulski KA, Rhoderick JF. Ngamma-aryl glutamine analogues as probes of the ASCT2 neutral amino acid transporter binding site [J]. Bioorg Med Chem. 2005;13(4):1111–8. Lu J, Chen M, Tao Z, et al. Effects of targeting SLC1A5 on inhibiting gastric cancer growth and tumor development in vitro and in vivo [J]. Oncotarget. 2017;8(44):76458–67. 10.18632/oncotarget.19479 . Cai Z, Zhao J-S, Li J-J, et al. A combined proteomics and metabolomics profiling of gastric cardia cancer reveals characteristic dysregulations in glucose metabolism [J]. Mol Cell Proteomics. 2010;9(12):2617–28. 10.1074/mcp.M110.000661 . Kelly B, Pearce EL. Amino Assets: How Amino Acids Support Immunity [J]. Cell Metabol. 2020;32(2):154–75. 10.1016/j.cmet.2020.06.010 . Bian Y, Li W, Kremer DM, et al. Cancer SLC43A2 alters T cell methionine metabolism and histone methylation [J]. Nature. 2020;585(7824):277–82. 10.1038/s41586-020-2682-1 . Wu D. Innate and Adaptive Immune Cell Metabolism in Tumor Microenvironment [J]. Adv Exp Med Biol. 2017;1011:211–23. 10.1007/978-94-024-1170-6_7 . Brochez L, Chevolet I, Kruse V. The rationale of indoleamine 2,3-dioxygenase inhibition for cancer therapy [J]. Eur J Cancer. 2017;76:167–82. 10.1016/j.ejca.2017.01.011 . Howden AJM, Hukelmann JL, Brenes A, et al. Quantitative analysis of T cell proteomes and environmental sensors during T cell differentiation [J]. Nat Immunol. 2019;20(11):1542–54. 10.1038/s41590-019-0495-x . Carr EL, Kelman A, Wu GS, et al. Glutamine uptake and metabolism are coordinately regulated by ERK/MAPK during T lymphocyte activation [J]. J Immunol (Baltimore Md: 1950). 2010;185(2):1037–44. 10.4049/jimmunol.0903586 . Loftus RM, Assmann N, Kedia-Mehta N, et al. Amino acid-dependent cMyc expression is essential for NK cell metabolic and functional responses in mice [J]. Nat Commun. 2018;9(1):2341. 10.1038/s41467-018-04719-2 . Yoon BR, Oh Y-J, Kang SW, et al. Role of SLC7A5 in Metabolic Reprogramming of Human Monocyte/Macrophage Immune Responses [J]. Front Immunol. 2018;9(53). 10.3389/fimmu.2018.00053 . Xiao M, Yang H, Xu W, et al. Inhibition of α-KG-dependent histone and DNA demethylases by fumarate and succinate that are accumulated in mutations of FH and SDH tumor suppressors [J]. Genes Dev. 2012;26(12):1326–38. 10.1101/gad.191056.112 . Hutter C, Zenklusen JC. Cell. 2018;173(2):283–5. 10.1016/j.cell.2018.03.042 . The Cancer Genome Atlas: Creating Lasting Value beyond Its Data [J]. Barrett T, Troup DB, Wilhite SE, et al. NCBI GEO: mining tens of millions of expression profiles–database and tools update [J]. Nucleic Acids Res. 2007;35(Database issue):D760–5. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles [J]. Proc Natl Acad Sci U S A. 2005;102(43):15545–50. Jiang J, Liu D, Xu G, et al. TRIM68, PIKFYVE, and DYNLL2: The Possible Novel Autophagy- and Immunity-Associated Gene Biomarkers for Osteosarcoma Prognosis [J]. Front Oncol. 2021;11(643104). 10.3389/fonc.2021.643104 . Zuo S, Wei M, Wang S, et al. Pan-Cancer Analysis of Immune Cell Infiltration Identifies a Prognostic Immune-Cell Characteristic Score (ICCS) in Lung Adenocarcinoma [J]. Front Immunol. 2020;11(1218). 10.3389/fimmu.2020.01218 . Yoshihara K, Shahmoradgoli M, Martínez E, et al. Inferring tumour purity and stromal and immune cell admixture from expression data [J]. Nat Commun. 2013;4(2612). 10.1038/ncomms3612 . Jiang P, Gu S, Pan D, et al. Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response [J]. Nat Med. 2018;24(10):1550–8. 10.1038/s41591-018-0136-1 . Danaher P, Warren S, Lu R, et al. Pan-cancer adaptive immune resistance as defined by the Tumor Inflammation Signature (TIS): results from The Cancer Genome Atlas (TCGA) [J]. J Immunother Cancer. 2018;6(1):63. 10.1186/s40425-018-0367-1 . Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications [J]. Proc Natl Acad Sci U S A. 1979;76(9):4350–4. Lin Z, Xu Q, Miao D, et al. An Inflammatory Response-Related Gene Signature Can Impact the Immune Status and Predict the Prognosis of Hepatocellular Carcinoma [J]. Front Oncol. 2021;11(644416). 10.3389/fonc.2021.644416 . Chen S, Li Y, Zhu Y et al. SERPINE1 Overexpression Promotes Malignant Progression and Poor Prognosis of Gastric Cancer [J]. J Oncol, 2022, 2022(2647825. doi: 10.1155/2022/2647825 Li L, Jiang X, Zhang Q, et al. Neuropilin-1 is associated with clinicopathology of gastric cancer and contributes to cell proliferation and migration as multifunctional co-receptors [J]. J Exp Clin Cancer Res. 2016;35(16). 10.1186/s13046-016-0291-5 . Boroughs LK, Deberardinis RJ. Metabolic pathways promoting cancer cell survival and growth [J]. Nat Cell Biol. 2015;17(4):351–9. 10.1038/ncb3124 . Armitage EG, Ciborowski M. Applications of Metabolomics in Cancer Studies [J]. Adv Exp Med Biol. 2017;965:209–34. 10.1007/978-3-319-47656-8_9 . Li H, Ning S, Ghandi M, et al. The landscape of cancer cell line metabolism [J]. Nat Med. 2019;25(5):850–60. 10.1038/s41591-019-0404-8 . Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation [J]. Cell. 2011;144(5):646–74. 10.1016/j.cell.2011.02.013 . Chang C-H, Qiu J, O'sullivan D, et al. Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression [J]. Cell. 2015;162(6):1229–41. 10.1016/j.cell.2015.08.016 . Ho P-C, Bihuniak JD, Macintyre AN, et al. Phosphoenolpyruvate Is a Metabolic Checkpoint of Anti-tumor T Cell Responses [J]. Cell. 2015;162(6):1217–28. 10.1016/j.cell.2015.08.012 . Zhao Y, Zhang J, Wang S, et al. Identification and Validation of a Nine-Gene Amino Acid Metabolism-Related Risk Signature in HCC [J]. Front Cell Dev Biol. 2021;9(731790). 10.3389/fcell.2021.731790 . Zhang Y, Liu W, Feng W, et al. Identification of 14 Differentially-Expressed Metabolism-Related Genes as Potential Targets of Gastric Cancer by Integrated Proteomics and Transcriptomics [J]. Front Cell Dev Biol. 2022;10(816249). 10.3389/fcell.2022.816249 . Ye Z, Zheng M, Zeng Y, et al. A 13-Gene Metabolic Prognostic Signature Is Associated With Clinical and Immune Features in Stomach Adenocarcinoma [J]. Front Oncol. 2021;11(612952). 10.3389/fonc.2021.612952 . Declerck PJ, Gils A. Three decades of research on plasminogen activator inhibitor-1: a multifaceted serpin [J]. Semin Thromb Hemost. 2013;39(4):356–64. 10.1055/s-0033-1334487 . Seker F, Cingoz A, Sur-Erdem İ, et al. Identification of as a Regulator of Glioblastoma Cell Dispersal with Transcriptome Profiling [J]. Cancers (Basel). 2019;11(11). 10.3390/cancers11111651 . Hanekom GS, Stubbings HM, Kidson SH. The active fraction of plasmatic plasminogen activator inhibitor type 1 as a possible indicator of increased risk for metastatic melanoma [J]. Cancer Detect Prev. 2002;26(1):50–9. Xu B, Bai Z, Yin J, et al. Global transcriptomic analysis identifies as a prognostic biomarker associated with epithelial-to-mesenchymal transition in gastric cancer [J]. PeerJ. 2019;7(e):7091. 10.7717/peerj.7091 . Jevrić M, Matić IZ, Krivokuća A, et al. Association of uPA and PAI-1 tumor levels and 4G/5G variants of PAI-1 gene with disease outcome in luminal HER2-negative node-negative breast cancer patients treated with adjuvant endocrine therapy [J]. BMC Cancer. 2019;19(1):71. 10.1186/s12885-018-5255-z . Harbeck N, Kates RE, Gauger K, et al. Urokinase-type plasminogen activator (uPA) and its inhibitor PAI-I: novel tumor-derived factors with a high prognostic and predictive impact in breast cancer [J]. Thromb Haemost. 2004;91(3):450–6. Sakakibara T, Hibi K, Koike M, et al. Plasminogen activator inhibitor-1 as a potential marker for the malignancy of colorectal cancer [J]. Br J Cancer. 2005;93(7):799–803. Nakatsuka E, Sawada K, Nakamura K, et al. Plasminogen activator inhibitor-1 is an independent prognostic factor of ovarian cancer and IMD-4482, a novel plasminogen activator inhibitor-1 inhibitor, inhibits ovarian cancer peritoneal dissemination [J]. Oncotarget. 2017;8(52):89887–902. 10.18632/oncotarget.20834 . Chan OTM, Furuya H, Pagano I, et al. Association of MMP-2, RB and PAI-1 with decreased recurrence-free survival and overall survival in bladder cancer patients [J]. Oncotarget. 2017;8(59):99707–21. 10.18632/oncotarget.20686 . Becker M, Szarvas T, Wittschier M, et al. Prognostic impact of plasminogen activator inhibitor type 1 expression in bladder cancer [J]. Cancer. 2010;116(19):4502–12. 10.1002/cncr.25326 . Huang Z, Liu X, Wu C, et al. A New Strategy to Identify ceRNA-Based CCDC144NL-AS1/SERPINE1 Regulatory Axis as a Novel Prognostic Biomarker for Stomach Adenocarcinoma High Throughput Transcriptome Data Mining and Computational Verification [J]. Front Oncol. 2021;11(802727). 10.3389/fonc.2021.802727 . Wang S, Pang L, Liu Z, et al. SERPINE1 associated with remodeling of the tumor microenvironment in colon cancer progression: a novel therapeutic target [J]. BMC Cancer. 2021;21(1):767. 10.1186/s12885-021-08536-7 . Prud'homme GJ, Glinka Y. Neuropilins are multifunctional coreceptors involved in tumor initiation, growth, metastasis and immunity [J]. Oncotarget. 2012;3(9):921–39. Bergé M, Allanic D, Bonnin P, et al. Neuropilin-1 is upregulated in hepatocellular carcinoma and contributes to tumour growth and vascular remodelling [J]. J Hepatol. 2011;55(4):866–75. 10.1016/j.jhep.2011.01.033 . Alattar M, Omo A, Elsharawy M, et al. Neuropilin-1 expression in squamous cell carcinoma of the oesophagus [J]. Eur J Cardiothorac Surg. 2014;45(3):514–20. 10.1093/ejcts/ezt380 . Staton CA, Koay I, Wu JM, et al. Neuropilin-1 and neuropilin-2 expression in the adenoma-carcinoma sequence of colorectal cancer [J]. Histopathology. 2013;62(6):908–15. 10.1111/his.12098 . Klatt AR, Nitsche DP, Kobbe B, et al. Molecular structure and tissue distribution of matrilin-3, a filament-forming extracellular matrix protein expressed during skeletal development [J]. J Biol Chem. 2000;275(6):3999–4006. Wu P-L, He Y-F, Yao H-H, et al. Martrilin-3 (MATN3) Overexpression in Gastric Adenocarcinoma and its Prognostic Significance [J]. Med Sci Monitor: Int Med J Experimental Clin Res. 2018;24:348–55. O'neill LJ, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists [J]. Nat Rev Immunol. 2016;16(9):553–65. 10.1038/nri.2016.70 . Lieu EL, Nguyen T, Rhyne S, et al. Amino acids in cancer [J]. Exp Mol Med. 2020;52(1):15–30. 10.1038/s12276-020-0375-3 . Uyttenhove C, Pilotte L, Théate I, et al. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase [J]. Nat Med. 2003;9(10):1269–74. Lee HJ, Song I-C, Yun H-J, et al. CXC chemokines and chemokine receptors in gastric cancer: from basic findings towards therapeutic targeting [J]. World J Gastroenterol. 2014;20(7):1681–93. 10.3748/wjg.v20.i7.1681 . Tang K, Mcleod L, Livis T, et al. Toll-like Receptor 9 Promotes Initiation of Gastric Tumorigenesis by Augmenting Inflammation and Cellular Proliferation [J]. Cell Mol Gastroenterol Hepatol. 2022;14(3):567–86. 10.1016/j.jcmgh.2022.06.002 . Pickering RJ, Booty LM. NLR in eXile: Emerging roles of NLRX1 in immunity and human disease [J]. Immunology. 2021;162(3):268–80. 10.1111/imm.13291 . Batlle E, Massagué J. Transforming Growth Factor-β Signaling in Immunity and Cancer [J]. Immunity. 2019;50(4):924–40. 10.1016/j.immuni.2019.03.024 . Luo J, Chen X-Q, Li P. The Role of TGF-β and Its Receptors in Gastrointestinal Cancers [J]. Transl Oncol. 2019;12(3):475–84. 10.1016/j.tranon.2018.11.010 . Zhu Y, Lin G, Dai Z, et al. L-Glutamine deprivation induces autophagy and alters the mTOR and MAPK signaling pathways in porcine intestinal epithelial cells [J]. Amino Acids. 2015;47(10):2185–97. 10.1007/s00726-014-1785-0 . Darnell JE, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins [J]. Science. 1994;264(5164):1415–21. Aaronson DS, Horvath CM. A road map for those who don't know JAK-STAT [J]. Science. 2002;296(5573):1653–5. Rawlings JS, Rosler KM, Harrison DA. The JAK/STAT signaling pathway [J]. J Cell Sci. 2004;117(Pt 8):1281–3. Giraud AS, Menheniott TR, Judd LM. Targeting STAT3 in gastric cancer [J]. Expert Opin Ther Targets. 2012;16(9):889–901. 10.1517/14728222.2012.709238 . Kanda N, Seno H, Konda Y, et al. STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cells [J]. Oncogene. 2004;23(28):4921–9. Massagué J. TGFbeta in Cancer [J]. Cell. 2008;134(2):215–30. 10.1016/j.cell.2008.07.001 . Fabregat I, Fernando J, Mainez J, et al. TGF-beta signaling in cancer treatment [J]. Curr Pharm Design. 2014;20(17):2934–47. David CJ, Massagué J. Contextual determinants of TGFβ action in development, immunity and cancer [J]. Nat Rev Mol Cell Biol. 2018;19(7):419–35. 10.1038/s41580-018-0007-0 . Hu W-Q, Wang L-W, Yuan J-P, et al. High expression of transform growth factor beta 1 in gastric cancer confers worse outcome: results of a cohort study on 184 patients [J]. Hepatogastroenterology. 2014;61(129):245–50. Kawazoe A, Fukuoka S, Nakamura Y, et al. Lenvatinib plus pembrolizumab in patients with advanced gastric cancer in the first-line or second-line setting (EPOC1706): an open-label, single-arm, phase 2 trial [J]. Lancet Oncol. 2020;21(8):1057–65. 10.1016/S1470-2045(20)30271-0 . Oh D-Y, Lee K-W, Cho JY, et al. Phase II trial of dacomitinib in patients with HER2-positive gastric cancer [J]. Gastric Cancer. 2016;19(4):1095–103. 10.1007/s10120-015-0567-z . Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.tif SupplementaryTable1.xlsx SupplementaryTable2.xlsx SupplementaryTable3.xlsx SupplementaryFigurelegends.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2754183","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":190285382,"identity":"6aa2aec9-26cb-48c8-83fa-d36b8e45b54b","order_by":0,"name":"Wenjun Zhu","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenjun","middleName":"","lastName":"Zhu","suffix":""},{"id":190285384,"identity":"159fb025-7e58-40bb-b1ac-886255d1a6b1","order_by":1,"name":"Min Fu","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Fu","suffix":""},{"id":190285385,"identity":"2fe11f0b-9dd3-41f2-b6d1-13526e1d00d1","order_by":2,"name":"Qianxia Li","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qianxia","middleName":"","lastName":"Li","suffix":""},{"id":190285386,"identity":"f61663bc-b43f-44b9-a8f6-31c6e7e399b8","order_by":3,"name":"Xin Chen","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Chen","suffix":""},{"id":190285387,"identity":"242178a8-d230-4a2e-8892-f2ef25c544d7","order_by":4,"name":"Xiaoyu Li","email":"","orcid":"","institution":"Hubei Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"Li","suffix":""},{"id":190285388,"identity":"eb45f18f-882c-47e5-973c-910c1cab536e","order_by":5,"name":"Na Luo","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Luo","suffix":""},{"id":190285389,"identity":"accbe56a-83b6-420c-abe5-d484c6a116ae","order_by":6,"name":"Wenhua Tang","email":"","orcid":"","institution":"Southwest Hospital, Third Military Medical University (Army Medical University)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenhua","middleName":"","lastName":"Tang","suffix":""},{"id":190285390,"identity":"0c4e00fd-6377-4691-aad9-0301985eccd0","order_by":7,"name":"Feng Yang","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Yang","suffix":""},{"id":190285392,"identity":"d643030c-ba45-46eb-a6fb-f6e6ef8e816c","order_by":8,"name":"Ziqi Chen","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ziqi","middleName":"","lastName":"Chen","suffix":""},{"id":190285393,"identity":"2e29b7e5-c9e1-4a2c-a6dd-2f3be54676ba","order_by":9,"name":"Yiling Zhang","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yiling","middleName":"","lastName":"Zhang","suffix":""},{"id":190285394,"identity":"1f6a2aef-da20-468e-999f-130d4597774b","order_by":10,"name":"Yuanyuan Zhang","email":"","orcid":"","institution":"Zhejiang University School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Zhang","suffix":""},{"id":190285395,"identity":"614e9cd1-57d5-4567-b742-a9cc27827c47","order_by":11,"name":"Xiaohong Peng","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaohong","middleName":"","lastName":"Peng","suffix":""},{"id":190285396,"identity":"b63c29aa-de8a-481b-8186-a57928a6cbc5","order_by":12,"name":"Guangyuan Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYBACAwglIcfG3tj48AMJWiyM+XgONxtLkKClInGeRHqbAA8xWswZ2C8w8zBIMLZJPmxjkGCwk9NtIKDFsoGnAKSFmU06se1BAUOysdkBQg47wJMA0sIG1NJuIMFwIHEbsVp42CQPtknwEKeF/QBIiwQb0DtEajnMw3BwjoGEARtPIjCQDYjxy/H2hw/eVNTVz28//vDhhwo7OYJaGJh5DA7xGMBNIKQcDNgfMP4gSuEoGAWjYBSMWAAASpA3kwhsEJ8AAAAASUVORK5CYII=","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Guangyuan","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2023-03-30 02:59:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2754183/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2754183/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":35607606,"identity":"cb917c73-0470-43d9-bc00-3a96081d6e04","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1324036,"visible":true,"origin":"","legend":"\u003cp\u003eFlowchart of analyzing the amino acid metabolism–related genes in STAD.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/f90e29aff6fc68ab9f243890.png"},{"id":35607607,"identity":"eda627ca-7b1e-462a-945a-d7d7b48a2bd1","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4484429,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of differentially expressed amino acid metabolism genes (DEAAMGs) in STAD tissues versus normal tissues.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/1d40f220d3985946dcb2b9a5.png"},{"id":35608202,"identity":"50153989-594b-4401-9e7e-af01bda4ad13","added_by":"auto","created_at":"2023-04-11 19:18:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":594008,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of an amino acid metabolism-related prognostic risk model in TCGA cohort. (A) Lasso coefficient plot. (B) The best log Lambda value was selected for the TCGA cohort through 10-fold cross-validation in the LASSO regression model.(C) Risk curve in TCGA cohort. (D) PCA analysis in TCGA cohort. (E) t-SNE analysis in TCGA cohort. (F) The survival status distribution of STAD patients in TCGA cohort. (G) The KM survival analysis of STAD patients in TCGA cohort. P \u0026lt; 0.05 revealed significant survival differences. (H) A nomogram was plotted to predict patient survival at 1, 3 and 5 years. (I) The calibration curve was used to determine the predictive accuracy of the nomogram.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/c4018d26384694b7f37486ec.png"},{"id":35607614,"identity":"7d464581-6d32-4039-99b1-7ddc2cee986b","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":567669,"visible":true,"origin":"","legend":"\u003cp\u003eValidation of the 3-gene prognostic model in the GEO cohort.\u003cstrong\u003e \u003c/strong\u003e(A) Risk curve in the GEO cohort. (B) PCA analysis in the GEO cohort. (C) t-SNE analysis in the GEO cohort. (D) The distribution of OS status in the GEO cohort. (E) The KM survival analysis of STAD patients in the GEO cohort. (F) The comparison of risk scores between grade 1-2 and grade 3. (G) The comparison of risk scores between stage I-II and stage III-IV.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/a21a9492c5ebcea334a49153.png"},{"id":35608315,"identity":"78e279c5-2d11-478c-a1b8-bbf06770554c","added_by":"auto","created_at":"2023-04-11 19:26:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1069281,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG pathway enrichment analysis. (A) Top ten pathways enriched in the high- and low-risk groups in the KEGG pathway enrichment analysis. (B-D) Tumor-related pathways enriched in the high-risk group. (E-H) Immune-related pathways enriched in the high-risk group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/f76de9b077f3d634750c3d67.png"},{"id":35608317,"identity":"123fb444-283a-4689-bdd8-335f3e2887ec","added_by":"auto","created_at":"2023-04-11 19:26:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":756096,"visible":true,"origin":"","legend":"\u003cp\u003eImmune infiltration analysis. (A) The infiltration of 16 immune cell subpopulations in high- and low-risk groups. (B) The comparison of 13 immune-related functions between high- and low-risk groups. (C) The comparison of risk scores in different immune infiltration subtypes. (D-G) The correlation between risk score and immune score, stromal score, ESTIMATE score and tumor purity. \u003cem\u003e*p \u003c/em\u003e\u0026lt; 0.05, \u003cem\u003e**p \u003c/em\u003e\u0026lt; 0.01, \u003cem\u003e***p \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/099b6152031605ea9d19007f.png"},{"id":35607608,"identity":"8fc3af52-67df-4ae5-8b6a-156fb61251af","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":382783,"visible":true,"origin":"","legend":"\u003cp\u003eImmunotherapy efficacy prediction and model comparison. (A) Comparison of dysfunction score, exclusion score tumor immune dysfunction and exclusion (TIDE) score and microsatellite instability (MSI) score between high- and low-risk groups. (E) Comparison of the predictive efficacy to prognosis between risk score, TIDE score and tumor inflammation signature (TIS) score. \u003cem\u003e***p \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/27cfe4722cc83b45abb867f7.png"},{"id":35608741,"identity":"cc20d2b6-71c8-487d-9469-a9400bfb6c13","added_by":"auto","created_at":"2023-04-11 19:34:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":719747,"visible":true,"origin":"","legend":"\u003cp\u003eThe drug sensitivity analysis.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/33e18c9a2bfffa5d879a0bbc.png"},{"id":35607618,"identity":"94c60761-e97b-4c2b-b83b-47b4708fdea4","added_by":"auto","created_at":"2023-04-11 19:10:39","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":306563,"visible":true,"origin":"","legend":"\u003cp\u003eInterference of MATN3\u003cem\u003e \u003c/em\u003einhibits the proliferation and migration of STAD cells. (A) The relative expression of MATN3 in the GES1, AGS, MKN45, BGC-823, SGC-7901, SNU-216, MGC-803, N87 and HGC-27 cells was detected by RT-PCR. (B) The transfection efficiency of si-MATN3 in BGC-823 and AGS cells was detected by RT-PCR. (C) The transfection efficiency of si-MATN3 in BGC-823 and AGS cells was detected by WB. (D) The CCK8 assay showed that MATN3 interference significantly inhibited BGC-823 and AGS cell proliferation at 48h, 72h, 96h and 120h. (E) Representative images in wound healing assay. (F) The result of the wound healing assay showed that interference of MATN3 significantly inhibited the migration ability of BGC-823 and AGS cells. (G) Representative images in the transwell assay. (H) The result of the transwell assay showed that interference of MATN3 significantly inhibited the migration ability of BGC-823 and AGS cells. \u003cem\u003e*p \u003c/em\u003e\u0026lt; 0.05, \u003cem\u003e**p \u003c/em\u003e\u0026lt; 0.01, \u003cem\u003e***p \u003c/em\u003e\u0026lt; 0.001, \u003cem\u003e****p \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/7c00e64aeb987f6715980175.png"},{"id":41764837,"identity":"15441508-8b63-4e0e-9b07-7d620fd2c40f","added_by":"auto","created_at":"2023-08-18 13:52:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4298284,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/e83cc295-3c51-47e8-bcaf-e1a33b2374e5.pdf"},{"id":35607617,"identity":"165ae905-f1ab-41b7-894e-3cb0df1b8b46","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3280292,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/8efb4f1a96fa8f60a5146919.tif"},{"id":35608207,"identity":"8cdaf3fb-5df6-4390-9e34-4e5697d3ded5","added_by":"auto","created_at":"2023-04-11 19:18:37","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":12030,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/2fa263bdbf2a217c1c975ef9.xlsx"},{"id":35607616,"identity":"ceb30338-f7eb-48c9-aa61-1e524b4b6b6f","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":230471,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/27fea4631102560f2992a6be.xlsx"},{"id":35608203,"identity":"a7e6a83b-5356-46d6-a2a9-f8500ade9185","added_by":"auto","created_at":"2023-04-11 19:18:37","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":29645,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/5701855d090653f6b73e9ce6.xlsx"},{"id":35607612,"identity":"78df7fb7-d6ed-4bf6-be21-575bbc74ee61","added_by":"auto","created_at":"2023-04-11 19:10:37","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":13307,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigurelegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-2754183/v1/5e547c6598cc86ae51b9adf4.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development of Amino Acid Metabolism-Related Prognostic Model and Immune Infiltration Analysis in Patients with Stomach Adenocarcinoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAccording to the Global Cancer Statistics 2020, the incidence of gastric cancer ranked fifth and mortality ranked third worldwide, with over 1\u0026nbsp;million new cases and about 769,000 deaths in 2020\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Despite the diagnosis and treatment of gastric cancer having made great progress in recent decades, a lot of patients still failed to be diagnosed until advanced stages, with a 5-year survival rate of around 30%, while it reaches 60% in the early-to-middle stage patients \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, hence it is an urgent need for sensitive biomarkers for early diagnosis and prognostic prediction.\u003c/p\u003e \u003cp\u003eAmino acids, the basic units of proteins, are involved in energy production, hormones and neurotransmitters generation, and methylation\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. In the late 1930s, Wargurg first discovered the phenomenon of glucose metabolism reprogramming in tumor cells, namely the Warburg effect, which opened up a new direction for the study of tumor development from the perspective of metabolism\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. The in-depth study of tumor metabolism found that tumor cells usually reprogram substance and energy metabolism to meet the energy demand of proliferation\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. In addition to glucose metabolism providing energy for tumor cells proliferation, amino acid metabolism reprogramming also plays a crucial role in tumor growth. Amino acid metabolic reprogramming refers to the abnormal process of amino acid uptake rate, metabolites, metabolic key enzymes or amino acid metabolic pathway in tumor cells\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. In recent years, more and more studies have focused on the amino acid metabolism of tumors, including stomach cancer, colon cancer, hepatocellular carcinoma, kidney clear cell carcinoma, breast cancer, ovarian cancer, etc\u003csup\u003e[\u003cspan additionalcitationids=\"CR8 CR9 CR10 CR11\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Amino acids promote cancer cells survival and proliferation under oxidative, genotoxic, and nutritional stress\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Therefore, targeting amino acid metabolism is emerging as a potential therapeutic measure for cancer patients.\u003c/p\u003e \u003cp\u003eIn stomach cancer, various amino acids metabolism is abnormal. The levels of L-glutamine, L-isoleucine and serine were elevated in gastric cancer tissue compared to non-malignant tissue, and higher levels of L-cysteine and L-tyrosine were detected in the invasive (T3 and T4) gastric cancers than non-invasive (T1 and T2) cancers\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. The activation of kynurenine pathway in tryptophan metabolism was reported in gastric cancer and kynurenic acid in gastric juice and serum might serve as a biomarker for gastric cancer\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Aromatic amino acids in gastric juice could serve as potential diagnostic biomarkers to monitor gastric malignancies\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Proline and serine metabolisms played an important role in gastric cancer metastasis\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Significantly higher levels of amino acids (e.g., alanine, glycolate, arginine, methionine, phenylalanine, glycine, and tyrosine) were excreted in GC patients urine and the levels of alanine, phenylacetylglycine, arginine and glycine increased significantly with T stage\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eChanges in amino acid metabolism in gastric cancer have been supported by many studies, but the mechanism remains unclear. Alanine-serine,-cysteine transporter 2 (SLC1A5; ASCT2), the main glutamine transporter, determines intracellular glutamine level\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Knockdown of SLC1A5 in gastric cancer cells suppressed cell proliferation, migration and invasion partly by inactivated mTOR/p-70S6K1 signaling pathway and also inhibited the relative volume of xenografted tumor in vivo\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Cai et al. also found lactate dehydrogenase A (LDH-A) downregulation and pyruvate dehydrogenase B (PDH-B) overexpression could inhibit gastric cancer cell growth and migration by forcing pyruvate into the Krebs cycle instead of the glycolysis process\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFurthermore, amino acid metabolism has also been reported to play an important role in the regulation of tumor immunity\u003csup\u003e[\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Immune cells have specific requirements for amino acid. The activation of CD8\u0026thinsp;+\u0026thinsp;T cells in the presence of interleukin (IL)-2 resulted in increased cell surface densities of Slc1a5 and Slc7a5\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Glutamine is necessary for T cell activation, as T cells cannot proliferate and produce IL-2 or IFN-γ when cultured without glutamine\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Myc-dependent natural killer cell activation induced by IL-2/IL-12 requires Slc7a5-mediated glutamine uptake\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Lipopolysaccharide supports cytokine production in proinflammatory macrophages by increasing Slc7a5 expression and leucine uptake\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Gls1 deficiency impairs the differentiation of Th17 cell through limiting αKG supply\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Thus, targeting amino acid metabolism might be helpful to guide the immunotherapy and improve existing therapeutic methods.\u003c/p\u003e \u003cp\u003eBased on the importance of amino acid metabolism in tumor development and immunity, in this paper, we focused on the role of amino acid metabolism-related genes in STAD and its involvement in tumor immunity to provide potential biomarkers for prognostic prediction, guide for immunotherapy and develop new therapeutic targets for further breakthroughs in the field of amino acid metabolism in STAD.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Data Collection\u003c/h2\u003e \u003cp\u003eWe downloaded transcriptomic gene expression data and corresponding clinical information of 380 patients with STAD (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) from the TCGA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. The data were from STAD patients after primary surgical resection (patients with missing clinical data were excluded). The gene expression data (GSE84433 series matrix) and corresponding clinical information of 357 patients with STAD from the GEO database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were employed to perform model validation\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. The samples in this study were initial STAD after primary surgical resection (samples with missing clinical information were excluded). The flowchart of the data analysis was shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical characteristics of STAD patients in the TCGA database.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCharacteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAll\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (y)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e218\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e57.37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e42.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e239\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e62.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrade\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e129\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e33.95\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eG3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e243\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63.95\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13.16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e169\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e44.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e180\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e47.37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eM0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e353\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e92.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e122\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003eTable\u0026nbsp;2. Multivariate Cox regression analysis results of model genes.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c7\" namest=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCoef\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHR.95L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHR.95H\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSERPINE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0224577911629626\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.199456\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.094436\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.314553\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e0.0001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0463621851393052\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.970686\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.412392\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.749666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e6.56E-05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMATN3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.0531597548577127\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.883591\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.396202\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.541119\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e3.40E-05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Acquisition of Differentially Expressed Amino Acid Metabolism Genes (DEAAMGs)\u003c/h2\u003e \u003cp\u003eAmino acid metabolism-related genes were extracted from GSEA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.gsea-msigdb.org/gsea/index.jsp\u003c/span\u003e\u003cspan address=\"http://www.gsea-msigdb.org/gsea/index.jsp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. To obtain differentially expressed amino acid metabolism-related genes, we employed the \u0026ldquo;bioconductor limma\u0026rdquo; R package to analyze the STAD tumor tissues and normal gastric tissues. The fold change\u0026thinsp;\u0026gt;\u0026thinsp;0.5 and false discovery rate\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered as the criteria for DEAAMGs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Construction and Validation of Amino Acid Metabolism Genes-Related Prognostic Model\u003c/h2\u003e \u003cp\u003eWe used the LASSO regression analysis method to construct the best prognostic model\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Univariate cox regression analysis was used to screen for DEAAMGs related to OS through the \u0026ldquo;survival\u0026rdquo; R package. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was a criterion for the prognosis-related gene. Then, we used the LASSO algorithm to avoid overfitting the model and screen out the optimal prognostic genes for constructing the amino acid metabolism-related prognostic model. The risk score in the model is the sum of the expression of each prognosis-related gene, multiplied by the corresponding regression coefficient. All STAD patients in TCGA were divided into high- and low-risk groups according to the median risk score. Next, we performed PCA and t-SNE analysis to investigate the distribution of patients in the high- and low-risk groups using \u0026ldquo;ggplot2\u0026rdquo; and \u0026ldquo;Rtsne\u0026rdquo; R packages. KM analysis was used to analyze the OS between the high- and low-risk groups. Furthermore, a nomogram comprised age, gender, grade, stage and risk score was plotted using \u0026ldquo;regplot\u0026rdquo; and \u0026ldquo;rms\u0026rdquo; R packages. The calibration curve was used to detect the predictive accuracy of the nomogram. The relationship of risk score with tumor grade and stage was analyzed using Spearman correlation analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Functional Enrichment Analysis\u003c/h2\u003e \u003cp\u003eTo further investigate the potential mechanism of model genes affecting the prognosis of STAD patients, we performed Kyoto Gene and Genome Encyclopedia (KEGG) pathway enrichment analysis by GSEA 4.1.0 software\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Firstly, we downloaded \u0026ldquo;c2.cp.kegg.v7.1.symbols.gmt\u0026rdquo; set from Molecular Signatures Database. Then, we used \u0026ldquo;GSEA\u0026rdquo; software to analyze the enriched pathways in the high- and low-risk groups. The \u0026ldquo;ggplot2\u0026rdquo; R package was applied to visualize the top 5 significantly enriched biological pathways in the high- and low-risk groups. The pathways at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Immune Infiltration Analysis\u003c/h2\u003e \u003cp\u003eWe applied the \u0026ldquo;GSVA\u0026rdquo; R package for single sample genomic enrichment analysis (ssGSEA) to analyze the immune cell infiltration and immune-related function\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. A box plot was drawn to visualize the differences in the immune infiltration subtypes between high- and low-risk groups. 2-way ANOVA analysis was used to test the relationship between risk score and immune infiltration subtypes. In addition, we used Spearman correlation analysis to determine the correlation of risk scores with immune cell scores, stromal cell scores, ESTIMATE scores and tumor purity \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Immunotherapy Response Evaluation and Model Comparison\u003c/h2\u003e \u003cp\u003eTo further investigate the efficacy of our prognostic risk model for assessing immunotherapy response, we analyzed immunotherapy biomarkers based on the TCGA data. We uploaded TCGA sample expression profiles to the TIDE database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tide.dfci.harvard.edu/\u003c/span\u003e\u003cspan address=\"http://tide.dfci.harvard.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to obtain dysfunction, exclusion, TIDE, and microsatellite instability (MSI) scores for each sample\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Next, we used the ROC curve to compare the predictive efficacy of the risk score with the TIDE and tumor inflammatory marker (TIS) score\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Drug Sensitivity Analysis\u003c/h2\u003e \u003cp\u003eWe downloaded transcriptomic gene expression data and FDA-certified drug sensitivity data from the CellMiner database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://discover.nci.nih.gov/cellminer/\u003c/span\u003e\u003cspan address=\"https://discover.nci.nih.gov/cellminer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and used Pearson correlation analysis to investigate the correlation of the sensitivity of 216 FDA-certified drugs (Supplementary Table\u0026nbsp;1) with prognosis-related gene expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Cell Culture and siRNA Treatment\u003c/h2\u003e \u003cp\u003eGastric mucosal epithelial cells (GES1), STAD cells (AGS, MKN45, BGC-823, SNU-216, MGC-803, SGC-7901, N87 and HGC-27) were from the American Type Culture Collection (Manassas, VA, USA). Lipofectamine 3000 (Invitrogen, California, USA) was used to transfect MATN3 siRNA (RiboBio, Guangzhou, China) into cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. WB Analysis\u003c/h2\u003e \u003cp\u003eWe extracted proteins from BGC-823 and AGS cells using RIPA lysis buffer (Servicebio, China) and separated the protein samples using 10% SDS-polyacrylamide gel electrophoresis\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Then we transferred the protein to polyvinylidene fluoride membranes. After being blocked with skim milk, membranes were incubated overnight at 4\u0026deg;C with the following primary antibodies: MATN3 (Abclonal, China), GAPDH (Proteintech, USA), then followed by the secondary antibody at 25\u0026deg;C for 1 hour. Finally, the proteins were detected by West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. qRT-PCR\u003c/h2\u003e \u003cp\u003eTRIzol reagent (TaKaRa, Japan) was used to extract cellular RNA. Hi Script II QRT SuperMix (Vazyme, China) was employed to synthesize cDNA, then qRT-RCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). The primers were as follows: MATN3-Forward: ACATGGCGTCCCTCAAGATG; MATN3-Reverse: GCACAGAAGGTTTCCTGGAATC; GAPDH-Forward: GACCACAGTCCATGCCATCA; GAPDH-Reverse: GTCAAAGGTGGAGGAGTGGG.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. CCK8 and Colony Formation Assays\u003c/h2\u003e \u003cp\u003eAfter being transfected with MATN3 siRNA for 48 h, BGC-823 and AGS cells were seeded into 96-well plates. Then we added the CCK8 reagent (MCE, USA) according to the manufacturer's instructions and detected the OD450 values using a microplate reader (BioTek, USA). For colony formation assay, BGC-823 and AGS cells were inoculated in 6-well plates and cultured for 2 weeks, and the number of cell clones per well was counted after crystalline violet staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Wound Healing Assay\u003c/h2\u003e \u003cp\u003eBGC-823 and AGS cells were seeded into a 24-well-plate and then scraped with a 10 \u0026micro;l pipette tip. Images of cell migration were captured at 0, 24, and 48 hours after scratching.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Transwell Migration Assay\u003c/h2\u003e \u003cp\u003eCells were cultured in the upper chamber with 200 \u0026micro;l medium without serum, and the lower chamber was added to 500 \u0026micro;l medium containing 20% fetal bovine serum. After incubation for 24 h at 37\u0026deg;, the cells in the lower chamber were fixed with methanol and stained with 1% crystal violet, and then the cells were counted with light microscopy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14. Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe gene differences between tumor tissue and normal tissue were analyzed by the Wilcoxon test. R software (version 4.0.4) and GraphPad Prism 7 software (version 7.0) were used to perform the statistical analysis. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003ch2\u003e3.1. Acquisition of Differentially Expressed Amino Acid Metabolism Genes (DEAAMGs) related to OS in TCGA Cohort\u003c/h2\u003e \u003cp\u003eDifferential expression analysis of the gene expression and clinical data in the TCGA cohort identified a total of 2495 DEAAMGs between normal tissue and tumor tissue of STAD patients, including 574 down-regulated and 1921 up-regulated genes in STAD tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table\u0026nbsp;2). Next, 294 DEAAMGs were found to be related to OS by Univariate cox regression analysis, including 161 high-risk genes and 133 low-risk genes (Supplementary Table\u0026nbsp;3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Construction of an Amino Acid Metabolism Genes-Related Prognostic Model in TCGA Cohort\u003c/h2\u003e \u003cp\u003eThrough analyzing the 294 prognosis-related DEAAMGs and excluding the relatively unimportant genes from the model through LASSO Cox regression analysis, we screened 3 genes (SERPINE1, NRP1, MATN3) to develop a prognostic risk model (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Risk score\u0026thinsp;=\u0026thinsp;0.022458 \u0026times; SERPINE1\u0026thinsp;+\u0026thinsp;0.046362 \u0026times; NRP1\u0026thinsp;+\u0026thinsp;0.053160 \u0026times; MATN3 (Table\u0026nbsp;2). In this model, SERPINE1, NRP1 and MATN3 were indicators of the poor prognosis. The median cut-off value of risk score divided STAD patients into high-risk and low-risk groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The results of PCA and t-SNE analyses demonstrated that the high-risk and low-risk groups could be separated based on the expression of 3 prognostic DEAAMGs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, E). In addition, the survival status scatter plots suggested that high-risk patients were more likely to have a poor prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Similarly, KM survival analysis results also demonstrated that patients in the low-risk group had a longer OS (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Furthermore, we plotted a nomogram to precisely predict the prognosis for each patient according to the risk score and clinical characteristics. For example, the total points of the patient in the nomogram were 327, which represented the 1, 3 and 5-year survival rates were 75.4%, 43.4% and 31.2%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). The calibration curve showed the high predictive accuracy of the nomogram (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Validation of the 3-Gene Prognostic Model in the GEO Cohort\u003c/h2\u003e \u003cp\u003eTo test the predictive stability of this prognostic model, we downloaded transcriptomic gene expression data and clinical data of STAD patients from the GEO database as external validation. Similarly, we divided STAD patients into high- and low-risk groups based on the above median cut-off value of risk score (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). PCA and t-SNE analysis revealed that the expression of the model genes could separate the high- and low-risk groups in the GEO cohort well (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). Besides, scatter plots and KM survival analyses showed that high-risk patients were prone to have a poorer prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD) and shorter OS (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) compared to low-risk patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). In addition, we analyzed the clinical characteristics and found that the risk scores were higher in the patients with tumor grade 3 compared to those with grade 1\u0026ndash;2 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), and patients with tumor stage III-IV also had higher risk scores than those with stage I-II (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4. KEGG Pathway Enrichment Analysis\u003c/h2\u003e \u003cp\u003eTo explore the potential mechanism of the model genes regulating the prognosis, we used GSEA to perform the KEGG pathway enrichment analysis and found that the focal adhesion and ECM receptor interaction pathways were significantly enriched in the high-risk group, while the low-risk group was mainly enriched in the spliceosome and oxidative phosphorylation pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In addition, we found that tumor-associated pathways were mainly enriched in the high-risk group, such as the MAPK signaling pathway, JAK-STAT signaling pathway and TGF-β signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-D). Notably, we noticed 4 immune-related pathways, such as cytokine-cytokine receptor interaction, toll like receptor (TLR) signaling pathway, chemokine signaling pathway and nod like receptor signaling pathway were also significantly enriched in the high-risk group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-H), indicating that amino acid metabolism genes might be associated with the progression of STAD through regulating the immune-related pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Immune Infiltration Analysis\u003c/h2\u003e \u003cp\u003eThus, to further explore the correlation between amino acid metabolism and immune infiltration in STAD, we performed immune cell subtypes and immune-related functions analysis by ssGSEA. We found that aDCs, DCs, iDCs, pDCs, B cells, CD8\u0026thinsp;+\u0026thinsp;T cells, macrophages, mast cells, neutrophils, T helper cells, Tfh, Th1 cells, TIL and Treg cells were significantly increased in the high-risk group than low-risk group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). In addition, immune-related function analysis showed that inflammation-promoting, parainflammation, APC co-inhibition, APC co-stimulation, T cell co-inhibition, T-cell co-stimulation, CCR, check-point, cytolytic activity, HLA, Type I IFN response and Type II IFN response were significantly increased in the high-risk group than low-risk group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). There were six types of immune infiltration in human tumors, namely C1 (wound healing type), C2 (IFN-gamma dominant type), C3 (inflammatory type), C4 (lymphocyte depleted type), C5 (immunologically quiet type) and C6 (TGF-β dominant type)\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Among them, the STAD patients belonging to the C5 immune subtype in the TCGA dataset were not sufficient for study, therefore, we analyzed the other five immune subtypes. We found that high-risk scores were significantly related to C6, while low-risk scores were significantly related to C4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Furthermore, Spearman correlation analysis showed that high risk score was associated with high immune score \u003cem\u003e(p\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), ESTIMATE score (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE), stromal score (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), and low tumor purity (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), suggesting that the higher immune composition and lower tumor purity predicted the poorer prognosis for STAD patients.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Immunotherapy Response Evaluation and Model Comparison\u003c/h2\u003e \u003cp\u003eGiven that the risk score was related to immune cell infiltration according to the above results, we analyzed immunotherapy biomarkers based on the TCGA dataset to further investigate whether our prognostic model could be used to predict immunotherapy response. The results showed a higher dysfunction score (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), exclusion score (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), TIDE score (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) and a lower MSI score (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD) in high-risk group, suggesting that high-risk group had a higher immune escape potential and a less benefit from immunotherapy. Furthermore, compared with the TIDE score and TIS score, our risk score had the largest area under the curve value, indicating a higher prognostic predictive efficacy than the TIDE score and TIS score (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Drug Sensitivity Analysis\u003c/h2\u003e \u003cp\u003eTo investigate the availability of our prognostic model in chemotherapy and targeted therapy, we analyzed the correlation between our model genes and FDA-approved drug sensitivity. The results demonstrated that the expression of NRP1 was positively correlated with the treatment sensitivity of dasatinib, simvastatin, idelalisib and midostaurin (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e), and negatively correlated with the treatment sensitivity of tamoxifen (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The expression of MATN3 was negatively correlated with the treatment sensitivity of eribulin mesilate, vinblastine, pipamperone, paclitaxel and vinorelbine (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e) and positively correlated with the treatment sensitivity of erlotinib and dacomitinib \u003cem\u003e(p\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). SERPINE1 expression was negatively correlated with tamoxifen and nilotinib sensitivity (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e), and positively correlated with simvastatin and lenvatinib sensitivity \u003cem\u003e(p\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Interference with MATN3 Expression Inhibits Proliferation and Migration of STAD Cells\u003c/h2\u003e \u003cp\u003eTo further increase the credibility of our prognostic model, we conducted functional validation through in vitro experiments. Since previous studies have reported the role of SERPINE1 and NRP1 in promoting the proliferation and migration of gastric cancer cells, thus, we selected MATN3 for subsequent functional validation\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. We detected the expression of MATN3 mRNA in gastric mucosal epithelial cell line GES1 and STAD cell lines AGS, BGC-823, SNU-216, MKN45, SGC-7901, MGC-803, N87 and HGC-27. The results showed that MATN3 expression was highest in AGS (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and BGC-823 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA), thus we used AGS and BGC-823 cells for subsequent experiments. The expression of MATN3 in BGC-823 and AGS cells was successfully interfered with siRNA and confirmed by qRT-PCR (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and WB (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB, C). The CCK8 assay showed that MATN3 interference significantly inhibited BGC-823 and AGS cell proliferation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). The colony formation assay revealed that MATN3 interference significantly inhibited colony formation in BGC-823 and AGS cells (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Supplementary Fig.\u0026nbsp;1A, B). Subsequently, we used wound healing and transwell migration assays to explore the effect of MATN3 interference on the migration ability of STAD cells. The results showed that interference of MATN3 significantly inhibited the migration ability of BGC-823 and AGS cells (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE-H). Taken together, interference of MATN3 expression inhibited STAD cell proliferation and migration, further confirming the predictive credibility of our prognostic model.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe important role of metabolism in tumors is gradually being recognized. Increasing evidence has proven that abnormal metabolic features exist in tumors\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Dysfunctional metabolic activities can promote tumor cell proliferation, recurrence and metastasis, affecting the immunosuppressive properties and malignant phenotype of tumors\u003csup\u003e[\u003cspan additionalcitationids=\"CR46 CR47\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. With the rapid development of bioinformatics technology, more and more studies have illustrated the metabolism-related risk profile of the tumor, including STAD\u003csup\u003e[\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. However, there is still a lack of study on amino acid metabolism-related genes in STAD. Thus, in this study, we analyzed the characteristic of amino acid metabolism-related genes in STAD.\u003c/p\u003e \u003cp\u003eWe firstly extracted prognosis-related amino acid metabolism genes by analyzing transcriptomic gene expression data and clinical parameters of STAD patients in TCGA and successfully constructed an amino acid metabolism genes-related prognostic model, consisting of 3 genes (SERPINE1, NRP1, MATN3). SERPINE1, a member of the serine protease inhibitor family, has been reported to promote tumor progression and metastasis\u003csup\u003e[\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e. Recent studies have reported that SERPINE1 is a reliable prognostic marker for gastric cancer, breast cancer, ovarian cancer, colorectal cancer, bladder cancer and many other cancers\u003csup\u003e[\u003cspan additionalcitationids=\"CR56 CR57 CR58 CR59 CR60\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. Our study identified SERPINE1 as a prognostic marker in STAD and found the potential role of SERPINE1 in regulating the immune cells infiltration, which is consistent with previous studies\u003csup\u003e[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]\u003c/sup\u003e. NRP-1, a transmembrane protein, acts as a multifunctional coreceptor involved in cancer initiation, growth and metastasis\u003csup\u003e[\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]\u003c/sup\u003e. NRP-1 is a potential target in cancer therapy and negatively correlates with the prognosis of esophageal squamous cell carcinoma, hepatocellular carcinoma and colorectal cancer\u003csup\u003e[\u003cspan additionalcitationids=\"CR66\" citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]\u003c/sup\u003e. In gastric cancer, NRP-1 promotes the gastric cancer cells proliferation and migration of and is associated with the clinicopathological staging\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. In our study, we further confirmed its role in predicting the prognosis and immunotherapy efficacy of STAD patients. MATN3, a protein-encoding gene, has been mainly focused on its role in cartilage and skeletal development in past studies\u003csup\u003e[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. Recently, MATN3 was reported to be highly expressed in STAD patients\u003csup\u003e[\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e. However, the role of MATN3 in the prognosis of STAD patients was still unclear. In our study, we found that MATN3 might influence the prognosis of STAD patients by involving in the metabolism acid metabolism and immune infiltration in the tumor microenvironment. In addition, we further confirmed the importance of MATN3 in promoting the proliferation and migration ability in gastric cancer through in vitro studies.\u003c/p\u003e \u003cp\u003eImmunometabolism provides an understanding of the relationship between immune response and metabolism\u003csup\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]\u003c/sup\u003e. Amino acids, as the main raw materials for protein synthesis, regulate the immune function through energy metabolism, redox balance, epigenetic modification and protein post-translational modification\u003csup\u003e[\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]\u003c/sup\u003e. Tumor cells require a continuous supply of amino acids, which leads to a metabolic competition between tumor cells and immune cells\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Metabolic remodeling of immune cells in the tumor microenvironment plays a potential role in the progression and metastasis of the tumor\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/sup\u003e. We explored the role of amino acid metabolism-related model in immune infiltration in STAD. In this study, we found immune-related pathways, such as cytokine-cytokine receptor interaction, TLR signaling pathway, chemokine signaling pathway and nod like receptor signaling pathway were significantly enriched in the high-risk group. Further analysis demonstrated that the high-risk scores were associated with higher immune cell infiltration and TGF-β dominant immune subtype, demonstrating that amino acid metabolism-related genes might influence STAD patient prognosis through regulating immune-related pathways and TGF-β dominant immune subtype cell infiltration. In gastric cancer, CXC chemokines and their receptors regulate cell transport into and out of tumor microenvironment, influence tumorigenesis indirectly by regulating tumor growth, survival, transformation, invasion, and metastasis, as well as indirectly by modulating tumor-leukocyte interactions and angiogenesis\u003csup\u003e[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]\u003c/sup\u003e. TLRs are key innate immunopathogenic sensors mediating chronic inflammation and carcinogenic responses. TLR9 promotes gastric cancer initiation and the gastric inflammation and hyperplasia induced by Helicobacter pylori\u003csup\u003e[\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]\u003c/sup\u003e. Nod like receptor family are patterns recognition receptors related with innate immunity. NLRX1, a member of the nod like receptor family, is reported to be associated with increased risk of Helicobacter pylori infection, which is common risk factor for developing gastric cancer\u003csup\u003e[\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]\u003c/sup\u003e. TGF-β, a key factor of immune homeostasis and tolerance, inhibits the expansion and function of the immune system\u003csup\u003e[\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]\u003c/sup\u003e. TGF-β signaling has dual roles in the development and progression of gastrointestinal tumor as both a suppressor and promoter\u003csup\u003e[\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]\u003c/sup\u003e. Furthermore, we revealed that the high-risk group had a higher immune escape potential, indicating a poorer immunotherapy effect, which provided a potential reference for applying immunotherapy in STAD patients.\u003c/p\u003e \u003cp\u003eKEGG functional enrichment analysis revealed the possible mechanisms of amino acid metabolism genes in STAD. We found that the tumor-associated pathways, such as the JAK-STAT signaling pathway, TGF-β signaling pathway and MAPK signaling pathway were enriched in the high-risk group, suggesting that amino acid metabolism genes may affect STAD prognosis through these pathways. The relationship between MAPK signaling pathway and amino acid metabolism has been reported. A previous study showed that L-Glutamine deficiency disturbed amino acid metabolism and attenuated mTOR and MAPK/ERK signaling pathways, thereby affecting protein synthesis and cell proliferation\u003csup\u003e[\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]\u003c/sup\u003e. The JAK-STAT signaling pathway is related with varieties of physiological processes such as cell proliferation, immune response, and stem cell self-renewal\u003csup\u003e[\u003cspan additionalcitationids=\"CR80\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]\u003c/sup\u003e. Aberrant activation of the JAK/STAT pathway has also been reported to be related to gastric cancer progression\u003csup\u003e[\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]\u003c/sup\u003e. Inhibition of STAT3 significantly reduces the expression of the anti-apoptotic protein survivin, which promotes gastric cancer cell death\u003csup\u003e[\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]\u003c/sup\u003e. TGF-β signaling pathway can affect cancer progression by regulating the immune response, tumor microenvironment, epithelial-mesenchymal transition, and cancer cell stemness\u003csup\u003e[\u003cspan additionalcitationids=\"CR85\" citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]\u003c/sup\u003e. A previous study showed that TGF-β expression was elevated in the tumor tissue of gastric cancer patients and was associated with a poorer prognosis\u003csup\u003e[\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo further increase the clinical translational value of our study, we performed the FDA-approved drug sensitivity analysis. By analyzing data from the CellMiner database, we found that our model genes were associated with the patient\u0026rsquo;s sensitivity to many FDA-approved drugs. The expression of SERPINE1 was positively correlated with the therapeutic sensitivity to lenvatinib. It has been reported that the combination of lenvatinib with pembrolizumab has promising antitumor activity in patients with advanced gastric cancer\u003csup\u003e[\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]\u003c/sup\u003e. In addition, our study found that MATN3 expression was positively correlated with the therapeutic sensitivity to dacomitinib. In a previous clinical trial, dacomitinib showed good efficacy in HER2-positive gastric cancer patients\u003csup\u003e[\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e]\u003c/sup\u003e. Therefore, our study may provide a potential reference for drug selection in STAD patients.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we developed a prognostic model of amino acid metabolism in STAD and demonstrated its high efficiency through the external validation. KEGG pathway enrichment analysis, immune infiltration analysis, immunotherapy efficacy prediction and drug sensitivity analysis further revealed that this model is highly correlated with immunity, discovered the potential mechanism, and enhanced the clinical application value. Finally, in vitro experiment demonstrated that model gene MATN3 promoted the proliferation and migration in gastric cancer, providing the basis for further study on the amino acid metabolism in STAD.\u003c/p\u003e \u003cp\u003eIn conclusion, our study revealed that targeting amino acid metabolism might be a potential therapeutic method to improve STAD patients\u0026rsquo; prognosis and provides a personalized predictive tool for prognosis and immunotherapy response in STAD.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eDifferentially expressed amino acid metabolism genes (DEAAMGs)\u003c/p\u003e\n\u003cp\u003eGene Expression Omnibus (GEO)\u003c/p\u003e\n\u003cp\u003eGastric mucosal epithelial cells (GES1)\u003c/p\u003e\n\u003cp\u003eGene Set Enrichment Analysis (GSEA)\u003c/p\u003e\n\u003cp\u003eIndoleamine 2,3-dioxygenase (IDO)\u003c/p\u003e\n\u003cp\u003eKyoto Gene and Genome Encyclopedia (KEGG)\u003c/p\u003e\n\u003cp\u003eKaplan-Meier (KM)\u003c/p\u003e\n\u003cp\u003eLeast absolute shrinkage and selection operator (LASSO)\u003c/p\u003e\n\u003cp\u003eMicrosatellite instability\u0026nbsp;(MSI)\u003c/p\u003e\n\u003cp\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/p\u003e\n\u003cp\u003eSingle sample genomic enrichment analysis (ssGSEA)\u003c/p\u003e\n\u003cp\u003eStomach adenocarcinoma (STAD)\u003c/p\u003e\n\u003cp\u003eThe Cancer Genome Atlas (TCGA)\u003c/p\u003e\n\u003cp\u003eTumor immune dysfunction and exclusion (TIDE)\u003c/p\u003e\n\u003cp\u003eTumor inflammatory marker (TIS)\u003c/p\u003e\n\u003cp\u003eWestern blot (WB)\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthors\u0026apos; contributions\u003c/h2\u003e\n\u003cp\u003eGuangyuan Hu, Xiaohong Peng and Yuanyuan Zhang conceived of the study. Wenjun Zhu, Min Fu, Qianxia Li and Xin Chen searched the literature, conducted data analysis and experiments, and produced the manuscript. Xiaoyu Li, Na Luo, Wenhua Tang, Feng Yang, Ziqi Chen and Yiling Zhang revised the manuscript. All authors have read and approved the manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eThanks to the TCGA and GEO databases for the availability of the above data. Thanks to the Huazhong University of Science \u0026amp; Technology Analytical \u0026amp; Testing center for the technical support.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThe study was funded by the National Natural Sciences Foundation of China (Grant No. 82003312, 82173311).\u003c/p\u003e\n\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\n\u003cp\u003eAll data generated and analyzed in this study are included in this article and its supplementary files. The transcriptomic gene expression data (TCGA and GSE84433 series matrix) and corresponding clinical information were downloaded from the TCGA database (https://portal.gdc.cancer.gov/) and GEO database (https://www.ncbi.nlm.nih.gov/).\u003c/p\u003e\n\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003ch2\u003eSupplementary information\u003c/h2\u003e\n\u003cp\u003eAll the supplementary files have been properly named and uploaded.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries [J]. CA Cancer J Clin. 2021;71(3):209\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3322/caac.21660\u003c/span\u003e\u003cspan address=\"10.3322/caac.21660\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmyth EC, Nilsson M, Grabsch HI, et al. Gastric cancer [J]. Lancet (London England). 2020;396(10251):635\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(20)31288-5\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(20)31288-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarimi P, Islami F, Anandasabapathy S, et al. Gastric cancer: descriptive epidemiology, risk factors, screening, and prevention [J]. Cancer Epidemiol Biomarkers Prev. 2014;23(5):700\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/1055-9965.EPI-13-1057\u003c/span\u003e\u003cspan address=\"10.1158/1055-9965.EPI-13-1057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eButler M, Van Der Meer LT, Van Leeuwen FN. Amino Acid Depletion Therapies: Starving Cancer Cells to Death [J]. Trends Endocrinol Metab. 2021;32(6):367\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tem.2021.03.003\u003c/span\u003e\u003cspan address=\"10.1016/j.tem.2021.03.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarburg O. On the origin of cancer cells [J]. Science. 1956;123(3191):309\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanahan D. Hallmarks of Cancer: New Dimensions [J]. Cancer Discov. 2022;12(1):31\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/2159-8290.CD-21-1059\u003c/span\u003e\u003cspan address=\"10.1158/2159-8290.CD-21-1059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNajumudeen AK, Ceteci F, Fey SK, et al. The amino acid transporter SLC7A5 is required for efficient growth of KRAS-mutant colorectal cancer [J]. Nat Genet. 2021;53(1):16\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41588-020-00753-3\u003c/span\u003e\u003cspan address=\"10.1038/s41588-020-00753-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu L, Chen J, Jia L, et al. SLC1A3 promotes gastric cancer progression via the PI3K/AKT signalling pathway [J]. J Cell Mol Med. 2020;24(24):14392\u0026ndash;404. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jcmm.16060\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.16060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkuda K, Umemura A, Kataoka S, et al. Enhanced Antitumor Effect in Liver Cancer by Amino Acid Depletion-Induced Oxidative Stress [J]. Front Oncol. 2021;11(758549). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2021.758549\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2021.758549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu Y-Y, Zhao R, Zhang H-L, et al. Inactivation of the AMPK-GATA3-ECHS1 Pathway Induces Fatty Acid Synthesis That Promotes Clear Cell Renal Cell Carcinoma Growth [J]. Cancer Res. 2020;80(2):319\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-19-1023\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-19-1023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Han J. Branched-chain amino acid transaminase 1 (BCAT1) promotes the growth of breast cancer cells through improving mTOR-mediated mitochondrial biogenesis and function [J]. Biochem Biophys Res Commun. 2017;486(2):224\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2017.02.101\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2017.02.101\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z-Q, Faddaoui A, Bachvarova M, et al. BCAT1 expression associates with ovarian cancer progression: possible implications in altered disease metabolism [J]. Oncotarget. 2015;6(31):31522\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.5159\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.5159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei Z, Liu X, Cheng C, et al. Metabolism of Amino Acids in Cancer [J]. Front Cell Dev Biol. 2020;8(603837). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2020.603837\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2020.603837\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu H, Xue R, Tang Z, et al. Metabolomic investigation of gastric cancer tissue using gas chromatography/mass spectrometry [J]. Anal Bioanal Chem. 2010;396(4):1385\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00216-009-3317-4\u003c/span\u003e\u003cspan address=\"10.1007/s00216-009-3317-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi JM, Park WS, Song KY, et al. Development of simultaneous analysis of tryptophan metabolites in serum and gastric juice - an investigation towards establishing a biomarker test for gastric cancer diagnosis [J]. Biomed Chromatogr. 2016;30(12):1963\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bmc.3773\u003c/span\u003e\u003cspan address=\"10.1002/bmc.3773\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng K, Lin S, Zhou L, et al. Three aromatic amino acids in gastric juice as potential biomarkers for gastric malignancies [J]. Anal Chim Acta. 2011;694(1\u0026ndash;2):100\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.aca.2011.03.053\u003c/span\u003e\u003cspan address=\"10.1016/j.aca.2011.03.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J-L, Tang H-Q, Hu J-D, et al. Metabolomics of gastric cancer metastasis detected by gas chromatography and mass spectrometry [J]. World J Gastroenterol. 2010;16(46):5874\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung J, Jung Y, Bang EJ et al. Noninvasive diagnosis and evaluation of curative surgery for gastric cancer by using NMR-based metabolomic profiling [J]. Ann Surg Oncol, 2014, 21 Suppl 4(S736-S742. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1245/s10434-014-3886-0\u003c/span\u003e\u003cspan address=\"10.1245/s10434-014-3886-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsslinger CS, Cybulski KA, Rhoderick JF. Ngamma-aryl glutamine analogues as probes of the ASCT2 neutral amino acid transporter binding site [J]. Bioorg Med Chem. 2005;13(4):1111\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu J, Chen M, Tao Z, et al. Effects of targeting SLC1A5 on inhibiting gastric cancer growth and tumor development in vitro and in vivo [J]. Oncotarget. 2017;8(44):76458\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.19479\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.19479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai Z, Zhao J-S, Li J-J, et al. A combined proteomics and metabolomics profiling of gastric cardia cancer reveals characteristic dysregulations in glucose metabolism [J]. Mol Cell Proteomics. 2010;9(12):2617\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/mcp.M110.000661\u003c/span\u003e\u003cspan address=\"10.1074/mcp.M110.000661\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly B, Pearce EL. Amino Assets: How Amino Acids Support Immunity [J]. Cell Metabol. 2020;32(2):154\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2020.06.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2020.06.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBian Y, Li W, Kremer DM, et al. Cancer SLC43A2 alters T cell methionine metabolism and histone methylation [J]. Nature. 2020;585(7824):277\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-020-2682-1\u003c/span\u003e\u003cspan address=\"10.1038/s41586-020-2682-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu D. Innate and Adaptive Immune Cell Metabolism in Tumor Microenvironment [J]. Adv Exp Med Biol. 2017;1011:211\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-94-024-1170-6_7\u003c/span\u003e\u003cspan address=\"10.1007/978-94-024-1170-6_7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrochez L, Chevolet I, Kruse V. The rationale of indoleamine 2,3-dioxygenase inhibition for cancer therapy [J]. Eur J Cancer. 2017;76:167\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejca.2017.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ejca.2017.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHowden AJM, Hukelmann JL, Brenes A, et al. Quantitative analysis of T cell proteomes and environmental sensors during T cell differentiation [J]. Nat Immunol. 2019;20(11):1542\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41590-019-0495-x\u003c/span\u003e\u003cspan address=\"10.1038/s41590-019-0495-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarr EL, Kelman A, Wu GS, et al. Glutamine uptake and metabolism are coordinately regulated by ERK/MAPK during T lymphocyte activation [J]. J Immunol (Baltimore Md: 1950). 2010;185(2):1037\u0026ndash;44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.0903586\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.0903586\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoftus RM, Assmann N, Kedia-Mehta N, et al. Amino acid-dependent cMyc expression is essential for NK cell metabolic and functional responses in mice [J]. Nat Commun. 2018;9(1):2341. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-018-04719-2\u003c/span\u003e\u003cspan address=\"10.1038/s41467-018-04719-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoon BR, Oh Y-J, Kang SW, et al. Role of SLC7A5 in Metabolic Reprogramming of Human Monocyte/Macrophage Immune Responses [J]. Front Immunol. 2018;9(53). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2018.00053\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2018.00053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao M, Yang H, Xu W, et al. Inhibition of α-KG-dependent histone and DNA demethylases by fumarate and succinate that are accumulated in mutations of FH and SDH tumor suppressors [J]. Genes Dev. 2012;26(12):1326\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gad.191056.112\u003c/span\u003e\u003cspan address=\"10.1101/gad.191056.112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHutter C, Zenklusen JC. Cell. 2018;173(2):283\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2018.03.042\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2018.03.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The Cancer Genome Atlas: Creating Lasting Value beyond Its Data [J].\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrett T, Troup DB, Wilhite SE, et al. NCBI GEO: mining tens of millions of expression profiles\u0026ndash;database and tools update [J]. Nucleic Acids Res. 2007;35(Database issue):D760\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles [J]. Proc Natl Acad Sci U S A. 2005;102(43):15545\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang J, Liu D, Xu G, et al. TRIM68, PIKFYVE, and DYNLL2: The Possible Novel Autophagy- and Immunity-Associated Gene Biomarkers for Osteosarcoma Prognosis [J]. Front Oncol. 2021;11(643104). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2021.643104\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2021.643104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo S, Wei M, Wang S, et al. Pan-Cancer Analysis of Immune Cell Infiltration Identifies a Prognostic Immune-Cell Characteristic Score (ICCS) in Lung Adenocarcinoma [J]. Front Immunol. 2020;11(1218). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2020.01218\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2020.01218\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshihara K, Shahmoradgoli M, Mart\u0026iacute;nez E, et al. Inferring tumour purity and stromal and immune cell admixture from expression data [J]. Nat Commun. 2013;4(2612). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms3612\u003c/span\u003e\u003cspan address=\"10.1038/ncomms3612\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang P, Gu S, Pan D, et al. Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response [J]. Nat Med. 2018;24(10):1550\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41591-018-0136-1\u003c/span\u003e\u003cspan address=\"10.1038/s41591-018-0136-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanaher P, Warren S, Lu R, et al. Pan-cancer adaptive immune resistance as defined by the Tumor Inflammation Signature (TIS): results from The Cancer Genome Atlas (TCGA) [J]. J Immunother Cancer. 2018;6(1):63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40425-018-0367-1\u003c/span\u003e\u003cspan address=\"10.1186/s40425-018-0367-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTowbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications [J]. Proc Natl Acad Sci U S A. 1979;76(9):4350\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Z, Xu Q, Miao D, et al. An Inflammatory Response-Related Gene Signature Can Impact the Immune Status and Predict the Prognosis of Hepatocellular Carcinoma [J]. Front Oncol. 2021;11(644416). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2021.644416\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2021.644416\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Li Y, Zhu Y et al. SERPINE1 Overexpression Promotes Malignant Progression and Poor Prognosis of Gastric Cancer [J]. J Oncol, 2022, 2022(2647825. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/2647825\u003c/span\u003e\u003cspan address=\"10.1155/2022/2647825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Jiang X, Zhang Q, et al. Neuropilin-1 is associated with clinicopathology of gastric cancer and contributes to cell proliferation and migration as multifunctional co-receptors [J]. J Exp Clin Cancer Res. 2016;35(16). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13046-016-0291-5\u003c/span\u003e\u003cspan address=\"10.1186/s13046-016-0291-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoroughs LK, Deberardinis RJ. Metabolic pathways promoting cancer cell survival and growth [J]. Nat Cell Biol. 2015;17(4):351\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncb3124\u003c/span\u003e\u003cspan address=\"10.1038/ncb3124\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArmitage EG, Ciborowski M. Applications of Metabolomics in Cancer Studies [J]. Adv Exp Med Biol. 2017;965:209\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-319-47656-8_9\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-47656-8_9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Ning S, Ghandi M, et al. The landscape of cancer cell line metabolism [J]. Nat Med. 2019;25(5):850\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41591-019-0404-8\u003c/span\u003e\u003cspan address=\"10.1038/s41591-019-0404-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanahan D, Weinberg RA. Hallmarks of cancer: the next generation [J]. Cell. 2011;144(5):646\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2011.02.013\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2011.02.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang C-H, Qiu J, O'sullivan D, et al. Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression [J]. Cell. 2015;162(6):1229\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2015.08.016\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2015.08.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo P-C, Bihuniak JD, Macintyre AN, et al. Phosphoenolpyruvate Is a Metabolic Checkpoint of Anti-tumor T Cell Responses [J]. Cell. 2015;162(6):1217\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2015.08.012\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2015.08.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Zhang J, Wang S, et al. Identification and Validation of a Nine-Gene Amino Acid Metabolism-Related Risk Signature in HCC [J]. Front Cell Dev Biol. 2021;9(731790). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2021.731790\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2021.731790\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu W, Feng W, et al. Identification of 14 Differentially-Expressed Metabolism-Related Genes as Potential Targets of Gastric Cancer by Integrated Proteomics and Transcriptomics [J]. Front Cell Dev Biol. 2022;10(816249). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2022.816249\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2022.816249\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe Z, Zheng M, Zeng Y, et al. A 13-Gene Metabolic Prognostic Signature Is Associated With Clinical and Immune Features in Stomach Adenocarcinoma [J]. Front Oncol. 2021;11(612952). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2021.612952\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2021.612952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeclerck PJ, Gils A. Three decades of research on plasminogen activator inhibitor-1: a multifaceted serpin [J]. Semin Thromb Hemost. 2013;39(4):356\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1055/s-0033-1334487\u003c/span\u003e\u003cspan address=\"10.1055/s-0033-1334487\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeker F, Cingoz A, Sur-Erdem İ, et al. Identification of as a Regulator of Glioblastoma Cell Dispersal with Transcriptome Profiling [J]. Cancers (Basel). 2019;11(11). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers11111651\u003c/span\u003e\u003cspan address=\"10.3390/cancers11111651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanekom GS, Stubbings HM, Kidson SH. The active fraction of plasmatic plasminogen activator inhibitor type 1 as a possible indicator of increased risk for metastatic melanoma [J]. Cancer Detect Prev. 2002;26(1):50\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu B, Bai Z, Yin J, et al. Global transcriptomic analysis identifies as a prognostic biomarker associated with epithelial-to-mesenchymal transition in gastric cancer [J]. PeerJ. 2019;7(e):7091. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7717/peerj.7091\u003c/span\u003e\u003cspan address=\"10.7717/peerj.7091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJevrić M, Matić IZ, Krivokuća A, et al. Association of uPA and PAI-1 tumor levels and 4G/5G variants of PAI-1 gene with disease outcome in luminal HER2-negative node-negative breast cancer patients treated with adjuvant endocrine therapy [J]. BMC Cancer. 2019;19(1):71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12885-018-5255-z\u003c/span\u003e\u003cspan address=\"10.1186/s12885-018-5255-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarbeck N, Kates RE, Gauger K, et al. Urokinase-type plasminogen activator (uPA) and its inhibitor PAI-I: novel tumor-derived factors with a high prognostic and predictive impact in breast cancer [J]. Thromb Haemost. 2004;91(3):450\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakakibara T, Hibi K, Koike M, et al. Plasminogen activator inhibitor-1 as a potential marker for the malignancy of colorectal cancer [J]. Br J Cancer. 2005;93(7):799\u0026ndash;803.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakatsuka E, Sawada K, Nakamura K, et al. Plasminogen activator inhibitor-1 is an independent prognostic factor of ovarian cancer and IMD-4482, a novel plasminogen activator inhibitor-1 inhibitor, inhibits ovarian cancer peritoneal dissemination [J]. Oncotarget. 2017;8(52):89887\u0026ndash;902. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.20834\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.20834\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan OTM, Furuya H, Pagano I, et al. Association of MMP-2, RB and PAI-1 with decreased recurrence-free survival and overall survival in bladder cancer patients [J]. Oncotarget. 2017;8(59):99707\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.20686\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.20686\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker M, Szarvas T, Wittschier M, et al. Prognostic impact of plasminogen activator inhibitor type 1 expression in bladder cancer [J]. Cancer. 2010;116(19):4502\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cncr.25326\u003c/span\u003e\u003cspan address=\"10.1002/cncr.25326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Z, Liu X, Wu C, et al. A New Strategy to Identify ceRNA-Based CCDC144NL-AS1/SERPINE1 Regulatory Axis as a Novel Prognostic Biomarker for Stomach Adenocarcinoma High Throughput Transcriptome Data Mining and Computational Verification [J]. Front Oncol. 2021;11(802727). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2021.802727\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2021.802727\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Pang L, Liu Z, et al. SERPINE1 associated with remodeling of the tumor microenvironment in colon cancer progression: a novel therapeutic target [J]. BMC Cancer. 2021;21(1):767. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12885-021-08536-7\u003c/span\u003e\u003cspan address=\"10.1186/s12885-021-08536-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrud'homme GJ, Glinka Y. Neuropilins are multifunctional coreceptors involved in tumor initiation, growth, metastasis and immunity [J]. Oncotarget. 2012;3(9):921\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerg\u0026eacute; M, Allanic D, Bonnin P, et al. Neuropilin-1 is upregulated in hepatocellular carcinoma and contributes to tumour growth and vascular remodelling [J]. J Hepatol. 2011;55(4):866\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhep.2011.01.033\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2011.01.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlattar M, Omo A, Elsharawy M, et al. Neuropilin-1 expression in squamous cell carcinoma of the oesophagus [J]. Eur J Cardiothorac Surg. 2014;45(3):514\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ejcts/ezt380\u003c/span\u003e\u003cspan address=\"10.1093/ejcts/ezt380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStaton CA, Koay I, Wu JM, et al. Neuropilin-1 and neuropilin-2 expression in the adenoma-carcinoma sequence of colorectal cancer [J]. Histopathology. 2013;62(6):908\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/his.12098\u003c/span\u003e\u003cspan address=\"10.1111/his.12098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlatt AR, Nitsche DP, Kobbe B, et al. Molecular structure and tissue distribution of matrilin-3, a filament-forming extracellular matrix protein expressed during skeletal development [J]. J Biol Chem. 2000;275(6):3999\u0026ndash;4006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu P-L, He Y-F, Yao H-H, et al. Martrilin-3 (MATN3) Overexpression in Gastric Adenocarcinoma and its Prognostic Significance [J]. Med Sci Monitor: Int Med J Experimental Clin Res. 2018;24:348\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'neill LJ, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists [J]. Nat Rev Immunol. 2016;16(9):553\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nri.2016.70\u003c/span\u003e\u003cspan address=\"10.1038/nri.2016.70\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLieu EL, Nguyen T, Rhyne S, et al. Amino acids in cancer [J]. Exp Mol Med. 2020;52(1):15\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s12276-020-0375-3\u003c/span\u003e\u003cspan address=\"10.1038/s12276-020-0375-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUyttenhove C, Pilotte L, Th\u0026eacute;ate I, et al. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase [J]. Nat Med. 2003;9(10):1269\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee HJ, Song I-C, Yun H-J, et al. CXC chemokines and chemokine receptors in gastric cancer: from basic findings towards therapeutic targeting [J]. World J Gastroenterol. 2014;20(7):1681\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.v20.i7.1681\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v20.i7.1681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang K, Mcleod L, Livis T, et al. Toll-like Receptor 9 Promotes Initiation of Gastric Tumorigenesis by Augmenting Inflammation and Cellular Proliferation [J]. Cell Mol Gastroenterol Hepatol. 2022;14(3):567\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jcmgh.2022.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.jcmgh.2022.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePickering RJ, Booty LM. NLR in eXile: Emerging roles of NLRX1 in immunity and human disease [J]. Immunology. 2021;162(3):268\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/imm.13291\u003c/span\u003e\u003cspan address=\"10.1111/imm.13291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBatlle E, Massagu\u0026eacute; J. Transforming Growth Factor-β Signaling in Immunity and Cancer [J]. Immunity. 2019;50(4):924\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2019.03.024\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2019.03.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo J, Chen X-Q, Li P. The Role of TGF-β and Its Receptors in Gastrointestinal Cancers [J]. Transl Oncol. 2019;12(3):475\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tranon.2018.11.010\u003c/span\u003e\u003cspan address=\"10.1016/j.tranon.2018.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y, Lin G, Dai Z, et al. L-Glutamine deprivation induces autophagy and alters the mTOR and MAPK signaling pathways in porcine intestinal epithelial cells [J]. Amino Acids. 2015;47(10):2185\u0026ndash;97. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00726-014-1785-0\u003c/span\u003e\u003cspan address=\"10.1007/s00726-014-1785-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarnell JE, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins [J]. Science. 1994;264(5164):1415\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAaronson DS, Horvath CM. A road map for those who don't know JAK-STAT [J]. Science. 2002;296(5573):1653\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRawlings JS, Rosler KM, Harrison DA. The JAK/STAT signaling pathway [J]. J Cell Sci. 2004;117(Pt 8):1281\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiraud AS, Menheniott TR, Judd LM. Targeting STAT3 in gastric cancer [J]. Expert Opin Ther Targets. 2012;16(9):889\u0026ndash;901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1517/14728222.2012.709238\u003c/span\u003e\u003cspan address=\"10.1517/14728222.2012.709238\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanda N, Seno H, Konda Y, et al. STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cells [J]. Oncogene. 2004;23(28):4921\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassagu\u0026eacute; J. TGFbeta in Cancer [J]. Cell. 2008;134(2):215\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2008.07.001\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2008.07.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFabregat I, Fernando J, Mainez J, et al. TGF-beta signaling in cancer treatment [J]. Curr Pharm Design. 2014;20(17):2934\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavid CJ, Massagu\u0026eacute; J. Contextual determinants of TGFβ action in development, immunity and cancer [J]. Nat Rev Mol Cell Biol. 2018;19(7):419\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-018-0007-0\u003c/span\u003e\u003cspan address=\"10.1038/s41580-018-0007-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu W-Q, Wang L-W, Yuan J-P, et al. High expression of transform growth factor beta 1 in gastric cancer confers worse outcome: results of a cohort study on 184 patients [J]. Hepatogastroenterology. 2014;61(129):245\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawazoe A, Fukuoka S, Nakamura Y, et al. Lenvatinib plus pembrolizumab in patients with advanced gastric cancer in the first-line or second-line setting (EPOC1706): an open-label, single-arm, phase 2 trial [J]. Lancet Oncol. 2020;21(8):1057\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1470-2045(20)30271-0\u003c/span\u003e\u003cspan address=\"10.1016/S1470-2045(20)30271-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh D-Y, Lee K-W, Cho JY, et al. Phase II trial of dacomitinib in patients with HER2-positive gastric cancer [J]. Gastric Cancer. 2016;19(4):1095\u0026ndash;103. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10120-015-0567-z\u003c/span\u003e\u003cspan address=\"10.1007/s10120-015-0567-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bioinformatics, Amino acid metabolism, Stomach adenocarcinoma, Prognosis, Immunity, Drug sensitivity, MATN3","lastPublishedDoi":"10.21203/rs.3.rs-2754183/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2754183/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eStomach adenocarcinoma (STAD) is a major contributor to cancer mortality worldwide. Alterations in amino acid metabolism have been reported in various tumors. However, the prognostic value of amino acid metabolism-related genes in STAD deserves to be further elucidated. In this study, we constructed a prognostic risk model consisting of 3 amino acid metabolism-related genes (SERPINE1, NRP1, MATN3) in STAD. Based on the median risk score, STAD patients were divided into high- and low-risk groups. The patients with high-risk scores had a worse prognosis. A nomogram consisting of risk score and various clinical characteristics accurately predicted the 1-, 3-, and 5-year survival time of STAD patients. Notably, KEGG pathway enrichment analysis indicated immune-related pathways enriched in the high-risk group. High-risk scores were significantly related to C6 (TGF-β dominant type), while low-risk scores were significantly related to C4 (lymphocyte-depleted type). The higher risk score was associated with higher immune infiltration, immune-related function, lower tumor purity and worse response to immunotherapy. In addition, the model genes were correlated with antitumor drug sensitivity. Finally, functional assays confirmed that interference of model gene MATN3 inhibited the proliferation and migration of STAD cells. In conclusion, the amino acid metabolism-related prognostic model might be used as a biomarker to predict the prognosis and guide immunotherapy for STAD patients.\u003c/p\u003e","manuscriptTitle":"Development of Amino Acid Metabolism-Related Prognostic Model and Immune Infiltration Analysis in Patients with Stomach Adenocarcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-04-11 19:10:32","doi":"10.21203/rs.3.rs-2754183/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"985b00b7-f08d-4a1d-bc47-f78df436e78f","owner":[],"postedDate":"April 11th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-08-18T13:44:27+00:00","versionOfRecord":[],"versionCreatedAt":"2023-04-11 19:10:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2754183","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2754183","identity":"rs-2754183","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0