Exploration of epiphytic bacteria of stone fruit trees for biocontrol of Pseudomonas syringae pv. syringae

Exploration of epiphytic bacteria of stone fruit trees for biocontrol of Pseudomonas syringae pv. syringae | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exploration of epiphytic bacteria of stone fruit trees for biocontrol of Pseudomonas syringae pv. syringae Sepideh Mehrfar, Fatemeh Shahryari, Nargues FalahiCharkhabi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5166856/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jul, 2025 Read the published version in European Journal of Plant Pathology → Version 1 posted 7 You are reading this latest preprint version Abstract Bacterial canker of stone fruits caused by Pseudomonas syringae pv. syringae (Pss) is one of the most important diseases of fruit trees worldwide. Despite its significant economic impact, chemical control methods using copper compounds remain often ineffective. Biological control provides a powerful and environmentally friendly alternative to synthetic pesticides. This study sought to isolate and identify epiphyte bacteria from the tissue surface of leaves and shoots of stone trees and investigate their antagonistic effects against pathogenic Pss in laboratory and greenhouse conditions. In vitro analysis of the antagonistic activity of 122 epiphytic bacterial strains showed that 36.78% of strains could produce inhibition zone diameter from 20 to 50 mm towards Pss. Also, some strains produced antibiotic and volatile organic antimicrobial compounds. The antagonist strains were identified as Pseudomonas sp., Acinetobacter sp., Stenotrophomonas sp. and Pantoea agglomerans due to the physiological and biochemical characteristics and the partial 16SrRNA gene sequence. In vivo tests, the antagonistic Pseudomonas sp. strain 145c and Acinetobacter sp. strain 147b reduced the disease severity of bacterial canker of stone fruit on two-year-old peach trees by 94.80% compared to the positive control. This study demonstrates that epiphytic bacteria from stone fruit trees exhibit strong potential for controlling Pss. These strains have the potential to serve as significant biocontrol agents. Antagonistic activity Acinetobacter sp. Peach Stenotrophomonas sp Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Pseudomonas syringae pathovars cause economically significant diseases in many plant species. Bacterial canker and gummosis of stone fruit trees caused by P. syringae pv. syringae (Pss) is one of the most important diseases of fruit trees worldwide (Abbasi et al., 2013 ; Bophela et al., 2020 ). Various Prunus species, such as apricot ( Prunus armeniaca ), peach ( Prunus persica ), sweet cherry ( Prunus avium ), plum ( Prunus domestica ), and almond ( Prunus dulcis ) are infected by Pss, and they suffer considerable damage (Hulin et al., 2018 ). This pathogen commonly overwinters in cankers and infected buds; it may also survive epiphytically on infected or healthy trees and on plants that are not susceptible. This disease mostly affects the aerial sections of trees, where wounds allow bacteria to enter the tissue (Agrios, 2005 ). The main symptoms include the blossom and bud blast, twig blight, dieback, small to large cankers accompanied by gummosis on the branches and trunk, small dark brown depressed spots on fruits, and leaf spots that later have a shot-hole appearance (Agrios, 2005 : Hulin et al., 2018 ; Bophela et al., 2020 ). Copper-based bactericidal compounds are usually used to manage bacterial canker disease of stone fruits. Chemical controls cause serious risks to human health and environment (water, soil and air pollution). They are often ineffective because of the emergence of resistance to chemicals especially copper in some plant pathogenic bacteria (Behlau et al., 2012 ). Therefore, it is necessary to use effective and safe methods to manage plant diseases. Fortunately, numerous studies have been conducted on the biological control of phytopathogens, and international initiatives have prioritized the use of biological control agents as viable options in integrated pest management (Mougou & Boughalleb-M’hamdi, 2018 ; Amaresan et al., 2020 ; Lahlali et al., 2022 ). Some studies are related to the biocontrol of bacteria against P. syringae pathovars. For example, Bacillus spp., Pantoea agglomerans , Pseudomonas spp., Bacillus amyloliquefaciens and Streptomyces spp. were effective against pathovars syringae (causing citrus blast disease and bacterial canker of stone fruits), actinidiae (causing bacterial canker in kiwifruit), and aptata (causing leaf spot of sugar beet) (Mougou & Boughalleb-M’hamdi, 2018 ; Wicaksono et al., 2018 ; Nikolić et al., 2019 ; Islam et al., 2020 ; Doolotkeldieva & Bobusheva, 2020 ; Abdellatif et al., 2022 ). Bacterial biocontrol agents (BCAs) can produce secondary compounds, such as antibiotics, siderophores, bacteriocins, enzymes, endotoxins, and hydrogen cyanide to kill plant pathogens directly or indirectly by preventing pathogen growth, and boost the growth and defense mechanisms of plants (systemic acquired resistance and induction of systemic resistance) (Lahlali et al., 2022 ; Pandit et al., 2022 ). Therefore, biological control is a promising strategy to control and prevent phytopathogens. The main objectives of the present study were the isolation, identification, and characterization of bacterial epiphytic strains from stone fruit trees and to evaluate their antagonistic activity against P. syringae pv. syringae the causal agent of bacterial canker of stone fruit, in both in vitro and greenhouse conditions. Materials and Methods Sampling and isolation of epiphytic bacteria The sampling was performed from healthy peach, apricot, cherry, and plum trees in areas with stone fruit bacterial canker in East Azerbaijan and Zanjan provinces, northwestern Iran. A total of 73 samples were collected. Plant materials (10 g) including leaves and young shoots were added to 100 ml of sterile distilled water (SDW) and stirred at 120 rpm for 30 min. The suspensions were serially diluted and 10 µL of each dilution was spread on nutrient agar (NA) medium and incubated at 27 ˚C for 48 h. The bacterial colonies with different morphological characteristics were randomly selected and sub-cultured on NA medium. The obtained strains were stored in SDW at 4°C and in nutrient broth (NB) supplemented with 30% glycerol at -70°C. Pathogenicity test Pathogenicity test Pseudomonas syringae pv. syringae strain 21 (Pss 21) (GenBank accession No. KF010313.1) (kindly gifted by Dr. Khodaygan from Vali-E-Asr University of Rafsanjan, Iran) was cultured on nutrient agar medium for 24–48 h at 25°C. Twenty µL of Pss 21 suspension (OD 600nm : 0.1 approximately 10 7 -10 8 CFU mL − 1 ) was injected under the skin of young shoots of two-year-old peach plant cv. Anjiri through shallow wounds caused using a sterile scalpel. SDW was used as a negative control. Three inoculations were performed on the same tree and then wounds were covered with parafilm. The glasshouse experiment was assessed 10–30 days after inoculation (Hulin et al., 2018 ). Koch’s postulates were carried out by re-isolation of the pathogen from inoculation sites and its identification was confirmed by biochemical tests including, LOPAT (levan production, oxidase activity, potato soft rot, arginine dihydrolase and tobacco hypersensitivity) and GATTa (gelatine hydrolysis, aesculin hydrolysis, tyrosinase activity and utilization of tartaric acid) as described by Schaad et al., ( 2001 ) and Lelliott & Stead ( 1987 ). In vitro antagonistic activity screening of epiphyte strains The epiphyte strains were screened toward Pss 21 using the method described by Ryan et al., ( 2004 ). Strains were spotted onto NA medium and incubated for 48 h at 28 ˚C. Then bacterial colonies were cleaned with a sterile cotton and the reaming bacteria were killed by chloroform vapors for 30 minutes. The plates were aerated for 30 min under sterile conditions. Two hundred µL of Pss 21 suspension (10 8 CFU mL − 1 ) was spread on the medium. The plates were incubated for 24 h at 28 ˚C, and then, the inhibition zone diameter was measured to assay the antagonistic activity. The experiments were conducted in a completely randomized design with three replications. Phenotypic identification of antagonist strains The antagonist strains were characterized based on various phenotypic tests, consisting of gram reaction using KOH 3%, oxidase, catalase, soft rot on potato slices, hypersensitive reaction (HR) on geranium leaves, ice nucleation activity (INA), oxidative/fermentative (O/F), gelatin and starch hydrolysis, levan formation from sucrase, green fluorescent pigment production on King’s medium B (KB), growth at 4°C, 37°C and 41°C (Fahy & Persley, 1983 ; Schaad et al., 2001 ). Moreover, resistance to antibiotics was determined on NA medium using the disk diffusion method with tetracycline (20 µg mL − 1 ), ampicillin (100 µg mL − 1 ), and kanamycin (30µg mL − 1 ) (Raja et al., 2009 ). The experiment was performed with three replications. Molecular identification of antagonist strains Total DNA from four selected antagonist strains (116a, 145c, 147b and 124a) was extracted by preparation of a suspension from overnight cultures grown on NA medium in 250 µL SDW and centrifugation at 6000 rpm for 10 min. The bacterial cell pellet was re-suspended in SDW, and suspensions at OD 600nm 0.1 was adjusted. Then 1/10 vol. of extraction buffer (1M Tris-HCl pH 8.0, 10 mM EDTA pH 8.0 containing 10 mg/ml lysozyme) was added to each sample and tubes were incubated at 35–37°C for 15 min. The bacterial suspensions were incubated at -20°C for 30 min and then at room temperature for 10 min. The freezing and thawing process was repeated two times. Then 1/10 vol. of KOH 10% was added to each tube and tubes were placed in the heating block for 5 min at 96°C, then centrifuged at 8000 rpm for 5 min. The supernatant was transferred to a fresh tube and stored at -20°C (Ausubel et al., 1990). The partial 16S rRNA gene sequence was amplified using the forward primer pA (AGAGTTTGATCCTGGCTCAG) and the reverse primer pH ∗ (AAGGAGGTGATCCAGCCGCA) (Edwards et al., 1989 ) in a total volume of 30 µL (15µL Taq DNA Polymerase Master Mix (Ampliqon, Denmark), 1 µL of each primer (10 pmol/ µL)), 4 µL of template DNA (10pg-1µg) and 9 µL nuclease-free water). The PCR program consisting of an initial denaturation at 95°C for 2 min, followed by 45 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, and a final extension at 72°C for 10 min. PCR products were directly sequenced for both strands by Bioneer Company (Daejeon, South Korea). The obtained nucleotide sequences were compared with other sequences available in GenBank database by the Basic Local Alignment Search Tool (BLAST) ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Alignments were performed in CLUSTALW (Thompson et al., 1994 ). Maximum likelihood phylogenetic trees were constructed using MEGA-X based on the lowest value of the Bayesian Information Criterion (BIC) with 1,000 bootstrap replications (Kumar et al., 2018 ). Antibiotic production test Four selected strains were spotted onto NAG (NA medium plus glucose 1%) saturated with FeCl 3 (1000 µmol/mL) and incubated at 26°C for 24 h. Then colonies on agar plates were cleaned by sterile cotton and killed with chloroform vapors for 30 min. Petri plates in the sterile conditions were aerated for 30 min, and a suspension of Pss 21 (10 8 CFU mL − 1 ) was sprayed on the medium, then the plates were incubated overnight. The presence of inhibition zones in the medium represents the production of antibiotics that limited growth of the pathogen (Weller & Cook, 1983 ). Siderophore production test The selected antagonist strains were spotted onto NAS (NA medium plus sucrose 1%) and NAS containing FeCl 3 (1000 µmol/mL) media and incubated at 26˚C for 24 h. Then the bacterial colonies were cleaned by sterile cottons and remaining colonies were killed with chloroform vapors for 30 min. Petri plates in sterile conditions were aerated for 30 min and incubated in 60 ˚C for 4 h to disable probably antibiotics. A suspension of Pss 21 (10 8 CFU mL − 1 ) was sprayed on the media, and the plates were incubated overnight. The absence of the inhibition zone in the NAS medium containing FeCl 3 and the presence of the inhibition zone in the NAS medium represents the production of siderophores which limit the growth of the pathogen. HCN production The selective strains were screened for the production of hydrogen cyanide by adapting the method of Lorck ( 1948 ). Briefly, strains were streaked onto NA medium supplemented with 4.4 g/L glycine. A Whatman filter paper no. 1 soaked in 2% sodium carbonate and 0.5% picric acid solutions was placed inside the plate lid. Plates were sealed with parafilm and incubated at 28 ˚C for four days. One plate without inoculation by the bacterium was considered as a negative control. The color change in the filter paper from orange to red indicates the levels of hydrogen cyanide production from low to very high. Biocontrol of Pss 21 with epiphyte strains under in vivo conditions This experiment was carried out on detached branches and also two-year-old peach seedlings cv. Anjiri according to the method of Moragrega et al., ( 2003 ) with modifications. A suspension with a concentration of approximately 10 8 CFU mL − 1 was prepared from overnight culture of Pss 21 and four selected antagonist strains grown on NA medium. Young peach branches with length of 15–20 cm and two -year-old peach seedlings were prepared. The surface of branches was disinfested with 90% ethanol for one minute, and wounds (0.5 cm) were made on branches with a sterile scalpel. Then, the Pss suspension (50 µL) was injected into wounds using sterile syringes one day after antagonist inoculation on branches. Branches inoculated with Pss, and antagonist strains and SDW were considered as positive and negative controls, respectively. The inoculated detached branches were kept within sterile glass containers, lined with sterile moist cottons to maintain a high humidity for 30 days. This experiment was conducted in a completely randomized design with nine replications. In the peach seedlings, the inoculated areas were covered with parafilm to preserve moisture. The inoculated plants were kept in the greenhouse at 18–22°C and a relative humidity of about 70% for 30 days. This experiment was conducted in a completely randomized design with 11 replications. The canker area on the stem was measured and biological control efficacy (BCE) of representative strains was calculated by [(D C - D T )/D C ]*100 which D C is disease severity of the control (inoculated with Pss) and D T is disease severity of the treatment. Statistical analysis The results were statistically analyzed via one-way ANOVA on the SPSS Statistics 24 software. Mean values among treatments were compared by Duncan’s multiple range test at the 1% and 5% significance levels. Results Pathogenicity test of P. syringae pv. syringae Pathogenicity of Pss 21 was confirmed by the emergence and development of necrotic areas on the branch of two-year-old peach plant during 10–30 days post inoculation (Fig. 1 ). Re-isolation of Pss 21 from necrotic lesions or cankers was performed on KB medium after two weeks. The results of biochemical tests LOPAT (+ − − − +) and GATTa (+ + - -) were consistent with characteristics of Pss. Negative control inoculated with SDW was symptomless. Isolation and in vitro selection of antagonist strains A total of 122 epiphytic strains were isolated from healthy samples of peach, apricot, cherry and plum trees. Then, according to negative reaction of strains in the HR on geranium leaves, soft rot on potato slices and INA tests, 87 selective strains were screened for production of diffusible compound(s) towards Pss 21 on NA medium. Thirty-two strains indicated extreme inhibitory activities against Pss 21 with the inhibition zone diameter of more than 20 mm (Fig. 2 ). The analysis of variance (one-way ANOVA) and mean comparison of the inhibition zone diameter showed significant statistical difference between the bacterial strains and the positive control (F 32, 66 = 4.1, P ≤ 0.01) (Fig. 2 ). Strains 148b, 118a, 147b and 143a with more than 40 mm and strains 132a, 145c and 146a with more than 26 mm inhibition zone diameter displayed the highest and lowest inhibitory effect, respectively. The strains with the highest inhibitory effect had a bactericide effect because Pss 21 did not grow around the colony of antagonist strains by two weeks after the test. Phenotypic identification of antagonist Thirty-two bacterial antagonist strains were identified based on physiological and biochemical characteristics and placed into four groups. Table 1 shows the characteristics of the selective strains of each group, antibiotic, siderophore and HCN production and susceptibility or resistance to antibiotics. Table 1 Phenotypic characteristics of bacterial antagonistic strains identified in this research Tests/ Strains Acinetobacter sp. (147b) Pantoea agglomerans (124a) Pseudomonas sp. (145c) Stenotrophomonas sp. (116a) Reference Gram test - - - - Schaad et al., 2001 Fluorescent pigment on KB - - + - ⸗ Oxidation/fermentation of glucose O O/F O O ⸗ Potato soft rot - - - - ⸗ Hypersensitivity reaction on geranium - - - - ⸗ Oxidase - - + - Fahy & Persley, 1983 Catalase + + + + Schaad et al., 2001 Ice nucleation activity - - - - ⸗ Levan formation - - - - ⸗ Hydrolysis of Gelatin + + - + Fahy & Persley, 1983 Urease ND - ND ND Schaad et al., 2001 Hydrolysis of Tween 80 - - - - ⸗ Hydrolysis of Starch + - - + ⸗ Nitrate reduction - + - + Fahy & Persley, 1983 Lecithinase ND ND - - ⸗ Growth at 4°C + - - + Schaad et al., 2001 Growth at 37°C + + - + ⸗ Growth at 41°C + + - - ⸗ Growth in 2% NaCl + + + - ⸗ Growth in 5% NaCl - - - - ⸗ Growth in 7% NaCl - - - + ⸗ Sensitivity/resistance to Raja et al., 2009 Tetracycline S (1.26 cm) S (0.6 cm) S (0.26 cm) S (1.26 cm) Ampicillin R S (1.26 cm) R R Kanamycin R R R R Acid production from Schaad et al., 2001 Sorbitol ND + - ND Sucrose - + - + Lactose - + - - Fructose ND + - N Maltose ND + ND - Siderophore production - - - - Antibiotic production - + - - Weller & Cook, 1983 HCN production + - - - Lorck, 1948 OF: Oxidation/fermentation of glucose, +: positive, -: negative, ND: non-determined, S: sensitivity to antibiotic (the diameter of the inhibition zone), R: antibiotic-resistance Molecular identification and phylogenetic analysis of antagonist strains The partial sequencing of the 16S rRNA gene for the representative antagonist strains and the nucleotide sequences of these strains were deposited in GenBank database under accession numbers PP967786.1-PP967789.1 regarding to strains 116a, 147b, 145c and 124a respectively. Comparison of sequences with those available in the GenBank database revealed strain 116a had 99.67% identity with strains Stenotrophomonas rhizophila e-p10 T and strain 147b indicated 100% identity with Taxon 53 = Acinetobacter sp. GK2. Moreover, strain 145c had 99.27% identity with Pseudomonas aestus CMAA 1-215 T and strain 124a showed 99.44% identity with strains Pantoea agglomerans NCTC 9381 T . The phylogenetic trees constructed based on the partial 16S rRNA gene sequences using maximum likelihood method indicated the taxonomic position of the epiphytic antagonist strains 116a, 147b, 145c and 124a isolated from stone fruits in comparison with the sequences of type strains deposited in NCBI (National Center for Biotechnology Information) with high bootstrap support (Fig. 3 ). Antagonistic activity of selective strains under in vivo conditions The bacterial epiphytes of Stenotrophomonas sp. strain 116a, Acinetobacter sp. strain 147b, Pseudomonas sp. strain 145c, and P. agglomerans strain 124a isolated from almond, cherry, peach, and sour cherry trees respectively, were applied to survey their antagonistic effects against Pss 21 and to reduces disease severity of bacterial canker on detached and living branches. According to the variance analysis of the data, the disease severity was significantly affected by antagonist inoculation on detached branches (F 5, 48 = 77.29, P ≤ 0.001) and peach seedlings (F 5, 60 = 66.41, P ≤ 0.001), and mean comparison showed a significant difference between antagonist strains and the positive control treatments. In the detached branch assay, Antagonist strains 147b ( Acinetobacter sp.) and 116a ( Stenotrophomonas sp.) could reduce the disease severity by 89.33% and 88% respectively, compared to the positive control. However, there was not a significant difference between the antagonist strains (Fig. 4 a). In the living branch assay, all strains reduced the spread of disease symptoms or disease severity by more than 90%. Antagonist strains 145c ( Pseudomonas sp.) and 147b ( Acinetobacter sp.) had the best result in terms of disease severity reduction by 94.80% in comparison with the positive control (Fig. 4 b). The severe canker symptoms were observed in branches inoculated by Pss 21, while in other treatments, small necrotic lesions were formed at the inoculation sites (Fig. 5 a and b). Discussion The present study explored the antagonistic activity of bacterial epiphyte strains towards the primary causal agent of bacterial canker disease of stone fruit trees. The antibacterial effect of epiphyte strains isolated from different tissues of stone fruit trees against P. syringae pv. syringae was acceptable in in vitro conditions and about 36.78% of the tested strains showed antagonistic activity. Moreover, in vitro evaluations indicated that antagonist strains can produce diffusible or volatile compounds such as antibiotics and HCN that spread in the medium or environment and inhibit the growth of the pathogen. While screening a great number of strains is given in laboratory testing owing to unique properties of biocontrol agents, in many instances the activity of antagonist in laboratory tests is not the same as greenhouse circumstances. key factors such as host genotype, intrinsic characteristics of a pathogen, inoculum density of a pathogen, and environmental conditions can influence the interaction between the plant, the pathogen, and the bacteria and the final levels of disease control achieved by bacteria (Bonaterra et al., 2022 ). Therefore, the potential of a superior biocontrol agent to control a disease should be tested in planta . In this study, in vivo efficiency of selective antagonist strains demonstrates that the disease severity or stem canker development in detached branches and two-year-old peach seedlings significantly reduced. In vitro , the antagonist strain 147b caused the highest inhibition zone and the strain 145c had the lowest inhibitory effect towards Pss 21. In vitro assays only permit the selection of microorganisms with antagonistic activity, and bacteria with other abilities such as competitive exclusion or plant resistance induction were not identified (Raymaekers et al., 2020 ). Therefore, vivo bioassays on seeds, detached branches and leaves, flowers, and fruits permit faster, reliable, and efficient screening (Pusey, 1997 ). In the present study, antagonist strains 145c and 147b outperformed in terms of disease severity reduction compared to the positive control in greenhouse circumstances. This excellent antagonistic effect in the natural environment could be attributed to quick adaptation to environmental conditions and compete with the plant pathogens for space, nutrients, and water and maintain itself for very long (Agrios, 2005 ) or probably the production of secondary metabolites that cannot be produced in the culture media (Abdel-Aziz et al., 2017 ). Regarding phenotypic and molecular identification, the effective biocontrol strains belonged to the genera Pseudomonas , Acinetobacter , Pantoea and Stenotrophomonas isolated from peach, cherry, sour cherry, and almond trees, respectively. The different strains of Pseudomonas spp. indicated a high degree of antagonism against plant pathogens which have an essential role in plant disease management (Balthazar et al., 2022 ; Lahlali et al., 2022 ). In a study, biological control of Pss under greenhouse conditions using strains of Pseudomonas putida , P. agglomerans , Serratia liquefaciens , Leclercia adecarboxylata , Curtobacterium flaccumfaciens , Alcaligenes piechaudii and Erwinia rhapontici isolated from pome fruit trees was reported that all bacterial strains significantly reduced disease severity on branches of one-year-old Golden delicious apples (Kotan & Sahin, 2006 ). In many studies, strains of Pseudomonas spp., Stenotrophomonas spp. and Pantoea agglomerans were reported as effective biocontrol agents towards several rhizospheric and phyllospheric phytopathogens including Rhizoctonia solani , Ralstonia solanacearum , Fusarium oxysporum , Colletotrichum sp., Aspergillus niger , Monilina laxa , Erwinia amylovora , Pseudomonas syringae pv. tomato , Uromyces appendiculatus and Penicillium digitatum (Giesler & Yuen, 1998 ; Nakayama et al., 1999 ; Özaktan & Bora, 2004 ; Elhalag et al., 2016 ; John & Thangavel, 2017 ; Morella et al., 2019 ; Lahlali et al., 2020 ; Abo-Elyousr & Hassan, 2021 ; Abo-Elyousr et al., 2021 ; Duchateau et al., 2024 ; Sharma et al., 2024 ). However, there is little evidence about the biocontrol potential of Acinetobacter sp. strains in previous studies. Xue et al., ( 2009 ) reported the bacterial strain Xa6 ( Acinetobacter sp.) as a biocontrol agent against Ralstonia solanacearum (causing of bacterial wilt of tomato) in vitro , iv vivo and field experiments. Also, Acinetobacter lwoffii strains PTA-113 and PTA-152 could reduce gray mold disease caused by Botrytis cinerea on detached leaves of grapevine (Trotel-Aziz et al., 2008 ). This research discovered that epiphytic bacteria from stone fruit trees exhibit strong potential for controlling Pss, and these strains can be exploited as effective biocontrol agents. Declarations Data availability statement The data that support the findings of this study are available from the corresponding author upon reasonable request. 16S rRNA genes sequences are available from GenBank with accession numbers: PP967786.1-PP967789.1. Ethical approval This research did not involve any studies with human participants or animals. Consent for publication: All authors consent to publication. Disclosure statement: The authors declare that they have no conflict of interest. Funding: The authors received no specific funding for this work. References Abbasi, V., Rahimian, H., & Tajick-Ghanbari, M. A. (2013). Genetic variability of Iranian strains of Pseudomonas syringae pv. syringae causing bacterial canker disease of stone fruits. European Journal of Plant Pathology , 135 , 225–235. https://doi.org/10.1007/s10658-012-0095-1 Abdel-Aziz, S. M., Abo Elsoud, M. M., & Anise, A. A. H. (2017). Microbial biosynthesis: A repertory of vital natural products. Handbook of food bioengineering, food biosynthesis (pp. 25–54). Academic. Grumezescu, A.M., & Holban, A.M. Abdellatif, E., Mikiciński, A., Kałużna, M., Bahri, B. A., Mougou-Hamdane, A., van Vaerenberg, J., Baeyen, S., Rhouma, A., & Janse, J. D. (2022). Promising epiphytic antagonistic Pseudomonas strains from the Citrus phyllosphere in the biocontrol of Pseudomonas syringae pv. syringae , causing bacterial citrus blast and black pit. Journal of Plant Pathology , 104 , 915–928. https://doi.org/10.1007/s42161-022-01133-y Abo-Elyousr, K. A. M., Abdel-Rahim, I. R., Almasoudi, N. M., & Alghamdi, S. A. (2021). Native endophytic Pseudomonas putida as a biocontrol agent against common bean rust caused by Uromyces appendiculatus . Journal of Fungi , 7 (9), 745. https://doi.org/10.3390/jof7090745 Abo-Elyousr, K. A. M., & Hassan, S. A. (2021). Biological control of Ralstonia solanacearum (Smith), the causal pathogen of bacterial wilt disease by using Pantoea spp. Egyptian Journal of Biological Pest Control , 31 , 113. https://doi.org/10.1186/s41938-021-00460-z Agrios, G. (2005). Plant pathology. 4thEdition (p. 922). Elsevier Academic. Amaresan, N., Kumar, S., Annapurna, M., Rishna Kumar, K., K., & Sankaranarayanan, A. (2020). Beneficial Microbes in Agro-Ecology: Bacteria and Fungi . Academic Press is an imprint of Elsevier. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., & Struhl, K. (1997). Current Protocols in Molecular Biology . John Wiley & Sons, Inc. Balthazar, C., Novinscak, A., Cantin, G., Joly, D. L., & Filion, M. (2022). Biocontrol activity of Bacillus spp. and Pseudomonas spp. against Botrytis cinerea and other cannabis fungal pathogens. Phytopathology , 112(3), 549–560. https://doi.org/10.1094/PHYTO-03-21-0128-R Behlau, F., Canteros, B. I., Jones, J. B., & Graham, J. H. (2012). Copper resistance genes from different xanthomonads and citrus epiphytic bacteria confer resistance to Xanthomonas citri subsp. citri . European Journal of Plant Pathology , 133 (4), 949–963. 10.1007/s10658-012-9966-8 . https://link.springer.com/article/ Bonaterra, A., Badosa, E., Daranas, N., Francés, J., Roselló, G., & Montesinos, E. (2022). Bacteria as biological control agents of plant diseases. Microorganisms , 10 , 1759. https://doi.org/10.3390/microorganisms10091759 Bophela, K. N., Petersen, Y., Bull, C. T., & Coutinho, T. A. (2020). Identification of Pseudomonas isolates associated with bacterial canker of stone fruit trees in the Western Cape, South Africa. Plant Disease , 104 , 882–892. https://doi.org/10.1094/PDIS-05-19-1102-RE Doolotkeldieva, T., & Bobusheva, S. (2020). Characterization of Pseudomonas syringae pv. syringae from diseased stone fruits in Kyrgyzstan and testing of biological agents against pathogen. International Journal of Phytopathology , 9(2), 71–91. https://doi.org/10.33687/phytopath.009.02.3270 Droby, S., Wisniewski, M., Teixidó, N., Spadaro, D., & Jijakli, M. H. (2016). The science, development, and commercialization of postharvest biocontrol products. Postharvest Biology and Technology , 122 , 22–29. https://doi.org/10.1016/j.postharvbio.2016.04.006 Duchateau, S., Crouzet, J., Dorey, S., & Aziz, A. (2024). The plant-associated Pantoea spp. as biocontrol agents: Mechanisms and diversity of bacteria-produced metabolites as a prospective tool for plant protection. Biological Control , 188 , 105441. https://doi.org/10.1016/j.biocontrol.2024.105441 Edwards, U., Rogall, T., Blöcker, H., Emde, M., & Böttger, E. C. (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Research , 17 (19), 7843–7853. 10.1093/nar/17.19.7843 PMID: 2798131; PMCID: PMC334891. Elhalag, K. M., Messiha, N. A., Emara, H. M., & Abdallah, S. A. (2016). Evaluation of antibacterial activity of Stenotrophomonas maltophilia against Ralstonia solanacearum under different application conditions. Journal of Applied Microbiology , 120 (6), 1629–1645. https://doi.org/10.1111/jam.13097 Fahy, P. C., & Persley, G. J. (1983). Plant bacterial diseases. A diagnostic guide . Academic Press Australia. Giesler, L. J., & Yuen, G. Y. (1998). Evaluation of Stenotrophomonas maltophilia strain C3 for biocontrol of brown patch disease. Crop Protection , 17 (6), 509–513. 10.1016/S0261-2194(98)00049-0 Hulin, M. T., Mansfield, J. W., Brain, P., Xiangming, X., Jackson, R. W., & Harrison, R. J. (2018). Characterization of the pathogenicity of strains of Pseudomonas syringae towards cherry and plum. Plant Pathology , 67 (5), 1177–1193. 10.1111/ppa.12834 Islam, M. S., Sultana, R., Hasan, M. A., Alam, M. S., Sikdar, B., Kamaruzzaman, M., & Islam, M. A. (2020). Characterization and biocontrol measures of Pseudomonas syringae pv. syringae associated with citrus blast disease. Vegetos , 33 , 555–569. https://doi.org/10.1007/s42535-020-00138-1 John, N., & Thangavel, M. (2017). Stenotrophomonas maltophilia : a novel plant growth promoter and biocontrol agent from marine environment. International Journal of Advanced Research , 5 , 207–214. https://dx.doi.org/10.21474/IJAR01/3797 Kotan, R., & Sahin, F. (2006). Biological control of Pseudomonas syringae pv. syringae and nutritional similarity in carbon source utilization of pathogen and its potential biocontrol agents. The Journal of Turkish Phytopathology , 35(3), 1–13. https://dergipark.org.tr/tr/pub/fitopatoloji/issue/6397/85424 Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution , 35 (6), 1547. https://doi.org/10.1093/molbev/msy096 Lahlali, R., Aksissou, W., Lyousfi, N., Ezrari, S., Blenzar, A., Tahiri, A., Ennahli, S., Hrusti´c, J., MacLean, D., & Amiri, S. (2020). Biocontrol activity and putative mechanism of Bacillus amyloliquefaciens (SF14 and SP10), Alcaligenes faecalis ACBC1, and Pantoea agglomerans ACBP1 against brown rot disease of fruit. Microbial Pathogenesis , 139 , 103914. https://doi.org/10.1016/j.micpath.2019.103914 Lahlali, R., Ezrari, S., Radouane, N., Kenfaoui, J., Esmaeel, Q., Hamss, E., Belabess, H., Z., & Barka, E. A. (2022). Biological control of plant pathogens: A global perspective. Microorganisms , 10 (3), 596. https://doi.org/10.3390/microorganisms10030596 PMID: 35336171; PMCID: PMC8951280. Lelliott, R. A., & Stead, D. E. (1987). Methods for the diagnosis of bacterial diseases of plants . Blackwell Scientific. Lorck, H. (1948). Production of hydrocyanic acid by bacteria. Physiologia Plantarum , 1 (2), 142–146. https://doi.org/10.1111/j.1399-3054.1948.tb07118.x Moragrega, C., Llorente, I., Manceau, C., & Montesinos, E. (2003). Susceptibility of European pear cultivars to Pseudomonas syringae pv. syringae using immature fruit and detached leaf assays. European Journal of Plant Pathology , 109 , 319–326. https://doi.org/10.1023/A:1023574219069 Morella, N. M., Zhang, X., & Koskella, B. (2019). Tomato seed-associated bacteria confer protection of seedlings against foliar disease caused by Pseudomonas syringae . Phytobiomes Journal , 3 , 177–190. https://doi.org/10.1094/PBIOMES-01-19-0007-R Mougou, I., & Boughalleb-M’hamdi, N. (2018). Biocontrol of Pseudomonas syringae pv. syringae affecting citrus orchards in Tunisia by using indigenous Bacillus spp. and garlic extract. Egyptian Journal of Biological Pest Control , 28 , 60. https://doi.org/10.1186/s41938-018-0061-0 Nakayama, T., Homma, Y., Hashidoko, Y., Mizutani, J., & Tahara, S. (1999). Possible role of xanthobaccins produced by Stenotrophomonas sp. strain SB-K88 in suppression of sugar beet damping off disease. Applied and Environmental Microbiology , 65 (10), 4334–4339. 10.1128/AEM.65.10.4334-4339.1999 Nikolić, I., Berić, T., Dimkić, I., Popović, T., Lozo, J., Fira, D., & Stanković, S. (2019). Biological control of Pseudomonas syringae pv. aptata on sugar beet with Bacillus pumilus SS-10.7 and Bacillus amyloliquefaciens (SS-12.6 and SS-38.4) strains. Journal of Applied Microbiology , 126(1), 165–176. https://doi.org/10.1111/jam.14070 Özaktan, H., & Bora, T. (2004). Biological control of fire blight in pear orchards with a formulation of Pantoea agglomerans strain Eh 24. Brazilian Journal of Microbiology , 35 , 224–229. https://doi.org/10.1590/S1517-83822004000200010 Pandit, M. A., Kumar, J., Gulati, S., Bhandari, N., Mehta, P., Katyal, R., Rawat, C. D., Mishra, V., & Kaur, J. (2022). Major biological control strategies for plant pathogens. Pathogens , 11 (2), 273. https://doi.org/10.3390/pathogens11020273 Pusey, P. L. (1997). Crab apple blossoms as a model for research on biological control of fire blight. Phytopathology , 87 (11), 1096–1102. 10.1094/PHYTO.1997.87.11.1096 Raja, C. E., Selvam, G. S., & Omive, K. (2009). Isolation, identification and characterization of heavy metal resistant bacteria from sewage. International Joint Symposium on Geodisaster Prevention and Geoenvironment in Asia , Fukuoka, 205–211. Raymaekers, K., Ponet, L., Holtappels, D., Berckmans, B., & Cammue, B. P. A. (2020). Screening for novel biocontrol agents applicable in plant disease management. Biological Control , 144 , 104240. https://doi.org/10.1016/j.biocontrol.2020.104240 Ryan, A. D., Kinkel, L. L., & Schottel, J. L. (2004). Effect of pathogen isolate, potato cultivar, and antagonist strain on potato scab severity and biological control. Biocontrol Science and Technology , 14 (3), 301–311. https://doi.org/10.1080/09583150410001665187 Schaad, N. W., Jones, J. B., & Chun, W. (2001). Laboratory guide for identification of plant pathogenic bacteria (3rd ed., p. 260). The American Phytopathological Society. Sharma, P., Pandey, R., & Chauhan, N. S. (2024). Biofertilizer and biocontrol properties of Stenotrophomonas maltophilia BCM emphasize its potential application for sustainable agriculture. Frontiers in Plant Science , 15 , 1364807. https://doi.org/10.3389/fpls.2024.1364807 Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution , 30 , 2725–2729. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research , 22 (22), 4673–4680. https://doi.org/10.1093/nar/22.22.4673 Trotel-Aziz, P., Couderchet, M., Biagianti, S., & Aziz, A. (2008). Characterization of new bacterial biocontrol agents Acinetobacter , Bacillus , Pantoea and Pseudomonas spp. mediating grapevine resistance against Botrytis cinerea . Environmental and Experimental Botany , 64 (1), 21–32. https://doi.org/10.1016/j.envexpbot.2007.12.009 Weller, D., & Cook, R. (1983). Suppression of take-all of wheat by seed treatments with fluorescent pseudomonads. Phytopathology , 73 (3), 463–469. 10.1094/Phyto-73-463 Wicaksono, W. A., Jones, E. E., Casonato, S., Monk, J., & Ridgway, H. J. (2018). Biological control of Pseudomonas syringae pv. actinidiae (Psa), the causal agent of bacterial canker of kiwifruit, using endophytic bacteria recovered from a medicinal plant. Biological Control , 116 , 103–112. https://doi.org/10.1016/j.biocontrol.2017.03.003 Xue, Q. Y., Chen, Y., Li, S. M., Chen, L. F., Ding, G. C., Guo, D. W., & Guo, J. H. (2009). Evaluation of the strains of Acinetobacter and Enterobacter as potential biocontrol agents against Ralstonia wilt of tomato. Biological Control , 48 (3), 252–258. Cite Share Download PDF Status: Published Journal Publication published 31 Jul, 2025 Read the published version in European Journal of Plant Pathology → Version 1 posted Editor assigned by journal 30 Jun, 2025 Reviewers agreed at journal 06 May, 2025 Reviewers invited by journal 30 Apr, 2025 Editor invited by journal 28 Apr, 2025 First submitted to journal 27 Apr, 2025 Editorial decision: Accept 20 Mar, 2025 Editorial decision: Accept,subject to authors carrying out corrections 20 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5166856","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":450022198,"identity":"f85934ec-92e4-41d5-8ada-c79ee9217df1","order_by":0,"name":"Sepideh Mehrfar","email":"","orcid":"","institution":"University of Zanjan","correspondingAuthor":false,"prefix":"","firstName":"Sepideh","middleName":"","lastName":"Mehrfar","suffix":""},{"id":450022199,"identity":"2462ecfe-130d-4dae-afe7-b4ab1026f558","order_by":1,"name":"Fatemeh Shahryari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYDACCQY2MM3G3gAVYSZaC88BUrUwSCQQ6S752c3PHle22eXzST5/9piHwU6egZ33AV4tBneOmRuebUu2bJNOSDfmYUg2bGBmN8CvRSLBTLKxjdmATTrhmDQPA3MCAzMbAYfNSP8G1FJvwCZ5sA2opZ6wFoYbOSBbDhuwSTCzAbUcJqzF4EZOmWTDueMGbDxpbJJzDI4bthHhsG2SDWXVBvLtx59JvKmolufnP0bAYSDACDcXGFaEfAIFf4hTNgpGwSgYBSMUAABTnjLssz2piQAAAABJRU5ErkJggg==","orcid":"","institution":"University of Zanjan","correspondingAuthor":true,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Shahryari","suffix":""},{"id":450022200,"identity":"a100423c-5d3a-4871-a4e0-ab99fe69f561","order_by":2,"name":"Nargues FalahiCharkhabi","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Nargues","middleName":"","lastName":"FalahiCharkhabi","suffix":""}],"badges":[],"createdAt":"2024-09-27 17:42:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5166856/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5166856/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10658-025-03112-2","type":"published","date":"2025-07-31T16:21:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81826741,"identity":"f5c6745f-8ba7-48f7-9e90-924583556803","added_by":"auto","created_at":"2025-05-02 12:46:06","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1299550,"visible":true,"origin":"","legend":"\u003cp\u003ePathogenicity test. Inoculation of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e strain 21 on two-year-old peach plants and the presence of necrotic tissue and its spread into the branch 15 days after inoculation (a). Negative control inoculated with sterile distilled water (b).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/842b432f19a032ae7f285d1a.jpeg"},{"id":81827864,"identity":"0e28e59f-9655-43ed-bf3e-109f98f29079","added_by":"auto","created_at":"2025-05-02 13:02:06","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1079067,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003eantagonistic activity of epiphytic bacterial strains against \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e based on inhibition zone diameter (a). Error bars represent the standard error of the means. Means in a column followed by the same letter are not significantly different according to Duncan's multiple range test (\u003cem\u003eP\u003c/em\u003e = 0.01). The inhibition zone formed by epiphytic bacterial strains (red arrows) towards \u003cem\u003eP. syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e on nutrient agar medium (b).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/f615a31c3b135f37c32c45af.jpeg"},{"id":81828588,"identity":"2c3115cd-f322-4329-ba9d-61c6b1f5af8e","added_by":"auto","created_at":"2025-05-02 13:10:06","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":306576,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood phylogenetic tree representing the partial sequences of 16SrRNA gene of epiphytic bacterial strains isolated from stone fruits and reference strains. The trees were constructed using the K2+ G (\u003cem\u003eAcinetobacter \u003c/em\u003espp.) (A), HKY+G+I (\u003cem\u003eStenotrophomonas\u003c/em\u003e spp.) (B), T92+G+I (\u003cem\u003ePantoea\u003c/em\u003e spp.) (C) and K2+G+I (\u003cem\u003ePseudomonas\u003c/em\u003e spp.) (D) models based on the lowest Bayesian information criterion (BIC). Bootstrap values after 1,000 replicates are indicated as percentages (only values ≥50 are shown). The scale bar represents the number of substitutions per site. HKY: Hasegawa-Kishino-Yano; K2: Kimura 2-parameter; T92: Tamura 3-parameter; G+I: gamma distribution and invariant sites\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/f7d92f31a74bb19a0b3258c8.jpeg"},{"id":81827865,"identity":"c1c5da48-dd9e-4f98-a9c5-16b1162fc016","added_by":"auto","created_at":"2025-05-02 13:02:06","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":108737,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of antagonist strains (124a, 145c, 116a and 147b) on disease severity of the bacterial canker of stone fruit trees, four weeks after inoculation of \u003cem\u003ePseudomonas\u003c/em\u003e \u003cem\u003esyringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e (Pss) on detached branches (a) and two-year old peach seedlings cv. Anjiri (b). C\u003csup\u003e-\u003c/sup\u003e: the negative control inoculated with sterile distilled water. Means in a column followed by the same letter are not significantly different according to Duncan's multiple range test (\u003cem\u003eP\u003c/em\u003e = 0.01)\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/240dd4a067bf1ff6216f8b7e.jpeg"},{"id":81826745,"identity":"32655009-f8ef-4633-bd15-144763222d36","added_by":"auto","created_at":"2025-05-02 12:46:06","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":646616,"visible":true,"origin":"","legend":"\u003cp\u003eCanker development after inoculation of epiphytic bacterial strains and\u003cem\u003ePseudomonas syrinage\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e strain 21 on detached branches (a-d) and two-year old peach seedlings cv. Anjiri (e-i) after 30 days. Negative controls inoculated with sterile distilled water (e: branch surface, a and f: under the skin); the negative control inoculated with an antagonist strain (b); positive controls inoculated with pathogenic Pss (c and g); the inhibition of canker formation on the detached branches (d) and living branches (h and i) using antagonist strains\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/22493a37f28ce711eb6c749b.jpeg"},{"id":88268861,"identity":"c95d7b4a-9860-4bac-93c5-c1dbd1c8f629","added_by":"auto","created_at":"2025-08-04 16:52:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4557946,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5166856/v1/65eea9f2-865d-4fbd-8b1a-eaa7ddcbe060.pdf"}],"financialInterests":"","formattedTitle":"Exploration of epiphytic bacteria of stone fruit trees for biocontrol of Pseudomonas syringae pv. syringae","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003ePseudomonas syringae\u003c/em\u003e pathovars cause economically significant diseases in many plant species. Bacterial canker and gummosis of stone fruit trees caused by \u003cem\u003eP. syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e (Pss) is one of the most important diseases of fruit trees worldwide (Abbasi et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Bophela et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Various \u003cem\u003ePrunus\u003c/em\u003e species, such as apricot (\u003cem\u003ePrunus armeniaca\u003c/em\u003e), peach (\u003cem\u003ePrunus persica\u003c/em\u003e), sweet cherry (\u003cem\u003ePrunus avium\u003c/em\u003e), plum (\u003cem\u003ePrunus domestica\u003c/em\u003e), and almond (\u003cem\u003ePrunus dulcis\u003c/em\u003e) are infected by Pss, and they suffer considerable damage (Hulin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). This pathogen commonly overwinters in cankers and infected buds; it may also survive epiphytically on infected or healthy trees and on plants that are not susceptible. This disease mostly affects the aerial sections of trees, where wounds allow bacteria to enter the tissue (Agrios, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The main symptoms include the blossom and bud blast, twig blight, dieback, small to large cankers accompanied by gummosis on the branches and trunk, small dark brown depressed spots on fruits, and leaf spots that later have a shot-hole appearance (Agrios, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2005\u003c/span\u003e: Hulin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Bophela et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCopper-based bactericidal compounds are usually used to manage bacterial canker disease of stone fruits. Chemical controls cause serious risks to human health and environment (water, soil and air pollution). They are often ineffective because of the emergence of resistance to chemicals especially copper in some plant pathogenic bacteria (Behlau et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Therefore, it is necessary to use effective and safe methods to manage plant diseases. Fortunately, numerous studies have been conducted on the biological control of phytopathogens, and international initiatives have prioritized the use of biological control agents as viable options in integrated pest management (Mougou \u0026amp; Boughalleb-M\u0026rsquo;hamdi, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Amaresan et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Lahlali et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Some studies are related to the biocontrol of bacteria against \u003cem\u003eP. syringae\u003c/em\u003e pathovars. For example, \u003cem\u003eBacillus\u003c/em\u003e spp., \u003cem\u003ePantoea agglomerans\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e spp., \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e and \u003cem\u003eStreptomyces\u003c/em\u003e spp. were effective against pathovars \u003cem\u003esyringae\u003c/em\u003e (causing citrus blast disease and bacterial canker of stone fruits), \u003cem\u003eactinidiae\u003c/em\u003e (causing bacterial canker in kiwifruit), and \u003cem\u003eaptata\u003c/em\u003e (causing leaf spot of sugar beet) (Mougou \u0026amp; Boughalleb-M\u0026rsquo;hamdi, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wicaksono et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Nikolić et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Islam et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Doolotkeldieva \u0026amp; Bobusheva, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Abdellatif et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Bacterial biocontrol agents (BCAs) can produce secondary compounds, such as antibiotics, siderophores, bacteriocins, enzymes, endotoxins, and hydrogen cyanide to kill plant pathogens directly or indirectly by preventing pathogen growth, and boost the growth and defense mechanisms of plants (systemic acquired resistance and induction of systemic resistance) (Lahlali et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Pandit et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, biological control is a promising strategy to control and prevent phytopathogens. The main objectives of the present study were the isolation, identification, and characterization of bacterial epiphytic strains from stone fruit trees and to evaluate their antagonistic activity against \u003cem\u003eP. syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e the causal agent of bacterial canker of stone fruit, in both \u003cem\u003ein vitro\u003c/em\u003e and greenhouse conditions.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSampling and isolation of epiphytic bacteria\u003c/h2\u003e \u003cp\u003eThe sampling was performed from healthy peach, apricot, cherry, and plum trees in areas with stone fruit bacterial canker in East Azerbaijan and Zanjan provinces, northwestern Iran. A total of 73 samples were collected. Plant materials (10 g) including leaves and young shoots were added to 100 ml of sterile distilled water (SDW) and stirred at 120 rpm for 30 min. The suspensions were serially diluted and 10 \u0026micro;L of each dilution was spread on nutrient agar (NA) medium and incubated at 27 ˚C for 48 h. The bacterial colonies with different morphological characteristics were randomly selected and sub-cultured on NA medium. The obtained strains were stored in SDW at 4\u0026deg;C and in nutrient broth (NB) supplemented with 30% glycerol at -70\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePathogenicity test\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003ePathogenicity test\u003c/div\u003e \u003cp\u003e \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e strain 21 (Pss 21) (GenBank accession No. KF010313.1) (kindly gifted by Dr. Khodaygan from Vali-E-Asr University of Rafsanjan, Iran) was cultured on nutrient agar medium for 24\u0026ndash;48 h at 25\u0026deg;C. Twenty \u0026micro;L of Pss 21 suspension (OD\u003csub\u003e600nm\u003c/sub\u003e: 0.1 approximately 10\u003csup\u003e7\u003c/sup\u003e-10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was injected under the skin of young shoots of two-year-old peach plant cv. Anjiri through shallow wounds caused using a sterile scalpel. SDW was used as a negative control. Three inoculations were performed on the same tree and then wounds were covered with parafilm. The glasshouse experiment was assessed 10\u0026ndash;30 days after inoculation (Hulin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Koch\u0026rsquo;s postulates were carried out by re-isolation of the pathogen from inoculation sites and its identification was confirmed by biochemical tests including, LOPAT (levan production, oxidase activity, potato soft rot, arginine dihydrolase and tobacco hypersensitivity) and GATTa (gelatine hydrolysis, aesculin hydrolysis, tyrosinase activity and utilization of tartaric acid) as described by Schaad et al., (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) and Lelliott \u0026amp; Stead (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1987\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003eantagonistic activity screening of epiphyte strains\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe epiphyte strains were screened toward Pss 21 using the method described by Ryan et al., (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Strains were spotted onto NA medium and incubated for 48 h at 28 ˚C. Then bacterial colonies were cleaned with a sterile cotton and the reaming bacteria were killed by chloroform vapors for 30 minutes. The plates were aerated for 30 min under sterile conditions. Two hundred \u0026micro;L of Pss 21 suspension (10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was spread on the medium. The plates were incubated for 24 h at 28 ˚C, and then, the inhibition zone diameter was measured to assay the antagonistic activity. The experiments were conducted in a completely randomized design with three replications.\u003c/p\u003e\n\u003ch3\u003ePhenotypic identification of antagonist strains\u003c/h3\u003e\n\u003cp\u003eThe antagonist strains were characterized based on various phenotypic tests, consisting of gram reaction using KOH 3%, oxidase, catalase, soft rot on potato slices, hypersensitive reaction (HR) on geranium leaves, ice nucleation activity (INA), oxidative/fermentative (O/F), gelatin and starch hydrolysis, levan formation from sucrase, green fluorescent pigment production on King\u0026rsquo;s medium B (KB), growth at 4\u0026deg;C, 37\u0026deg;C and 41\u0026deg;C (Fahy \u0026amp; Persley, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1983\u003c/span\u003e; Schaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Moreover, resistance to antibiotics was determined on NA medium using the disk diffusion method with tetracycline (20 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), ampicillin (100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), and kanamycin (30\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) (Raja et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The experiment was performed with three replications.\u003c/p\u003e\n\u003ch3\u003eMolecular identification of antagonist strains\u003c/h3\u003e\n\u003cp\u003eTotal DNA from four selected antagonist strains (116a, 145c, 147b and 124a) was extracted by preparation of a suspension from overnight cultures grown on NA medium in 250 \u0026micro;L SDW and centrifugation at 6000 rpm for 10 min. The bacterial cell pellet was re-suspended in SDW, and suspensions at OD\u003csub\u003e600nm\u003c/sub\u003e 0.1 was adjusted. Then 1/10 vol. of extraction buffer (1M Tris-HCl pH 8.0, 10 mM EDTA pH 8.0 containing 10 mg/ml lysozyme) was added to each sample and tubes were incubated at 35\u0026ndash;37\u0026deg;C for 15 min. The bacterial suspensions were incubated at -20\u0026deg;C for 30 min and then at room temperature for 10 min. The freezing and thawing process was repeated two times. Then 1/10 vol. of KOH 10% was added to each tube and tubes were placed in the heating block for 5 min at 96\u0026deg;C, then centrifuged at 8000 rpm for 5 min. The supernatant was transferred to a fresh tube and stored at -20\u0026deg;C (Ausubel et al., 1990).\u003c/p\u003e \u003cp\u003eThe partial 16S rRNA gene sequence was amplified using the forward primer pA (AGAGTTTGATCCTGGCTCAG) and the reverse primer pH\u003csup\u003e\u0026lowast;\u003c/sup\u003e (AAGGAGGTGATCCAGCCGCA) (Edwards et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1989\u003c/span\u003e) in a total volume of 30 \u0026micro;L (15\u0026micro;L \u003cem\u003eTaq\u003c/em\u003e DNA Polymerase Master Mix (Ampliqon, Denmark), 1 \u0026micro;L of each primer (10 pmol/ \u0026micro;L)), 4 \u0026micro;L of template DNA (10pg-1\u0026micro;g) and 9 \u0026micro;L nuclease-free water). The PCR program consisting of an initial denaturation at 95\u0026deg;C for 2 min, followed by 45 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 55\u0026deg;C for 30 s, extension at 72\u0026deg;C for 60 s, and a final extension at 72\u0026deg;C for 10 min. PCR products were directly sequenced for both strands by Bioneer Company (Daejeon, South Korea). The obtained nucleotide sequences were compared with other sequences available in GenBank database by the Basic Local Alignment Search Tool (BLAST) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"https://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Alignments were performed in CLUSTALW (Thompson et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Maximum likelihood phylogenetic trees were constructed using MEGA-X based on the lowest value of the Bayesian Information Criterion (BIC) with 1,000 bootstrap replications (Kumar et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eAntibiotic production test\u003c/h3\u003e\n\u003cp\u003eFour selected strains were spotted onto NAG (NA medium plus glucose 1%) saturated with FeCl\u003csub\u003e3\u003c/sub\u003e (1000 \u0026micro;mol/mL) and incubated at 26\u0026deg;C for 24 h. Then colonies on agar plates were cleaned by sterile cotton and killed with chloroform vapors for 30 min. Petri plates in the sterile conditions were aerated for 30 min, and a suspension of Pss 21 (10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was sprayed on the medium, then the plates were incubated overnight. The presence of inhibition zones in the medium represents the production of antibiotics that limited growth of the pathogen (Weller \u0026amp; Cook, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1983\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSiderophore production test\u003c/h2\u003e \u003cp\u003eThe selected antagonist strains were spotted onto NAS (NA medium plus sucrose 1%) and NAS containing FeCl\u003csub\u003e3\u003c/sub\u003e (1000 \u0026micro;mol/mL) media and incubated at 26˚C for 24 h. Then the bacterial colonies were cleaned by sterile cottons and remaining colonies were killed with chloroform vapors for 30 min. Petri plates in sterile conditions were aerated for 30 min and incubated in 60 ˚C for 4 h to disable probably antibiotics. A suspension of Pss 21 (10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was sprayed on the media, and the plates were incubated overnight. The absence of the inhibition zone in the NAS medium containing FeCl\u003csub\u003e3\u003c/sub\u003e and the presence of the inhibition zone in the NAS medium represents the production of siderophores which limit the growth of the pathogen.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHCN production\u003c/h3\u003e\n\u003cp\u003eThe selective strains were screened for the production of hydrogen cyanide by adapting the method of Lorck (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1948\u003c/span\u003e). Briefly, strains were streaked onto NA medium supplemented with 4.4 g/L glycine. A Whatman filter paper no. 1 soaked in 2% sodium carbonate and 0.5% picric acid solutions was placed inside the plate lid. Plates were sealed with parafilm and incubated at 28 ˚C for four days. One plate without inoculation by the bacterium was considered as a negative control. The color change in the filter paper from orange to red indicates the levels of hydrogen cyanide production from low to very high.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBiocontrol of Pss 21 with epiphyte strains under\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003econditions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis experiment was carried out on detached branches and also two-year-old peach seedlings cv. Anjiri according to the method of Moragrega et al., (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) with modifications.\u003c/p\u003e \u003cp\u003eA suspension with a concentration of approximately 10\u003csup\u003e8\u003c/sup\u003e CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was prepared from overnight culture of Pss 21 and four selected antagonist strains grown on NA medium. Young peach branches with length of 15\u0026ndash;20 cm and two -year-old peach seedlings were prepared. The surface of branches was disinfested with 90% ethanol for one minute, and wounds (0.5 cm) were made on branches with a sterile scalpel. Then, the Pss suspension (50 \u0026micro;L) was injected into wounds using sterile syringes one day after antagonist inoculation on branches. Branches inoculated with Pss, and antagonist strains and SDW were considered as positive and negative controls, respectively. The inoculated detached branches were kept within sterile glass containers, lined with sterile moist cottons to maintain a high humidity for 30 days. This experiment was conducted in a completely randomized design with nine replications.\u003c/p\u003e \u003cp\u003eIn the peach seedlings, the inoculated areas were covered with parafilm to preserve moisture. The inoculated plants were kept in the greenhouse at 18\u0026ndash;22\u0026deg;C and a relative humidity of about 70% for 30 days. This experiment was conducted in a completely randomized design with 11 replications. The canker area on the stem was measured and biological control efficacy (BCE) of representative strains was calculated by [(D\u003csub\u003eC\u003c/sub\u003e- D\u003csub\u003eT\u003c/sub\u003e)/D\u003csub\u003eC\u003c/sub\u003e]*100 which D\u003csub\u003eC\u003c/sub\u003e is disease severity of the control (inoculated with Pss) and D\u003csub\u003eT\u003c/sub\u003e is disease severity of the treatment.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe results were statistically analyzed via one-way ANOVA on the SPSS Statistics 24 software. Mean values among treatments were compared by Duncan\u0026rsquo;s multiple range test at the 1% and 5% significance levels.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003ePathogenicity test of\u003c/b\u003e \u003cb\u003eP. syringae\u003c/b\u003e \u003cb\u003epv.\u003c/b\u003e \u003cb\u003esyringae\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePathogenicity of Pss 21 was confirmed by the emergence and development of necrotic areas on the branch of two-year-old peach plant during 10\u0026ndash;30 days post inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Re-isolation of Pss 21 from necrotic lesions or cankers was performed on KB medium after two weeks. The results of biochemical tests LOPAT (+ \u0026minus; \u0026minus; \u0026minus; +) and GATTa (+ + - -) were consistent with characteristics of Pss. Negative control inoculated with SDW was symptomless.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation and\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eselection of antagonist strains\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 122 epiphytic strains were isolated from healthy samples of peach, apricot, cherry and plum trees. Then, according to negative reaction of strains in the HR on geranium leaves, soft rot on potato slices and INA tests, 87 selective strains were screened for production of diffusible compound(s) towards Pss 21 on NA medium. Thirty-two strains indicated extreme inhibitory activities against Pss 21 with the inhibition zone diameter of more than 20 mm (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The analysis of variance (one-way ANOVA) and mean comparison of the inhibition zone diameter showed significant statistical difference between the bacterial strains and the positive control (F\u003csub\u003e32, 66\u003c/sub\u003e= 4.1, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Strains 148b, 118a, 147b and 143a with more than 40 mm and strains 132a, 145c and 146a with more than 26 mm inhibition zone diameter displayed the highest and lowest inhibitory effect, respectively. The strains with the highest inhibitory effect had a bactericide effect because Pss 21 did not grow around the colony of antagonist strains by two weeks after the test.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePhenotypic identification of antagonist\u003c/h2\u003e \u003cp\u003eThirty-two bacterial antagonist strains were identified based on physiological and biochemical characteristics and placed into four groups. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the characteristics of the selective strains of each group, antibiotic, siderophore and HCN production and susceptibility or resistance to antibiotics.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhenotypic characteristics of bacterial antagonistic strains identified in this research\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTests/ Strains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eAcinetobacter\u003c/em\u003e sp. (147b)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003ePantoea agglomerans\u003c/em\u003e (124a)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (145c)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eStenotrophomonas\u003c/em\u003e sp. (116a)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGram test\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFluorescent pigment on KB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOxidation/fermentation of glucose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eO/F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePotato soft rot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHypersensitivity reaction on geranium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOxidase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFahy \u0026amp; Persley, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1983\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCatalase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIce nucleation activity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLevan formation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHydrolysis of Gelatin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFahy \u0026amp; Persley, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1983\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHydrolysis of Tween 80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHydrolysis of Starch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNitrate reduction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFahy \u0026amp; Persley, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1983\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLecithinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth at 4\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth at 37\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth at 41\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth in 2% NaCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth in 5% NaCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth in 7% NaCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e⸗\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSensitivity/resistance to\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRaja et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2009\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTetracycline\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eS (1.26 cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eS (0.6 cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS (0.26 cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS (1.26 cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmpicillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eS (1.26 cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKanamycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAcid production from\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSchaad et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2001\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSorbitol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSucrose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLactose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFructose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMaltose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSiderophore production\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAntibiotic production\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWeller \u0026amp; Cook, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1983\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHCN production\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLorck, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1948\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eOF: Oxidation/fermentation of glucose, +: positive, -: negative, ND: non-determined, S: sensitivity to antibiotic (the diameter of the inhibition zone), R: antibiotic-resistance\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMolecular identification and phylogenetic analysis of antagonist strains\u003c/h2\u003e \u003cp\u003eThe partial sequencing of the 16S rRNA gene for the representative antagonist strains and the nucleotide sequences of these strains were deposited in GenBank database under accession numbers PP967786.1-PP967789.1 regarding to strains 116a, 147b, 145c and 124a respectively. Comparison of sequences with those available in the GenBank database revealed strain 116a had 99.67% identity with strains \u003cem\u003eStenotrophomonas rhizophila\u003c/em\u003e e-p10\u003csup\u003eT\u003c/sup\u003e and strain 147b indicated 100% identity with Taxon 53\u0026thinsp;=\u0026thinsp;\u003cem\u003eAcinetobacter\u003c/em\u003e sp. GK2. Moreover, strain 145c had 99.27% identity with \u003cem\u003ePseudomonas aestus\u003c/em\u003e CMAA 1-215\u003csup\u003eT\u003c/sup\u003e and strain 124a showed 99.44% identity with strains \u003cem\u003ePantoea agglomerans\u003c/em\u003e NCTC 9381\u003csup\u003eT\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe phylogenetic trees constructed based on the partial 16S rRNA gene sequences using maximum likelihood method indicated the taxonomic position of the epiphytic antagonist strains 116a, 147b, 145c and 124a isolated from stone fruits in comparison with the sequences of type strains deposited in NCBI (National Center for Biotechnology Information) with high bootstrap support (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAntagonistic activity of selective strains under\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003econditions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe bacterial epiphytes of \u003cem\u003eStenotrophomonas\u003c/em\u003e sp. strain 116a, \u003cem\u003eAcinetobacter\u003c/em\u003e sp. strain 147b, \u003cem\u003ePseudomonas\u003c/em\u003e sp. strain 145c, and \u003cem\u003eP. agglomerans\u003c/em\u003e strain 124a isolated from almond, cherry, peach, and sour cherry trees respectively, were applied to survey their antagonistic effects against Pss 21 and to reduces disease severity of bacterial canker on detached and living branches.\u003c/p\u003e \u003cp\u003eAccording to the variance analysis of the data, the disease severity was significantly affected by antagonist inoculation on detached branches (F\u003csub\u003e5, 48\u003c/sub\u003e= 77.29, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001) and peach seedlings (F\u003csub\u003e5, 60\u003c/sub\u003e = 66.41, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001), and mean comparison showed a significant difference between antagonist strains and the positive control treatments. In the detached branch assay, Antagonist strains 147b (\u003cem\u003eAcinetobacter\u003c/em\u003e sp.) and 116a (\u003cem\u003eStenotrophomonas\u003c/em\u003e sp.) could reduce the disease severity by 89.33% and 88% respectively, compared to the positive control. However, there was not a significant difference between the antagonist strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). In the living branch assay, all strains reduced the spread of disease symptoms or disease severity by more than 90%. Antagonist strains 145c (\u003cem\u003ePseudomonas\u003c/em\u003e sp.) and 147b (\u003cem\u003eAcinetobacter\u003c/em\u003e sp.) had the best result in terms of disease severity reduction by 94.80% in comparison with the positive control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe severe canker symptoms were observed in branches inoculated by Pss 21, while in other treatments, small necrotic lesions were formed at the inoculation sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and b).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study explored the antagonistic activity of bacterial epiphyte strains towards the primary causal agent of bacterial canker disease of stone fruit trees. The antibacterial effect of epiphyte strains isolated from different tissues of stone fruit trees against \u003cem\u003eP. syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e was acceptable in \u003cem\u003ein vitro\u003c/em\u003e conditions and about 36.78% of the tested strains showed antagonistic activity. Moreover, \u003cem\u003ein vitro\u003c/em\u003e evaluations indicated that antagonist strains can produce diffusible or volatile compounds such as antibiotics and HCN that spread in the medium or environment and inhibit the growth of the pathogen. While screening a great number of strains is given in laboratory testing owing to unique properties of biocontrol agents, in many instances the activity of antagonist in laboratory tests is not the same as greenhouse circumstances. key factors such as host genotype, intrinsic characteristics of a pathogen, inoculum density of a pathogen, and environmental conditions can influence the interaction between the plant, the pathogen, and the bacteria and the final levels of disease control achieved by bacteria (Bonaterra et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, the potential of a superior biocontrol agent to control a disease should be tested \u003cem\u003ein planta\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, \u003cem\u003ein vivo\u003c/em\u003e efficiency of selective antagonist strains demonstrates that the disease severity or stem canker development in detached branches and two-year-old peach seedlings significantly reduced. \u003cem\u003eIn vitro\u003c/em\u003e, the antagonist strain 147b caused the highest inhibition zone and the strain 145c had the lowest inhibitory effect towards Pss 21. \u003cem\u003eIn vitro\u003c/em\u003e assays only permit the selection of microorganisms with antagonistic activity, and bacteria with other abilities such as competitive exclusion or plant resistance induction were not identified (Raymaekers et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, \u003cem\u003evivo\u003c/em\u003e bioassays on seeds, detached branches and leaves, flowers, and fruits permit faster, reliable, and efficient screening (Pusey, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). In the present study, antagonist strains 145c and 147b outperformed in terms of disease severity reduction compared to the positive control in greenhouse circumstances. This excellent antagonistic effect in the natural environment could be attributed to quick adaptation to environmental conditions and compete with the plant pathogens for space, nutrients, and water and maintain itself for very long (Agrios, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) or probably the production of secondary metabolites that cannot be produced in the culture media (Abdel-Aziz et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Regarding phenotypic and molecular identification, the effective biocontrol strains belonged to the genera \u003cem\u003ePseudomonas\u003c/em\u003e, \u003cem\u003eAcinetobacter\u003c/em\u003e, \u003cem\u003ePantoea\u003c/em\u003e and \u003cem\u003eStenotrophomonas\u003c/em\u003e isolated from peach, cherry, sour cherry, and almond trees, respectively. The different strains of \u003cem\u003ePseudomonas\u003c/em\u003e spp. indicated a high degree of antagonism against plant pathogens which have an essential role in plant disease management (Balthazar et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Lahlali et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In a study, biological control of Pss under greenhouse conditions using strains of \u003cem\u003ePseudomonas putida\u003c/em\u003e, \u003cem\u003eP. agglomerans\u003c/em\u003e, \u003cem\u003eSerratia liquefaciens\u003c/em\u003e, \u003cem\u003eLeclercia adecarboxylata\u003c/em\u003e, \u003cem\u003eCurtobacterium flaccumfaciens\u003c/em\u003e, \u003cem\u003eAlcaligenes piechaudii\u003c/em\u003e and \u003cem\u003eErwinia rhapontici\u003c/em\u003e isolated from pome fruit trees was reported that all bacterial strains significantly reduced disease severity on branches of one-year-old Golden delicious apples (Kotan \u0026amp; Sahin, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In many studies, strains of \u003cem\u003ePseudomonas\u003c/em\u003e spp., \u003cem\u003eStenotrophomonas\u003c/em\u003e spp. and \u003cem\u003ePantoea agglomerans\u003c/em\u003e were reported as effective biocontrol agents towards several rhizospheric and phyllospheric phytopathogens including \u003cem\u003eRhizoctonia solani\u003c/em\u003e, \u003cem\u003eRalstonia solanacearum\u003c/em\u003e, \u003cem\u003eFusarium oxysporum\u003c/em\u003e, \u003cem\u003eColletotrichum\u003c/em\u003e sp., \u003cem\u003eAspergillus niger\u003c/em\u003e, \u003cem\u003eMonilina laxa\u003c/em\u003e, \u003cem\u003eErwinia amylovora\u003c/em\u003e, \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003etomato\u003c/em\u003e, \u003cem\u003eUromyces appendiculatus\u003c/em\u003e and \u003cem\u003ePenicillium digitatum\u003c/em\u003e (Giesler \u0026amp; Yuen, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Nakayama et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; \u0026Ouml;zaktan \u0026amp; Bora, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Elhalag et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; John \u0026amp; Thangavel, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Morella et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lahlali et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Abo-Elyousr \u0026amp; Hassan, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Abo-Elyousr et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Duchateau et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Sharma et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, there is little evidence about the biocontrol potential of \u003cem\u003eAcinetobacter\u003c/em\u003e sp. strains in previous studies. Xue et al., (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) reported the bacterial strain Xa6 (\u003cem\u003eAcinetobacter\u003c/em\u003e sp.) as a biocontrol agent against \u003cem\u003eRalstonia solanacearum\u003c/em\u003e (causing of bacterial wilt of tomato) \u003cem\u003ein vitro\u003c/em\u003e, \u003cem\u003eiv vivo\u003c/em\u003e and field experiments. Also, \u003cem\u003eAcinetobacter lwoffii\u003c/em\u003e strains PTA-113 and PTA-152 could reduce gray mold disease caused by \u003cem\u003eBotrytis cinerea\u003c/em\u003e on detached leaves of grapevine (Trotel-Aziz et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). This research discovered that epiphytic bacteria from stone fruit trees exhibit strong potential for controlling Pss, and these strains can be exploited as effective biocontrol agents.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u0026nbsp;16S rRNA\u0026nbsp;genes sequences are available from GenBank with accession numbers:\u0026nbsp;PP967786.1-PP967789.1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not involve any studies with human participants or animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eAll authors consent to publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe authors received no specific funding for this work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbbasi, V., Rahimian, H., \u0026amp; Tajick-Ghanbari, M. A. (2013). Genetic variability of Iranian strains of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e causing bacterial canker disease of stone fruits. \u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e, \u003cem\u003e135\u003c/em\u003e, 225\u0026ndash;235. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10658-012-0095-1\u003c/span\u003e\u003cspan address=\"10.1007/s10658-012-0095-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Aziz, S. M., Abo Elsoud, M. M., \u0026amp; Anise, A. A. H. (2017). Microbial biosynthesis: A repertory of vital natural products. \u003cem\u003eHandbook of food bioengineering, food biosynthesis\u003c/em\u003e (pp. 25\u0026ndash;54). Academic. Grumezescu, A.M., \u0026amp; Holban, A.M.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdellatif, E., Mikiciński, A., Kałużna, M., Bahri, B. A., Mougou-Hamdane, A., van Vaerenberg, J., Baeyen, S., Rhouma, A., \u0026amp; Janse, J. D. (2022). Promising epiphytic antagonistic \u003cem\u003ePseudomonas\u003c/em\u003e strains from the Citrus phyllosphere in the biocontrol of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e, causing bacterial citrus blast and black pit. \u003cem\u003eJournal of Plant Pathology\u003c/em\u003e, \u003cem\u003e104\u003c/em\u003e, 915\u0026ndash;928. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42161-022-01133-y\u003c/span\u003e\u003cspan address=\"10.1007/s42161-022-01133-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbo-Elyousr, K. A. M., Abdel-Rahim, I. R., Almasoudi, N. M., \u0026amp; Alghamdi, S. A. (2021). Native endophytic \u003cem\u003ePseudomonas putida\u003c/em\u003e as a biocontrol agent against common bean rust caused by \u003cem\u003eUromyces appendiculatus\u003c/em\u003e. \u003cem\u003eJournal of Fungi\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(9), 745. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jof7090745\u003c/span\u003e\u003cspan address=\"10.3390/jof7090745\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbo-Elyousr, K. A. M., \u0026amp; Hassan, S. A. (2021). Biological control of \u003cem\u003eRalstonia solanacearum\u003c/em\u003e (Smith), the causal pathogen of bacterial wilt disease by using \u003cem\u003ePantoea\u003c/em\u003e spp. \u003cem\u003eEgyptian Journal of Biological Pest Control\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e, 113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41938-021-00460-z\u003c/span\u003e\u003cspan address=\"10.1186/s41938-021-00460-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgrios, G. (2005). \u003cem\u003ePlant pathology. 4thEdition\u003c/em\u003e (p. 922). Elsevier Academic.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmaresan, N., Kumar, S., Annapurna, M., Rishna Kumar, K., K., \u0026amp; Sankaranarayanan, A. (2020). \u003cem\u003eBeneficial Microbes in Agro-Ecology: Bacteria and Fungi\u003c/em\u003e. Academic Press is an imprint of Elsevier.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAusubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., \u0026amp; Struhl, K. (1997). \u003cem\u003eCurrent Protocols in Molecular Biology\u003c/em\u003e. John Wiley \u0026amp; Sons, Inc.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalthazar, C., Novinscak, A., Cantin, G., Joly, D. L., \u0026amp; Filion, M. (2022). Biocontrol activity of \u003cem\u003eBacillus\u003c/em\u003e spp. and \u003cem\u003ePseudomonas\u003c/em\u003e spp. against \u003cem\u003eBotrytis cinerea\u003c/em\u003e and other cannabis fungal pathogens. \u003cem\u003ePhytopathology\u003c/em\u003e, 112(3), 549\u0026ndash;560. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PHYTO-03-21-0128-R\u003c/span\u003e\u003cspan address=\"10.1094/PHYTO-03-21-0128-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehlau, F., Canteros, B. I., Jones, J. B., \u0026amp; Graham, J. H. (2012). Copper resistance genes from different xanthomonads and citrus epiphytic bacteria confer resistance to \u003cem\u003eXanthomonas citri\u003c/em\u003e subsp. \u003cem\u003ecitri\u003c/em\u003e. \u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e, \u003cem\u003e133\u003c/em\u003e(4), 949\u0026ndash;963. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10658-012-9966-8\u003c/span\u003e\u003cspan address=\"10.1007/s10658-012-9966-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://link.springer.com/article/\u003c/span\u003e\u003cspan address=\"https://link.springer.com/article/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonaterra, A., Badosa, E., Daranas, N., Franc\u0026eacute;s, J., Rosell\u0026oacute;, G., \u0026amp; Montesinos, E. (2022). Bacteria as biological control agents of plant diseases. \u003cem\u003eMicroorganisms\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1759. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms10091759\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10091759\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBophela, K. N., Petersen, Y., Bull, C. T., \u0026amp; Coutinho, T. A. (2020). Identification of \u003cem\u003ePseudomonas\u003c/em\u003e isolates associated with bacterial canker of stone fruit trees in the Western Cape, South Africa. \u003cem\u003ePlant Disease\u003c/em\u003e, \u003cem\u003e104\u003c/em\u003e, 882\u0026ndash;892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-05-19-1102-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-05-19-1102-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoolotkeldieva, T., \u0026amp; Bobusheva, S. (2020). Characterization of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e from diseased stone fruits in Kyrgyzstan and testing of biological agents against pathogen. \u003cem\u003eInternational Journal of Phytopathology\u003c/em\u003e, 9(2), 71\u0026ndash;91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.33687/phytopath.009.02.3270\u003c/span\u003e\u003cspan address=\"10.33687/phytopath.009.02.3270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDroby, S., Wisniewski, M., Teixid\u0026oacute;, N., Spadaro, D., \u0026amp; Jijakli, M. H. (2016). The science, development, and commercialization of postharvest biocontrol products. \u003cem\u003ePostharvest Biology and Technology\u003c/em\u003e, \u003cem\u003e122\u003c/em\u003e, 22\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.postharvbio.2016.04.006\u003c/span\u003e\u003cspan address=\"10.1016/j.postharvbio.2016.04.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuchateau, S., Crouzet, J., Dorey, S., \u0026amp; Aziz, A. (2024). The plant-associated \u003cem\u003ePantoea\u003c/em\u003e spp. as biocontrol agents: Mechanisms and diversity of bacteria-produced metabolites as a prospective tool for plant protection. \u003cem\u003eBiological Control\u003c/em\u003e, \u003cem\u003e188\u003c/em\u003e, 105441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocontrol.2024.105441\u003c/span\u003e\u003cspan address=\"10.1016/j.biocontrol.2024.105441\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdwards, U., Rogall, T., Bl\u0026ouml;cker, H., Emde, M., \u0026amp; B\u0026ouml;ttger, E. C. (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. \u003cem\u003eNucleic Acids Research\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(19), 7843\u0026ndash;7853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/17.19.7843\u003c/span\u003e\u003cspan address=\"10.1093/nar/17.19.7843\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 2798131; PMCID: PMC334891.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElhalag, K. M., Messiha, N. A., Emara, H. M., \u0026amp; Abdallah, S. A. (2016). Evaluation of antibacterial activity of \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e against \u003cem\u003eRalstonia solanacearum\u003c/em\u003e under different application conditions. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e, \u003cem\u003e120\u003c/em\u003e(6), 1629\u0026ndash;1645. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jam.13097\u003c/span\u003e\u003cspan address=\"10.1111/jam.13097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFahy, P. C., \u0026amp; Persley, G. J. (1983). \u003cem\u003ePlant bacterial diseases. A diagnostic guide\u003c/em\u003e. Academic Press Australia.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiesler, L. J., \u0026amp; Yuen, G. Y. (1998). Evaluation of \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e strain C3 for biocontrol of brown patch disease. \u003cem\u003eCrop Protection\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(6), 509\u0026ndash;513. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0261-2194(98)00049-0\u003c/span\u003e\u003cspan address=\"10.1016/S0261-2194(98)00049-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHulin, M. T., Mansfield, J. W., Brain, P., Xiangming, X., Jackson, R. W., \u0026amp; Harrison, R. J. (2018). Characterization of the pathogenicity of strains of \u003cem\u003ePseudomonas syringae\u003c/em\u003e towards cherry and plum. \u003cem\u003ePlant Pathology\u003c/em\u003e, \u003cem\u003e67\u003c/em\u003e(5), 1177\u0026ndash;1193. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ppa.12834\u003c/span\u003e\u003cspan address=\"10.1111/ppa.12834\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam, M. S., Sultana, R., Hasan, M. A., Alam, M. S., Sikdar, B., Kamaruzzaman, M., \u0026amp; Islam, M. A. (2020). Characterization and biocontrol measures of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e associated with citrus blast disease. \u003cem\u003eVegetos\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e, 555\u0026ndash;569. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42535-020-00138-1\u003c/span\u003e\u003cspan address=\"10.1007/s42535-020-00138-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohn, N., \u0026amp; Thangavel, M. (2017). \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e: a novel plant growth promoter and biocontrol agent from marine environment. \u003cem\u003eInternational Journal of Advanced Research\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e, 207\u0026ndash;214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.21474/IJAR01/3797\u003c/span\u003e\u003cspan address=\"10.21474/IJAR01/3797\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKotan, R., \u0026amp; Sahin, F. (2006). Biological control of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e and nutritional similarity in carbon source utilization of pathogen and its potential biocontrol agents. \u003cem\u003eThe Journal of Turkish Phytopathology\u003c/em\u003e, 35(3), 1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dergipark.org.tr/tr/pub/fitopatoloji/issue/6397/85424\u003c/span\u003e\u003cspan address=\"https://dergipark.org.tr/tr/pub/fitopatoloji/issue/6397/85424\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, S., Stecher, G., Li, M., Knyaz, C., \u0026amp; Tamura, K. (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(6), 1547. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msy096\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msy096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahlali, R., Aksissou, W., Lyousfi, N., Ezrari, S., Blenzar, A., Tahiri, A., Ennahli, S., Hrusti\u0026acute;c, J., MacLean, D., \u0026amp; Amiri, S. (2020). Biocontrol activity and putative mechanism of \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e (SF14 and SP10), \u003cem\u003eAlcaligenes faecalis\u003c/em\u003e ACBC1, and \u003cem\u003ePantoea agglomerans\u003c/em\u003e ACBP1 against brown rot disease of fruit. \u003cem\u003eMicrobial Pathogenesis\u003c/em\u003e, \u003cem\u003e139\u003c/em\u003e, 103914. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.micpath.2019.103914\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2019.103914\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahlali, R., Ezrari, S., Radouane, N., Kenfaoui, J., Esmaeel, Q., Hamss, E., Belabess, H., Z., \u0026amp; Barka, E. A. (2022). Biological control of plant pathogens: A global perspective. \u003cem\u003eMicroorganisms\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(3), 596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms10030596\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10030596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 35336171; PMCID: PMC8951280.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLelliott, R. A., \u0026amp; Stead, D. E. (1987). \u003cem\u003eMethods for the diagnosis of bacterial diseases of plants\u003c/em\u003e. Blackwell Scientific.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorck, H. (1948). Production of hydrocyanic acid by bacteria. \u003cem\u003ePhysiologia Plantarum\u003c/em\u003e, \u003cem\u003e1\u003c/em\u003e(2), 142\u0026ndash;146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1399-3054.1948.tb07118.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1399-3054.1948.tb07118.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoragrega, C., Llorente, I., Manceau, C., \u0026amp; Montesinos, E. (2003). Susceptibility of European pear cultivars to \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e using immature fruit and detached leaf assays. \u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e, \u003cem\u003e109\u003c/em\u003e, 319\u0026ndash;326. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1023574219069\u003c/span\u003e\u003cspan address=\"10.1023/A:1023574219069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorella, N. M., Zhang, X., \u0026amp; Koskella, B. (2019). Tomato seed-associated bacteria confer protection of seedlings against foliar disease caused by \u003cem\u003ePseudomonas syringae\u003c/em\u003e. \u003cem\u003ePhytobiomes Journal\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e, 177\u0026ndash;190. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PBIOMES-01-19-0007-R\u003c/span\u003e\u003cspan address=\"10.1094/PBIOMES-01-19-0007-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMougou, I., \u0026amp; Boughalleb-M\u0026rsquo;hamdi, N. (2018). Biocontrol of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e affecting citrus orchards in Tunisia by using indigenous \u003cem\u003eBacillus\u003c/em\u003e spp. and garlic extract. \u003cem\u003eEgyptian Journal of Biological Pest Control\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e, 60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s41938-018-0061-0\u003c/span\u003e\u003cspan address=\"10.1186/s41938-018-0061-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakayama, T., Homma, Y., Hashidoko, Y., Mizutani, J., \u0026amp; Tahara, S. (1999). Possible role of xanthobaccins produced by \u003cem\u003eStenotrophomonas\u003c/em\u003e sp. strain SB-K88 in suppression of sugar beet damping off disease. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, \u003cem\u003e65\u003c/em\u003e(10), 4334\u0026ndash;4339. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.65.10.4334-4339.1999\u003c/span\u003e\u003cspan address=\"10.1128/AEM.65.10.4334-4339.1999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikolić, I., Berić, T., Dimkić, I., Popović, T., Lozo, J., Fira, D., \u0026amp; Stanković, S. (2019). Biological control of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003eaptata\u003c/em\u003e on sugar beet with \u003cem\u003eBacillus pumilus\u003c/em\u003e SS-10.7 and \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e (SS-12.6 and SS-38.4) strains. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e, 126(1), 165\u0026ndash;176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jam.14070\u003c/span\u003e\u003cspan address=\"10.1111/jam.14070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;zaktan, H., \u0026amp; Bora, T. (2004). Biological control of fire blight in pear orchards with a formulation of \u003cem\u003ePantoea agglomerans\u003c/em\u003e strain Eh 24. \u003cem\u003eBrazilian Journal of Microbiology\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e, 224\u0026ndash;229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S1517-83822004000200010\u003c/span\u003e\u003cspan address=\"10.1590/S1517-83822004000200010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandit, M. A., Kumar, J., Gulati, S., Bhandari, N., Mehta, P., Katyal, R., Rawat, C. D., Mishra, V., \u0026amp; Kaur, J. (2022). Major biological control strategies for plant pathogens. \u003cem\u003ePathogens\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(2), 273. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens11020273\u003c/span\u003e\u003cspan address=\"10.3390/pathogens11020273\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePusey, P. L. (1997). Crab apple blossoms as a model for research on biological control of fire blight. \u003cem\u003ePhytopathology\u003c/em\u003e, \u003cem\u003e87\u003c/em\u003e(11), 1096\u0026ndash;1102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/PHYTO.1997.87.11.1096\u003c/span\u003e\u003cspan address=\"10.1094/PHYTO.1997.87.11.1096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaja, C. E., Selvam, G. S., \u0026amp; Omive, K. (2009). Isolation, identification and characterization of heavy metal resistant bacteria from sewage. \u003cem\u003eInternational Joint Symposium on Geodisaster Prevention and Geoenvironment in Asia\u003c/em\u003e, Fukuoka, 205\u0026ndash;211.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaymaekers, K., Ponet, L., Holtappels, D., Berckmans, B., \u0026amp; Cammue, B. P. A. (2020). Screening for novel biocontrol agents applicable in plant disease management. \u003cem\u003eBiological Control\u003c/em\u003e, \u003cem\u003e144\u003c/em\u003e, 104240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocontrol.2020.104240\u003c/span\u003e\u003cspan address=\"10.1016/j.biocontrol.2020.104240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyan, A. D., Kinkel, L. L., \u0026amp; Schottel, J. L. (2004). Effect of pathogen isolate, potato cultivar, and antagonist strain on potato scab severity and biological control. \u003cem\u003eBiocontrol Science and Technology\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(3), 301\u0026ndash;311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/09583150410001665187\u003c/span\u003e\u003cspan address=\"10.1080/09583150410001665187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaad, N. W., Jones, J. B., \u0026amp; Chun, W. (2001). \u003cem\u003eLaboratory guide for identification of plant pathogenic bacteria\u003c/em\u003e (3rd ed., p. 260). The American Phytopathological Society.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma, P., Pandey, R., \u0026amp; Chauhan, N. S. (2024). Biofertilizer and biocontrol properties of \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e BCM emphasize its potential application for sustainable agriculture. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 1364807. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2024.1364807\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2024.1364807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura, K., Stecher, G., Peterson, D., Filipski, A., \u0026amp; Kumar, S. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e, 2725\u0026ndash;2729.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson, J. D., Higgins, D. G., \u0026amp; Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. \u003cem\u003eNucleic Acids Research\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(22), 4673\u0026ndash;4680. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/22.22.4673\u003c/span\u003e\u003cspan address=\"10.1093/nar/22.22.4673\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrotel-Aziz, P., Couderchet, M., Biagianti, S., \u0026amp; Aziz, A. (2008). Characterization of new bacterial biocontrol agents \u003cem\u003eAcinetobacter\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003ePantoea\u003c/em\u003e and \u003cem\u003ePseudomonas\u003c/em\u003e spp. mediating grapevine resistance against \u003cem\u003eBotrytis cinerea\u003c/em\u003e. \u003cem\u003eEnvironmental and Experimental Botany\u003c/em\u003e, \u003cem\u003e64\u003c/em\u003e(1), 21\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.envexpbot.2007.12.009\u003c/span\u003e\u003cspan address=\"10.1016/j.envexpbot.2007.12.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeller, D., \u0026amp; Cook, R. (1983). Suppression of take-all of wheat by seed treatments with fluorescent pseudomonads. \u003cem\u003ePhytopathology\u003c/em\u003e, \u003cem\u003e73\u003c/em\u003e(3), 463\u0026ndash;469. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/Phyto-73-463\u003c/span\u003e\u003cspan address=\"10.1094/Phyto-73-463\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWicaksono, W. A., Jones, E. E., Casonato, S., Monk, J., \u0026amp; Ridgway, H. J. (2018). Biological control of \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003eactinidiae\u003c/em\u003e (Psa), the causal agent of bacterial canker of kiwifruit, using endophytic bacteria recovered from a medicinal plant. \u003cem\u003eBiological Control\u003c/em\u003e, \u003cem\u003e116\u003c/em\u003e, 103\u0026ndash;112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocontrol.2017.03.003\u003c/span\u003e\u003cspan address=\"10.1016/j.biocontrol.2017.03.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue, Q. Y., Chen, Y., Li, S. M., Chen, L. F., Ding, G. C., Guo, D. W., \u0026amp; Guo, J. H. (2009). Evaluation of the strains of \u003cem\u003eAcinetobacter\u003c/em\u003e and \u003cem\u003eEnterobacter\u003c/em\u003e as potential biocontrol agents against Ralstonia wilt of tomato. \u003cem\u003eBiological Control\u003c/em\u003e, \u003cem\u003e48\u003c/em\u003e(3), 252\u0026ndash;258.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Antagonistic activity, Acinetobacter sp., Peach, Stenotrophomonas sp","lastPublishedDoi":"10.21203/rs.3.rs-5166856/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5166856/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBacterial canker of stone fruits caused by \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. \u003cem\u003esyringae\u003c/em\u003e (Pss) is one of the most important diseases of fruit trees worldwide. Despite its significant economic impact, chemical control methods using copper compounds remain often ineffective. Biological control provides a powerful and environmentally friendly alternative to synthetic pesticides. This study sought to isolate and identify epiphyte bacteria from the tissue surface of leaves and shoots of stone trees and investigate their antagonistic effects against pathogenic Pss in laboratory and greenhouse conditions. \u003cem\u003eIn vitro\u003c/em\u003e analysis of the antagonistic activity of 122 epiphytic bacterial strains showed that 36.78% of strains could produce inhibition zone diameter from 20 to 50 mm towards Pss. Also, some strains produced antibiotic and volatile organic antimicrobial compounds. The antagonist strains were identified as \u003cem\u003ePseudomonas\u003c/em\u003e sp., \u003cem\u003eAcinetobacter\u003c/em\u003e sp., \u003cem\u003eStenotrophomonas\u003c/em\u003e sp. and \u003cem\u003ePantoea agglomerans\u003c/em\u003e due to the physiological and biochemical characteristics and the partial 16SrRNA gene sequence. \u003cem\u003eIn vivo\u003c/em\u003e tests, the antagonistic \u003cem\u003ePseudomonas\u003c/em\u003e sp. strain 145c and \u003cem\u003eAcinetobacter\u003c/em\u003e sp. strain 147b reduced the disease severity of bacterial canker of stone fruit on two-year-old peach trees by 94.80% compared to the positive control. This study demonstrates that epiphytic bacteria from stone fruit trees exhibit strong potential for controlling Pss. These strains have the potential to serve as significant biocontrol agents.\u003c/p\u003e","manuscriptTitle":"Exploration of epiphytic bacteria of stone fruit trees for biocontrol of Pseudomonas syringae pv. syringae","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-02 12:46:01","doi":"10.21203/rs.3.rs-5166856/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2025-06-30T09:42:51+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-05-06T04:26:35+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-30T06:18:45+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"European Journal of Plant Pathology","date":"2025-04-29T02:41:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Plant Pathology","date":"2025-04-27T11:05:42+00:00","index":"","fulltext":""},{"type":"decision","content":"Accept","date":"2025-03-20T06:16:17+00:00","index":"","fulltext":""},{"type":"decision","content":"Accept,subject to authors carrying out corrections","date":"2025-03-20T06:16:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"be3aae25-227e-45c5-a5e8-0ea8d51e5839","owner":[],"postedDate":"May 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-04T16:48:34+00:00","versionOfRecord":{"articleIdentity":"rs-5166856","link":"https://doi.org/10.1007/s10658-025-03112-2","journal":{"identity":"european-journal-of-plant-pathology","isVorOnly":false,"title":"European Journal of Plant Pathology"},"publishedOn":"2025-07-31 16:21:04","publishedOnDateReadable":"July 31st, 2025"},"versionCreatedAt":"2025-05-02 12:46:01","video":"","vorDoi":"10.1007/s10658-025-03112-2","vorDoiUrl":"https://doi.org/10.1007/s10658-025-03112-2","workflowStages":[]},"version":"v1","identity":"rs-5166856","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5166856","identity":"rs-5166856","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}