Dolutegravir Disrupts Mouse Blood-Brain Barrier by Inducing Endoplasmic Reticulum Stress 

Dolutegravir Disrupts Mouse Blood-Brain Barrier by Inducing Endoplasmic Reticulum Stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dolutegravir Disrupts Mouse Blood-Brain Barrier by Inducing Endoplasmic Reticulum Stress Chang Huang, Qing Rui Qu, Md. Tozammel Hoque, Reina Bendayan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4420818/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Dolutegravir (DTG) - based antiretroviral therapy is the contemporary first-line therapy to treat HIV infection. Despite its efficacy, mounting evidence has suggested a higher risk of neuropsychiatric adverse effect (NPAE) associated with DTG use with a limited understanding of the underlying mechanisms. Our laboratory has previously reported a toxic effect of DTG comparable to efavirenz in disrupting the blood-brain barrier (BBB) integrity in vitro and in vivo . The current study aimed to investigate, in vitro , the potential mechanisms involved in DTG toxicity. Methods Primary cultures of mouse brain microvascular endothelial cells were used as a robust rodent BBB cell model. The cells were treated with DTG at therapeutic relevant concentrations (2500, 3500, 5000 ng/ml) for 3–48 h with or without the presence of three endoplasmic reticulum (ER) sensor inhibitors (GSK2606414, 4µ8c, 4PBA). RNA-sequencing, qPCR, western blot analysis and cell stress assays (Ca 2+ flux, H 2 DCFDA, TMRE, MTT) were performed. Results Our initial Gene Ontology (GO) analysis of RNA-Sequencing data revealed an enriched transcriptome signature of ER stress pathway in DTG treated cells. We further demonstrated that therapeutic concentrations of DTG significantly activated the ER stress sensor proteins (PERK, IRE1, p-IRE1) and downstream ER stress markers (eIF2α, p-eIF2α, Hspa5, Atf4, Ddit3, Ppp1r15a, Xbp1 , spliced-Xbp1 ). In addition, DTG treatment resulted in a transient Ca 2+ flux, an aberrant mitochondrial membrane potential, and a significant increase in reactive oxygen species in primary cultures of mouse brain microvascular endothelial cells. Furthermore, we found that prior cell treatment with 4PBA (a broad-spectrum ER stress inhibitor) significantly rescued DTG-induced downregulation of tight junction proteins (Zo-1, Ocln, Cldn5), whereas GSK2606414 (a PERK inhibitor) elicited the greatest protective effect on DTG-induced elevation of pro-inflammatory cytokines and chemokines ( Il6, Il23a, Il12b, Cxcl1, Cxcl2 ). Conclusions The current study provides valuable insights into DTG toxicological cell mechanisms, which may serve as a potential explanation of DTG-associated NPAEs in the clinic. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background The integrase strand transfer inhibitor (INSTI) dolutegravir (DTG) - based antiretroviral regimen is the contemporary recommended first-line drug regimen for the treatment of human immunodeficiency virus (HIV) infection. Despite its great potency, high barrier to resistance and tolerability, DTG - based antiretroviral therapy (ART) is known to induce neuropsychiatric adverse effect (NPAEs) including insomnia, dizziness, anxiety and depression [ 1 ]. Moreover, some recent clinical studies raised a potential association between ART and a slow progressive degeneration of cognitive and motor functions [ 2 ]. Despite evidence revealing the toxic potential of DTG in the central nervous system (CNS), the molecular mechanisms responsible for this observed toxicity are not well understood. Considering the lifelong requirement of ART treatment, a comprehensive assessment of the potential toxicity of the first line antiretroviral drugs (ARVs) is urgently needed [ 3 ]. The blood-brain barrier (BBB), primarily composed of brain microvascular endothelial cells sealed by tight junction (TJ) proteins is the major physiological barrier separating the brain from the systemic circulation and plays a critical role in maintaining CNS homeostasis [ 4 ]. BBB dysfunction can lead to disruption of the brain microenvironment and is widely implicated in multiple neurological diseases including dementia, depression and schizophrenia [ 5 ]. Recent work in our laboratory has demonstrated the potential of DTG to disrupt the BBB by downregulating TJ proteins inducing pro-inflammatory cytokines and altering expression of efflux transporters in various human and rodent BBB models [ 6 ]. To further understand the cellular mechanisms related to DTG toxicity in brain microvascular endothelial cells, RNA-sequencing was performed and revealed the endoplasmic reticulum (ER) stress as a major dysregulated pathway. The ER is a large membrane-enclosed cellular compartment that is primarily responsible for protein synthesis and folding [ 7 ]. Physiological or pathological challenges such as increased secretory protein load or the presence of mutated proteins overloading ER capacity can result in ER stress, activating protective strategies, collectively termed the “unfolded protein response” (UPR) [ 7 , 8 ]. The UPR in mammalian cells is activated by three ER transmembrane receptors: type I transmembrane protein inositol requiring 1 (IRE1α); protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK) and an activating transcription factor 6 (ATF6) [ 8 ]. The UPR operates in multiple ways as a homeostatic mechanism to prevent further accumulation of unfolded proteins in the cells, which includes: i) increased ER folding capacity by transcriptionally upregulating ER-chaperones; ii) attenuation of secretory protein transcription and translation; and iii) ER-associated degradation of misfolded protein [ 7 ]. In addition to protein folding, ER serves as the largest site of cellular free Ca 2+ storage, which plays a key role in ER-mitochondria crosstalk [ 9 ]. The presence of ER stress can result in Ca 2+ dysregulation, and UPR acts as a critical adaptive mechanism to cope with Ca 2+ imbalance [ 10 ]. Severe or prolonged ER stress can cause oxidative stress and ultimately lead to cell death by inducing mitochondrial membrane permeabilization [ 11 ], cytochrome c release and caspase activation [ 12 ]. This process is believed to be primarily mediated by the activation of the c-Jun N-terminal kinase (JNK) pathway [ 12 ], which has been attributed to IRE1/TRAF2/ASK1 pathway activation in response to UPR failure [ 13 ]. In the context of HIV treatment, several ARVs, particularly efavirenz (EFV) (a non-nucleoside reverse transcriptase inhibitor) have been reported to induce ER stress by activating PERK and IRE1α receptors and autophagy dysfunction in brain microvascular endothelial cells [ 14 ]. Protease inhibitors ritonavir and lopinavir have also been reported to induce ER stress, oxidative stress and inflammatory response in human and mouse macrophages and hepatocytes [ 15 , 16 ]. Several other events including alteration of Ca 2+ homeostasis, cellular respiratory metabolism, mitochondrial function, and DNA replication have also been documented with EFV and some HIV-protease inhibitors [ 17 , 18 ]. In contrast, the toxicity mechanisms of the first-line ARV, DTG, is not well understood in any cell types. Our laboratory recently reported the toxic potential of DTG in disrupting BBB at comparable levels to EFV [ 6 ]. The goal of the current study was to investigate ER stress as an underlying mechanism of DTG-induced toxicity at the BBB. The current study revealed a significant upregulation of ER stress and UPR associated with DTG treatment using primary cultures of mouse brain microvascular endothelial cells as a robust rodent BBB in vitro cell model. Materials and Methods RNA Sequencing (RNA-Seq) and analysis Total RNA was isolated from primary cultures of mouse brain microvascular endothelial cells using TRIzol reagent (Invitrogen) treated with DTG at 5000 ng/ml for 24 h. RNA quality was first assessed by Agilent Fragment Analyzer, then was subjected to library preparation using the Illumina TruSeq Stranded mRNA Library Preparation Kit (RS-122-2101) according to the manufacturer’s instructions. Libraries fragment size was checked using an Agilent Fragment Analyzer, then quantified with Qubit and qPCR using Collibri™ Library Quantification Kit (ThermoFisher, Cat#A38524500) on a BioRad CFX96 Touch Real-Time PCR Detection System. Quality checked libraries were loaded onto an Illumina NextSeq500 running SR 75 cycles. Real-time base call (.bcl) files were converted to FASTQ files using Illumina bcl2fastq2 conversion software. Qiagen CLC Genomic Workbench v23.0.4 with default parameters was used for the differential gene expression data analysis. Principal components analysis (PCA) was performed with DEseq on expression data to observe patterns with respect to experimental factors [ 19 ]. Volcano plot was generated using false discovery rate-adjusted P value cut-off of < 0.05 and log 2 fold change cut-offs of 1. Gene set enrichment analysis (GSEA) of differentially expressed gene sets was conducted using "fgsea" R package 1.20.0 (version 4.1.0) using M5: Gene Ontology (GO) subcollection (v2023.2) [ 20 ]. Reagents/materials All cell culture reagents were of the highest purity and obtained from Invitrogen (Carlsbad, CA, USA), unless indicated otherwise. Real-time quantitative polymerase chain reaction (qPCR) reagents, including reverse transcription cDNA kits and qPCR TaqMan primers, were purchased from Applied Biosystems (Foster City, CA, USA) and Life Technologies (Carlsbad, CA, USA), respectively. ER stress inhibitors GSK2606414, 4µ8c and 4PBA, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and PBS buffer were purchased from Sigma-Aldrich. Primary rabbit polyclonal anti-TJP1 (ZO-1; 402300), anti-OCLN (OCLN; 711500), anti-CLDN5 (CLDN5; 341600) and anti-Phospho-IRE1α (PA5-85738) antibodies were purchased from Invitrogen (Burlington, ON, Canada). Primary rabbit polyclonal anti-PERK (ab229912), anti-eIF2α (ab169528), anti-IRE1α (ab37073), primary mouse polyclonal anti-cytochrome c (ab110325), anti-VDAC1 (ab14734) antibodies, Fluo-8 Calcium Flux Assay Kit (ab112129) and Mitochondria/Cytosol Fractionation Kit (ab65320) were purchased from Abcam (Boston, MA, USA). Primary rabbit polyclonal anti-Phospho-eIF2α antibody (SAB4504388) Hoechst 33342 (14533) and H 2 DCFDA (D6883) were purchased from Sigma-Aldrich (Oakville, ON, Canada). Mouse monoclonal anti-β actin (sc-47778) antibody was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-rabbit and anti-mouse horseradish peroxidase-conjugated secondary antibodies and DTG were purchased from Jackson ImmunoResearch Inc. (Baltimore, PA, USA) and MedChem Express (Deer Park, NJ, USA), respectively. µ-Slide 8 Well (80826) were purchased from Ibidi (Grafelfing, Germany). Cell cultures Primary cultures of mouse (C57BL/6) brain microvascular endothelial cells were cultured (passage 2–6) in complete Mouse Endothelial Cell Medium (M1168, Cell Biologics Inc, Chicago, Illinois, USA), supplemented with vascular endothelial growth factor, endothelia cell growth supplements, heparin, epidermal growth factor, hydrocortisone, L-glutamine, antibiotic-Antimycotic Solution, and 5% FBS, and grown on gelatin-coated tissue culture plates. Cell lines were maintained in a humidified incubator at 37°C with 5% CO 2 , 95% air with fresh medium replaced every 2–3 days. Cells were split using 0.25% trypsin-EDTA upon reaching 95% confluence. Cell viability assay Cell viability of primary cultures of mouse brain microvascular endothelial cells in the presence of DTG (1000–10000 ng/ml) was assessed using the MTT assay as previously published [ 21 ]. Briefly following 48 h treatment, cells were incubated for 2 h at 37°C with 2.5 mg/mL MTT in PBS. The resulting formazan content in each well was dissolved using DMSO and quantified by UV absorbtion at 580 nm using a SpectraMax 384 microplate reader (Molecular Devices, Sunnyvale, CA). Cell viability was assessed by comparing the absorbance of cellular reduced MTT in DTG-treated cells to that of vehicle (DMSO)-treated cells. MTT assays revealed that the viability of primary cultures of mouse brain microvascular endothelial cells was not significantly affected by DTG in a wide range of concentrations (1000–10000 ng/ml) including therapeutic relevant concentrations after 48 h exposure (Supplemental Fig. 1). Supplemental Fig. 1 . Cell viability was assessed by MTT assay in primary cultures of mouse brain microvascular endothelial treated with DTG (1000–10000 ng/ml) for 48 h. Results are presented as mean relative cell viability ± SEM normalized to the DMSO control from n = 3 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied. ARVs and ER stress inhibitors treatment Confluent monolayers of primary cultures of mouse brain microvascular endothelial cells were treated with either DMSO (vehicle control), DTG (2500, 3500, 5000 ng/ml) or tunicamycin (3000 ng/ml) for a period of 3, 6, 16, 24 or 48 h at 37°C. Doses of DTG were carefully chosen to correspond to human therapeutic plasma levels [ 22 ]. The naturally occurring nucleoside antibiotic tunicamycin, known to behave as a strong ER stressor by inhibiting the biosynthesis of N-linked glycans in the proteins, was used as a positive control [ 23 ]. For experiments involving ER stress inhibitors, cells were pre-treated by GSK2606414 (5 µM; PERK inhibitor), 4µ8c (10 µM; IRE1α inhibitor) or 4PBA (2 mM; a broad inhibitor) for 6 h, following the treatment of DTG (5000 ng/ml) with specific inhibitors at desired concentrations for 24 or 48 h. At the desired time interval, treated cells were harvested and processed for subsequent assays. Gene expression analysis The mRNA expression of specific genes of interest was quantified using qPCR. Total RNA was isolated from cell samples (primary mouse BBB cells) using TRIzol reagent (Invitrogen) and treated with DNase I to remove contaminating genomic DNA. RNA concentration (absorbance at 260 nm) and purity (absorbance ratio 260/280) was assessed using NanoDrop One Spectrophotometer (Thermo Scientific). A total amount of 2 µg of RNA was then reverse transcribed to cDNA using a high-capacity reverse transcription cDNA kit (Applied Biosystems) according to the manufacturer’s instructions. Specific mouse primer pairs for Tjp1 (Zo-1; Mm01320638_m1), Ocln (Ocln; Mm00500912_m1), Cldn5 (Cldn5; Mm00727012_s1), Il6 (Il6; Mm00446190_m1), Cxcl1 (Cxcl1;Mm04207460_m1), Cxcl2 (Cxcl2;Mm00436450), Il23α (Il23α;Mm00518984), Il12β (Il12β,Mm01288989) were designed and validated by Life Technologies for use with TaqMan qPCR chemistry. Specific mouse primer pairs for spliced Xbp1 were customized using the following sequence 5'GCTGAGTCCGCAGCAGGT3'; 5'CAGGGTCCAACTTGTCCAGAAT3' and validated by Life Technologies with TaqMan qPCR chemistry. All assays were performed in triplicates with the housekeeping gene for mouse cyclophilin B Ppib (Ppib; Mm00478295_m1) or glyceraldehyde-3-phosphate dehydrogenase Gapdh (Gapdh; Mm99999915_g1) as an internal control. For each gene of interest, the critical threshold cycle (CT) was normalized to Ppib or Gapdh using the comparative CT method. The difference in CT values (ΔCT) between the target gene and cyclophilin B was then normalized to the corresponding ΔCT of the vehicle control (ΔΔCT) and expressed as fold expression (2 −ΔΔCT ) to assess the relative difference in mRNA expression. Cytosolic and mitochondrial protein isolation Cytosolic and mitochondrial protein fractions were extracted from the vehicle, DTG or tunicamycin-treated primary mouse brain microvascular endothelial cells using the Mitochondria/Cytosol Fractionation Kit (ab65320, Abcam) according to the manufacturer’s protocol. Briefly, 4×10 7 cells were harvested, washed, and centrifuged at 1000 × g for 10 min at 4°C. Cells were then resuspended in cytosol extraction buffer, incubated on ice for 10 min, and homogenized on ice using a Dounce tissue grinder. The homogenate was centrifuged at 1000 × g for 10 min at 4°C. The supernatant was collected and centrifuged at 10,000 × g for 30 min at 4°C. The supernatant was used as the cytosolic fraction. The pellet was resuspended in mitochondrial extraction buffer, vortexed for 10 sec, and used as the mitochondrial fraction. Western blot analysis Western blots were performed in accordance with our published protocol with minor modifications [ 24 ]. Cell lysates were obtained using modified RIPA buffer [50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 mM sodium o-vanadate, 0.25% (v/v) sodium deoxycholic acid, 0.1% (v/v) sodium dodecyl sulfate (SDS), 1% (v/v) NP-40, 200 µM PMSF, 0.1% (v/v) protease inhibitor]. Protein concentrations of the lysates were quantified using Bradford’s protein assay (Bio-Rad Laboratories) with BSA as the standard. Total protein (50 µg) for each sample was loaded, separated on 10%, 12% or 14% SDS-polyacrylamide gel, and electro-transferred onto a polyvinylidene fluoride membrane overnight at 4°C. The blots were blocked for 1 h at room temperature in 5% skim milk Tris-buffered saline solution containing 0.1% Tween 20 and incubated with primary rabbit polyclonal anti-TJP1 (1:250), anti-OCLN (1:250), anti-CLDN5 (1:250), anti-PERK (1:1000), anti-IRE1α (1:1000), anti-pIRE1α (1:1000), anti-eIF2α (1:1000), anti-peIF2α (1:1000) antibodies, primary mouse polyclonal anti-Cytochrome c (1:2000), anti-VDAC1 (1:1000) antibodies, and murine monoclonal anti-β-actin antibody (1:2000) overnight at 4°C. The blots were then incubated with corresponding horseradish peroxidase-conjugated anti-rabbit (1:5000) or anti-mouse (1:5000) secondary antibody for 1.5 h. Protein bands were detected using enhanced chemiluminescence SuperSignal West Pico System (Thermo Fisher Scientific). Calcium assay and imaging Cytosolic Ca 2+ was quantified using Fluo-8 Calcium Flux Assay Kit (Cat# ab112129, Abcam) according to manufacturer’s protocol. Briefly, the primary mouse brain microvascular endothelial cells were cultured overnight on 96-black well plates (1 x 10 5 cells/well) or µ-Slide 8 Well chambered coverslips (3 x 10 4 cells/well) prior to the assay. Cells were first incubated with Fluo-8 for 30 min at 37°C and then incubated at room temperature for 30 min. Spontaneous calcium activity was recorded prior to DTG challenge (time 0). Baseline signal was measured at Ex/Em = 490/525 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). DTG or DMSO (vehicle control) was then added to the wells, and the calcium flux was monitored and recorded by the fluorescence intensity at Ex/Em = 490/525 nm every minute for 5 min. The DTG-induced amplitude change in the 490/525 nm fluorescence ratio was calculated by subtracting the baseline ratio before DTG challenge. For calcium imaging, pre-stimulation images were taken to establish baseline calcium in cells (time 0) by fluorescence microscopy (Zeiss Axio Observer Apotome-2) using a 40× objective. Time lapse images were then taken every 20 s for one minute following DTG challenge. Measurement of intracellular ROS generation Reactive oxygen species (ROS) generation was quantified by fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate (H 2 DCFDA) according to the following published protocol with minor modification [ 25 ]. Briefly, primary mouse brain microvascular endothelial cells were seeded overnight on 96-black well plates (1 x 10 5 cells/well) prior to the assay. Cells were incubated with H 2 DCFDA (20 µM in pre-warmed cell medium) for 30 min at 37°C and the washed by pre-warmed PBS. Cells were then treated by DTG, tunicamycin or vehicle control for 1 or 6 h. ROS content was then measured by acquiring the fluorescence intensity at Ex/Em = 494/522 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). The DTG-induced change in the 494/522 nm fluorescence was calculated by subtracting the background fluorescence and then normalized to the vehicle control group. Measurement of MMP with TMRE Changes in mitochondrial membrane potential (MMP) was assessed by tetramethyl rhodamine ethyl ester (TMRE)-MMP assay kit according to manufacturer’s protocol (Cat# ab113852, Abcam, UK). In summary, the primary mouse brain microvascular endothelial cells were seeded overnight on 96-well black plates (2 x 10 5 cells/well) or µ-Slide 8 Well chambered coverslips (3 x 10 4 cells/well) prior to the assay. After exposure to DTG for 10 min or 6 h, cells were incubated with TMRE (600 nM) for 25 min and washed twice with warm PBS/0.2% BSA. Fluorescence intensity was measured at Ex/Em = 549/575 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). FCCP (carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone), an ionophore uncoupler of oxidative phosphorylation was used as a positive control in each experiment [ 26 ]. Cells were treated by FCCP for 10 min prior to the TMRE incubation. Data Analysis All experiments were repeated 3–4 times using cells obtained from different passages. Results are presented as mean ± SEM. All statistical analyses were performed using Prism 6 software (GraphPad Software Inc., San Diego, CA, USA). Statistical significance between two groups was assessed by two-tailed Student’s t test for unpaired experimental values. Multiple group comparisons were performed using one-way analysis of variance (ANOVA) with Bonferroni’s post-hoc test. p < 0.05 was considered statistically significant. Results Bulk mRNA sequencing in primary cultures of mouse brain microvascular endothelial cells revealed activated ER stress as a result of DTG toxicity. To investigate the alteration of transcriptomic profile by DTG treatment in primary cultures of mouse brain microvascular endothelial cells, RNA-seq and subsequent gene set enrichment analysis was performed. PCA analysis revealed that the two sample groups (DMSO vs. DTG treated) cluster separately, indicating distinct transcriptomic signatures due to the treatment of DTG ( Fig. 1 A ). A volcano plot was generated as determined by False Discovery Rate (FDR) based on differential gene expression analysis, revealing key genes ( Il6, Hspa5, Cxcl2, Atf4, Xbp1 ) involved in inflammatory and ER stress response were significantly upregulated in DTG treatment group compared to control ( Fig. 1 B ) . The transcriptome signature in DTG treated cells was enriched for gene ontology (GO) molecular function (MF), biological process (BP) and cellular component (CC) terms related to ER stress, protein folding, ER protein containing complex, response to unfolded protein ( Fig. 1 C ) . DTG induces ER stress by activating PERK signaling pathway in primary cultures of mouse brain microvascular endothelial cells. To examine whether DTG activates PERK signaling pathway in a dose-dependent and time-dependent manner, primary cultures of mouse brain microvascular cells were treated with DTG at 2500, 3500, 5000 ng/ml or tunicamycin at 3000 ng/ml for 3, 6, 16, 24 and 48 h. Compared to DMSO control, PERK protein expression was also significantly upregulated (~ 50%) by DTG (5000 ng/ml) following 24 or 48 h exposure ( Fig. 2 A ). DTG (5000 ng/ml) treatment resulted in a time-dependent upregulation of p-eIF2α protein with greater elevation observed at 48 h (~ 50%) compared to 24 h (~ 25%) ( Fig. 2 A ). Although DTG at 2500 ng/ml did not affect PERK or p-eIF2α protein expression, it significantly increased the gene expression of Hspa5 (BiP), Ddit3 (CHOP) and Ppp1r15a (GADD34) in a time-dependent manner. Consistent with this, stronger induction of Hspa5, Ddit3 Ppp1r15a gene expression was observed at 3500 ng/ml DTG together with a significant increase in Atf4 gene expression in a time-dependent manner ( Fig. 2 B ). Finally, DTG at 5000 ng/ml resulted in a robust upregulation of Hspa5, Atf4, Ddit3 and Ppp1r15a gene expression at all three time points (3, 6 and 16 h) with a peak response observed at 6 h ( Fig. 2 B ). The positive control tunicamycin robustly activated PERK pathway as expected ( Fig. 2 A, Fig. 2 B ). DTG induces ER stress by activating IRE1 signaling pathway in primary cultures of mouse brain microvascular endothelial cells. To examine whether DTG activates IRE1α signaling pathway in a dose and time-dependent manner, primary cultures of mouse brain microvascular cells were treated with DTG at 2500, 3500 and 5000 ng/ml or tunicamycin at 3000 ng/ml for 3, 6, 16, 24 and 48 h. A mild but significant increase (~ 30%) of p-IRE1α protein expression was observed following DTG treatment at 2500 ng/ml for 24 h. Consistent with this, p-IRE1α protein upregulation was more robust at DTG concentration of 5000 ng/ml (~ 2 fold) at 24 h; and returned to basal level after 48 h. As expected, the positive control tunicamycin robustly activated p-IRE1α protein expression after 24 and 48 h as expected ( Fig. 3 A ). The gene expression of Xbp1 was significantly upregulated following DTG treatment at 2500, 3500 and 5000 ng/ml at all three time points (3, 6, 16 h) in a dose-dependent manner, with the highest response observed at 6 h. The gene expression of the activated form of Xbp1 ( spliced-Xbp1 ) was mildly increased by DTG 2500 ng/ml after 16 h, and by DTG 3500 ng/ml at an earlier time point (6 h) ( Fig. 3 B ). Notably, DTG 5000 ng/ml robustly increased the Xbp1 and s-Xbp1 gene expression at a comparable level as induced by the positive control tunicamycin ( Fig. 3 B ). ER stress inhibitors mitigated the DTG-induced downregulation of TJ proteins in primary cultures of mouse brain microvascular endothelial cells. To further investigate the role of ER stress in DTG-induced downregulation of TJ proteins, primary cultures of mouse brain microvascular cells were pre-treated with 3 different ER stress inhibitors: GSK2606414 (PERK inhibitor); 4µ8c (IRE1α inhibitor) and 4PBA (a broad inhibitor) separately for 6 h following DTG treatment (5000 ng/ml) for 24 or 48 h. The expression of TJ protein was examined at both gene (24 h) and protein (48 h) levels. In agreement with our previous report, DTG 5000 ng/ml robustly downregulated the gene expression of Tjp1 (Zo-1), Ocln (Ocln) and Cldn5 (Cldn5) by > 60% following 24 h of treatment ( Fig. 4 A ). The observed downregulation of TJ protein expression was significantly mitigated by three inhibitors at the gene level, with the rescue effect being the most noticeable following 4PBA pre-treatment ( Fig. 4 A ). In parallel with the gene expression data, 48 h DTG (5000 ng/ml) treatment significantly downregulated the protein expression of Zo-1 and Ocln ( Fig. 4 B ). The downregulation of Zo-1 and Ocln protein was fully rescued by 4PBA pre-treatment. Though GSK and 4µ8c also appeared to mitigate the DTG-induced downregulation of Zo-1 and Ocln, this effect did not reach statistical significance ( Fig. 4 B ). Unlike the gene expression data, DTG treatment (5000 ng/ml) did not significantly affect Cldn5 protein expression ( Fig. 4 B ). ER stress inhibitors mitigated the DTG-induced upregulation of pro-inflammatory cytokines and chemokines at the gene level in primary cultures of mouse brain microvascular endothelial cells. To further investigate the role of ER stress in DTG-induced inflammatory responses, primary cultures of mouse brain microvascular cells were pre-treated with 3 different ER stress inhibitors: GSK2606414 (PERK inhibitor); 4µ8c (IRE1α inhibitor) and 4PBA (a broad inhibitor) separately for 6 h following DTG treatment (5000 ng/ml) for 24 h. The expression of pro-inflammatory cytokines and chemokines was examined at the gene level. Consistent with our previous data, DTG 5000 ng/ml robustly induced the gene expression of Il6 (~ 23 fold), Il23a (~ 30 fold), Il12b (~ 20 fold), Cxcl2 (~ 15 folds) and mildly induced the gene expression of Cxcl1 (~ 2 fold) after 24 h treatment ( Fig. 5 ). The induction of Il6, Il23a, Il12b , and Cxcl1 gene expression was mitigated by ~ 50% following ER stress inhibitors 4PBA and 4µ8c pre-treatment ( Fig. 5 ). GSK pre-treatment, specifically, rescued the Il6, Il23a, Il12b, Cxcl1 and Cxcl2 gene upregulation to a similar level as the control group ( Fig. 5 ). DTG treatment induced Ca 2+ release in primary cultures of mouse brain microvascular endothelial cells. Dysregulation of cytosolic Ca 2+ level is known to be associated with ER stress. To further characterize the mechanisms and downstream effects of DTG-induced ER stress, cytosolic Ca 2+ level was measured in primary cultures of mouse brain microvascular cells 1–5 min following DTG exposure (2500, 5000 ng/ml) using Fluo-8 Ca 2+ assay kit. The data demonstrated that, the cytosolic Ca 2+ level was transiently increased in the presence of DTG (2500, 5000 ng/ml) within the first minute post DTG challenge, quickly reaching a plateau and remaining stable after that ( Fig. 6 A, Fig. 6 B ). To better characterize the timing of this Ca 2+ increase, samples were dynamically examined by immunofluorescence microscopy following the DTG challenge. Ca 2+ induction was first observed as early as 20 s after DTG challenge, persisted at 40 s and gradually reached a plateau by 60 s. The effect was more pronounced with DTG at 5000 ng/ml compared to 2500 ng/ml ( Fig. 6 C ). DTG disrupted MMP, induced ROS generation but did not induce cytochrome-c release from mitochondria in primary cultures of mouse brain microvascular endothelial cells . To further investigate whether DTG-induced ER stress results in the alteration of mitochondrial bioenergetics, MMP was assessed by TMRE assay kit using a microplate reader in primary mouse brain microvascular cells treated with DTG (2500, 5000 ng/ml). Acute DTG treatment for 10 min at 2500 or 5000 ng/ml did not demonstrate any significant change in relative MMP. By contrast, prolonged DTG treatment (6 h) at both 2500 and 5000 ng/ml resulted in a significant decrease in MMP compared to controls, as indicated by the dose-dependent reduction in TMRE fluorescence ( Fig. 7 A ). FCCP, an ionophore uncoupler, was used as a positive control in this assay, and resulted in an aberrant MMP after 10 min-treatment as expected ( Fig. 7 A ). To investigate whether the observed ER stress and elevated UPR led to oxidative stress, ROS was quantified by a microplate reader using H 2 DCFDA assay. Despite the unaltered MMP, a significant increase (~ 30%) of ROS content was observed following DTG treatment at 2500 ng/ml for 1 h, with a greater ROS induction (~ 50%) observed at 5000 ng/ml. Also, the DTG-induced ROS generation was time-dependent, as reflected by a greater increase in ROS (~ 2 fold) after a 6 h at 5000 ng/ml ( Fig. 7 B ). However, a 48 h-treatment of DTG at 5000 ng/ml did not induce the cytochrome-c translocation from the mitochondria to cytosol, whereas such effect was observed with tunicamycin as expected ( Fig. 7 C ). Discussion Owing to the great efficacy and tolerability in suppressing viral replication, DTG - based ART is one of the recommended first-line regimens to treat HIV infected individuals worldwide, including pregnant women [ 27 ]. However multiple clinical reports have revealed a significantly higher incidence of NPAEs associated with DTG than other INSTIs [ 1 , 28 ]. The underlying mechanisms of DTG-induced toxicity remain largely unknown. Recently our laboratory reported an unexpected toxic potential of DTG in disrupting the BBB using several human and mouse BBB models in vitro, ex vivo and in vivo [ 6 ]. In the present study, our initial RNA-sequencing data illustrates an enrichment of transcriptome signature related to ER stress. We have therefore aimed to further investigate ER stress as a potential underlying mechanism of DTG toxicity at the BBB. ER stress has been reported with the use of multiple ARVs particularly EFV, some nucleoside reverse transcriptase inhibitors (abacavir, lamivudine) and protease inhibitors (lopinavir, ritonavir) in various CNS cell culture systems including human brain microvascular endothelial cells (hCMEC/D3) and primary cultures of human astrocytes [ 14 , 29 ]. To the best of our knowledge, our current study demonstrates for the first time that clinically relevant concentrations of the first line INSTI, DTG induces ER and oxidative stress, inflammatory responses, cytosolic Ca 2+ imbalance and mitochondrial bioenergetic alteration in primary cultures of mouse brain microvascular endothelial cells, which together suggest the underlying mechanism by which DTG induces toxicity at the BBB. PERK and IRE1α are the two major ER stress transducers of UPR response [ 12 ]. The PERK protein is activated by phosphorylation and dimerization in response to the accumulation of misfolded/unfolded protein, which leads to the phosphorylation of the eukaryotic Initiation Factor 2 alpha (eIF2α) and promotes the transcription/translation of the Activating Transcription Factor 4 (ATF4) [ 30 ]. Prolonged or excessive levels of ER stress stimulates the genes of CCAAT-enhancer-binding protein homologous protein (CHOP) by activating ATF4 which plays a key role in the initiation of apoptosis [ 31 ]. Similar to PERK, the IRE1α protein is activated by autophosphorylation in response to overloaded misfolded/unfolded protein, which will induce a splicing event of a transcription factor X-box binding protein 1 (XBP1) mRNA as an adaptive mechanism to cope with cell stress [ 12 ]. Alternatively in response to excessive ER stress and UPR failure, activated IRE1α can lead to cell death by triggering pro-apoptotic cascades through activation of the c-Jun N-terminal kinase (JNK) pathway [ 32 ]. In this study we showed that a therapeutic relevant concentration of DTG (5000 ng/ml) activates PERK by significantly upregulating the protein expression of PERK and phosphorylated-eIF2α at 24 and/or 48 h in primary cultures of mouse brain microvascular endothelial cells. Despite the absence of significant upregulation of PERK or p-eIF2α protein by DTG 2500 ng/ml, our gene expression data revealed a dose- and time-dependent induction of downstream chaperone, pro-apoptotic and transcription factor genes ( Ddit3, Hspa5, Atf4, Ppp1r15a ) by DTG at 2500, 3500 and 5000 ng/ml. Similarly, the IRE1α pathway was activated by both concentrations of DTG (2500, 5000 ng/ml), as reflected by significant upregulation of phosphorylated IRE1α protein expression at 24 h as well as a dose-dependent and time-dependent induction of Xbp1 and s-Xbp1 mRNA expression. Notably, the induction of pro-apoptotic genes as well as adaptive gene markers ( Xbp1 and s-Xbp1 ) was modest with DTG treatment at 2500 ng/ml (median therapeutic plasma concentration) and 3500 ng/ml, but was more pronounce at the higher DTG concentration of 5000 ng/ml (C max ), suggesting a potential adaptative UPR response at least below 3500 ng/ml. Our recently published study demonstrated that DTG can result in BBB leakage by disrupting TJ proteins [ 6 ]. To investigate whether ER stress is responsible for the observed effects, we pre-treated the cells with three ER sensor inhibitors 6 h before DTG exposure. Inhibitor concentrations were carefully selected based on prior literature to ensure efficacy of inhibition, with effects of the inhibitors were assessed in inhibitor groups alone [ 14 , 33 ]. Our gene expression data demonstrate that all three inhibitors elicited protective effects on DTG-induced Tjp1, Ocln and Cldn5 mRNA downregulation, with the most noticeable protective effects being observed with 4PBA (a broad inhibitor). We noticed the inhibitors alone upregulated the gene expression of TJ proteins, this was potentially due to the inhibition of intrinsic RNase activity of the ER sensor proteins, which has been previously well documented in the literature [ 14 , 34 ]. In agreement with our gene expression data, western blotting further demonstrated that 4PBA pre-treatment successfully rescued the DTG-induced downregulation of Zo-1 and Ocln proteins. Even though some protective effects were also observed by the GSK and 4µ8c, these did not reach statistical significance. Overall, our data suggests that ER stress plays a key role in DTG-induced TJ proteins downregulation at the BBB. Apart from structural damage, inflammatory response is another important aspect in the context of DTG toxicity at the BBB. To assess whether ER stress is also responsible for the DTG-induced inflammatory responses, the gene expression of several pro-inflammatory cytokines and chemokines was assessed in the presence or absence of the ER sensor inhibitors before the DTG exposure. Our data revealed that GSK, 4µ8c and 4PBA all significantly mitigated DTG-induced elevation of Il6, Il23a, Il12b, Cxcl1 and Cxcl2 gene expression. Interestingly in contrast to the TJ protein data where 4PBA elicited the most significant protective effect, the most noticeable rescue effect in the inflammatory response was observed in the presence of GSK (PERK inhibitor), suggesting PERK pathway being the major mediator in the context of DTG-associated inflammation, whereas the DTG-induced BBB structural damage related to TJ protein dysfunction appears to be resulted from general activation of ER sensors. Cytosolic Ca 2+ is one of the key regulators in ER stress and plays an important role in determining the cell fate [ 35 ]. A cytosolic Ca 2+ imbalance can induce ER stress, and vice versa, the activated UPR response can aggravate the cytosolic Ca 2+ dysregulation [ 35 ]. Our data demonstrated that DTG treatment (2500, 5000 ng/ml) resulted in a transient cytosolic Ca 2+ surge in primary cultures of mouse brain microvascular endothelial cells. These results are in agreement with several published studies which have implicated ARV (EFV) with ER stress, evoking Ca 2+ flux in various cell types including hepatocytes, neurons, and brain microvascular endothelial cells [ 14 , 36 , 37 ]. Interestingly DTG has also been reported to induce cytosolic Ca 2+ in human erythrocytes and potentiate platelet activation [ 38 ]. Due to the important role of cytosolic Ca 2+ in the crosstalk between ER and mitochondria, we next assessed DTG’s potential to induce mitochondrial dysfunction. Our data showed that a 6 h DTG (5000 ng/ml) treatment resulted in a rapid drop in MMP, but an acute treatment (10 min) of DTG did not produce any significant effect. These data suggest that DTG is unlikely to act as a direct mitochondrial uncoupler but attenuates mitochondrial bioenergetics as a result of cellular stress. This is in agreement with other studies reporting that some ARVs (EFV, 2′,3′-dideoxyinosine, tenofovir, ritonavir, lopinavir) treatment (4–24 h) resulted in a rapid drop in MMP in various cell types including human hepatoma cell line, primary cultures of human umbilical vein endothelial cells (HUVEC) and primary rat neuronal and glial cultures [ 37 , 39 – 42 ]. While the underlying mechanism remains unknown, such changes are likely due to the ER-mitochondrial uncoupling resulting from ARVs-induced disruption of Ca 2+ signal, which can subsequentially lead to impaired mitochondrial metabolism [ 43 ]. Interestingly, DTG has been reported as a potential Ca 2+ chelator [ 38 ]. Whether the DTG’s chelating potential may affect Ca 2+ -regulated ER-mitochondrial coupling which may lead to a differential toxicological mechanism from other ARVs[ 11 , 38 ] is an interesting aspect that needs further investigation. An aberrant MMP is closely associated with mitochondrial dysfunction and oxidative stress [ 10 ]. To further investigate the DTG-mediated oxidative stress, we next sought to quantify the DTG-induced ROS generation with cytosolic cytochrome c level. Tunicamycin was used as a positive control due to its widely documented potential to induce ROS formation and cytochrome c release [ 44 ]. Our data demonstrate ROS was significantly elevated by DTG treatment at both 2500 and 5000 ng/ml doses 1 h and 6h post-treatment. Notably, similar to our mRNA and protein data, the ROS content was significantly higher at C max DTG (5000 ng/ml), with a modest effect at 2500 ng/ml (median therapeutic plasma concentration), suggesting an adaptative UPR below 2500 ng/ml. Our results agree with others showing that several ARVs (EFV, ritonavir, lopinavir) could induce ROS production and impair mitochondrial function in multiple CNS cell types including neurons and oligodendrocytes in rodents [ 45 , 46 ]. Importantly some clinical studies documented a higher oxidant level in the serum of HIV + individuals on ARVs compared to treatment naïve HIV + individuals and uninfected controls [ 47 , 48 ], suggesting that the ARVs-induced oxidative stress is translatable to clinical conditions. It is worth noting that as a signalling molecule, ROS activation can serve as an adaptive purpose in response to acute UPR or promote cell death after excessive or prolonged ER stress [ 44 ]. Here we demonstrated ROS generation shortly after DTG exposure. To further investigate whether DTG-induced ROS activation potentially leads to cell death, we then assessed the level of cytochrome c translocation, which acts as a key initiator in caspase activation [ 12 ]. Our data showed that 48 h DTG (5000 ng/ml) treatment did not result in a significant increase in cytosolic cytochrome c level when compared to tunicamycin, which is known to provoke cytochrome c cytoplasmic release to initiate apoptosis [ 49 ]. Similarly, the MTT assay did not reveal any significant changes in cell viability following any DTG treatment (up to 10000 ng/ml) after 48 h. Together, these data suggest that despite the high level of cell stress and inflammatory response, DTG at C max (5000 ng/ml) did not lead to subsequent endothelial cell death. Conclusion In conclusion, this study demonstrates that DTG disrupts the BBB via induction of ER and oxidative stress, inflammatory response, and an alteration of mitochondrial bioenergetics. The current work provides insight into the underlying mechanisms responsible for DTG-induced toxicity in the CNS, which serve as a potential explanation for the high incidence of NPAEs associated with DTG use in the clinic; and further reveals that elevated DTG plasma concentrations could present a potential risk factor for DTG-induced toxicity in the CNS. In the clinic, a dose adjustment during ongoing DTG - based ART treatment may be beneficial to alleviate DTG-induced NPAEs. Abbreviations ART antiretroviral therapy ARV antiretroviral drugs ATF6 activating transcription factor 6 BBB blood-brain barrier CNS central nervous system DTG dolutegravir EFV efavirenz ER endoplasmic reticulum FDR False Discovery Rate GO Gene Ontology GSEA Gene set enrichment analysis H 2 DCFDA 2',7'-dichlorodihydrofluorescein diacetate HIV human immunodeficiency virus INSTI integrase strand transfer inhibitor IRE1α type I transmembrane protein inositol requiring 1 MMP mitochondrial membrane potential MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide PCA Principal components analysis PERK protein kinase R (PKR)-like endoplasmic reticulum kinase qPCR real-time quantitative polymerase chain reaction ROS reactive oxygen species TJ tight junction TMRE tetramethyl rhodamine ethyl ester UPR unfolded protein response Declarations Availability of data and materials The data that support the findings of this study are available in the Materials and Methods, Results, and/or Supplemental Material of this article or from the corresponding author on reasonable request. Ethics declarations Ethics approval and consent to participate Not applicable. The current study does not involve any human or animal subjects. Competing interests The authors declare that they have no competing interests. Funding This work was supported, in part, by the Canadian Institutes of Health Research (CIHR Grant# 511794) and the Ontario HIV Treatment Network (OHTN Grant# 506657) awarded to Dr. Reina Bendayan. Authors’ Contributions CH, QRQ, MTH performed the experimental work, RB conceived the study and directed the research. CH, MTH, and RB drafted the manuscript. All authors have read and approved the final version of the manuscript. Acknowledgements The authors thank Network Biology Collaborative Center (NBCC), Mount Sinai Hospital (University of Toronto, Canada) and Yiyan Wu (University of Toronto, Canada) for the help in RNA-Sequencing and data analysis. We acknowledge Dr. Jeffery Henderson (University of Toronto, Canada) for his help in experimental design and manuscript review. References Cailhol J, Rouyer C, Alloui C, Jeantils V. Dolutegravir and neuropsychiatric adverse events: a continuing debate. AIDS. 2017;31:2023–4. Robertson KR, Su Z, Margolis DM, Krambrink A, Havlir DV, Evans S, et al. Neurocognitive effects of treatment interruption in stable HIV-positive patients in an observational cohort. Neurology. 2010;74:1260–6. Buell KG, Chung C, Chaudhry Z, Puri A, Nawab K, Ravindran RP. Lifelong antiretroviral therapy or HIV cure: The benefits for the individual patient. AIDS Care. 2016;28:242–6. Kadry H, Noorani B, Cucullo L. A blood–brain barrier overview on structure, function, impairment, and biomarkers of integrity. Fluids Barriers CNS. 2020;17:69. Obrenovich M. Leaky Gut, Leaky Brain? Microorganisms. 2018;6:107. Huang C, Hoque T, Bendayan R. Antiretroviral drugs efavirenz, dolutegravir and bictegravir dysregulate blood-brain barrier integrity and function. Front Pharmacol. 2023;14:1118580. Lin JH, Walter P, Yen TSB. Endoplasmic Reticulum Stress in Disease Pathogenesis. Annu Rev Pathol Mech Dis. 2008;3:399–425. Read A, Schröder M. The Unfolded Protein Response: An Overview. Biology. 2021;10:384. Zhang Y, Wu Y, Zhang M, Li Z, Liu B, Liu H, et al. Synergistic mechanism between the endoplasmic reticulum and mitochondria and their crosstalk with other organelles. Cell Death Discov. 2023;9:51. Cao SS, Kaufman RJ. Endoplasmic Reticulum Stress and Oxidative Stress in Cell Fate Decision and Human Disease. Antioxidants & Redox Signaling. 2014;21:396–413. Deniaud A, Sharaf El Dein O, Maillier E, Poncet D, Kroemer G, Lemaire C, et al. Endoplasmic reticulum stress induces calcium-dependent permeability transition, mitochondrial outer membrane permeabilization and apoptosis. Oncogene. 2008;27:285–99. Sano R, Reed JC. ER stress-induced cell death mechanisms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2013;1833:3460–70. Lee H, Park M-T, Choi B-H, Oh E-T, Song M-J, Lee J, et al. Endoplasmic Reticulum Stress-Induced JNK Activation Is a Critical Event Leading to Mitochondria-Mediated Cell Death Caused by β-Lapachone Treatment. Blagosklonny MV, editor. PLoS ONE. 2011;6:e21533. Bertrand L, Toborek M. Dysregulation of Endoplasmic Reticulum Stress and Autophagic Responses by the Antiretroviral Drug Efavirenz. Mol Pharmacol. 2015;88:304–15. Zhang X, Cao R, Liu R, Zhao R, Huang Y, Gurley EC, et al. Reduction of the HIV Protease Inhibitor-Induced ER Stress and Inflammatory Response by Raltegravir in Macrophages. Zhang Y, editor. PLoS ONE. 2014;9:e90856. Han H, He Y, Hu J, Lau R, Lee H, Ji C. Disrupted ER‐to‐Golgi trafficking underlies anti‐HIV drugs and alcohol‐induced cellular stress and hepatic injury. Hepatology Communications. 2017;1:122–39. Blas-García A, Apostolova N, Ballesteros D, Monleón D, Morales JM, Rocha M, et al. Inhibition of mitochondrial function by efavirenz increases lipid content in hepatic cells. Hepatology. 2010;52:115–25. Gallego-Escuredo JM, Del Mar Gutierrez M, Diaz-Delfin J, Domingo JC, Mateo MG, Domingo P, et al. Differential effects of efavirenz and lopinavir/ritonavir on human adipocyte differentiation, gene expression and release of adipokines and pro-inflammatory cytokines. Curr HIV Res. 2010;8:545-53. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11:R106. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database Hallmark Gene Set Collection. Cell Systems. 2015;1:417–25. Kamiloglu S, Sari G, Ozdal T, Capanoglu E. Guidelines for cell viability assays. Food Frontiers. 2020;1:332–49. Cottrell ML, Hadzic T, Kashuba ADM. Clinical Pharmacokinetic, Pharmacodynamic and Drug-Interaction Profile of the Integrase Inhibitor Dolutegravir. Clin Pharmacokinet. 2013;52:981–94. Guha P, Kaptan E, Gade P, Kalvakolanu DV, Ahmed H. Tunicamycin induced endoplasmic reticulum stress promotes apoptosis of prostate cancer cells by activating mTORC1. Oncotarget. 2017;8:68191–207. Hoque MdT, Shah A, More V, Miller DS, Bendayan R. In vivo and ex vivo regulation of breast cancer resistant protein (Bcrp) by peroxisome proliferator‐activated receptor alpha (Pparα) at the blood–brain barrier. Journal of Neurochemistry. 2015;135:1113–22. Ng N, Ooi L. A Simple Microplate Assay for Reactive Oxygen Species Generation and Rapid Cellular Protein Normalization. BioProtoc. 2021;11:e3877. Demine, Renard, Arnould. Mitochondrial Uncoupling: A Key Controller of Biological Processes in Physiology and Diseases. Cells. 2019;8:795. Estill J, Bertisch B. More evidence for dolutegravir as first-line ART for all. The Lancet HIV. 2020;7:e154–5. Hoffmann C, Llibre JM. Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors. AIDSRev. 2019;21:1768. Nooka S, Ghorpade A. HIV-1-associated inflammation and antiretroviral therapy regulate astrocyte endoplasmic reticulum stress responses. Cell Death Discov. 2017;3:17061. Liu Z, Lv Y, Zhao N, Guan G, Wang J. Protein kinase R-like ER kinase and its role in endoplasmic reticulum stress-decided cell fate. Cell Death Dis. 2015;6:e1822–e1822. Rozpedek W, Pytel D, Mucha B, Leszczynska H, Diehl JA, Majsterek I. The Role of the PERK/eIF2α/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress. CMM. 2016;16:533–44. Siwecka N, Rozpędek-Kamińska W, Wawrzynkiewicz A, Pytel D, Diehl JA, Majsterek I. The Structure, Activation and Signaling of IRE1 and Its Role in Determining Cell Fate. Biomedicines. 2021;9:156. Chen S, Melchior WB, Guo L. Endoplasmic Reticulum Stress in Drug- and Environmental Toxicant-Induced Liver Toxicity. Journal of Environmental Science and Health, Part C. 2014;32:83–104. Prischi F, Nowak PR, Carrara M, Ali MMU. Phosphoregulation of Ire1 RNase splicing activity. Nat Commun. 2014;5:3554. Bahar E, Kim H, Yoon H. ER Stress-Mediated Signaling: Action Potential and Ca2+ as Key Players. IJMS. 2016;17:1558. Tovar-y-Romo LB, Bumpus NN, Pomerantz D, Avery LB, Sacktor N, McArthur JC, et al. Dendritic Spine Injury Induced by the 8-Hydroxy Metabolite of Efavirenz. J Pharmacol Exp Ther. 2012;343:696–703. Apostolova N, Gomez-Sucerquia LJ, Alegre F, Funes HA, Victor VM, Barrachina MD, et al. ER stress in human hepatic cells treated with Efavirenz: Mitochondria again. Journal of Hepatology. 2013;59:780–9. Madzime M, Theron AJ, Anderson R, Tintinger GR, Steel HC, Meyer PWA, et al. Dolutegravir potentiates platelet activation by a calcium-dependent, ionophore-like mechanism. Journal of Immunotoxicology. 2022;19:117–24. Apostolova N, Gomez‐Sucerquia L, Moran A, Alvarez A, Blas‐Garcia A, Esplugues J. Enhanced oxidative stress and increased mitochondrial mass during Efavirenz‐induced apoptosis in human hepatic cells. British J Pharmacology. 2010;160:2069–84. Apostolova N, Blas-García A, Ballesteros D, González Y, Morán A, Gómez-Sucerquia L, et al. Clinical concentrations of efavirenz (EFV) reduce cellular proliferation and viability in several human cell lines. JIAS. 2008;11:P161. Robertson K, Liner J, Meeker RB. Antiretroviral neurotoxicity. J Neurovirol. 2012;18:388–99. White MG, Wang Y, Akay C, Lindl KA, Kolson DL, Jordan-Sciutto KL. Parallel high throughput neuronal toxicity assays demonstrate uncoupling between loss of mitochondrial membrane potential and neuronal damage in a model of HIV-induced neurodegeneration. Neuroscience Research. 2011;70:220–9. Bravo-Sagua R, López-Crisosto C, Parra V, Rodriguez-Peña M, Rothermel BA, Quest AFG, et al. mTORC1 inhibitor rapamycin and ER stressor tunicamycin induce differential patterns of ER-mitochondria coupling. Sci Rep. 2016;6:36394. Ochoa CD, Wu RF, Terada LS. ROS signaling and ER stress in cardiovascular disease. Molecular Aspects of Medicine. 2018;63:18–29. Jensen BK, Monnerie H, Mannell MV, Gannon PJ, Espinoza CA, Erickson MA, et al. Altered Oligodendrocyte Maturation and Myelin Maintenance: The Role of Antiretrovirals in HIV-Associated Neurocognitive Disorders. J Neuropathol Exp Neurol. 2015;74:1093–118. Stauch KL, Emanuel K, Lamberty BG, Morsey B, Fox HS. Central nervous system-penetrating antiretrovirals impair energetic reserve in striatal nerve terminals. J Neurovirol. 2017;23:795–807. Hulgan T, Morrow J, D’Aquila RT, Raffanti S, Morgan M, Rebeiro P, et al. Oxidant Stress Is Increased during Treatment of Human Immunodeficiency Virus Infection. Clinical Infectious Diseases. 2003;37:1711–7. Mandas A, Iorio EL, Congiu MG, Balestrieri C, Mereu A, Cau D, et al. Oxidative Imbalance in HIV-1 Infected Patients Treated with Antiretroviral Therapy. Journal of Biomedicine and Biotechnology. 2009;2009:1–7. Häcki J, Egger L, Monney L, Conus S, Rossé T, Fellay I, et al. Apoptotic crosstalk between the endoplasmic reticulum and mitochondria controlled by Bcl-2. Oncogene. 2000;19:2286–95. Additional Declarations No competing interests reported. Supplementary Files SupplePDF.pdf Onlinefloatimage1.png Supplemental Figure 1. Cell viability was assessed by MTT assay in primary cultures of mouse brain microvascular endothelial treated with DTG (1000-10000 ng/ml) for 48 h. Results are presented as mean relative cell viability ± SEM normalized to the DMSO control from n=3 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4420818","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":306144193,"identity":"fb815fba-9667-4df7-96c1-500e7f313f42","order_by":0,"name":"Chang Huang","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Huang","suffix":""},{"id":306144194,"identity":"77a2708d-bb65-4166-a1fc-02489d95abe5","order_by":1,"name":"Qing Rui Qu","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"Rui","lastName":"Qu","suffix":""},{"id":306144195,"identity":"077f3844-9fe0-4bb5-b4ab-8a901246ee4a","order_by":2,"name":"Md. Tozammel Hoque","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Md.","middleName":"Tozammel","lastName":"Hoque","suffix":""},{"id":306144196,"identity":"928d5f22-fcba-45e0-94c3-739b642d8927","order_by":3,"name":"Reina Bendayan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYFACHiBmAzGYD5CshS2BAayJjXgtPAbEaTFv4D34uKDMLrF/ds836Q8V9+TM5ZsPMPyowa1F5gBfsvGMc8mJM+6c3SZx4EyxsWUbWwJjzzHcWiQYeMykeduYExtu5G6TONiWkLjhGI8BMz7XAbWY/+Ztq0+cfyPnGZKWf/htYeZtO5y44UYOG0ILYxseLcx8ydI8544bb7yRZmxx5kyCscGxtISDvX14tLD3HvzMU1YtO+9G8sMbFRUJcgaHDx988OMbbi0MzBDKsQFZ8AAeDXBgT4yiUTAKRsEoGKEAAHRcT1sd+JHGAAAAAElFTkSuQmCC","orcid":"","institution":"University of Toronto","correspondingAuthor":true,"prefix":"","firstName":"Reina","middleName":"","lastName":"Bendayan","suffix":""}],"badges":[],"createdAt":"2024-05-14 17:29:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4420818/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4420818/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57089888,"identity":"b126d5e1-a738-4305-839d-73ebc16da482","added_by":"auto","created_at":"2024-05-24 12:42:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":39213,"visible":true,"origin":"","legend":"\u003cp\u003eBulk mRNA sequencing primary cultures of mouse brain microvascular endothelial cells treated by DMSO or DTG (5000 ng/ml) for 24 h. \u003cstrong\u003e(A)\u003c/strong\u003e Principal component plot of the first and second components from PCA analysis in these samples (n = 3). \u003cstrong\u003e(B)\u003c/strong\u003e Volcano plot illustrates differential gene expression between control and DTG-treated groups defining significantly upregulated or downregulated genes as those with Log\u003csub\u003e2\u003c/sub\u003eFC \u0026gt; 2 and log\u003csub\u003e10\u003c/sub\u003eFDR \u0026gt; 1. \u003cstrong\u003e(C)\u003c/strong\u003e Dot plot: gene ontology (GO) analysis to identify key molecular function (MF), biological process (BP) and cellular component (CC). Dot size: number of genes in data attributed to each GO term; dot color: red indicates upregulated gene sets by DTG-treatment; blue indicates downregulated gene sets by DTG-treatment.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/afaa355fa0d9bedb1ea0b24e.png"},{"id":57089889,"identity":"f3e094ba-3de4-4bb3-a303-1180612105d3","added_by":"auto","created_at":"2024-05-24 12:42:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":52404,"visible":true,"origin":"","legend":"\u003cp\u003eProtein and gene expression of ER stress markers was assessed by immunoblotting and qPCR in primary cultures of mouse brain microvascular endothelial cells treated with DTG (2500, 3500, 5000 ng/ml) or tunicamycin (Tuni) (3000 ng/ml; positive control) for 24 or 48 h, respectively. \u003cstrong\u003e(A)\u003c/strong\u003e Representative immunoblots and densitometric analysis of PERK and p-eIF2α protein expression. Western blot analysis was applied using specific antibodies to detect the protein expression of PERK, p-eIF2α and eIF2α; b-actin was used as a loading control. \u003cstrong\u003e(B) \u003c/strong\u003eThe mRNA expression of \u003cem\u003eHspa5, Atf4, Ddit3\u003c/em\u003e and\u003cem\u003e Ppp1r15a \u003c/em\u003egenes were assessed by qPCR normalized to the housekeeping mouse \u003cem\u003eGapdh\u003c/em\u003e gene. Results are presented as mean relative mRNA or protein expression ± SEM normalized to the DMSO control from n=3-4 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/296a08bd6d0a32b4485bef43.png"},{"id":57090285,"identity":"7237a85a-9511-4e16-a5d5-5c512fea11ee","added_by":"auto","created_at":"2024-05-24 12:50:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":52086,"visible":true,"origin":"","legend":"\u003cp\u003eProtein and gene expression of ER stress markers was assessed by immunoblotting and qPCR in primary cultures of mouse brain microvascular endothelial cells treated with DTG (2500, 3500, 5000 ng/ml) or tunicamycin (Tuni) (3000 ng/ml; positive control) for 24 or 48 h, respectively. \u003cstrong\u003e(A)\u003c/strong\u003e Representative blots and densitometric analysis performed on p-IRE1α protein expression level. Western blot analysis was applied using specific antibodies to detect the protein expressions of p-IREα and IREα; b-actin was used as a loading control. \u003cstrong\u003e(B) \u003c/strong\u003eThe mRNA expression of \u003cem\u003eXbp1 \u003c/em\u003eand \u003cem\u003esXbp1 \u003c/em\u003egenes was assessed by qPCR normalized to the housekeeping mouse \u003cem\u003eGapdh\u003c/em\u003e gene. Results are presented as mean relative mRNA or protein expression ± SEM normalized to the DMSO control from n=3-4 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/06eabb0b80e1533e736ab054.png"},{"id":57090286,"identity":"944f7629-b75c-411f-94a1-a60e7eedbc96","added_by":"auto","created_at":"2024-05-24 12:50:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":64485,"visible":true,"origin":"","legend":"\u003cp\u003eER sensor inhibitors (GSK; 4PBA; 4μ8c) mitigated the DTG-induced downregulation of TJ proteins. \u003cstrong\u003e(A)\u003c/strong\u003e Gene expression of TJ proteins was assessed by qPCR in primary cultures of mouse brain microvascular endothelial cells treated with DTG (5000ng/ml) for 24 h in the presence or absence of the ER sensor inhibitors. The mRNA expression is normalized to the housekeeping mouse \u003cem\u003eGapdh\u003c/em\u003e gene.\u003cstrong\u003e (B)\u003c/strong\u003eRepresentative immunoblots and densitometric analysis performed on Zo-1, Ocln and Cldn5 protein expression levels. Western blot analysis was applied using specific antibodies to detect the protein expression of Zo-1, Ocln and Cldn5; b-actin was used as a loading control. Results are presented as mean relative mRNA or protein expression ± SEM normalized to the DMSO control from n=3-4 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. ****, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/218689626e5f16dba9c8e2c0.png"},{"id":57090287,"identity":"94e0e9c9-6f4b-4e5d-9030-f86d0a1a8d6a","added_by":"auto","created_at":"2024-05-24 12:50:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":29517,"visible":true,"origin":"","legend":"\u003cp\u003eER sensor inhibitors (GSK; 4PBA; 4μ8c) mitigated the DTG-induced proinflammatory cytokines and chemokines elevation. Gene expression of \u003cem\u003eIl6, Il23a, Il12b, Cxcl1, Cxcl2\u003c/em\u003e was assessed by qPCR in primary cultures of mouse brain microvascular endothelial treated with DTG (5000ng/ml) for 24 h in the presence or absence of the ER sensor inhibitors. The mRNA expression is normalized to the housekeeping mouse \u003cem\u003eGapdh\u003c/em\u003e gene. Results are presented as mean relative mRNA expression ± SEM normalized to the DMSO control from n=4 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001\u003cem\u003e.\u003c/em\u003e **** \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0.0001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/d4c589a3ef06e5f2ef284a48.png"},{"id":57089896,"identity":"221b47bc-824d-48d0-8e8b-4c6f290f72dd","added_by":"auto","created_at":"2024-05-24 12:42:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":100172,"visible":true,"origin":"","legend":"\u003cp\u003eCytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level was assessed by fluo-8 calcium flux assay in primary cultures of mouse brain microvascular endothelial cells treated with DTG (2500, 5000 ng/ml) at various time points. \u003cstrong\u003e(A)\u003c/strong\u003e Cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level was monitored by measuring the fluo-8 fluorescence within the first 1-5 min of post DTG challenge by a microplate reader. \u003cstrong\u003e(B)\u003c/strong\u003e Statistical analysis was performed by subtracting basal fluorescence and then normalized to untreated control.\u0026nbsp; \u003cstrong\u003e(C)\u003c/strong\u003e Cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level was recorded every 20 s within the first minute post DTG challenge by fluorescence microscopy. The arrows indicate the cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e flux. Nuclei were stained by Hoechst. Results are presented as mean fluorescence ± SEM normalized to the DMSO control from n=3 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/bfed1970be05764516d1237e.png"},{"id":57089895,"identity":"38ce889f-fb34-4bb4-a755-0a54ceb7a3f5","added_by":"auto","created_at":"2024-05-24 12:42:35","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":38829,"visible":true,"origin":"","legend":"\u003cp\u003eMMP, ROS content and cytochrome c translocation were assessed in primary cultures of mouse brain microvascular endothelial treated with DTG at various time points. \u003cstrong\u003e(A) \u003c/strong\u003eMMP was assessed by TMRE assay kit in cells treated with DTG (2500, 5000ng/ml) or FCCP (20 μM; positive control) for 10 min and 6 h. Fluorescence intensity was measured by microplate reader, normalized, and compared to DMSO control, n = 4 independent experiments.\u003cstrong\u003e (B)\u003c/strong\u003e ROS content was measured by H\u003csub\u003e2\u003c/sub\u003eDCFDA assay in cells treated with DTG (2500, 5000 ng/ml) or tunicamycin (Tuni) (3000 ng/ml; positive control) for 1 and 6 h. Fluorescence intensity was measured by microplate reader, normalized, and compared to DMSO control, n = 3 independent experiments. \u003cstrong\u003e(C)\u003c/strong\u003e Cytochrome c expression in the cytosolic and mitochondrial cell fractions was assessed by western blot analysis in primary cultures of mouse brain microvascular endothelial treated with DTG (5000ng/ml) or tunicamycin (Tuni) (3000 ng/ml; positive control) for 48 h. Representative blot and densitometric analysis are shown, n= 3 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied, * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. ****, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/427d4ab8d2a95c123053f161.png"},{"id":58797150,"identity":"26283667-51b5-4a73-ac74-95bc86397887","added_by":"auto","created_at":"2024-06-21 08:39:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1213978,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/0f336485-9398-4d82-8e13-0a06c3d5785f.pdf"},{"id":57089897,"identity":"6491f841-bb78-4107-b6c0-9b4dd3aace16","added_by":"auto","created_at":"2024-05-24 12:42:35","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":448759,"visible":true,"origin":"","legend":"","description":"","filename":"SupplePDF.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/fc35afbf3120ef8e76f06661.pdf"},{"id":57089891,"identity":"490847c0-d944-48a5-9455-4e34b2c0ff1f","added_by":"auto","created_at":"2024-05-24 12:42:34","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":9598,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Figure 1\u003c/strong\u003e. Cell viability was assessed by MTT assay in primary cultures of mouse brain microvascular endothelial treated with DTG (1000-10000 ng/ml) for 48 h. Results are presented as mean relative cell viability ± SEM normalized to the DMSO control from n=3 independent experiments. One-way ANOVA with Bonferroni’s post-hoc test analysis was applied.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4420818/v1/7125d298e6552d2e279a2424.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dolutegravir Disrupts Mouse Blood-Brain Barrier by Inducing Endoplasmic Reticulum Stress ","fulltext":[{"header":"Background","content":"\u003cp\u003eThe integrase strand transfer inhibitor (INSTI) dolutegravir (DTG) - based antiretroviral regimen is the contemporary recommended first-line drug regimen for the treatment of human immunodeficiency virus (HIV) infection. Despite its great potency, high barrier to resistance and tolerability, DTG - based antiretroviral therapy (ART) is known to induce neuropsychiatric adverse effect (NPAEs) including insomnia, dizziness, anxiety and depression [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Moreover, some recent clinical studies raised a potential association between ART and a slow progressive degeneration of cognitive and motor functions [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite evidence revealing the toxic potential of DTG in the central nervous system (CNS), the molecular mechanisms responsible for this observed toxicity are not well understood. Considering the lifelong requirement of ART treatment, a comprehensive assessment of the potential toxicity of the first line antiretroviral drugs (ARVs) is urgently needed [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe blood-brain barrier (BBB), primarily composed of brain microvascular endothelial cells sealed by tight junction (TJ) proteins is the major physiological barrier separating the brain from the systemic circulation and plays a critical role in maintaining CNS homeostasis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. BBB dysfunction can lead to disruption of the brain microenvironment and is widely implicated in multiple neurological diseases including dementia, depression and schizophrenia [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Recent work in our laboratory has demonstrated the potential of DTG to disrupt the BBB by downregulating TJ proteins inducing pro-inflammatory cytokines and altering expression of efflux transporters in various human and rodent BBB models [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. To further understand the cellular mechanisms related to DTG toxicity in brain microvascular endothelial cells, RNA-sequencing was performed and revealed the endoplasmic reticulum (ER) stress as a major dysregulated pathway.\u003c/p\u003e \u003cp\u003eThe ER is a large membrane-enclosed cellular compartment that is primarily responsible for protein synthesis and folding [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Physiological or pathological challenges such as increased secretory protein load or the presence of mutated proteins overloading ER capacity can result in ER stress, activating protective strategies, collectively termed the \u0026ldquo;unfolded protein response\u0026rdquo; (UPR) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The UPR in mammalian cells is activated by three ER transmembrane receptors: type I transmembrane protein inositol requiring 1 (IRE1α); protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK) and an activating transcription factor 6 (ATF6) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The UPR operates in multiple ways as a homeostatic mechanism to prevent further accumulation of unfolded proteins in the cells, which includes: i) increased ER folding capacity by transcriptionally upregulating ER-chaperones; ii) attenuation of secretory protein transcription and translation; and iii) ER-associated degradation of misfolded protein [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In addition to protein folding, ER serves as the largest site of cellular free Ca\u003csup\u003e2+\u003c/sup\u003e storage, which plays a key role in ER-mitochondria crosstalk [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The presence of ER stress can result in Ca\u003csup\u003e2+\u003c/sup\u003e dysregulation, and UPR acts as a critical adaptive mechanism to cope with Ca\u003csup\u003e2+\u003c/sup\u003e imbalance [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Severe or prolonged ER stress can cause oxidative stress and ultimately lead to cell death by inducing mitochondrial membrane permeabilization [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], cytochrome c release and caspase activation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. This process is believed to be primarily mediated by the activation of the c-Jun N-terminal kinase (JNK) pathway [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which has been attributed to IRE1/TRAF2/ASK1 pathway activation in response to UPR failure [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the context of HIV treatment, several ARVs, particularly efavirenz (EFV) (a non-nucleoside reverse transcriptase inhibitor) have been reported to induce ER stress by activating PERK and IRE1α receptors and autophagy dysfunction in brain microvascular endothelial cells [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Protease inhibitors ritonavir and lopinavir have also been reported to induce ER stress, oxidative stress and inflammatory response in human and mouse macrophages and hepatocytes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Several other events including alteration of Ca\u003csup\u003e2+\u003c/sup\u003e homeostasis, cellular respiratory metabolism, mitochondrial function, and DNA replication have also been documented with EFV and some HIV-protease inhibitors [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In contrast, the toxicity mechanisms of the first-line ARV, DTG, is not well understood in any cell types. Our laboratory recently reported the toxic potential of DTG in disrupting BBB at comparable levels to EFV [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The goal of the current study was to investigate ER stress as an underlying mechanism of DTG-induced toxicity at the BBB. The current study revealed a significant upregulation of ER stress and UPR associated with DTG treatment using primary cultures of mouse brain microvascular endothelial cells as a robust rodent BBB \u003cem\u003ein vitro\u003c/em\u003e cell model.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eRNA Sequencing (RNA-Seq) and analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from primary cultures of mouse brain microvascular endothelial cells using TRIzol reagent (Invitrogen) treated with DTG at 5000 ng/ml for 24 h. RNA quality was first assessed by Agilent Fragment Analyzer, then was subjected to library preparation using the Illumina TruSeq Stranded mRNA Library Preparation Kit (RS-122-2101) according to the manufacturer\u0026rsquo;s instructions. Libraries fragment size was checked using an Agilent Fragment Analyzer, then quantified with Qubit and qPCR using Collibri\u0026trade; Library Quantification Kit (ThermoFisher, Cat#A38524500) on a BioRad CFX96 Touch Real-Time PCR Detection System. Quality checked libraries were loaded onto an Illumina NextSeq500 running SR 75 cycles. Real-time base call (.bcl) files were converted to FASTQ files using Illumina bcl2fastq2 conversion software. Qiagen CLC Genomic Workbench v23.0.4 with default parameters was used for the differential gene expression data analysis. Principal components analysis (PCA) was performed with DEseq on expression data to observe patterns with respect to experimental factors [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Volcano plot was generated using false discovery rate-adjusted P value cut-off of \u0026lt;\u0026thinsp;0.05 and log\u003csub\u003e2\u003c/sub\u003e fold change cut-offs of \u0026lt;\u0026ndash;1 or \u0026gt;\u0026thinsp;1. Gene set enrichment analysis (GSEA) of differentially expressed gene sets was conducted using \"fgsea\" R package 1.20.0 (version 4.1.0) using M5: Gene Ontology (GO) subcollection (v2023.2) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eReagents/materials\u003c/h2\u003e \u003cp\u003eAll cell culture reagents were of the highest purity and obtained from Invitrogen (Carlsbad, CA, USA), unless indicated otherwise. Real-time quantitative polymerase chain reaction (qPCR) reagents, including reverse transcription cDNA kits and qPCR TaqMan primers, were purchased from Applied Biosystems (Foster City, CA, USA) and Life Technologies (Carlsbad, CA, USA), respectively. ER stress inhibitors GSK2606414, 4\u0026micro;8c and 4PBA, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and PBS buffer were purchased from Sigma-Aldrich. Primary rabbit polyclonal anti-TJP1 (ZO-1; 402300), anti-OCLN (OCLN; 711500), anti-CLDN5 (CLDN5; 341600) and anti-Phospho-IRE1α (PA5-85738) antibodies were purchased from Invitrogen (Burlington, ON, Canada). Primary rabbit polyclonal anti-PERK (ab229912), anti-eIF2α (ab169528), anti-IRE1α (ab37073), primary mouse polyclonal anti-cytochrome c (ab110325), anti-VDAC1 (ab14734) antibodies, Fluo-8 Calcium Flux Assay Kit (ab112129) and Mitochondria/Cytosol Fractionation Kit (ab65320) were purchased from Abcam (Boston, MA, USA). Primary rabbit polyclonal anti-Phospho-eIF2α antibody (SAB4504388) Hoechst 33342 (14533) and H\u003csub\u003e2\u003c/sub\u003eDCFDA (D6883) were purchased from Sigma-Aldrich (Oakville, ON, Canada). Mouse monoclonal anti-β actin (sc-47778) antibody was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-rabbit and anti-mouse horseradish peroxidase-conjugated secondary antibodies and DTG were purchased from Jackson ImmunoResearch Inc. (Baltimore, PA, USA) and MedChem Express (Deer Park, NJ, USA), respectively. \u0026micro;-Slide 8 Well (80826) were purchased from Ibidi (Grafelfing, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell cultures\u003c/h2\u003e \u003cp\u003ePrimary cultures of mouse (C57BL/6) brain microvascular endothelial cells were cultured (passage 2\u0026ndash;6) in complete Mouse Endothelial Cell Medium (M1168, Cell Biologics Inc, Chicago, Illinois, USA), supplemented with vascular endothelial growth factor, endothelia cell growth supplements, heparin, epidermal growth factor, hydrocortisone, L-glutamine, antibiotic-Antimycotic Solution, and 5% FBS, and grown on gelatin-coated tissue culture plates. Cell lines were maintained in a humidified incubator at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e, 95% air with fresh medium replaced every 2\u0026ndash;3 days. Cells were split using 0.25% trypsin-EDTA upon reaching 95% confluence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCell viability of primary cultures of mouse brain microvascular endothelial cells in the presence of DTG (1000\u0026ndash;10000 ng/ml) was assessed using the MTT assay as previously published [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Briefly following 48 h treatment, cells were incubated for 2 h at 37\u0026deg;C with 2.5 mg/mL MTT in PBS. The resulting formazan content in each well was dissolved using DMSO and quantified by UV absorbtion at 580 nm using a SpectraMax 384 microplate reader (Molecular Devices, Sunnyvale, CA). Cell viability was assessed by comparing the absorbance of cellular reduced MTT in DTG-treated cells to that of vehicle (DMSO)-treated cells. MTT assays revealed that the viability of primary cultures of mouse brain microvascular endothelial cells was not significantly affected by DTG in a wide range of concentrations (1000\u0026ndash;10000 ng/ml) including therapeutic\u003c/p\u003e \u003cp\u003erelevant concentrations after 48 h exposure \u003cb\u003e(Supplemental Fig.\u0026nbsp;1).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSupplemental Fig.\u0026nbsp;1\u003c/b\u003e. Cell viability was assessed by MTT assay in primary cultures of mouse brain microvascular endothelial treated with DTG (1000\u0026ndash;10000 ng/ml) for 48 h. Results are presented as mean relative cell viability\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM normalized to the DMSO control from n\u0026thinsp;=\u0026thinsp;3 independent experiments. One-way ANOVA with Bonferroni\u0026rsquo;s post-hoc test analysis was applied.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eARVs and ER stress inhibitors treatment\u003c/h2\u003e \u003cp\u003eConfluent monolayers of primary cultures of mouse brain microvascular endothelial cells were treated with either DMSO (vehicle control), DTG (2500, 3500, 5000 ng/ml) or tunicamycin (3000 ng/ml) for a period of 3, 6, 16, 24 or 48 h at 37\u0026deg;C. Doses of DTG were carefully chosen to correspond to human therapeutic plasma levels [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The naturally occurring nucleoside antibiotic tunicamycin, known to behave as a strong ER stressor by inhibiting the biosynthesis of N-linked glycans in the proteins, was used as a positive control [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For experiments involving ER stress inhibitors, cells were pre-treated by GSK2606414 (5 \u0026micro;M; PERK inhibitor), 4\u0026micro;8c (10 \u0026micro;M; IRE1α inhibitor) or 4PBA (2 mM; a broad inhibitor) for 6 h, following the treatment of DTG (5000 ng/ml) with specific inhibitors at desired concentrations for 24 or 48 h. At the desired time interval, treated cells were harvested and processed for subsequent assays.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGene expression analysis\u003c/h2\u003e \u003cp\u003eThe mRNA expression of specific genes of interest was quantified using qPCR. Total RNA was isolated from cell samples (primary mouse BBB cells) using TRIzol reagent (Invitrogen) and treated with DNase I to remove contaminating genomic DNA. RNA concentration (absorbance at 260 nm) and purity (absorbance ratio 260/280) was assessed using NanoDrop One Spectrophotometer (Thermo Scientific). A total amount of 2 \u0026micro;g of RNA was then reverse transcribed to cDNA using a high-capacity reverse transcription cDNA kit (Applied Biosystems) according to the manufacturer\u0026rsquo;s instructions. Specific mouse primer pairs for \u003cem\u003eTjp1\u003c/em\u003e (Zo-1; Mm01320638_m1), \u003cem\u003eOcln\u003c/em\u003e (Ocln; Mm00500912_m1), \u003cem\u003eCldn5\u003c/em\u003e (Cldn5; Mm00727012_s1), \u003cem\u003eIl6\u003c/em\u003e (Il6; Mm00446190_m1), \u003cem\u003eCxcl1\u003c/em\u003e (Cxcl1;Mm04207460_m1), \u003cem\u003eCxcl2\u003c/em\u003e (Cxcl2;Mm00436450), \u003cem\u003eIl23α\u003c/em\u003e (Il23α;Mm00518984), \u003cem\u003eIl12β\u003c/em\u003e (Il12β,Mm01288989) were designed and validated by Life Technologies for use with TaqMan qPCR chemistry. Specific mouse primer pairs for spliced \u003cem\u003eXbp1\u003c/em\u003e were customized using the following sequence\u0026thinsp;\u0026lt;\u0026thinsp;forward\u0026thinsp;\u0026gt;\u0026thinsp;5'GCTGAGTCCGCAGCAGGT3'; \u0026lt;reverse\u0026thinsp;\u0026gt;\u0026thinsp;5'CAGGGTCCAACTTGTCCAGAAT3' and validated by Life Technologies with TaqMan qPCR chemistry. All assays were performed in triplicates with the housekeeping gene for mouse cyclophilin B \u003cem\u003ePpib\u003c/em\u003e (Ppib; Mm00478295_m1) or glyceraldehyde-3-phosphate dehydrogenase \u003cem\u003eGapdh\u003c/em\u003e (Gapdh; Mm99999915_g1) as an internal control. For each gene of interest, the critical threshold cycle (CT) was normalized to \u003cem\u003ePpib\u003c/em\u003e or \u003cem\u003eGapdh\u003c/em\u003e using the comparative CT method. The difference in CT values (ΔCT) between the target gene and cyclophilin B was then normalized to the corresponding ΔCT of the vehicle control (ΔΔCT) and expressed as fold expression (2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e) to assess the relative difference in mRNA expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCytosolic and mitochondrial protein isolation\u003c/h2\u003e \u003cp\u003eCytosolic and mitochondrial protein fractions were extracted from the vehicle, DTG or tunicamycin-treated primary mouse brain microvascular endothelial cells using the Mitochondria/Cytosol Fractionation Kit (ab65320, Abcam) according to the manufacturer\u0026rsquo;s protocol. Briefly, 4\u0026times;10\u003csup\u003e7\u003c/sup\u003e cells were harvested, washed, and centrifuged at 1000 \u0026times; g for 10 min at 4\u0026deg;C. Cells were then resuspended in cytosol extraction buffer, incubated on ice for 10 min, and homogenized on ice using a Dounce tissue grinder. The homogenate was centrifuged at 1000 \u0026times; g for 10 min at 4\u0026deg;C. The supernatant was collected and centrifuged at 10,000 \u0026times; g for 30 min at 4\u0026deg;C. The supernatant was used as the cytosolic fraction. The pellet was resuspended in mitochondrial extraction buffer, vortexed for 10 sec, and used as the mitochondrial fraction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eWestern blots were performed in accordance with our published protocol with minor modifications [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Cell lysates were obtained using modified RIPA buffer [50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 mM sodium o-vanadate, 0.25% (v/v) sodium deoxycholic acid, 0.1% (v/v) sodium dodecyl sulfate (SDS), 1% (v/v) NP-40, 200 \u0026micro;M PMSF, 0.1% (v/v) protease inhibitor]. Protein concentrations of the lysates were quantified using Bradford\u0026rsquo;s protein assay (Bio-Rad Laboratories) with BSA as the standard. Total protein (50 \u0026micro;g) for each sample was loaded, separated on 10%, 12% or 14% SDS-polyacrylamide gel, and electro-transferred onto a polyvinylidene fluoride membrane overnight at 4\u0026deg;C. The blots were blocked for 1 h at room temperature in 5% skim milk Tris-buffered saline solution containing 0.1% Tween 20 and incubated with primary rabbit polyclonal anti-TJP1 (1:250), anti-OCLN (1:250), anti-CLDN5 (1:250), anti-PERK (1:1000), anti-IRE1α (1:1000), anti-pIRE1α (1:1000), anti-eIF2α (1:1000), anti-peIF2α (1:1000) antibodies, primary mouse polyclonal anti-Cytochrome c (1:2000), anti-VDAC1 (1:1000) antibodies, and murine monoclonal anti-β-actin antibody (1:2000) overnight at 4\u0026deg;C. The blots were then incubated with corresponding horseradish peroxidase-conjugated anti-rabbit (1:5000) or anti-mouse (1:5000) secondary antibody for 1.5 h. Protein bands were detected using enhanced chemiluminescence SuperSignal West Pico System (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCalcium assay and imaging\u003c/h2\u003e \u003cp\u003eCytosolic Ca\u003csup\u003e2+\u003c/sup\u003e was quantified using Fluo-8 Calcium Flux Assay Kit (Cat# ab112129, Abcam) according to manufacturer\u0026rsquo;s protocol. Briefly, the primary mouse brain microvascular endothelial cells were cultured overnight on 96-black well plates (1 x 10\u003csup\u003e5\u003c/sup\u003e cells/well) or \u0026micro;-Slide 8 Well chambered coverslips (3 x 10\u003csup\u003e4\u003c/sup\u003e cells/well) prior to the assay. Cells were first incubated with Fluo-8 for 30 min at 37\u0026deg;C and then incubated at room temperature for 30 min. Spontaneous calcium activity was recorded prior to DTG challenge (time 0). Baseline signal was measured at Ex/Em\u0026thinsp;=\u0026thinsp;490/525 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). DTG or DMSO (vehicle control) was then added to the wells, and the calcium flux was monitored and recorded by the fluorescence intensity at Ex/Em\u0026thinsp;=\u0026thinsp;490/525 nm every minute for 5 min. The DTG-induced amplitude change in the 490/525 nm fluorescence ratio was calculated by subtracting the baseline ratio before DTG challenge. For calcium imaging, pre-stimulation images were taken to establish baseline calcium in cells (time 0) by fluorescence microscopy (Zeiss Axio Observer Apotome-2) using a 40\u0026times; objective. Time lapse images were then taken every 20 s for one minute following DTG challenge.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of intracellular ROS generation\u003c/h2\u003e \u003cp\u003eReactive oxygen species (ROS) generation was quantified by fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate (H\u003csub\u003e2\u003c/sub\u003eDCFDA) according to the following published protocol with minor modification [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Briefly, primary mouse brain microvascular endothelial cells were seeded overnight on 96-black well plates (1 x 10\u003csup\u003e5\u003c/sup\u003e cells/well) prior to the assay. Cells were incubated with H\u003csub\u003e2\u003c/sub\u003eDCFDA (20 \u0026micro;M in pre-warmed cell medium) for 30 min at 37\u0026deg;C and the washed by pre-warmed PBS. Cells were then treated by DTG, tunicamycin or vehicle control for 1 or 6 h. ROS content was then measured by acquiring the fluorescence intensity at Ex/Em\u0026thinsp;=\u0026thinsp;494/522 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). The DTG-induced change in the 494/522 nm fluorescence was calculated by subtracting the background fluorescence and then normalized to the vehicle control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of MMP with TMRE\u003c/h2\u003e \u003cp\u003eChanges in mitochondrial membrane potential (MMP) was assessed by tetramethyl rhodamine ethyl ester (TMRE)-MMP assay kit according to manufacturer\u0026rsquo;s protocol (Cat# ab113852, Abcam, UK). In summary, the primary mouse brain microvascular endothelial cells were seeded overnight on 96-well black plates (2 x 10\u003csup\u003e5\u003c/sup\u003e cells/well) or \u0026micro;-Slide 8 Well chambered coverslips (3 x 10\u003csup\u003e4\u003c/sup\u003e cells/well) prior to the assay. After exposure to DTG for 10 min or 6 h, cells were incubated with TMRE (600 nM) for 25 min and washed twice with warm PBS/0.2% BSA. Fluorescence intensity was measured at Ex/Em\u0026thinsp;=\u0026thinsp;549/575 nm using multi-mode microplate reader (Biotek, Life Science, Inc., USA). FCCP (carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone), an ionophore uncoupler of oxidative phosphorylation was used as a positive control in each experiment [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Cells were treated by FCCP for 10 min prior to the TMRE incubation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eData Analysis\u003c/h2\u003e \u003cp\u003eAll experiments were repeated 3\u0026ndash;4 times using cells obtained from different passages. Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. All statistical analyses were performed using Prism 6 software (GraphPad Software Inc., San Diego, CA, USA). Statistical significance between two groups was assessed by two-tailed Student\u0026rsquo;s t test for unpaired experimental values. Multiple group comparisons were performed using one-way analysis of variance (ANOVA) with Bonferroni\u0026rsquo;s post-hoc test. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eBulk mRNA sequencing in primary cultures of mouse brain microvascular endothelial cells revealed activated ER stress as a result of DTG toxicity.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the alteration of transcriptomic profile by DTG treatment in primary cultures of mouse brain microvascular endothelial cells, RNA-seq and subsequent gene set enrichment analysis was performed. PCA analysis revealed that the two sample groups (DMSO vs. DTG treated) cluster separately, indicating distinct transcriptomic signatures due to the treatment of DTG \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e A volcano plot was generated as determined by False Discovery Rate (FDR) based on differential gene expression analysis, revealing key genes (\u003cem\u003eIl6, Hspa5, Cxcl2, Atf4, Xbp1\u003c/em\u003e) involved in inflammatory and ER stress response were significantly upregulated in DTG treatment group compared to control \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. The transcriptome signature in DTG treated cells was enriched for gene ontology (GO) molecular function (MF), biological process (BP) and cellular component (CC) terms related to ER stress, protein folding, ER protein containing complex, response to unfolded protein \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDTG induces ER stress by activating PERK signaling pathway in primary cultures of mouse brain microvascular endothelial cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo examine whether DTG activates PERK signaling pathway in a dose-dependent and time-dependent manner, primary cultures of mouse brain microvascular cells were treated with DTG at 2500, 3500, 5000 ng/ml or tunicamycin at 3000 ng/ml for 3, 6, 16, 24 and 48 h. Compared to DMSO control, PERK protein expression was also significantly upregulated (~\u0026thinsp;50%) by DTG (5000 ng/ml) following 24 or 48 h exposure \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e DTG (5000 ng/ml) treatment resulted in a time-dependent upregulation of p-eIF2α protein with greater elevation observed at 48 h (~\u0026thinsp;50%) compared to 24 h (~\u0026thinsp;25%) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e Although DTG at 2500 ng/ml did not affect PERK or p-eIF2α protein expression, it significantly increased the gene expression of \u003cem\u003eHspa5\u003c/em\u003e (BiP), \u003cem\u003eDdit3\u003c/em\u003e (CHOP) and \u003cem\u003ePpp1r15a\u003c/em\u003e (GADD34) in a time-dependent manner. Consistent with this, stronger induction of \u003cem\u003eHspa5, Ddit3 Ppp1r15a\u003c/em\u003e gene expression was observed at 3500 ng/ml DTG together with a significant increase in \u003cem\u003eAtf4\u003c/em\u003e gene expression in a time-dependent manner \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e Finally, DTG at 5000 ng/ml resulted in a robust upregulation of \u003cem\u003eHspa5, Atf4, Ddit3\u003c/em\u003e and \u003cem\u003ePpp1r15a\u003c/em\u003e gene expression at all three time points (3, 6 and 16 h) with a peak response observed at 6 h \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e The positive control tunicamycin robustly activated PERK pathway as expected \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDTG induces ER stress by activating IRE1 signaling pathway in primary cultures of mouse brain microvascular endothelial cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo examine whether DTG activates IRE1α signaling pathway in a dose and time-dependent manner, primary cultures of mouse brain microvascular cells were treated with DTG at 2500, 3500 and 5000 ng/ml or tunicamycin at 3000 ng/ml for 3, 6, 16, 24 and 48 h. A mild but significant increase (~\u0026thinsp;30%) of p-IRE1α protein expression was observed following DTG treatment at 2500 ng/ml for 24 h. Consistent with this, p-IRE1α protein upregulation was more robust at DTG concentration of 5000 ng/ml (~\u0026thinsp;2 fold) at 24 h; and returned to basal level after 48 h. As expected, the positive control tunicamycin robustly activated p-IRE1α protein expression after 24 and 48 h as expected \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e The gene expression of \u003cem\u003eXbp1\u003c/em\u003e was significantly upregulated following DTG treatment at 2500, 3500 and 5000 ng/ml at all three time points (3, 6, 16 h) in a dose-dependent manner, with the highest response observed at 6 h. The gene expression of the activated form of \u003cem\u003eXbp1\u003c/em\u003e (\u003cem\u003espliced-Xbp1\u003c/em\u003e) was mildly increased by DTG 2500 ng/ml after 16 h, and by DTG 3500 ng/ml at an earlier time point (6 h) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e Notably, DTG 5000 ng/ml robustly increased the \u003cem\u003eXbp1\u003c/em\u003e and \u003cem\u003es-Xbp1\u003c/em\u003e gene expression at a comparable level as induced by the positive control tunicamycin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eER stress inhibitors mitigated the DTG-induced downregulation of TJ proteins in primary cultures of mouse brain microvascular endothelial cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further investigate the role of ER stress in DTG-induced downregulation of TJ proteins, primary cultures of mouse brain microvascular cells were pre-treated with 3 different ER stress inhibitors: GSK2606414 (PERK inhibitor); 4\u0026micro;8c (IRE1α inhibitor) and 4PBA (a broad inhibitor) separately for 6 h following DTG treatment (5000 ng/ml) for 24 or 48 h. The expression of TJ protein was examined at both gene (24 h) and protein (48 h) levels. In agreement with our previous report, DTG 5000 ng/ml robustly downregulated the gene expression of \u003cem\u003eTjp1\u003c/em\u003e (Zo-1), \u003cem\u003eOcln\u003c/em\u003e (Ocln) and \u003cem\u003eCldn5\u003c/em\u003e (Cldn5) by \u0026gt;\u0026thinsp;60% following 24 h of treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e The observed downregulation of TJ protein expression was significantly mitigated by three inhibitors at the gene level, with the rescue effect being the most noticeable following 4PBA pre-treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e In parallel with the gene expression data, 48 h DTG (5000 ng/ml) treatment significantly downregulated the protein expression of Zo-1 and Ocln \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e The downregulation of Zo-1 and Ocln protein was fully rescued by 4PBA pre-treatment. Though GSK and 4\u0026micro;8c also appeared to mitigate the DTG-induced downregulation of Zo-1 and Ocln, this effect did not reach statistical significance \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e Unlike the gene expression data, DTG treatment (5000 ng/ml) did not significantly affect Cldn5 protein expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eER stress inhibitors mitigated the DTG-induced upregulation of pro-inflammatory cytokines and chemokines at the gene level in primary cultures of mouse brain microvascular endothelial cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further investigate the role of ER stress in DTG-induced inflammatory responses, primary cultures of mouse brain microvascular cells were pre-treated with 3 different ER stress inhibitors: GSK2606414 (PERK inhibitor); 4\u0026micro;8c (IRE1α inhibitor) and 4PBA (a broad inhibitor) separately for 6 h following DTG treatment (5000 ng/ml) for 24 h. The expression of pro-inflammatory cytokines and chemokines was examined at the gene level. Consistent with our previous data, DTG 5000 ng/ml robustly induced the gene expression of \u003cem\u003eIl6\u003c/em\u003e (~\u0026thinsp;23 fold), \u003cem\u003eIl23a\u003c/em\u003e (~\u0026thinsp;30 fold), \u003cem\u003eIl12b\u003c/em\u003e (~\u0026thinsp;20 fold), \u003cem\u003eCxcl2\u003c/em\u003e (~\u0026thinsp;15 folds) and mildly induced the gene expression of \u003cem\u003eCxcl1\u003c/em\u003e (~\u0026thinsp;2 fold) after 24 h treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e The induction of \u003cem\u003eIl6, Il23a, Il12b\u003c/em\u003e, and \u003cem\u003eCxcl1\u003c/em\u003e gene expression was mitigated by ~\u0026thinsp;50% following ER stress inhibitors 4PBA and 4\u0026micro;8c pre-treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e GSK pre-treatment, specifically, rescued the \u003cem\u003eIl6, Il23a, Il12b, Cxcl1\u003c/em\u003e and \u003cem\u003eCxcl2\u003c/em\u003e gene upregulation to a similar level as the control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDTG treatment induced Ca\u003c/b\u003e \u003csup\u003e \u003cb\u003e2+\u003c/b\u003e \u003c/sup\u003e \u003cb\u003erelease in primary cultures of mouse brain microvascular endothelial cells.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDysregulation of cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level is known to be associated with ER stress. To further characterize the mechanisms and downstream effects of DTG-induced ER stress, cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level was measured in primary cultures of mouse brain microvascular cells 1\u0026ndash;5 min following DTG exposure (2500, 5000 ng/ml) using Fluo-8 Ca\u003csup\u003e2+\u003c/sup\u003e assay kit. The data demonstrated that, the cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e level was transiently increased in the presence of DTG (2500, 5000 ng/ml) within the first minute post DTG challenge, quickly reaching a plateau and remaining stable after that \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e To better characterize the timing of this Ca\u003csup\u003e2+\u003c/sup\u003e increase, samples were dynamically examined by immunofluorescence microscopy following the DTG challenge. Ca\u003csup\u003e2+\u003c/sup\u003e induction was first observed as early as 20 s after DTG challenge, persisted at 40 s and gradually reached a plateau by 60 s. The effect was more pronounced with DTG at 5000 ng/ml compared to 2500 ng/ml \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDTG disrupted MMP, induced ROS generation but did not induce cytochrome-c release from mitochondria in primary cultures of mouse brain microvascular endothelial cells\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eTo further investigate whether DTG-induced ER stress results in the alteration of mitochondrial bioenergetics, MMP was assessed by TMRE assay kit using a microplate reader in primary mouse brain microvascular cells treated with DTG (2500, 5000 ng/ml). Acute DTG treatment for 10 min at 2500 or 5000 ng/ml did not demonstrate any significant change in relative MMP. By contrast, prolonged DTG treatment (6 h) at both 2500 and 5000 ng/ml resulted in a significant decrease in MMP compared to controls, as indicated by the dose-dependent reduction in TMRE fluorescence \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e FCCP, an ionophore uncoupler, was used as a positive control in this assay, and resulted in an aberrant MMP after 10 min-treatment as expected \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e To investigate whether the observed ER stress and elevated UPR led to oxidative stress, ROS was quantified by a microplate reader using H\u003csub\u003e2\u003c/sub\u003eDCFDA assay. Despite the unaltered MMP, a significant increase (~\u0026thinsp;30%) of ROS content was observed following DTG treatment at 2500 ng/ml for 1 h, with a greater ROS induction (~\u0026thinsp;50%) observed at 5000 ng/ml. Also, the DTG-induced ROS generation was time-dependent, as reflected by a greater increase in ROS (~\u0026thinsp;2 fold) after a 6 h at 5000 ng/ml \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB\u003cb\u003e).\u003c/b\u003e However, a 48 h-treatment of DTG at 5000 ng/ml did not induce the cytochrome-c translocation from the mitochondria to cytosol, whereas such effect was observed with tunicamycin as expected \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOwing to the great efficacy and tolerability in suppressing viral replication, DTG - based ART is one of the recommended first-line regimens to treat HIV infected individuals worldwide, including pregnant women [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However multiple clinical reports have revealed a significantly higher incidence of NPAEs associated with DTG than other INSTIs [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The underlying mechanisms of DTG-induced toxicity remain largely unknown. Recently our laboratory reported an unexpected toxic potential of DTG in disrupting the BBB using several human and mouse BBB models \u003cem\u003ein vitro, ex vivo\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In the present study, our initial RNA-sequencing data illustrates an enrichment of transcriptome signature related to ER stress. We have therefore aimed to further investigate ER stress as a potential underlying mechanism of DTG toxicity at the BBB.\u003c/p\u003e \u003cp\u003eER stress has been reported with the use of multiple ARVs particularly EFV, some nucleoside reverse transcriptase inhibitors (abacavir, lamivudine) and protease inhibitors (lopinavir, ritonavir) in various CNS cell culture systems including human brain microvascular endothelial cells (hCMEC/D3) and primary cultures of human astrocytes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. To the best of our knowledge, our current study demonstrates for the first time that clinically relevant concentrations of the first line INSTI, DTG induces ER and oxidative stress, inflammatory responses, cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e imbalance and mitochondrial bioenergetic alteration in primary cultures of mouse brain microvascular endothelial cells, which together suggest the underlying mechanism by which DTG induces toxicity at the BBB.\u003c/p\u003e \u003cp\u003ePERK and IRE1α are the two major ER stress transducers of UPR response [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The PERK protein is activated by phosphorylation and dimerization in response to the accumulation of misfolded/unfolded protein, which leads to the phosphorylation of the eukaryotic Initiation Factor 2 alpha (eIF2α) and promotes the transcription/translation of the Activating Transcription Factor 4 (ATF4) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Prolonged or excessive levels of ER stress stimulates the genes of CCAAT-enhancer-binding protein homologous protein (CHOP) by activating ATF4 which plays a key role in the initiation of apoptosis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Similar to PERK, the IRE1α protein is activated by autophosphorylation in response to overloaded misfolded/unfolded protein, which will induce a splicing event of a transcription factor X-box binding protein 1 (XBP1) mRNA as an adaptive mechanism to cope with cell stress [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Alternatively in response to excessive ER stress and UPR failure, activated IRE1α can lead to cell death by triggering pro-apoptotic cascades through activation of the c-Jun N-terminal kinase (JNK) pathway [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In this study we showed that a therapeutic relevant concentration of DTG (5000 ng/ml) activates PERK by significantly upregulating the protein expression of PERK and phosphorylated-eIF2α at 24 and/or 48 h in primary cultures of mouse brain microvascular endothelial cells. Despite the absence of significant upregulation of PERK or p-eIF2α protein by DTG 2500 ng/ml, our gene expression data revealed a dose- and time-dependent induction of downstream chaperone, pro-apoptotic and transcription factor genes (\u003cem\u003eDdit3, Hspa5, Atf4, Ppp1r15a\u003c/em\u003e) by DTG at 2500, 3500 and 5000 ng/ml. Similarly, the IRE1α pathway was activated by both concentrations of DTG (2500, 5000 ng/ml), as reflected by significant upregulation of phosphorylated IRE1α protein expression at 24 h as well as a dose-dependent and time-dependent induction of \u003cem\u003eXbp1\u003c/em\u003e and \u003cem\u003es-Xbp1\u003c/em\u003e mRNA expression. Notably, the induction of pro-apoptotic genes as well as adaptive gene markers (\u003cem\u003eXbp1\u003c/em\u003e and \u003cem\u003es-Xbp1\u003c/em\u003e) was modest with DTG treatment at 2500 ng/ml (median therapeutic plasma concentration) and 3500 ng/ml, but was more pronounce at the higher DTG concentration of 5000 ng/ml (C\u003csub\u003emax\u003c/sub\u003e), suggesting a potential adaptative UPR response at least below 3500 ng/ml.\u003c/p\u003e \u003cp\u003eOur recently published study demonstrated that DTG can result in BBB leakage by disrupting TJ proteins [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. To investigate whether ER stress is responsible for the observed effects, we pre-treated the cells with three ER sensor inhibitors 6 h before DTG exposure. Inhibitor concentrations were carefully selected based on prior literature to ensure efficacy of inhibition, with effects of the inhibitors were assessed in inhibitor groups alone [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Our gene expression data demonstrate that all three inhibitors elicited protective effects on DTG-induced \u003cem\u003eTjp1, Ocln\u003c/em\u003e and \u003cem\u003eCldn5\u003c/em\u003e mRNA downregulation, with the most noticeable protective effects being observed with 4PBA (a broad inhibitor). We noticed the inhibitors alone upregulated the gene expression of TJ proteins, this was potentially due to the inhibition of intrinsic RNase activity of the ER sensor proteins, which has been previously well documented in the literature [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In agreement with our gene expression data, western blotting further demonstrated that 4PBA pre-treatment successfully rescued the DTG-induced downregulation of Zo-1 and Ocln proteins. Even though some protective effects were also observed by the GSK and 4\u0026micro;8c, these did not reach statistical significance. Overall, our data suggests that ER stress plays a key role in DTG-induced TJ proteins downregulation at the BBB.\u003c/p\u003e \u003cp\u003eApart from structural damage, inflammatory response is another important aspect in the context of DTG toxicity at the BBB. To assess whether ER stress is also responsible for the DTG-induced inflammatory responses, the gene expression of several pro-inflammatory cytokines and chemokines was assessed in the presence or absence of the ER sensor inhibitors before the DTG exposure. Our data revealed that GSK, 4\u0026micro;8c and 4PBA all significantly mitigated DTG-induced elevation of \u003cem\u003eIl6, Il23a, Il12b, Cxcl1\u003c/em\u003e and \u003cem\u003eCxcl2\u003c/em\u003e gene expression. Interestingly in contrast to the TJ protein data where 4PBA elicited the most significant protective effect, the most noticeable rescue effect in the inflammatory response was observed in the presence of GSK (PERK inhibitor), suggesting PERK pathway being the major mediator in the context of DTG-associated inflammation, whereas the DTG-induced BBB structural damage related to TJ protein dysfunction appears to be resulted from general activation of ER sensors.\u003c/p\u003e \u003cp\u003eCytosolic Ca\u003csup\u003e2+\u003c/sup\u003e is one of the key regulators in ER stress and plays an important role in determining the cell fate [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. A cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e imbalance can induce ER stress, and vice versa, the activated UPR response can aggravate the cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e dysregulation [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Our data demonstrated that DTG treatment (2500, 5000 ng/ml) resulted in a transient cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e surge in primary cultures of mouse brain microvascular endothelial cells. These results are in agreement with several published studies which have implicated ARV (EFV) with ER stress, evoking Ca\u003csup\u003e2+\u003c/sup\u003e flux in various cell types including hepatocytes, neurons, and brain microvascular endothelial cells [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Interestingly DTG has also been reported to induce cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e in human erythrocytes and potentiate platelet activation [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Due to the important role of cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e in the crosstalk between ER and mitochondria, we next assessed DTG\u0026rsquo;s potential to induce mitochondrial dysfunction. Our data showed that a 6 h DTG (5000 ng/ml) treatment resulted in a rapid drop in MMP, but an acute treatment (10 min) of DTG did not produce any significant effect. These data suggest that DTG is unlikely to act as a direct mitochondrial uncoupler but attenuates mitochondrial bioenergetics as a result of cellular stress. This is in agreement with other studies reporting that some ARVs (EFV, 2\u0026prime;,3\u0026prime;-dideoxyinosine, tenofovir, ritonavir, lopinavir) treatment (4\u0026ndash;24 h) resulted in a rapid drop in MMP in various cell types including human hepatoma cell line, primary cultures of human umbilical vein endothelial cells (HUVEC) and primary rat neuronal and glial cultures [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan additionalcitationids=\"CR40 CR41\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. While the underlying mechanism remains unknown, such changes are likely due to the ER-mitochondrial uncoupling resulting from ARVs-induced disruption of Ca\u003csup\u003e2+\u003c/sup\u003e signal, which can subsequentially lead to impaired mitochondrial metabolism [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Interestingly, DTG has been reported as a potential Ca\u003csup\u003e2+\u003c/sup\u003e chelator [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Whether the DTG\u0026rsquo;s chelating potential may affect Ca\u003csup\u003e2+\u003c/sup\u003e-regulated ER-mitochondrial coupling which may lead to a differential toxicological mechanism from other ARVs[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] is an interesting aspect that needs further investigation.\u003c/p\u003e \u003cp\u003eAn aberrant MMP is closely associated with mitochondrial dysfunction and oxidative stress [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. To further investigate the DTG-mediated oxidative stress, we next sought to quantify the DTG-induced ROS generation with cytosolic cytochrome c level. Tunicamycin was used as a positive control due to its widely documented potential to induce ROS formation and cytochrome c release [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Our data demonstrate ROS was significantly elevated by DTG treatment at both 2500 and 5000 ng/ml doses 1 h and 6h post-treatment. Notably, similar to our mRNA and protein data, the ROS content was significantly higher at C\u003csub\u003emax\u003c/sub\u003e DTG (5000 ng/ml), with a modest effect at 2500 ng/ml (median therapeutic plasma concentration), suggesting an adaptative UPR below 2500 ng/ml. Our results agree with others showing that several ARVs (EFV, ritonavir, lopinavir) could induce ROS production and impair mitochondrial function in multiple CNS cell types including neurons and oligodendrocytes in rodents [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Importantly some clinical studies documented a higher oxidant level in the serum of HIV\u0026thinsp;+\u0026thinsp;individuals on ARVs compared to treatment na\u0026iuml;ve HIV\u0026thinsp;+\u0026thinsp;individuals and uninfected controls [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], suggesting that the ARVs-induced oxidative stress is translatable to clinical conditions. It is worth noting that as a signalling molecule, ROS activation can serve as an adaptive purpose in response to acute UPR or promote cell death after excessive or prolonged ER stress [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Here we demonstrated ROS generation shortly after DTG exposure. To further investigate whether DTG-induced ROS activation potentially leads to cell death, we then assessed the level of cytochrome c translocation, which acts as a key initiator in caspase activation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Our data showed that 48 h DTG (5000 ng/ml) treatment did not result in a significant increase in cytosolic cytochrome c level when compared to tunicamycin, which is known to provoke cytochrome c cytoplasmic release to initiate apoptosis [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Similarly, the MTT assay did not reveal any significant changes in cell viability following any DTG treatment (up to 10000 ng/ml) after 48 h. Together, these data suggest that despite the high level of cell stress and inflammatory response, DTG at C\u003csub\u003emax\u003c/sub\u003e (5000 ng/ml) did not lead to subsequent endothelial cell death.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study demonstrates that DTG disrupts the BBB via induction of ER and oxidative stress, inflammatory response, and an alteration of mitochondrial bioenergetics. The current work provides insight into the underlying mechanisms responsible for DTG-induced toxicity in the CNS, which serve as a potential explanation for the high incidence of NPAEs associated with DTG use in the clinic; and further reveals that elevated DTG plasma concentrations could present a potential risk factor for DTG-induced toxicity in the CNS. In the clinic, a dose adjustment during ongoing DTG - based ART treatment may be beneficial to alleviate DTG-induced NPAEs.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eART\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eantiretroviral therapy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eARV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eantiretroviral drugs\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eATF6\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eactivating transcription factor 6\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eBBB\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eblood-brain barrier\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCNS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecentral nervous system\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDTG\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edolutegravir\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eEFV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eefavirenz\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eER\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eendoplasmic reticulum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eFDR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFalse Discovery Rate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGO\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene Ontology\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGSEA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene set enrichment analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eH\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u003cb\u003eDCFDA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e2',7'-dichlorodihydrofluorescein diacetate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHIV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehuman immunodeficiency virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eINSTI\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eintegrase strand transfer inhibitor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIRE1α\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etype I transmembrane protein inositol requiring 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMMP\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emitochondrial membrane potential\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMTT\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePCA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePrincipal components analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePERK\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eprotein kinase R (PKR)-like endoplasmic reticulum kinase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eqPCR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereal-time quantitative polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eROS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTJ\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etight junction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTMRE\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etetramethyl rhodamine ethyl ester\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eUPR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eunfolded protein response\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available in the Materials and Methods, Results, and/or Supplemental Material of this article or from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. The current study does not involve any human or animal subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported, in part, by the Canadian Institutes of Health Research (CIHR Grant# 511794) and the Ontario HIV Treatment Network (OHTN Grant# 506657) awarded to Dr. Reina Bendayan.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCH, QRQ, MTH performed the experimental work, RB conceived the study and directed the research. CH, MTH, and RB drafted the manuscript. All authors have read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank Network Biology Collaborative Center (NBCC), Mount Sinai Hospital (University of Toronto, Canada) and Yiyan Wu (University of Toronto, Canada) for the help in RNA-Sequencing and data analysis. We acknowledge Dr. Jeffery Henderson (University of Toronto, Canada) for his help in experimental design and manuscript review.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCailhol J, Rouyer C, Alloui C, Jeantils V. Dolutegravir and neuropsychiatric adverse events: a continuing debate. AIDS. 2017;31:2023\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eRobertson KR, Su Z, Margolis DM, Krambrink A, Havlir DV, Evans S, et al. Neurocognitive effects of treatment interruption in stable HIV-positive patients in an observational cohort. Neurology. 2010;74:1260\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eBuell KG, Chung C, Chaudhry Z, Puri A, Nawab K, Ravindran RP. Lifelong antiretroviral therapy or HIV cure: The benefits for the individual patient. AIDS Care. 2016;28:242\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eKadry H, Noorani B, Cucullo L. A blood\u0026ndash;brain barrier overview on structure, function, impairment, and biomarkers of integrity. Fluids Barriers CNS. 2020;17:69. \u003c/li\u003e\n\u003cli\u003eObrenovich M. Leaky Gut, Leaky Brain? Microorganisms. 2018;6:107. \u003c/li\u003e\n\u003cli\u003eHuang C, Hoque T, Bendayan R. Antiretroviral drugs efavirenz, dolutegravir and bictegravir dysregulate blood-brain barrier integrity and function. Front Pharmacol. 2023;14:1118580. \u003c/li\u003e\n\u003cli\u003eLin JH, Walter P, Yen TSB. Endoplasmic Reticulum Stress in Disease Pathogenesis. Annu Rev Pathol Mech Dis. 2008;3:399\u0026ndash;425. \u003c/li\u003e\n\u003cli\u003eRead A, Schr\u0026ouml;der M. The Unfolded Protein Response: An Overview. Biology. 2021;10:384. \u003c/li\u003e\n\u003cli\u003eZhang Y, Wu Y, Zhang M, Li Z, Liu B, Liu H, et al. Synergistic mechanism between the endoplasmic reticulum and mitochondria and their crosstalk with other organelles. Cell Death Discov. 2023;9:51. \u003c/li\u003e\n\u003cli\u003eCao SS, Kaufman RJ. Endoplasmic Reticulum Stress and Oxidative Stress in Cell Fate Decision and Human Disease. Antioxidants \u0026amp; Redox Signaling. 2014;21:396\u0026ndash;413. \u003c/li\u003e\n\u003cli\u003eDeniaud A, Sharaf El Dein O, Maillier E, Poncet D, Kroemer G, Lemaire C, et al. Endoplasmic reticulum stress induces calcium-dependent permeability transition, mitochondrial outer membrane permeabilization and apoptosis. Oncogene. 2008;27:285\u0026ndash;99. \u003c/li\u003e\n\u003cli\u003eSano R, Reed JC. ER stress-induced cell death mechanisms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2013;1833:3460\u0026ndash;70. \u003c/li\u003e\n\u003cli\u003eLee H, Park M-T, Choi B-H, Oh E-T, Song M-J, Lee J, et al. Endoplasmic Reticulum Stress-Induced JNK Activation Is a Critical Event Leading to Mitochondria-Mediated Cell Death Caused by \u0026beta;-Lapachone Treatment. Blagosklonny MV, editor. PLoS ONE. 2011;6:e21533.\u003c/li\u003e\n\u003cli\u003eBertrand L, Toborek M. Dysregulation of Endoplasmic Reticulum Stress and Autophagic Responses by the Antiretroviral Drug Efavirenz. Mol Pharmacol. 2015;88:304\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eZhang X, Cao R, Liu R, Zhao R, Huang Y, Gurley EC, et al. Reduction of the HIV Protease Inhibitor-Induced ER Stress and Inflammatory Response by Raltegravir in Macrophages. Zhang Y, editor. PLoS ONE. 2014;9:e90856.\u003c/li\u003e\n\u003cli\u003eHan H, He Y, Hu J, Lau R, Lee H, Ji C. Disrupted ER‐to‐Golgi trafficking underlies anti‐HIV drugs and alcohol‐induced cellular stress and hepatic injury. Hepatology Communications. 2017;1:122\u0026ndash;39.\u003c/li\u003e\n\u003cli\u003eBlas-Garc\u0026iacute;a A, Apostolova N, Ballesteros D, Monle\u0026oacute;n D, Morales JM, Rocha M, et al. Inhibition of mitochondrial function by efavirenz increases lipid content in hepatic cells. Hepatology. 2010;52:115\u0026ndash;25.\u003c/li\u003e\n\u003cli\u003eGallego-Escuredo JM, Del Mar Gutierrez M, Diaz-Delfin J, Domingo JC, Mateo MG, Domingo P, et al. Differential effects of efavirenz and lopinavir/ritonavir on human adipocyte differentiation, gene expression and release of adipokines and pro-inflammatory cytokines. Curr HIV Res. 2010;8:545-53. \u003c/li\u003e\n\u003cli\u003eAnders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11:R106.\u003c/li\u003e\n\u003cli\u003eLiberzon A, Birger C, Thorvaldsd\u0026oacute;ttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database Hallmark Gene Set Collection. Cell Systems. 2015;1:417\u0026ndash;25.\u003c/li\u003e\n\u003cli\u003eKamiloglu S, Sari G, Ozdal T, Capanoglu E. Guidelines for cell viability assays. Food Frontiers. 2020;1:332\u0026ndash;49.\u003c/li\u003e\n\u003cli\u003eCottrell ML, Hadzic T, Kashuba ADM. Clinical Pharmacokinetic, Pharmacodynamic and Drug-Interaction Profile of the Integrase Inhibitor Dolutegravir. Clin Pharmacokinet. 2013;52:981\u0026ndash;94.\u003c/li\u003e\n\u003cli\u003eGuha P, Kaptan E, Gade P, Kalvakolanu DV, Ahmed H. Tunicamycin induced endoplasmic reticulum stress promotes apoptosis of prostate cancer cells by activating mTORC1. Oncotarget. 2017;8:68191\u0026ndash;207.\u003c/li\u003e\n\u003cli\u003eHoque MdT, Shah A, More V, Miller DS, Bendayan R. In vivo and ex vivo regulation of breast cancer resistant protein (Bcrp) by peroxisome proliferator‐activated receptor alpha (Ppar\u0026alpha;) at the blood\u0026ndash;brain barrier. Journal of Neurochemistry. 2015;135:1113\u0026ndash;22.\u003c/li\u003e\n\u003cli\u003eNg N, Ooi L. A Simple Microplate Assay for Reactive Oxygen Species Generation and Rapid Cellular Protein Normalization. BioProtoc. 2021;11:e3877. \u003c/li\u003e\n\u003cli\u003eDemine, Renard, Arnould. Mitochondrial Uncoupling: A Key Controller of Biological Processes in Physiology and Diseases. Cells. 2019;8:795.\u003c/li\u003e\n\u003cli\u003eEstill J, Bertisch B. More evidence for dolutegravir as first-line ART for all. The Lancet HIV. 2020;7:e154\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eHoffmann C, Llibre JM. Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors. AIDSRev. 2019;21:1768.\u003c/li\u003e\n\u003cli\u003eNooka S, Ghorpade A. HIV-1-associated inflammation and antiretroviral therapy regulate astrocyte endoplasmic reticulum stress responses. Cell Death Discov. 2017;3:17061.\u003c/li\u003e\n\u003cli\u003eLiu Z, Lv Y, Zhao N, Guan G, Wang J. Protein kinase R-like ER kinase and its role in endoplasmic reticulum stress-decided cell fate. Cell Death Dis. 2015;6:e1822\u0026ndash;e1822.\u003c/li\u003e\n\u003cli\u003eRozpedek W, Pytel D, Mucha B, Leszczynska H, Diehl JA, Majsterek I. The Role of the PERK/eIF2\u0026alpha;/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress. CMM. 2016;16:533\u0026ndash;44.\u003c/li\u003e\n\u003cli\u003eSiwecka N, Rozpędek-Kamińska W, Wawrzynkiewicz A, Pytel D, Diehl JA, Majsterek I. The Structure, Activation and Signaling of IRE1 and Its Role in Determining Cell Fate. Biomedicines. 2021;9:156.\u003c/li\u003e\n\u003cli\u003eChen S, Melchior WB, Guo L. Endoplasmic Reticulum Stress in Drug- and Environmental Toxicant-Induced Liver Toxicity. Journal of Environmental Science and Health, Part C. 2014;32:83\u0026ndash;104.\u003c/li\u003e\n\u003cli\u003ePrischi F, Nowak PR, Carrara M, Ali MMU. Phosphoregulation of Ire1 RNase splicing activity. Nat Commun. 2014;5:3554.\u003c/li\u003e\n\u003cli\u003eBahar E, Kim H, Yoon H. ER Stress-Mediated Signaling: Action Potential and Ca2+ as Key Players. IJMS. 2016;17:1558.\u003c/li\u003e\n\u003cli\u003eTovar-y-Romo LB, Bumpus NN, Pomerantz D, Avery LB, Sacktor N, McArthur JC, et al. Dendritic Spine Injury Induced by the 8-Hydroxy Metabolite of Efavirenz. J Pharmacol Exp Ther. 2012;343:696\u0026ndash;703.\u003c/li\u003e\n\u003cli\u003eApostolova N, Gomez-Sucerquia LJ, Alegre F, Funes HA, Victor VM, Barrachina MD, et al. ER stress in human hepatic cells treated with Efavirenz: Mitochondria again. Journal of Hepatology. 2013;59:780\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eMadzime M, Theron AJ, Anderson R, Tintinger GR, Steel HC, Meyer PWA, et al. Dolutegravir potentiates platelet activation by a calcium-dependent, ionophore-like mechanism. Journal of Immunotoxicology. 2022;19:117\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eApostolova N, Gomez‐Sucerquia L, Moran A, Alvarez A, Blas‐Garcia A, Esplugues J. Enhanced oxidative stress and increased mitochondrial mass during Efavirenz‐induced apoptosis in human hepatic cells. British J Pharmacology. 2010;160:2069\u0026ndash;84.\u003c/li\u003e\n\u003cli\u003eApostolova N, Blas-Garc\u0026iacute;a A, Ballesteros D, Gonz\u0026aacute;lez Y, Mor\u0026aacute;n A, G\u0026oacute;mez-Sucerquia L, et al. Clinical concentrations of efavirenz (EFV) reduce cellular proliferation and viability in several human cell lines. JIAS. 2008;11:P161.\u003c/li\u003e\n\u003cli\u003eRobertson K, Liner J, Meeker RB. Antiretroviral neurotoxicity. J Neurovirol. 2012;18:388\u0026ndash;99.\u003c/li\u003e\n\u003cli\u003eWhite MG, Wang Y, Akay C, Lindl KA, Kolson DL, Jordan-Sciutto KL. Parallel high throughput neuronal toxicity assays demonstrate uncoupling between loss of mitochondrial membrane potential and neuronal damage in a model of HIV-induced neurodegeneration. Neuroscience Research. 2011;70:220\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eBravo-Sagua R, L\u0026oacute;pez-Crisosto C, Parra V, Rodriguez-Pe\u0026ntilde;a M, Rothermel BA, Quest AFG, et al. mTORC1 inhibitor rapamycin and ER stressor tunicamycin induce differential patterns of ER-mitochondria coupling. Sci Rep. 2016;6:36394.\u003c/li\u003e\n\u003cli\u003eOchoa CD, Wu RF, Terada LS. ROS signaling and ER stress in cardiovascular disease. Molecular Aspects of Medicine. 2018;63:18\u0026ndash;29.\u003c/li\u003e\n\u003cli\u003eJensen BK, Monnerie H, Mannell MV, Gannon PJ, Espinoza CA, Erickson MA, et al. Altered Oligodendrocyte Maturation and Myelin Maintenance: The Role of Antiretrovirals in HIV-Associated Neurocognitive Disorders. J Neuropathol Exp Neurol. 2015;74:1093\u0026ndash;118.\u003c/li\u003e\n\u003cli\u003eStauch KL, Emanuel K, Lamberty BG, Morsey B, Fox HS. Central nervous system-penetrating antiretrovirals impair energetic reserve in striatal nerve terminals. J Neurovirol. 2017;23:795\u0026ndash;807.\u003c/li\u003e\n\u003cli\u003eHulgan T, Morrow J, D\u0026rsquo;Aquila RT, Raffanti S, Morgan M, Rebeiro P, et al. Oxidant Stress Is Increased during Treatment of Human Immunodeficiency Virus Infection. Clinical Infectious Diseases. 2003;37:1711\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eMandas A, Iorio EL, Congiu MG, Balestrieri C, Mereu A, Cau D, et al. Oxidative Imbalance in HIV-1 Infected Patients Treated with Antiretroviral Therapy. Journal of Biomedicine and Biotechnology. 2009;2009:1\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eH\u0026auml;cki J, Egger L, Monney L, Conus S, Ross\u0026eacute; T, Fellay I, et al. Apoptotic crosstalk between the endoplasmic reticulum and mitochondria controlled by Bcl-2. Oncogene. 2000;19:2286\u0026ndash;95.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4420818/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4420818/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eDolutegravir (DTG) - based antiretroviral therapy is the contemporary first-line therapy to treat HIV infection. Despite its efficacy, mounting evidence has suggested a higher risk of neuropsychiatric adverse effect (NPAE) associated with DTG use with a limited understanding of the underlying mechanisms. Our laboratory has previously reported a toxic effect of DTG comparable to efavirenz in disrupting the blood-brain barrier (BBB) integrity \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. The current study aimed to investigate, \u003cem\u003ein vitro\u003c/em\u003e, the potential mechanisms involved in DTG toxicity.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ePrimary cultures of mouse brain microvascular endothelial cells were used as a robust rodent BBB cell model. The cells were treated with DTG at therapeutic relevant concentrations (2500, 3500, 5000 ng/ml) for 3\u0026ndash;48 h with or without the presence of three endoplasmic reticulum (ER) sensor inhibitors (GSK2606414, 4\u0026micro;8c, 4PBA). RNA-sequencing, qPCR, western blot analysis and cell stress assays (Ca\u003csup\u003e2+\u003c/sup\u003e flux, H\u003csub\u003e2\u003c/sub\u003eDCFDA, TMRE, MTT) were performed.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur initial Gene Ontology (GO) analysis of RNA-Sequencing data revealed an enriched transcriptome signature of ER stress pathway in DTG treated cells. We further demonstrated that therapeutic concentrations of DTG significantly activated the ER stress sensor proteins (PERK, IRE1, p-IRE1) and downstream ER stress markers (eIF2α, p-eIF2α, \u003cem\u003eHspa5, Atf4, Ddit3, Ppp1r15a, Xbp1\u003c/em\u003e, \u003cem\u003espliced-Xbp1\u003c/em\u003e). In addition, DTG treatment resulted in a transient Ca\u003csup\u003e2+\u003c/sup\u003e flux, an aberrant mitochondrial membrane potential, and a significant increase in reactive oxygen species in primary cultures of mouse brain microvascular endothelial cells. Furthermore, we found that prior cell treatment with 4PBA (a broad-spectrum ER stress inhibitor) significantly rescued DTG-induced downregulation of tight junction proteins (Zo-1, Ocln, Cldn5), whereas GSK2606414 (a PERK inhibitor) elicited the greatest protective effect on DTG-induced elevation of pro-inflammatory cytokines and chemokines (\u003cem\u003eIl6, Il23a, Il12b, Cxcl1, Cxcl2\u003c/em\u003e).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe current study provides valuable insights into DTG toxicological cell mechanisms, which may serve as a potential explanation of DTG-associated NPAEs in the clinic.\u003c/p\u003e","manuscriptTitle":"Dolutegravir Disrupts Mouse Blood-Brain Barrier by Inducing Endoplasmic Reticulum Stress ","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-24 12:42:30","doi":"10.21203/rs.3.rs-4420818/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b568eecc-cbe3-44cf-ad98-f594d6b8e2ee","owner":[],"postedDate":"May 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-21T08:31:50+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-24 12:42:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4420818","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4420818","identity":"rs-4420818","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}