CB1 Receptor Signaling Regulates Cx43 Hemichannel Trafficking and Phosphorylation in Astrocytes: Implications for Gliotransmission and Neuropathological Injury

CB1 Receptor Signaling Regulates Cx43 Hemichannel Trafficking and Phosphorylation in Astrocytes: Implications for Gliotransmission and Neuropathological Injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CB1 Receptor Signaling Regulates Cx43 Hemichannel Trafficking and Phosphorylation in Astrocytes: Implications for Gliotransmission and Neuropathological Injury Xiaomu Wang, Lei Ma, hua He This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7238022/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Dec, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 14 You are reading this latest preprint version Abstract Background Connexin 43 (Cx43), the most abundant connexin in the central nervous system, is predominantly expressed in astrocytes, where it mediates intercellular communication and energy exchange via gap junctions and hemichannels. Although Cx43 hemichannels are critically involved in neuropathological injury, the regulatory mechanisms controlling their expression and activity remain poorly understood. Previous studies indicate that cannabinoid receptor type 1 (CB1R) activation enhances Cx43 hemichannel opening by elevating intracellular calcium levels in astrocytes, thereby modulating synaptic transmission and neural network plasticity. Methods This study aimed to investigated whether the CB1R pathway regulates Cx43 hemichannel expression, intracellular trafficking, phosphorylation, and functional activity in astrocytes. The human astrocyte cell line U251 was cultured in vitro. Western blotting was performed to assess total and membrane-associated Cx43 protein levels following treatment with the CB1R agonist Bay59-3074 or the CB1R antagonist JD-5037. Membrane permeability was evaluated via dye uptake assays, while gliotransmitter release (ATP and GABA) and intracellular calcium levels were measured using ELISA kits and the fluorescent probe Fluo-3 AM, respectively. Results Our findings unveiled that neither Bay59-3074 nor JD-5037 altered total Cx43 protein levels. However, the CB1R agonist group exhibited reduced total Cx43 phosphorylation (p-Cx43/Cx43 ratio) but increased membrane Cx43 localization, whereas the antagonist group showed elevated phosphorylation and decreased membrane Cx43. Dye uptake efficiency significantly increased in the agonist-treated group, indicating enhanced hemichannel activity. Lentivirus-mediated Cx43 knockdown attenuated CB1R agonist-induced calcium influx and gliotransmitter release (ATP and GABA), confirming Cx43 dependency. Conclusion These results demonstrate that the CB1R pathway regulates Cx43 hemichannel membrane trafficking and phosphorylation, thereby modulating astrocytic membrane permeability and gliotransmitter release. Targeting astrocytic Cx43 hemichannels via CB1R signaling may represent a novel therapeutic strategy for neurological disorders associated with dysregulated intercellular communication. Cx43 Cannabinoid Cannabinoid receptor type 1 Astrocytes gliotransmitters Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Connexin 43 (CX43) serves as a fundamental mediator of intercellular communication by forming gap junction channels that facilitate the direct exchange of ions, metabolites, and signaling molecules between adjacent cells. This function is critical for synchronizing physiological activities in tissues including cardiac conduction, neuronal excitation, and wound healing [ 1 ]. Additionally, CX43 hemichannels regulate autocrine/paracrine signaling through ATP and glutamate release [ 2 ]. However, its regulatory mechanisms remain incompletely elucidated. Cannabinoid receptor 1 (CB1R) is widely distributed in the brain, especially in regions like the cortex, hippocampus, basal ganglia and cerebellum [ 3 ]. Endocannabinoids activate CB1R, triggering Ca²⁺ release from IP₃-sensitive intracellular stores via Gαq/11-PLCβ cascades. This Ca²⁺ surge propagates as intercellular waves through gap junctions (e.g., CX43 hemichannels), facilitating gliotransmitter release (ATP/glutamate) that modulates synaptic plasticity [ 4 ]. Concurrently, CB1R-Gαi/o coupling inhibits cAMP-PKA signaling, suppressing pro-inflammatory pathways [ 5 ]. Critically, astrocyte-derived endocannabinoids also engage neuronal CB1R retrograde signaling, forming a tripartite synapse-regulatory loop whose imbalance contributes to epilepsy and neuropathic pain [ 6 ]. Interestingly, astrocytes possess an intrinsic system for producing and responding to endocannabinoids, which activate CB1R. When CB1R in astrocytes is activated, it enhances synaptic transmission and affects plasticity by altering intracellular calcium levels and glutamate release [ 7 , 8 ]. The endocannabinoid system is thus essential for synaptic plasticity and excitatory transmission. Notably, previous studies have shown that phosphorylation of Cx43 attenuates gap junctional communication between astrocytes [ 9 ], whereas dephosphorylation promotes intercellular communication and increase Cx43 activity [ 10 ]. Although endocannabinoid modulates astroglial function in vivo by increasing Cx43 hemichannel activity [ 11 ], it remains unclear this modulation involves direct regulation of Cx43 in astrocytes. Therefore, this study aims to investigate how the CB1R pathway influences Cx43 function in cultured astrocytes and to explore the underlying mechanism of this regulation. Material and Methods Materials and Reagents Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and streptomycin were obtained from Gibco (Invitrogen Corp., San Diego, CA). Bay 59-3074 and JD-5073 were sourced from YI FEI XUE Biotechnology, China, and used at a dilution of 1:5000. Cell culture Human astrocytes (U251) were purchased from the Chinese Academy of Sciences (Shanghai, China). These cells were cultured in DMEM containing 4.5 g/L glucose, 10%FBS, 100 U/mL penicillin and streptomycin. The cells were maintained at 37°C in a humidified incubator with 5% CO 2 . Western blotting The experiment was divided into control group, agonist (Bay 59-3074) group and inhibitor (JD-5037) group. For total protein extraction, the cultured astrocytes in each group were ground with radio immunoprecipitation assay (RIPA) lysate buffer (LMAI Bio, No.LM-F401, China) and placed at 4℃. The lysates were centrifuged at 16,000 g for 15 min at 4℃, and the protein was denatured by boiling water bath for 10 min. The prepared SDS-PAGE was put into the electrophoresis tank, and the proteins were blotted on PVDF membranes (PALL Gelman, Ann Arbor, MI, USA) using Mini-PROTEAN® Tetra Handcast Systems and Mini Trans-Blot® Cell (Bio-Rad Laboratories, Hercules, CA, USA) by wet transfer method, and the total protein was blocked for 2 h at room temperature with 5% fat free milk in Tris-buffered saline Tween-20 (8.0 g/L NaCl, 2.4 g/L Tris base and 1 mL/L Tween-20). Membrane proteins were extracted via two rounds of ultracentrifugation, with protein concentrations determined by the BCA method (BCA Protein Quantitation Assay, Keygen Biotech, China). The extracts were resolved by SDS/PAGE on an 8–12% gradient separating gel and blotted on PVDF membranes (PALL Gelman, Ann Arbor, MI, USA). Electrophoresis buffer (14.4 g/L Glycine, 3.0 g/L Tris.HCl and 1.0 g/L SDS) and transfer buffer (2.93 g/L Glycine, 5.82 g /L Tris. HCl and 200 ml/L Methanol) were used. The membrane was blocked with fresh blocking buffer containing 5% skim milk powder at room temperature for 1 h, followed by incubation with primary antibodies at 4°C overnight. The following day, the membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000) for 2 h at room temperature. Finally, enhanced chemiluminescence (ECL) solution (Phygene, No. PH0353, China) was used to detect the luminescence signal changes which were analyzed with the ImageQuant™ LAS 4000 imaging system (GE Healthcare, USA). The band intensity was determined by densitometry with the aid of the Bio-Rad Gel Doc XR documentation system. Dye uptake experiments Gap junction intercellular communication was assessed using Lucifer Yellow (LY, MKBio, MX4476, No.71206-95-6, China), a fluorescent dye that can diffuse between neighboring cells via gap junctions [ 12 ]. Cells were seeded in 24-well plates (70,000 cells per well) and incubated for 24 hours. They were then exposed to 400µl 0.05%(w/v) LY (Potassium salt) solution, and an injection cannula (0.45×12 mm) was used to cut as straight as possible from left to right. After incubation with LY for 2 mins under protection at 37℃, the plates were washed and then evaluated directly by laser scanning confocal microscopy (Leica SP8, German). Function was assessed at 10× magnification and at a wavelength of 488 nm. Cx43 gene knockdown Cell suspensions at a density of 1×10 5 cells/ml were prepared using complete medium and spread in six-well plates for 24h at 37℃. The required amount of virus was calculated according to the multiplicity of infection (MOI) of the cells and the virus titer of the Cx43 three-target knockdown lentivirus. The complete medium was replaced by 1ml Opti-MEM medium (Gibco, No.51985-034, America) in each well, and then the corresponding amount of lentivirus was added. After 72 h, the infection efficiency was observed under a fluorescence microscope (Olympus CKX53, Japan). When the cell density was 90–100%, the knockdown efficiency of Cx43 at the protein and RNA level was detected by WB and qPCR, respectively. RNA extraction and quantitative PCR : Collect about 1×10 6 astrocyte centrifugal supernatant, Trizol (Sigma, T3038, America) reagent was used to extract RNA. The concentration and quality of the extracted RNA were determine using a Nanodrop 100 spectrophotometer (Thermo, America). The cDNA obtained by reverse transcription of RNA was reverse transcribed according to the vazyme Hiscript QRT supermix for qPCR (+ gDNA WIPER) program. The resulting cDNA was stored at -80℃ until use. Real-time PCR (Applied Biosystems, America) detection reaction system was prepared the reaction mixture as follows: AceQ qPCR SYBR Green master mix (Vazyme, America) 5.0µl, upstream primer (10µM) 0.25µl, downstream primer (10µM) 0.25µl, Dye2 0.2µl, cDNA 2.0µl, RNase-Free H 2 O 2.3µl. The reaction conditions were as follows: an initial denaturation at 95℃ for 3min followed by 40 cycles of amplification at 95℃ for 5s, 56℃ for 10s, and 72℃ for 25s, the 65 ~ 95℃ for Real-Time PCR preparation dissolution curve. According to the cycle threshold (Ct) value calculate relative quantitative analysis F = 2 −△△Ct ,△Ct = Ct value of target gene - Ct value of reference gene, -△△Ct=△Ct mean value of negative control (NC) group -△Ct value of each sample, 2 −△△Ct reflects the relative expression level of target genes in each sample compared to the NC group. Relative expression was calculated using β-actin as the reference gene. The primer information of the tested genes is shown in Table 1 . Table 1 The primer information of the genes purpose gene upstream primer sequences downstream primer sequences CX43 CTCTCGCCTATGTCTCCTCCT GCTCACTTGCTTGCTTGTTGTA 91 GAPDH TGACTTCAACAGCGACACCCA CACCCTGTTGCTGTAGCCAAA 121 Statistical analysis Data are expressed as mean ± SEM and were analyzed by Statistical Product and Service Solutions (SPSS) software. Comparison among multiple groups were conducted using one-way ANOVA by Tukey’s multiple comparison test, or by Kruskal Wallis test followed by Dunn’s multiple comparison test when the data did not meet a Gaussian distribution. Comparisons between two groups were performed using an unpaired Student’s t-test, or by Mann–Whitney test when the data did not meet a Gaussian distribution. Significant difference was considered when P < 0.05. Results Effects of cannabinoids on membrane protein and total protein of Cx43 hemichannels in astrocytes in vitro In this study, we investigated how cannabinoids affect Cx43 hemichannels in human astrocytes (U251 cells) in vitro. To understand the impact of CB1R on Cx43 hemichannels, we compared the amount of Cx43 protein in the cell membrane and in the total cell content. We divided our experiments into three groups: a control group, a group treated with a CB1R agonist (Bay 59-3074), and a group treated with a CB1R inhibitor (JD-5037). We found that the CB1R agonist increased the level of Cx43 hemichannel protein in the membrane, while the CB1R inhibitor decreased it (Fig. 1 A). However, when we looked at the total protein, the effects of the agonist and inhibitor on Cx43 hemichannel levels were not statistically significant (Fig. 1 B). Next, we examined the level of phosphorylation of Cx43 protein, which is a process that can change its function. The CB1R agonist decreased the phosphorylation of Cx43 protein in both the cell membrane and the total cell content (Fig. 1 C and 1 D). Conversely, the CB1R inhibitor increased the phosphorylation of Cx43 protein in both locations (Figs. 1 C and 1 D). Our results showed that CB1R agonists and inhibitors had opposite effects on the level and phosphorylation of Cx43 hemichannel protein in the cell membrane of human astrocytes. Effects of cannabinoids on the biological activity of gap junctions in astrocytes in vitro To assess how CB1R agonists and inhibitors affect the function of gap junctions in astrocytes, we conducted dye uptake experiments. We used a small, fluorescent dye called LY to measure how much dye the astrocytes absorbed. Our results showed that when astrocytes were treated with a CB1R agonist, they took up significantly more LY through their Cx43 hemichannels compared to the control group. This suggests that the agonist increased the activity of the gap junctions. On the other hand, when astrocytes were treated with a CB1R inhibitor, they took up slightly less LY, although this decrease was not statistically significant. This indicates that the inhibitor may have had a minimal effect on reducing the activity of the gap junctions. Cannabinoids increased the release of gliotransmitters and calcium concentration by regulating Cx43 in astrocytes We cultured human astrocytes (U251) and treated them with different lentiviruses to create cell lines with reduced levels of Cx43, a protein important for cell communication. qPCR was used to detect the efficiency of Cx43 knockdown. We created five groups: a blank control group (CON), a group infected with a negative control lentivirus (shCtrl), and three groups infected with different lentiviruses designed to target Cx43 (shCx43-1, shCx43-2, and shCx43-3). We then compared the levels of Cx43 mRNA in each cell line to a reference gene, GAPDH, to determine the efficiency of Cx43 knockdown. We found that shCx43-1 and shCx43-2 were equally effective at reducing Cx43 levels by 66.3% and 48.2% compared to the shCtrl group (p < 0.01). The shCx43-3 lentivirus had a lower knockdown efficiency of 30.7%, which was not statistically significant. Based on these results, we selected the shCx43-1 cell line, which had the highest knockdown efficiency, for further study. Next, we wanted to investigate whether cannabinoids can affect the release of gliotransmitters and calcium levels in astrocytes by changing the levels of a protein called Cx43. To do this, we grew human astrocytes (U251) in a dish for four days and then infected them with a virus that reduces Cx43 levels. Next, we treated the infected astrocytes with a cannabinoid compound called Bay 59-3074, which activates a specific receptor in the cells. We then measured the levels of three gliotransmitters (ATP, D-serine, and GABA) outside the cells. We found that ATP levels were 56.5% lower (p < 0.001, Fig. 4 A) and GABA levels were 18.7% lower (p < 0.05, Fig. 4 B) in the cells with reduced Cx43 levels compared to the control cells treated with the same cannabinoid. The effect of D-serine release was not significant (Fig. 4 C). At last, we detected the calcium concentration with of Fluo-3 AM confocal microscope images. Compared with the shCtrl + Bay59-3074 group, the fluorescence intensity of calcium fluorescence of shCx43 + Bay59-3074 group decreased by 56.8% ( p < 0.001) (Fig. 4 D). Discussion Our study demonstrates that CB1R signaling dynamically regulates Cx43 hemichannel activity in astrocytes. CB1R agonist Bay 59-3074 increased the abundance of Cx43 hemichannels at the cell membrane, enhancing permeability as evidenced by elevated LY dye uptake. In contrast, the CB1R antagonist JD-5037 reduced LY uptake, indicating suppression of hemichannel activity. Importantly, neither agonist nor antagonist altered total Cx43 protein levels, indicating that CB1R signaling modulates the trafficking of Cx43 to the membrane rather than its overall expression. Cx43 undergoes post-translational phosphorylation, which regulates its function. We observed that CB1R activation reduced Cx43 phosphorylation, correlating with increased membrane localization and permeability. Cx43 is initially synthesized as a 40 kDa protein and phosphorylated to a 41 kDa form in the endoplasmic reticulum or early Golgi [ 13 ]. Further phosphorylation occurs later in the secretory pathway or at the plasma membrane, influencing channel assembly, stability, and intercellular communication[ 14 ]. Furthermore, it seems that the effects of altered Cx43 phosphorylation may be both species and cell type dependent [ 14 , 15 ]. Phosphorylation and dephosphorylation of Cx43 have important effects on the function of gap junction channel. Cx43 phosphorylated parameter and gap junction reconfiguration affect the occurrence of neurological diseases by altering gap junction cellular communication [ 16 , 17 ]. Phosphorylation at specific residues, such as Ser368, is known to reduce gap junction activity [ 9 ]. Our findings suggest that CB1R activation disrupts phosphorylation patterns, potentially altering channel conformation and promoting hemichannel opening. This mechanism could explain the enhanced release of ATP, GABA, and Ca²⁺ observed in astrocytes following CB1R activation. Cx43 hemichannels serve as conduits for molecules like ATP, Ca²⁺, and neurotransmitters, enabling astrocytes to modulate neuronal activity and respond to environmental changes [ 18 – 20 ]. Cx43 is the main channel for the transmembrane transport of Ca2 + and NAD + between nerve cells, and plays an important role in the electrical signal transduction and nutrient metabolism of nerve cells7. Under pathological conditions (e.g., ischemia, inflammation), prolonged Cx43 hemichannel opening exacerbates cell damage by releasing excitotoxic substances [ 21 ]. In our experiments, CB1R activation increased ATP, GABA, and Ca²⁺ release, effects that were diminished when Cx43 expression was knocked down. This aligns with evidence linking astrocyte CB1R signaling to calcium mobilization, adenosine kinase activity and glutamate release, processes implicated in synaptic plasticity, excitability of neural network and neurodegeneration [ 22 , 23 ]. By enhancing Cx43 membrane localization and permeability, CB1R activation may amplify astrocyte-mediated signaling, potentially influencing neurological outcomes such as seizure susceptibility or neuroinflammation [ 24 , 25 ]. While our study clarifies CB1R’s role in Cx43 trafficking and function, several questions remain. First, we did not identify the specific phosphorylation sites on Cx43 responsible for altered hemichannel activity. Second, while dye uptake experiments confirmed changes in membrane permeability, further studies are needed to directly link Cx43 upregulation or inhibition to these effects. Finally, the interplay between CB1R signaling, phosphorylation cascades, and downstream pathological consequences (e.g., neurodegeneration) warrants deeper exploration, particularly in disease models. These findings establish CB1R as a key regulator of Cx43 hemichannel dynamics in astrocytes, influencing intercellular communication and neurotransmitter release. By enhancing hemichannel permeability and neurotransmitter release, CB1R activation may reshape astrocyte-neuron interactions, with potential ramifications for neurological disease. Future studies should delineate the phosphorylation-dependent mechanisms and evaluate therapeutic strategies targeting this pathway in disorders characterized by aberrant gap junction activity. Conclusion In summary, activation of the CB1R pathway regulates the expression and function of Cx43 in astrocytes. Specifically, it increases the amount of Cx43 protein on the cell membrane and enhances its permeability. Moreover, reducing Cx43 expression in astrocytes decreases the release of ATP and GABA when the CB1R pathway is activated. Our findings elucidate regulatory mechanisms of the CB1R pathway in astrocyte function, demonstrating its critical impact on synaptic communication and neural activity. Declarations Authors’ Contributions Xiaomu Wang: Writing – original draft, Investigation, Data curation. Hua He: Writing – original draft, Investigation, Resources, Methodology. Lei Ma: Writing – review &editing, Resources, Methodology, Funding acquisition, Conceptualization. All authors read and approved the final article. Disclaimer The funder had no role in article design, data collection, data analysis, interpretation, and writing of the article. Author Disclosure Statement All authors declare no relevant interests. Funding This study was supported by the National Natural Science Foundation of China (Grant numbers: 82071449). References Zhang M, Wang ZZ, Chen NH(2023) Connexin 43 Phosphorylation: Implications in Multiple Diseases. Molecules 28(13):4914 Zhang Y, Acosta FM, Jiang JX(2024) Connexin 43 hemichannels and related diseases. Antib Ther 7(4):361-369 Gorzkiewicz A, Szemraj J(2018) Brain endocannabinoid signaling exhibits remarkable complexity. Brain Res Bull 142:33-46 Cheung KAK, Peiris H, Wallace G, et al(2019) The Interplay between the Endocannabinoid System, Epilepsy and Cannabinoids. Int J Mol Sci 20(23): 6079 Maroto IB, Moreno E, Costas-Insua C, et al(2023) Selective inhibition of cannabinoid CB(1) receptor-evoked signalling by the interacting protein GAP43. Neuropharmacology 240:109712 Ramesh K, Rosenbaum DM(2022) Molecular basis for ligand modulation of the cannabinoid CB(1) receptor. Br J Pharmacol 179(14):3487-3495 Bruzzone S, Guida L, Zocchi E, et al(2001) Connexin 43 hemi channels mediate Ca2+-regulated transmembrane NAD+ fluxes in intact cells. Faseb j 15(1):10-12 Navarrete M, Díez A, Araque A(2014) Astrocytes in endocannabinoid signalling. Philos Trans R Soc Lond B Biol Sci 369(1654):20130599 Ryu JE, Shim KW, Roh HW, et al(2024) Circadian regulation of endoplasmic reticulum calcium response in cultured mouse astrocytes. Elife 13:RP96357 Yao J, Chen C, Sun Y, et al(2024). Higenamine exerts antidepressant effect by improving the astrocytic gap junctions and inflammatory response. J Affect Disord 348:107-115 Vázquez C, Tolón RM, Pazos MR, et al(2015) Endocannabinoids regulate the activity of astrocytic hemichannels and the microglial response against an injury: In vivo studies. Neurobiol Dis 79:41-50 Jin C, Wang ZZ, Zhou H, et al(2017) Ginsenoside Rg1-induced antidepressant effects involve the protection of astrocyte gap junctions within the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry 75:183-191 Puranam KL, Laird DW, Revel JP(1993) Trapping an intermediate form of connexin43 in the Golgi. Exp Cell Res 206(1):85-92 Axelsen LN, Calloe K, Holstein-Rathlou NH, et al(2013) Managing the complexity of communication: regulation of gap junctions by post-translational modification. Front Pharmacol 4:130 Weiss BE, Kraner SD, Artiushin IA, et al(2024) Elevated calcineurin activity in primary astrocytes leads to the dephosphorylation of connexin 43 in conjunction with increased membrane permeability. Neuroreport 35(10):673-678 Beardslee MA, Lerner DL, Tadros PN, et al(2000) Dephosphorylation and intracellular redistribution of ventricular connexin43 during electrical uncoupling induced by ischemia. Circ Res 87(8):656-662 Kawasaki A, Hayashi T, Nakachi K, et al(2009) Modulation of connexin 43 in rotenone-induced model of Parkinson's disease. Neuroscience 160(1):61-68 Tencé M, Ezan P, Amigou E, et al(2012) Increased interaction of connexin43 with zonula occludens-1 during inhibition of gap junctions by G protein-coupled receptor agonists. Cell Signal 24(1):86-98 Jiang S, Yuan H, Duan L, et al(2011) Glutamate release through connexin 43 by cultured astrocytes in a stimulated hypertonicity model. Brain Res 1392:8-15 Pannasch U, Vargová L, Reingruber J, et al(2011) Astroglial networks scale synaptic activity and plasticity. Proc Natl Acad Sci USA 108(20):8467-8472 Medina-Ceja L, Salazar-Sánchez JC, Ortega-Ibarra J, et al(2019) Connexins-Based Hemichannels/Channels and Their Relationship with Inflammation, Seizures and Epilepsy. Int J Mol Sci 20(23): 5976 Covelo A, Eraso-Pichot A, Fernández-Moncada I,et al(2021) CB1R-dependent regulation of astrocyte physiology and astrocyte-neuron interactions. Neuropharmacology 195:108678 Zou S, Kumar U(2018) Cannabinoid Receptors and the Endocannabinoid System: Signaling and Function in the Central Nervous System. Int J Mol Sci 19(3); 833 Motaghi S, Sayyah M, Babapour V, et al(2017) Hippocampal Expression of Connexin36 and Connexin43 during Epileptogenesis in Pilocarpine Model of Epilepsy. Iran Biomed J 21(3):167-173 García-Rodríguez C, Bravo-Tobar ID, Duarte Y,et al(2022) Contribution of non-selective membrane channels and receptors in epilepsy. Pharmacol Ther 231:107980 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 29 Dec, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 26 Aug, 2025 Reviews received at journal 22 Aug, 2025 Reviews received at journal 22 Aug, 2025 Reviews received at journal 20 Aug, 2025 Reviewers agreed at journal 13 Aug, 2025 Reviewers agreed at journal 12 Aug, 2025 Reviewers agreed at journal 08 Aug, 2025 Reviewers agreed at journal 08 Aug, 2025 Reviewers agreed at journal 07 Aug, 2025 Reviewers agreed at journal 06 Aug, 2025 Reviewers invited by journal 06 Aug, 2025 Editor assigned by journal 29 Jul, 2025 Submission checks completed at journal 29 Jul, 2025 First submitted to journal 28 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7238022","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":497853865,"identity":"ff48a55c-4a66-4a47-ac85-08073c6483bb","order_by":0,"name":"Xiaomu Wang","email":"","orcid":"","institution":"Xijing Hospital of the Air Force Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaomu","middleName":"","lastName":"Wang","suffix":""},{"id":497853866,"identity":"00a34971-5090-4183-8585-78459d8323de","order_by":1,"name":"Lei Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuklEQVRIiWNgGAWjYFAC5gaGhAo5CJuHOC2MQC1njEnVwthGihbd9oONDx7OM4jWnZHA+OBtG4O8OSEtZmcSmw0StxnkbruRwGw4t43BcGcDIS0HEtskErf9AWlhk+ZtY0gwOEBIy/mH7T8S54BtYf9NnJYbiW0MiQ1gLWzMRGp52CyRcAyo5czDZsk55yQMNxB2WPLBjz9qgFqOJx/88KbMRp6gLUgAGEEMDBLEqx8Fo2AUjIJRgBsAAKJSRdhSXeJKAAAAAElFTkSuQmCC","orcid":"","institution":"Xijing Hospital of the Air Force Military Medical University","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Ma","suffix":""},{"id":497853867,"identity":"7f049659-57b8-4223-a821-bdbce3a01931","order_by":2,"name":"hua He","email":"","orcid":"","institution":"Xijing 986 Hospital, Air Force Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"hua","middleName":"","lastName":"He","suffix":""}],"badges":[],"createdAt":"2025-07-29 02:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7238022/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7238022/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-025-11346-w","type":"published","date":"2025-12-29T15:57:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":88785644,"identity":"88817a0c-e2e2-4b79-ad83-2073a0689fc7","added_by":"auto","created_at":"2025-08-11 11:42:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":103724,"visible":true,"origin":"","legend":"\u003cp\u003eThe levels of membrane protein and total protein and phosphorylation of Cx43 hemichannels were detected by Western Blot.\u003cstrong\u003e (A)\u003c/strong\u003e Agonist (Bay 59-3074) can increase the level of Cx43 hemichannels protein in membrane protein, and inhibitor (JD-5037) can decrease the level of Cx43 hemichannels protein in membrane protein. \u003cstrong\u003e(B)\u003c/strong\u003e The effects of agonist (Bay 59-3074) and inhibitor (JD-5037) on the level of Cx43 hemichannels in total protein were not statistically significant. \u003cstrong\u003e(C)\u003c/strong\u003e Agonist (Bay 59-3074) can decrease the phosphorylation level of Cx43 hemichannels protein, and inhibitor (JD-5037) can increase the phosphorylation level of Cx43 hemichannels protein in membrane protein. \u003cstrong\u003e(D)\u003c/strong\u003eAgonist (Bay 59-3074) can decrease the phosphorylation level of Cx43 hemichannels protein, and inhibitor (JD-5037) can increase the phosphorylation level of Cx43 hemichannels protein in total protein. Vertical bars represent±SE. Unpaired Student t-test between control (Ctrl), agonist (Bay 59-3074) and inhibitor (JD-5037) groups.The data compared with the control group *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7238022/v1/c8ea205273b26280dd94438d.png"},{"id":88785647,"identity":"200b8f77-56c9-4a0a-9a05-dfc0e938896b","added_by":"auto","created_at":"2025-08-11 11:42:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":61135,"visible":true,"origin":"","legend":"\u003cp\u003eConfocal microscope images and analysis of the Cx43 hemichannels bioactivity of astrocytes in dye uptake experiments with CB1R agonists and inhibitors\u003cstrong\u003e. (A) \u003c/strong\u003eRepresentative photomicrographs showing LY in control (Ctrl), agonist (Bay 59-3074) and inhibitor (JD-5037) groups, Scale bar, 60μm.\u003cstrong\u003e (B)\u003c/strong\u003e Bar graph shows relative fluorescence intensity in different groups. Vertical bars represent ±SE. Unpaired Student t-test between control (Ctrl), agonist (Bay 59-3074) and inhibitor (JD-5037) groups. Agonist (Bay 59-3074) group compared with the control group. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7238022/v1/8bf79bc2ff733e038db5aeda.png"},{"id":88785654,"identity":"e9a0ae64-e701-4058-8ed1-2cd9d13acd49","added_by":"auto","created_at":"2025-08-11 11:42:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":91806,"visible":true,"origin":"","legend":"\u003cp\u003eEfficiency of Cx43 knockdown lentivirus cell lines detected by qPCR\u003cstrong\u003e.\u003c/strong\u003e The knockdown efficiency of each cell line was measured by relative mRNA level (Cx43/GAPDH). Compared with the shCtrl cell line, Cx43 knockdown efficiency of shCx43-1 cell line was 66.3%, Cx43 knockdown efficiency of shCx43-2 cell line was 48.2% and Cx43 knockdown efficiency of shCx43-3 cell line was 30.7%. Vertical bars represent ±SE. The relative mRNA level of compared of Cx43 knockdown lentivirus cell lines with the shCtrl cell line. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7238022/v1/6586d10b3bdfc8174b4938fe.png"},{"id":88785721,"identity":"8684707a-3e78-4adb-b706-924a2d6b3224","added_by":"auto","created_at":"2025-08-11 11:50:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":98964,"visible":true,"origin":"","legend":"\u003cp\u003eCannabinoids increased the release of gliotransmitters and calcium concentration by modulating Cx43 in astrocytes in vitro\u003cstrong\u003e.\u003c/strong\u003e The Human astrocytes (U251) of shCtrl (infected with negative control lentivirus) and shCx43 (infected with Cx43 interfering lentivirus 1) were treated with the agonist (Bay 59-3074). \u003cstrong\u003e(A)\u003c/strong\u003eCompared with theshCtrl+Bay59-3074 group, the ATP of shCx43+Bay59-3074 group decreased by 56.5%. \u003cstrong\u003e(B) \u003c/strong\u003eGABA decreased by 18.7%. \u003cstrong\u003e(C) \u003c/strong\u003eThe D-serine release was not significant. \u003cstrong\u003e(D)\u003c/strong\u003e Compared with the shCtrl+Bay59-3074 group, the fluorescence intensity of calcium fluorescence of shCx43+Bay59-3074 group decreased by 56.8%. Vertical bars represent ±SE. Student t-test between shCtrl+Bay59-3074 group and shCx43+Bay59-3074 group. The shCx43+Bay59-3074 group compared with the shCtrl+Bay59-3074 group *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7238022/v1/5991ff0b78ebd7dd8bbae17f.png"},{"id":99545240,"identity":"1cd03de6-f5ce-496d-8890-774ada9dfb25","added_by":"auto","created_at":"2026-01-05 16:03:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1005312,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7238022/v1/7bb7e922-4227-4c1a-b96b-db0fe2e90e2d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"CB1 Receptor Signaling Regulates Cx43 Hemichannel Trafficking and Phosphorylation in Astrocytes: Implications for Gliotransmission and Neuropathological Injury","fulltext":[{"header":"Introduction","content":"\u003cp\u003eConnexin 43 (CX43) serves as a fundamental mediator of intercellular communication by forming gap junction channels that facilitate the direct exchange of ions, metabolites, and signaling molecules between adjacent cells. This function is critical for synchronizing physiological activities in tissues including cardiac conduction, neuronal excitation, and wound healing [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Additionally, CX43 hemichannels regulate autocrine/paracrine signaling through ATP and glutamate release [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, its regulatory mechanisms remain incompletely elucidated.\u003c/p\u003e\u003cp\u003eCannabinoid receptor 1 (CB1R) is widely distributed in the brain, especially in regions like the cortex, hippocampus, basal ganglia and cerebellum [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Endocannabinoids activate CB1R, triggering Ca\u0026sup2;⁺ release from IP₃-sensitive intracellular stores via Gαq/11-PLCβ cascades. This Ca\u0026sup2;⁺ surge propagates as intercellular waves through gap junctions (e.g., CX43 hemichannels), facilitating gliotransmitter release (ATP/glutamate) that modulates synaptic plasticity [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Concurrently, CB1R-Gαi/o coupling inhibits cAMP-PKA signaling, suppressing pro-inflammatory pathways [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Critically, astrocyte-derived endocannabinoids also engage neuronal CB1R retrograde signaling, forming a tripartite synapse-regulatory loop whose imbalance contributes to epilepsy and neuropathic pain [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eInterestingly, astrocytes possess an intrinsic system for producing and responding to endocannabinoids, which activate CB1R. When CB1R in astrocytes is activated, it enhances synaptic transmission and affects plasticity by altering intracellular calcium levels and glutamate release [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The endocannabinoid system is thus essential for synaptic plasticity and excitatory transmission.\u003c/p\u003e\u003cp\u003eNotably, previous studies have shown that phosphorylation of Cx43 attenuates gap junctional communication between astrocytes [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], whereas dephosphorylation promotes intercellular communication and increase Cx43 activity [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Although endocannabinoid modulates astroglial function in vivo by increasing Cx43 hemichannel activity [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], it remains unclear this modulation involves direct regulation of Cx43 in astrocytes. Therefore, this study aims to investigate how the CB1R pathway influences Cx43 function in cultured astrocytes and to explore the underlying mechanism of this regulation.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cb\u003eMaterials and Reagents\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM), fetal bovine serum (FBS), and streptomycin were obtained from Gibco (Invitrogen Corp., San Diego, CA). Bay 59-3074 and JD-5073 were sourced from YI FEI XUE Biotechnology, China, and used at a dilution of 1:5000.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell culture\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHuman astrocytes (U251) were purchased from the Chinese Academy of Sciences (Shanghai, China). These cells were cultured in DMEM containing 4.5 g/L glucose, 10%FBS, 100 U/mL penicillin and streptomycin. The cells were maintained at 37\u0026deg;C in a humidified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blotting\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe experiment was divided into control group, agonist (Bay 59-3074) group and inhibitor (JD-5037) group. For total protein extraction, the cultured astrocytes in each group were ground with radio immunoprecipitation assay (RIPA) lysate buffer (LMAI Bio, No.LM-F401, China) and placed at 4℃. The lysates were centrifuged at 16,000 g for 15 min at 4℃, and the protein was denatured by boiling water bath for 10 min. The prepared SDS-PAGE was put into the electrophoresis tank, and the proteins were blotted on PVDF membranes (PALL Gelman, Ann Arbor, MI, USA) using Mini-PROTEAN\u0026reg; Tetra Handcast Systems and Mini Trans-Blot\u0026reg; Cell (Bio-Rad Laboratories, Hercules, CA, USA) by wet transfer method, and the total protein was blocked for 2 h at room temperature with 5% fat free milk in Tris-buffered saline Tween-20 (8.0 g/L NaCl, 2.4 g/L Tris base and 1 mL/L Tween-20).\u003c/p\u003e\u003cp\u003eMembrane proteins were extracted via two rounds of ultracentrifugation, with protein concentrations determined by the BCA method (BCA Protein Quantitation Assay, Keygen Biotech, China). The extracts were resolved by SDS/PAGE on an 8\u0026ndash;12% gradient separating gel and blotted on PVDF membranes (PALL Gelman, Ann Arbor, MI, USA). Electrophoresis buffer (14.4 g/L Glycine, 3.0 g/L Tris.HCl and 1.0 g/L SDS) and transfer buffer (2.93 g/L Glycine, 5.82 g /L Tris. HCl and 200 ml/L Methanol) were used. The membrane was blocked with fresh blocking buffer containing 5% skim milk powder at room temperature for 1 h, followed by incubation with primary antibodies at 4\u0026deg;C overnight. The following day, the membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000) for 2 h at room temperature. Finally, enhanced chemiluminescence (ECL) solution (Phygene, No. PH0353, China) was used to detect the luminescence signal changes which were analyzed with the ImageQuant\u0026trade; LAS 4000 imaging system (GE Healthcare, USA). The band intensity was determined by densitometry with the aid of the Bio-Rad Gel Doc XR documentation system.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDye uptake experiments\u003c/b\u003e\u003c/p\u003e\u003cp\u003eGap junction intercellular communication was assessed using Lucifer Yellow (LY, MKBio, MX4476, No.71206-95-6, China), a fluorescent dye that can diffuse between neighboring cells via gap junctions [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Cells were seeded in 24-well plates (70,000 cells per well) and incubated for 24 hours. They were then exposed to 400\u0026micro;l 0.05%(w/v) LY (Potassium salt) solution, and an injection cannula (0.45\u0026times;12 mm) was used to cut as straight as possible from left to right. After incubation with LY for 2 mins under protection at 37℃, the plates were washed and then evaluated directly by laser scanning confocal microscopy (Leica SP8, German). Function was assessed at 10\u0026times; magnification and at a wavelength of 488 nm.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCx43 gene knockdown\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCell suspensions at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/ml were prepared using complete medium and spread in six-well plates for 24h at 37℃. The required amount of virus was calculated according to the multiplicity of infection (MOI) of the cells and the virus titer of the Cx43 three-target knockdown lentivirus. The complete medium was replaced by 1ml Opti-MEM medium (Gibco, No.51985-034, America) in each well, and then the corresponding amount of lentivirus was added. After 72 h, the infection efficiency was observed under a fluorescence microscope (Olympus CKX53, Japan). When the cell density was 90\u0026ndash;100%, the knockdown efficiency of Cx43 at the protein and RNA level was detected by WB and qPCR, respectively.\u003c/p\u003e\u003cp\u003e\u003cb\u003eRNA extraction and quantitative PCR\u003c/b\u003e:\u003c/p\u003e\u003cp\u003eCollect about 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e astrocyte centrifugal supernatant, Trizol (Sigma, T3038, America) reagent was used to extract RNA. The concentration and quality of the extracted RNA were determine using a Nanodrop 100 spectrophotometer (Thermo, America). The cDNA obtained by reverse transcription of RNA was reverse transcribed according to the vazyme Hiscript QRT supermix for qPCR (+\u0026thinsp;gDNA WIPER) program. The resulting cDNA was stored at -80℃ until use. Real-time PCR (Applied Biosystems, America) detection reaction system was prepared the reaction mixture as follows: AceQ qPCR SYBR Green master mix (Vazyme, America) 5.0\u0026micro;l, upstream primer (10\u0026micro;M) 0.25\u0026micro;l, downstream primer (10\u0026micro;M) 0.25\u0026micro;l, Dye2 0.2\u0026micro;l, cDNA 2.0\u0026micro;l, RNase-Free H\u003csub\u003e2\u003c/sub\u003eO 2.3\u0026micro;l. The reaction conditions were as follows: an initial denaturation at 95℃ for 3min followed by 40 cycles of amplification at 95℃ for 5s, 56℃ for 10s, and 72℃ for 25s, the 65\u0026thinsp;~\u0026thinsp;95℃ for Real-Time PCR preparation dissolution curve. According to the cycle threshold (Ct) value calculate relative quantitative analysis F\u0026thinsp;=\u0026thinsp;2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e,△Ct\u0026thinsp;=\u0026thinsp;Ct value of target gene - Ct value of reference gene, -△△Ct=△Ct mean value of negative control (NC) group -△Ct value of each sample, 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e reflects the relative expression level of target genes in each sample compared to the NC group. Relative expression was calculated using β-actin as the reference gene. The primer information of the tested genes is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe primer information of the genes\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003epurpose gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eupstream primer sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003edownstream primer sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCX43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCTCGCCTATGTCTCCTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTCACTTGCTTGCTTGTTGTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e91\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGACTTCAACAGCGACACCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCACCCTGTTGCTGTAGCCAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e121\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM and were analyzed by Statistical Product and Service Solutions (SPSS) software. Comparison among multiple groups were conducted using one-way ANOVA by Tukey\u0026rsquo;s multiple comparison test, or by Kruskal Wallis test followed by Dunn\u0026rsquo;s multiple comparison test when the data did not meet a Gaussian distribution. Comparisons between two groups were performed using an unpaired Student\u0026rsquo;s t-test, or by Mann\u0026ndash;Whitney test when the data did not meet a Gaussian distribution. Significant difference was considered when P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eEffects of cannabinoids on membrane protein and total protein of Cx43 hemichannels in astrocytes in vitro\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn this study, we investigated how cannabinoids affect Cx43 hemichannels in human astrocytes (U251 cells) in vitro. To understand the impact of CB1R on Cx43 hemichannels, we compared the amount of Cx43 protein in the cell membrane and in the total cell content. We divided our experiments into three groups: a control group, a group treated with a CB1R agonist (Bay 59-3074), and a group treated with a CB1R inhibitor (JD-5037). We found that the CB1R agonist increased the level of Cx43 hemichannel protein in the membrane, while the CB1R inhibitor decreased it (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). However, when we looked at the total protein, the effects of the agonist and inhibitor on Cx43 hemichannel levels were not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Next, we examined the level of phosphorylation of Cx43 protein, which is a process that can change its function. The CB1R agonist decreased the phosphorylation of Cx43 protein in both the cell membrane and the total cell content (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Conversely, the CB1R inhibitor increased the phosphorylation of Cx43 protein in both locations (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Our results showed that CB1R agonists and inhibitors had opposite effects on the level and phosphorylation of Cx43 hemichannel protein in the cell membrane of human astrocytes.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffects of cannabinoids on the biological activity of gap junctions in astrocytes in vitro\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo assess how CB1R agonists and inhibitors affect the function of gap junctions in astrocytes, we conducted dye uptake experiments. We used a small, fluorescent dye called LY to measure how much dye the astrocytes absorbed. Our results showed that when astrocytes were treated with a CB1R agonist, they took up significantly more LY through their Cx43 hemichannels compared to the control group. This suggests that the agonist increased the activity of the gap junctions. On the other hand, when astrocytes were treated with a CB1R inhibitor, they took up slightly less LY, although this decrease was not statistically significant. This indicates that the inhibitor may have had a minimal effect on reducing the activity of the gap junctions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCannabinoids increased the release of gliotransmitters and calcium concentration by regulating Cx43 in astrocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe cultured human astrocytes (U251) and treated them with different lentiviruses to create cell lines with reduced levels of Cx43, a protein important for cell communication. qPCR was used to detect the efficiency of Cx43 knockdown. We created five groups: a blank control group (CON), a group infected with a negative control lentivirus (shCtrl), and three groups infected with different lentiviruses designed to target Cx43 (shCx43-1, shCx43-2, and shCx43-3). We then compared the levels of Cx43 mRNA in each cell line to a reference gene, GAPDH, to determine the efficiency of Cx43 knockdown. We found that shCx43-1 and shCx43-2 were equally effective at reducing Cx43 levels by 66.3% and 48.2% compared to the shCtrl group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The shCx43-3 lentivirus had a lower knockdown efficiency of 30.7%, which was not statistically significant. Based on these results, we selected the shCx43-1 cell line, which had the highest knockdown efficiency, for further study.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eNext, we wanted to investigate whether cannabinoids can affect the release of gliotransmitters and calcium levels in astrocytes by changing the levels of a protein called Cx43. To do this, we grew human astrocytes (U251) in a dish for four days and then infected them with a virus that reduces Cx43 levels. Next, we treated the infected astrocytes with a cannabinoid compound called Bay 59-3074, which activates a specific receptor in the cells. We then measured the levels of three gliotransmitters (ATP, D-serine, and GABA) outside the cells. We found that ATP levels were 56.5% lower (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) and GABA levels were 18.7% lower (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) in the cells with reduced Cx43 levels compared to the control cells treated with the same cannabinoid. The effect of D-serine release was not significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). At last, we detected the calcium concentration with of Fluo-3 AM confocal microscope images. Compared with the shCtrl\u0026thinsp;+\u0026thinsp;Bay59-3074 group, the fluorescence intensity of calcium fluorescence of shCx43\u0026thinsp;+\u0026thinsp;Bay59-3074 group decreased by 56.8% (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study demonstrates that CB1R signaling dynamically regulates Cx43 hemichannel activity in astrocytes. CB1R agonist Bay 59-3074 increased the abundance of Cx43 hemichannels at the cell membrane, enhancing permeability as evidenced by elevated LY dye uptake. In contrast, the CB1R antagonist JD-5037 reduced LY uptake, indicating suppression of hemichannel activity. Importantly, neither agonist nor antagonist altered total Cx43 protein levels, indicating that CB1R signaling modulates the trafficking of Cx43 to the membrane rather than its overall expression.\u003c/p\u003e\u003cp\u003eCx43 undergoes post-translational phosphorylation, which regulates its function. We observed that CB1R activation reduced Cx43 phosphorylation, correlating with increased membrane localization and permeability. Cx43 is initially synthesized as a 40 kDa protein and phosphorylated to a 41 kDa form in the endoplasmic reticulum or early Golgi [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Further phosphorylation occurs later in the secretory pathway or at the plasma membrane, influencing channel assembly, stability, and intercellular communication[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Furthermore, it seems that the effects of altered Cx43 phosphorylation may be both species and cell type dependent [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Phosphorylation and dephosphorylation of Cx43 have important effects on the function of gap junction channel. Cx43 phosphorylated parameter and gap junction reconfiguration affect the occurrence of neurological diseases by altering gap junction cellular communication [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Phosphorylation at specific residues, such as Ser368, is known to reduce gap junction activity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Our findings suggest that CB1R activation disrupts phosphorylation patterns, potentially altering channel conformation and promoting hemichannel opening. This mechanism could explain the enhanced release of ATP, GABA, and Ca\u0026sup2;⁺ observed in astrocytes following CB1R activation.\u003c/p\u003e\u003cp\u003eCx43 hemichannels serve as conduits for molecules like ATP, Ca\u0026sup2;⁺, and neurotransmitters, enabling astrocytes to modulate neuronal activity and respond to environmental changes [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Cx43 is the main channel for the transmembrane transport of Ca2\u0026thinsp;+\u0026thinsp;and NAD\u0026thinsp;+\u0026thinsp;between nerve cells, and plays an important role in the electrical signal transduction and nutrient metabolism of nerve cells7. Under pathological conditions (e.g., ischemia, inflammation), prolonged Cx43 hemichannel opening exacerbates cell damage by releasing excitotoxic substances [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In our experiments, CB1R activation increased ATP, GABA, and Ca\u0026sup2;⁺ release, effects that were diminished when Cx43 expression was knocked down. This aligns with evidence linking astrocyte CB1R signaling to calcium mobilization, adenosine kinase activity and glutamate release, processes implicated in synaptic plasticity, excitability of neural network and neurodegeneration [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. By enhancing Cx43 membrane localization and permeability, CB1R activation may amplify astrocyte-mediated signaling, potentially influencing neurological outcomes such as seizure susceptibility or neuroinflammation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWhile our study clarifies CB1R\u0026rsquo;s role in Cx43 trafficking and function, several questions remain. First, we did not identify the specific phosphorylation sites on Cx43 responsible for altered hemichannel activity. Second, while dye uptake experiments confirmed changes in membrane permeability, further studies are needed to directly link Cx43 upregulation or inhibition to these effects. Finally, the interplay between CB1R signaling, phosphorylation cascades, and downstream pathological consequences (e.g., neurodegeneration) warrants deeper exploration, particularly in disease models.\u003c/p\u003e\u003cp\u003eThese findings establish CB1R as a key regulator of Cx43 hemichannel dynamics in astrocytes, influencing intercellular communication and neurotransmitter release. By enhancing hemichannel permeability and neurotransmitter release, CB1R activation may reshape astrocyte-neuron interactions, with potential ramifications for neurological disease. Future studies should delineate the phosphorylation-dependent mechanisms and evaluate therapeutic strategies targeting this pathway in disorders characterized by aberrant gap junction activity.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, activation of the CB1R pathway regulates the expression and function of Cx43 in astrocytes. Specifically, it increases the amount of Cx43 protein on the cell membrane and enhances its permeability. Moreover, reducing Cx43 expression in astrocytes decreases the release of ATP and GABA when the CB1R pathway is activated. Our findings elucidate regulatory mechanisms of the CB1R pathway in astrocyte function, demonstrating its critical impact on synaptic communication and neural activity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiaomu Wang: Writing \u0026ndash; original draft, Investigation, Data curation. Hua He: Writing \u0026ndash; original draft, Investigation, Resources, Methodology. Lei Ma: Writing \u0026ndash; review \u0026amp;editing, Resources, Methodology, Funding acquisition, Conceptualization. All authors read and approved the final article.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eDisclaimer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe funder had no role in article design, data collection, data analysis, interpretation, and writing of the article.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthor Disclosure Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no relevant interests.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (Grant numbers: \u0026nbsp;82071449).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhang M, Wang ZZ, Chen NH(2023) Connexin 43 Phosphorylation: Implications in Multiple Diseases. Molecules 28(13):4914\u003c/li\u003e\n\u003cli\u003eZhang Y, Acosta FM, Jiang JX(2024) Connexin 43 hemichannels and related diseases. Antib Ther 7(4):361-369\u003c/li\u003e\n\u003cli\u003eGorzkiewicz A, Szemraj J(2018) Brain endocannabinoid signaling exhibits remarkable complexity. Brain Res Bull\u003cem\u003e \u003c/em\u003e142:33-46\u003c/li\u003e\n\u003cli\u003eCheung KAK, Peiris H, Wallace G, et al(2019) The Interplay between the Endocannabinoid System, Epilepsy and Cannabinoids. Int J Mol Sci 20(23): 6079\u003c/li\u003e\n\u003cli\u003eMaroto IB, Moreno E, Costas-Insua C, et al(2023) Selective inhibition of cannabinoid CB(1) receptor-evoked signalling by the interacting protein GAP43. Neuropharmacology\u003cem\u003e \u003c/em\u003e 240:109712\u003c/li\u003e\n\u003cli\u003eRamesh K, Rosenbaum DM(2022) Molecular basis for ligand modulation of the cannabinoid CB(1) receptor. Br J Pharmacol 179(14):3487-3495\u003c/li\u003e\n\u003cli\u003eBruzzone S, Guida L, Zocchi E, et al(2001) Connexin 43 hemi channels mediate Ca2+-regulated transmembrane NAD+ fluxes in intact cells. Faseb j 15(1):10-12\u003c/li\u003e\n\u003cli\u003eNavarrete M, D\u0026iacute;ez A, Araque A(2014) Astrocytes in endocannabinoid signalling. Philos Trans R Soc Lond B Biol Sci 369(1654):20130599\u003c/li\u003e\n\u003cli\u003eRyu JE, Shim KW, Roh HW, et al(2024) Circadian regulation of endoplasmic reticulum calcium response in cultured mouse astrocytes. Elife 13:RP96357\u003c/li\u003e\n\u003cli\u003eYao J, Chen C, Sun Y, et al(2024). Higenamine exerts antidepressant effect by improving the astrocytic gap junctions and inflammatory response. J Affect Disord 348:107-115\u003c/li\u003e\n\u003cli\u003eV\u0026aacute;zquez C, Tol\u0026oacute;n RM, Pazos MR, et al(2015) Endocannabinoids regulate the activity of astrocytic hemichannels and the microglial response against an injury: In vivo studies. Neurobiol Dis 79:41-50\u003c/li\u003e\n\u003cli\u003eJin C, Wang ZZ, Zhou H, et al(2017) Ginsenoside Rg1-induced antidepressant effects involve the protection of astrocyte gap junctions within the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry\u003cem\u003e \u003c/em\u003e75:183-191\u003c/li\u003e\n\u003cli\u003ePuranam KL, Laird DW, Revel JP(1993) Trapping an intermediate form of connexin43 in the Golgi. Exp Cell Res 206(1):85-92\u003c/li\u003e\n\u003cli\u003eAxelsen LN, Calloe K, Holstein-Rathlou NH, et al(2013) Managing the complexity of communication: regulation of gap junctions by post-translational modification. Front Pharmacol 4:130\u003c/li\u003e\n\u003cli\u003eWeiss BE, Kraner SD, Artiushin IA, et al(2024) Elevated calcineurin activity in primary astrocytes leads to the dephosphorylation of connexin 43 in conjunction with increased membrane permeability. Neuroreport 35(10):673-678\u003c/li\u003e\n\u003cli\u003eBeardslee MA, Lerner DL, Tadros PN, et al(2000) Dephosphorylation and intracellular redistribution of ventricular connexin43 during electrical uncoupling induced by ischemia. Circ Res 87(8):656-662\u003c/li\u003e\n\u003cli\u003eKawasaki A, Hayashi T, Nakachi K, et al(2009) Modulation of connexin 43 in rotenone-induced model of Parkinson\u0026apos;s disease. Neuroscience 160(1):61-68\u003c/li\u003e\n\u003cli\u003eTenc\u0026eacute; M, Ezan P, Amigou E, et al(2012) Increased interaction of connexin43 with zonula occludens-1 during inhibition of gap junctions by G protein-coupled receptor agonists. Cell Signal 24(1):86-98\u003c/li\u003e\n\u003cli\u003eJiang S, Yuan H, Duan L, et al(2011) Glutamate release through connexin 43 by cultured astrocytes in a stimulated hypertonicity model. Brain Res 1392:8-15\u003c/li\u003e\n\u003cli\u003ePannasch U, Vargov\u0026aacute; L, Reingruber J, et al(2011) Astroglial networks scale synaptic activity and plasticity. Proc Natl Acad Sci USA 108(20):8467-8472\u003c/li\u003e\n\u003cli\u003eMedina-Ceja L, Salazar-S\u0026aacute;nchez JC, Ortega-Ibarra J, et al(2019) Connexins-Based Hemichannels/Channels and Their Relationship with Inflammation, Seizures and Epilepsy. Int J Mol Sci 20(23): 5976\u003c/li\u003e\n\u003cli\u003eCovelo A, Eraso-Pichot A, Fern\u0026aacute;ndez-Moncada I,et al(2021) CB1R-dependent regulation of astrocyte physiology and astrocyte-neuron interactions. Neuropharmacology 195:108678\u003c/li\u003e\n\u003cli\u003eZou S, Kumar U(2018) Cannabinoid Receptors and the Endocannabinoid System: Signaling and Function in the Central Nervous System. Int J Mol Sci 19(3); 833\u003c/li\u003e\n\u003cli\u003eMotaghi S, Sayyah M, Babapour V, et al(2017) Hippocampal Expression of Connexin36 and Connexin43 during Epileptogenesis in Pilocarpine Model of Epilepsy. Iran Biomed J\u003cem\u003e \u003c/em\u003e 21(3):167-173\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Rodr\u0026iacute;guez C, Bravo-Tobar ID, Duarte Y,et al(2022) Contribution of non-selective membrane channels and receptors in epilepsy. Pharmacol Ther 231:107980\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Cx43, Cannabinoid, Cannabinoid receptor type 1, Astrocytes, gliotransmitters","lastPublishedDoi":"10.21203/rs.3.rs-7238022/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7238022/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eConnexin 43 (Cx43), the most abundant connexin in the central nervous system, is predominantly expressed in astrocytes, where it mediates intercellular communication and energy exchange via gap junctions and hemichannels. Although Cx43 hemichannels are critically involved in neuropathological injury, the regulatory mechanisms controlling their expression and activity remain poorly understood. Previous studies indicate that cannabinoid receptor type 1 (CB1R) activation enhances Cx43 hemichannel opening by elevating intracellular calcium levels in astrocytes, thereby modulating synaptic transmission and neural network plasticity.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis study aimed to investigated whether the CB1R pathway regulates Cx43 hemichannel expression, intracellular trafficking, phosphorylation, and functional activity in astrocytes. The human astrocyte cell line U251 was cultured in vitro. Western blotting was performed to assess total and membrane-associated Cx43 protein levels following treatment with the CB1R agonist Bay59-3074 or the CB1R antagonist JD-5037. Membrane permeability was evaluated via dye uptake assays, while gliotransmitter release (ATP and GABA) and intracellular calcium levels were measured using ELISA kits and the fluorescent probe Fluo-3 AM, respectively.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eOur findings unveiled that neither Bay59-3074 nor JD-5037 altered total Cx43 protein levels. However, the CB1R agonist group exhibited reduced total Cx43 phosphorylation (p-Cx43/Cx43 ratio) but increased membrane Cx43 localization, whereas the antagonist group showed elevated phosphorylation and decreased membrane Cx43. Dye uptake efficiency significantly increased in the agonist-treated group, indicating enhanced hemichannel activity. Lentivirus-mediated Cx43 knockdown attenuated CB1R agonist-induced calcium influx and gliotransmitter release (ATP and GABA), confirming Cx43 dependency.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThese results demonstrate that the CB1R pathway regulates Cx43 hemichannel membrane trafficking and phosphorylation, thereby modulating astrocytic membrane permeability and gliotransmitter release. Targeting astrocytic Cx43 hemichannels via CB1R signaling may represent a novel therapeutic strategy for neurological disorders associated with dysregulated intercellular communication.\u003c/p\u003e","manuscriptTitle":"CB1 Receptor Signaling Regulates Cx43 Hemichannel Trafficking and Phosphorylation in Astrocytes: Implications for Gliotransmission and Neuropathological Injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-11 11:42:00","doi":"10.21203/rs.3.rs-7238022/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-26T09:33:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-22T19:58:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-22T12:53:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-20T21:19:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"72112272138400701092762152031713110823","date":"2025-08-13T04:14:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"170350041488680975661812002858220359637","date":"2025-08-13T02:33:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"78890790096968831565634493603932605949","date":"2025-08-08T18:48:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259686335610530800910392526920261680453","date":"2025-08-08T13:42:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"132876539121480052835498980349544990218","date":"2025-08-07T16:51:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335250439164698426987542921875617329658","date":"2025-08-07T03:22:57+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-06T17:26:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-29T15:46:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-29T13:00:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2025-07-29T01:55:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"fb2394af-0336-4e2d-bbcf-dd192abc0741","owner":[],"postedDate":"August 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-05T15:59:37+00:00","versionOfRecord":{"articleIdentity":"rs-7238022","link":"https://doi.org/10.1007/s11033-025-11346-w","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2025-12-29 15:57:20","publishedOnDateReadable":"December 29th, 2025"},"versionCreatedAt":"2025-08-11 11:42:00","video":"","vorDoi":"10.1007/s11033-025-11346-w","vorDoiUrl":"https://doi.org/10.1007/s11033-025-11346-w","workflowStages":[]},"version":"v1","identity":"rs-7238022","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7238022","identity":"rs-7238022","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}