SUFU: A potential novel gene responsible for Lhermitte Duclos disease

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

A novel germline de novo SUFU variant disrupting splicing was identified in a patient with Lhermitte-Duclos disease, establishing SUFU as a potential gene responsible for the condition.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

This preprint reports an incidental case of a 10-year-old patient with Lhermitte-Duclos disease (dysplastic gangliocytoma of the cerebellum) identified on MRI and confirmed on pathology, with subsequent germline testing using targeted next-generation sequencing and confirmatory Sanger sequencing. A novel heterozygous de novo pathogenic SUFU splice-site variant (c.183-2A>G) was identified from blood-derived DNA, and RNA studies showed exon 2 skipping on RT-PCR, while tumor DNA sequencing also detected a PTEN variant (c.389G>A). The authors interpret SUFU as a negative regulator of hedgehog signaling and discuss pathway links involving WNT and PTEN/AKT/mTOR, presenting the SUFU variant as the first reported association with LDD, while noting the study is limited to a single case. This paper is centrally about endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Lhermitte-Duclos disease (LDD) is a rare dysplastic gangliocytoma of the cerebellum, typically presenting as a hamartomatous lesion in the posterior fossa. PTEN and the PI3K/AKT/mTOR pathway are involved in the pathogenesis of LDD. We present a case of a patient who incidentally was detected with LDD. A novel, pathogenic, heterozygous, de novo, splice site variant c.183-2A > G (NM_016169.4) in the SUFU gene was identified with targeted next-generation sequencing from genomic DNA. SUFU, a tumor suppressor gene, negatively regulates the hedgehog (Hh) signaling pathway. SUFU also influences WNT and PTEN/AKT/mTOR signaling pathways. While SUFU pathogenic variants are associated with various central nervous system (CNS) tumors, this is the first reported link between SUFU and LDD. The study delves into the role of SUFU in LDD development, establishing the novel SUFU variant as a potential genetic marker for the disease. Sanger sequencing and gel electrophoresis were applied to RNA isolated from blood to show that the variant disrupts splicing. DNA extracted from tumor tissue underwent NGS with the TWIST Exome 2.0 Panel. Results unveiled the de novo pathogenic SUFU (c.183-2A > G) and PTEN (c.389G > A) variants. In conclusion, this study establishes the first reported association between LDD and a germline, de novo SUFU variant, and sheds light on the crucial role of SUFU in LDD pathogenesis. It contributes to the broader understanding of genetic factors influencing this rare cerebellar disorder.
Full text 65,228 characters · extracted from preprint-html · click to expand
SUFU: A potential novel gene responsible for Lhermitte Duclos disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SUFU: A potential novel gene responsible for Lhermitte Duclos disease Özge Güngör, Aslı Ece Solmaz, Emin Karaca, Taner Akalın, Elif Bolat, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4271310/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lhermitte-Duclos disease (LDD) is a rare dysplastic gangliocytoma of the cerebellum, typically presenting as a hamartomatous lesion in the posterior fossa. PTEN and the PI3K/AKT/mTOR pathway are involved in the pathogenesis of LDD. We present a case of a patient who incidentally was detected with LDD. A novel, pathogenic, heterozygous, de novo, splice site variant c.183-2A > G (NM_016169.4) in the SUFU gene was identified with targeted next-generation sequencing from genomic DNA. SUFU , a tumor suppressor gene, negatively regulates the hedgehog (Hh) signaling pathway. SUFU also influences WNT and PTEN/AKT/mTOR signaling pathways. While SUFU pathogenic variants are associated with various central nervous system (CNS) tumors, this is the first reported link between SUFU and LDD. The study delves into the role of SUFU in LDD development, establishing the novel SUFU variant as a potential genetic marker for the disease. Sanger sequencing and gel electrophoresis were applied to RNA isolated from blood to show that the variant disrupts splicing. DNA extracted from tumor tissue underwent NGS with the TWIST Exome 2.0 Panel. Results unveiled the de novo pathogenic SUFU (c.183-2A > G) and PTEN (c.389G > A) variants. In conclusion, this study establishes the first reported association between LDD and a germline, de novo SUFU variant, and sheds light on the crucial role of SUFU in LDD pathogenesis. It contributes to the broader understanding of genetic factors influencing this rare cerebellar disorder. Lhermitte Duclos SUFU PTEN NGS Figures Figure 1 Figure 2 Figure 3 1 INTRODUCTION LDD, or dysplastic gangliocytoma of the cerebellum, is a rare benign mass primarily located in the posterior fossa [ 1 , 2 ]. The pathological characteristics of LDD involve the displacement of the inner granular layer of the cerebellum by dysplastic ganglion cells of varying sizes, resulting in diffuse expansion [ 3 ]. Typically emerging in the third to fourth decades, LDD exhibits a broad age range without gender predominance. Symptoms vary in duration and may include cranial nerve palsies, gait instability, ataxia, and, in advanced stages, manifestations such as headaches, nausea, vomiting, and mental disorders [ 4 – 6 ]. LDD, typically sporadic, can also have a familial form linked to Phosphatase And Tensin Homolog (PTEN) gene variants. PTEN , a phosphatase, controls crucial cellular processes through the PI3K/PTEN/AKT pathway, impacting apoptosis, growth, migration, and differentiation. Inactivation of PTEN increases p-AKT levels and activates the mTOR pathway, promoting cell growth, proliferation, and survival. This pathway has a role in the pathogenesis of most LDD cases. [ 7 ]. Germline variants in the PTEN gene are responsible for developing Cowden syndrome, an autosomal-dominant disorder characterized by age-related penetrance. Cowden syndrome has multiple hamartomas, affecting tissues derived from all three germ layers [ 8 ]. SUFU , a tumor suppressor gene, negatively regulates the Hh signaling pathway [ 9 ]. Inactivation of SUFU unleashes control of GLI1 transcription factors, promoting tumorigenesis in various cancers [ 10 , 11 ]. Homozygous SUFU variants cause Joubert syndrome, while heterozygous variants pose risks of medulloblastoma in childhood, gonadal tumors in adolescence, and BCC, Gorlin syndrome, and meningiomas in adulthood [ 12 – 14 ]. In recent studies, SUFU is a crucial link between the Hh and WNT pathways, interacting with SPOP and PTEN in clear renal cell carcinoma pathogenesis. Additionally, SUFU aids in the nuclear export of β-CATENIN, contributing to the negative regulation of WNT signaling [ 15 ]. Polydactyly/syndactyly and brain overgrowth, common in Hh pathway mutations, suggest a link between the Hh pathway and the PTEN/AKT/mTOR pathway, which is associated with overgrowth. In Steven D Klein's study, loss of SUFU triggers LAMTOR3-mediated AKT and mTOR activation. At the same time, GLI passes into the nucleus and inhibits mTOR negative regulators. These regulations lead to mTOR-mediated activation of p4EBP1 and p70S6K. (Fig. 1 ) [ 16 ]. The aim of this article is to present a rare case with both LDD and a germline, de novo SUFU variant, and to discuss the relationship between them. 2 METHODS 2.1 Clinical Report The case presented here is a 10-year-old female patient who was incidentally found to have a mass in the posterior fossa. This well-circumscribed mass in the cerebellum was detected by cranial magnetic resonance imaging (MRI), done due to the persistence of headaches after head trauma (Figure 2). Although she had no active complaints during the examination, the patient was taken into surgery with the preliminary diagnosis of medulloblastoma. However, The operation material examined by pathology was evaluated as dysplastic gangliocytoma (Figure 3A). The patient was referred to the medical genetics department, and there were no remarkable dysmorphic features on examination. During the 5-year follow-up, mild scoliosis and mild falx cerebri calcification were detected. The patient recently applied for plastic surgery with the complaint of a palpable mass on the skin of the mandible and thoracic spine. The pathology result was compatible with an epidermoid cyst. His family is healthy and has no history of tumors. 2.2 Germline Analysis Genomic DNA was extracted from the proband's blood using the QIAamp DNA Mini QIA-cube Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. Sanger sequencing of the PTEN gene was performed, but no clinically relevant variant was detected. Therefore, a targeted next-generation sequencing panel (TruSight Cancer Sequencing Panel, Illumina, San Diego, CA), which contains 94 high-risk genes associated with both common and rare cancers, was performed according to the manufacturer's instructions. The sequence data were analyzed using VariantStudio variant analysis software (Illumina) and Integrative Genomics Viewer (Broad Institute, Cambridge, MA, USA). Variants were filtered on mapping quality, call quality, minimum depth of coverage of 30 ×, and minor allele frequency < 1%. The detection threshold for constitutional analysis was 20% of reads. The technical sensitivity was greater than 95%. Variants were assessed with in silico prediction programs (DANN, MutationTaster, BayesDel, GenoCanyon). Splice variants were interpreted using SpliceAI (v1.3) and SPIP (v1.0) software. Variants were annotated with the Genome Aggregation Database (gnomAD), Database of Short Genetic Variation (dbSNP), ClinVar, and Human Gene Mutation Database (HGMD). Variants were classified according to the recommendations of the American College of Medical Genetics (ACMG). A novel, heterozygous, pathogenic splice site variant c.183-2A>G (NM_016169.4) in SUFU was detected. Segregation analysis was performed with NGS, and the variant was not found in the patient' s parents (Figure ). Sanger DNA sequencing confirmed the heterozygous variant in the patient and showed that his parents and healthy sister did not have this variant. 2.3 mRNA Analysis Total RNA was extracted from blood using the hybrid-r blood RNA GeneAll® kit and then reverse-transcribed with the iScriptTM cDNA Synthesis kit (BIO-RAD, Waltham, MA, USA), following the manufacturer's instructions. We analyzed the novel SUFU c.183-2G>A (NM_016169.4) variant by amplifying the complementary DNA of the SUFU mRNA via RealTime-PCR using the TaqTM Universal SYBR® Green Supermix kit (BIO-RAD, Waltham, MA, USA) and a specific primer set within the exons flanking exon 2 (forward in exon 1, GCCTTCGCTTCGCTCTTTC; reverse in exon 4, CTGCATCTGTGGGTCCTCTG). The PCR cycle included an initial denaturation step at 95 °C for 30 s, followed by 40 cycles consisting of denaturation at 95 °C for 15 s and an annealing step at 60 °C for 1 min. The PCR product, loaded onto a 4% agarose gel, revealed a second band of lower height (385 bp) in the patient compared to the control sample (520 bp), corresponding to the excision of exon 2 (long 135 bp) (Figure 3C). Sequencing of the PCR product confirmed the heterozygous excision of the entire exon 2 (Figure 3D). 2.4 Tumour Analysis According to the manufacturer's recommendation, DNA from the microdissected formalin-fixated paraffin-embedded (FFPE) tumor tissue was extracted with a DNeasy Blood Tissue Kit (Qiagen). The sequencing library was prepared with the TWIST Exome 2.0 Panel (Twist Bioscience), and next-generation sequencing (NGS) was performed on the NextSeq 550 platform (Illumina, San Diego, CA, USA). All procedures were performed according to the manufacturer's instructions. The sequence data were analyzed using A Variant Analysis Platform for Rare Disease, Cancer and Preventive Genomics (genomize-SEQ). Variant calling was performed according to a minor allele frequency threshold of 1% (gnomAD database); the detection threshold was 10% of reads, with coverage of 200 ×. The observed frequency of the variant in the patient's tumor site and histology is determined using databases such as the Catalog of Somatic Mutations in Cancer (COSMIC)18 and The Cancer Genome Atlas (TCGA). Variants were classified according to the ACMG, the Association for Molecular Pathology (AMP), and the College of American Pathologists (CAP) recommendations. 3 DISCUSSION We present a rare case with LDD and germline SUFU variants and discuss their relationship. LDD can occur in isolation or with Cowden Syndrome, caused by loss-of-function (LOF) variants in the PTEN gene. [ 17 , 18 ]. LDD has not been associated with variants in any other gene before. Therefore, PTEN gene Sanger sequencing was initially performed on this patient's genomic DNA, but no clinically relevant variant was detected. A new germline variant in the SUFU gene was subsequently identified with the targeted next-generation sequencing panel studied. In the segregation analysis, this variant was not detected in her family, so the variant was considered de novo. A novel de novo variant c.183-2A > G (NM_016169.4) affects an acceptor splice site in intron 1 of the SUFU gene. The variant disrupts RNA splicing and results in the absence or degradation of the protein product [ 19 ]. In-silico predictions (DANN, MutationTaster, SpliceAl, BayesDel, GenoCanyon) were aggregated deleterious for the replacement. The variant had not previously been reported in the public databases (gnomAD, HGMD, dbSNP). According to the ACMG criteria, the variant is pathogenic (PVS1-PM2-PS2). SUFU is a potential novel gene in LDD. Variants in PTEN and S UFU were detected in the NGS analysis from FFPE tumor tissue. The PTEN variant c.389G > A (p.R130Q ) is enlisted in the Catalogue of Somatic Mutations in Cancer (COSMIC) database (COSV64288376), but The SUFU variant c.183-2A > G (NM_016169.4) is not included in the COSMIC database. A missense variant, p.Arg130Gln, is in exon 5 of PTEN and induces a conservative amino acid alteration within the Tyrosine-specific protein phosphatase domain (IPR000387) of the encoded protein sequence. This genetic alteration, demonstrated by published functional studies, manifests a detrimental impact, notably marked by a reduction in phosphatase activity and an elevation in pAKT levels [ 20 , 21 ]. This variant is not found at a significant frequency in large population cohorts (gnomAD). This variant is in silico analysis, which is consistent with the idea that this missense variant exerts a deleterious effect on protein structure and function. Several clinical laboratories at ClinVar and an expert panel at ClinGen have classified it as pathogenic. [ 21 , 22 ]. This variant is also interpreted as pathogenic according to the COSMIC database and considered oncogenic when mutated on the somatic level in PTEN syndrome-associated tumor forms. These forms include PTEN hamartoma tumor syndrome, breast cancer, endometrial cancer, prostate cancer, and gliomas [ 23 ]. The variant is also oncogenic for all solid tumors in the MSK's Precision Oncology Knowledge Base (OncoKB). LDD is a rare benign tumor affecting the granular cell layer of the cerebellar parenchyma. It is primarily diagnosed in the middle age group. The onset of the symptoms may take up to 10 years. The symptoms of LDD are nonspecific and are caused by intracranial space-occupying formation. Our 10-year-old patient had no symptoms; incidentally, a mass was detected in the cerebellum. The patient was operated on with a preliminary diagnosis of medulloblastoma due to the location of the mass, age of the patient, and radiological images. The patient, who was evaluated as having dysplastic gangliocytoma in her pathology, has been followed for five years without progression. Homozygous SUFU variants cause Joubert syndrome, while heterozygous variants pose risks of medulloblastoma in childhood, gonadal tumors in adolescence, and BCC, Gorlin syndrome, and meningiomas in adulthood [ 12 – 14 ]. A similar variant at the same position and splice site of the SUFU gene [c.183-2A > C (NM_016169.4)] has been previously reported in a case with Gorlin syndrome and medulloblastoma in ClinVar (RCV001990795.2) [ 12 , 19 ]. Our patient had no history of medulloblastoma. However, during the 5-year follow-up of the patient, mild scoliosis, mild falx cerebri calcification, and two epidermoid cysts were detected as features of Gorlin syndrome. We informed the patient and referred her to a surveillance program as recommended by clinical guidelines. Gliomas and meningiomas from CNS tumors have been associated with the deletion of the q arm of chromosome 10. LOF variants in the PTEN located at 10q23 are observed in gliomas, while LOF variants in the SUFU located at 10q24 are detected in meningiomas [ 8 ]. Our patient has germline SUFU and somatic PTEN pathogenic variants. Somatic PTEN pathogenic variants were identified in sporadic LDD patients during adulthood. However, these studies did not observe somatic PTEN pathogenic variants in young individuals and children with LDD. This situation suggests a potential age-related pattern. [ 8 ]. In the study by Ty W. Abel et al., immunohistochemical results indicate that the PTEN/AKT/mTOR pathway is involved in the pathogenesis of most LDD cases. Most lesions were negative for PTEN, suggesting that the inhibitory effect of this protein on the pathway was lost. Consistent with this interpretation, nearly all tumors showed immunoreactivity to p-AKT in abnormal ganglion cells, while one of the patients studied, a 13-year-old male, was positive for PTEN negative for p-AKT. This result suggests that other pathways play a role, especially in young patients.[ 7 ]. In Xiao-Ping Zhou's study, the PTEN/AKT/mTOR pathway was responsible for the pathogenesis in most cases. However, in three cases aged 1, 3, and 11 years, there was no PTEN -related variant, and the tissues were PTEN positive, although p-AKT was also positive [ 24 ]. In studies, while the PTEN/AKT/mTOR pathway was active in the pathogenesis of adult LDD patients, p-AKT was positive in child and adolescent cases even when there was no LOF variant in PTEN . This result suggests that dysfunction in genes other than PTEN causes p-AKT positivity in early LDD cases during childhood and adolescence. Additionally, the intricate genomic architecture of these tumors contributes to a significant diversity, thereby predisposing individuals harboring multiple genetic variants to an earlier onset of LDD manifestation. Although SUFU is primarily a negative regulator of the Hh pathway, it has also been shown to play a role in the PI3K/AKT/mTOR pathway in macrocephaly-associated conditions [ 16 ]. It also regulated the ß-catenin pathway via PTEN in the pathogenesis of ccRCC [ 15 ]. This result suggests that there is a connection between PTEN and SUFU. In conclusion, we present a 10-year-old case with LDD and the germline pathogenic SUFU variant and It shows that LOF of SUFU is associated with the pathogenesis of LDD. The emergence of NGS technology and the widespread use of multi-gene testing in clinical practice has accelerated the detection of hereditary cancer syndromes and reduced costs [ 25 ]. Detection of variants that cause cancer is critical in the clinical management of the patient, both in determining the cancer risk and, if necessary, in reducing the risk of cancer that may develop in the patient. They may include screening programs or conservative surgeries. In addition, detecting these variants is necessary for family screening, risk assessment, and family planning. 4 CONCLUSIONS Although germline and pathogenic variants in the SUFU gene are associated with various cancers in the central nervous system, their association with LDD has not yet been demonstrated. The patient is the first case in the literature to show an association between LDD and a germline, novel de novo SUFU variant. Declarations AUTHOR CONTRIBUTIONS Conception and design: Özge Güngör, Aslı Ece Solmaz Development of methodology: Özge Güngör, Aslı Ece Solmaz Data collection (including animal provisioning, patient management, facility arrangement, etc.): Özge Güngör, Aslı Ece Solmaz, Haluk Akın, Taner Akalın Writing, review, and/or revision of the manuscript: Özge Güngör, Aslı Ece Solmaz Administrative, technical, or material support: Özge Güngör, Aslı Ece Solmaz, Taner Akalın Study supervision: Aslı Ece Solmaz, Taner Akalın, Emin Karaca, Haluk Akın ACKNOWLEDGMENTS The authors express their gratitude to the patient for granting consent for publication. CONFLICT OF INTEREST STATEMENT The authors assert that they do not possess any conflicting interests. ETHICS STATEMENT The patient has given their written informed consent for genetic research and publication. FUNDING DECLARATİON There was no Funding DATA AVAILABILITY All data are available upon request. References Huang S, Zhang G, Zhang J. Similar MR imaging characteristics but different pathological changes: a misdiagnosis for Lhermitte-Duclos disease and review of the literature. Int J Clin Exp Pathol . 2015;8(6):7583-7587. Published 2015 Jun 1. Thomas B, Krishnamoorthy T, Radhakrishnan VV, Kesavadas C. Advanced MR imaging in Lhermitte-Duclos disease: moving closer to pathology and pathophysiology. Neuroradiology . 2007;49(9):733-738. doi:10.1007/s00234-007-0241-1 Nowak DA, Trost HA. Lhermitte-Duclos disease (dysplastic cerebellar gangliocytoma): a malformation, hamartoma or neoplasm?. Acta Neurol Scand . 2002;105(3):137-145. doi:10.1034/j.1600-0404.2002.1r127.x Nowak DA, Trost HA, Porr A, Stölzle A, Lumenta CB. Lhermitte-Duclos disease (Dysplastic gangliocytoma of the cerebellum). Clin Neurol Neurosurg . 2001;103(2):105-110. doi:10.1016/s0303-8467(01)00124-x Cheng CS, Ou CH, Chen JS, Lui CC, Yeh LR. Lhermitte-Duclos disease: A case report with radiologic-pathologic correlation. Radiol Case Rep . 2019;14(6):734-739. Published 2019 Apr 3. doi:10.1016/j.radcr.2019.03.020 Ambler M, Pogacar S, Sidman R. Lhermitte-Duclos disease (granule cell hypertrophy of the cerebellum) pathological analysis of the first familial cases. J Neuropathol Exp Neurol . 1969;28(4):622-647. doi:10.1097/00005072-196910000-00005 Abel TW, Baker SJ, Fraser MM, et al. Lhermitte-Duclos disease: a report of 31 cases with immunohistochemical analysis of the PTEN/AKT/mTOR pathway. J Neuropathol Exp Neurol . 2005;64(4):341-349. doi:10.1093/jnen/64.4.341 Aavikko M, Li SP, Saarinen S, et al. Loss of SUFU function in familial multiple meningioma. Am J Hum Genet . 2012;91(3):520-526. doi:10.1016/j.ajhg.2012.07.015 Serpieri V, D'Abrusco F, Dempsey JC, et al. SUFU haploinsufficiency causes a recognisable neurodevelopmental phenotype at the mild end of the Joubert syndrome spectrum. J Med Genet . 2022;59(9):888-894. doi:10.1136/jmedgenet-2021-108114 Varjosalo M, Taipale J. Hedgehog: functions and mechanisms. Genes Dev . 2008;22(18):2454-2472. doi:10.1101/gad.1693608 Doheny D, Manore SG, Wong GL, Lo HW. Hedgehog Signaling and Truncated GLI1 in Cancer. Cells . 2020;9(9):2114. Published 2020 Sep 17. doi:10.3390/cells9092114 Skoda AM, Simovic D, Karin V, Kardum V, Vranic S, Serman L. The role of the Hedgehog signaling pathway in cancer: A comprehensive review. Bosn J Basic Med Sci . 2018;18(1):8-20. Published 2018 Feb 20. doi:10.17305/bjbms.2018.2756 Brugières L, Remenieras A, Pierron G, et al. High frequency of germline SUFU mutations in children with desmoplastic/nodular medulloblastoma younger than 3 years of age. J Clin Oncol . 2012;30(17):2087-2093. doi:10.1200/JCO.2011.38.7258 Guerrini-Rousseau L, Masliah-Planchon J, Waszak SM, et al. Cancer risk and tumour spectrum in 172 patients with a germline SUFU pathogenic variation: a collaborative study of the SIOPE Host Genome Working Group. J Med Genet . Published online June 29, 2022. doi:10.1136/jmedgenet-2021-108385 Han B, Sun Z, Yu T, et al. SPOP-PTEN-SUFU axis promotes progression of clear cell renal cell carcinoma via activating SHH and WNT pathway. Cell Death Discov . 2021;7(1):120. Published 2021 May 21. doi:10.1038/s41420-021-00484-2 Klein SD, Nguyen DC, Bhakta V, et al. Mutations in the sonic hedgehog pathway cause macrocephaly-associated conditions due to crosstalk to the PI3K/AKT/mTOR pathway. Am J Med Genet A . 2019;179(12):2517-2531. doi:10.1002/ajmg.a.61368 Jornayvaz FR, Philippe J. Mucocutaneous papillomatous papules in Cowden's syndrome. Clin Exp Dermatol . 2008;33(2):151-153. doi:10.1111/j.1365-2230.2007.02602.x McMahon ME, Murray D, MacNally S, O'Brien DF. Lhermitte-Duclos disease (dysplastic cerebellar gangliocytoma) in the setting of cowden syndrome: a case report and literature review on COLD syndrome. Br J Neurosurg . Published online August 1, 2022. doi:10.1080/02688697.2022.2106354 Smith MJ, Beetz C, Williams SG, et al. Germline mutations in SUFU cause Gorlin syndrome-associated childhood medulloblastoma and redefine the risk associated with PTCH1 mutations. J Clin Oncol . 2014;32(36):4155-4161. doi:10.1200/JCO.2014.58.2569 Mighell TL, Evans-Dutson S, O'Roak BJ. A Saturation Mutagenesis Approach to Understanding PTEN Lipid Phosphatase Activity and Genotype-Phenotype Relationships. Am J Hum Genet . 2018;102(5):943-955. doi:10.1016/j.ajhg.2018.03.018 Andrés-Pons A, Rodríguez-Escudero I, Gil A, et al. In vivo functional analysis of the counterbalance of hyperactive phosphatidylinositol 3-kinase p110 catalytic oncoproteins by the tumor suppressor PTEN. Cancer Res . 2007;67(20):9731-9739. doi:10.1158/0008-5472.CAN-07-1278 Han SY, Kato H, Kato S, et al. Functional evaluation of PTEN missense mutations using in vitro phosphoinositide phosphatase assay. Cancer Res . 2000;60(12):3147-3151. Tate JG, Bamford S, Jubb HC, et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res . 2019;47(D1):D941-D947. doi:10.1093/nar/gky1015 Zhou XP, Marsh DJ, Morrison CD, et al. Germline inactivation of PTEN and dysregulation of the phosphoinositol-3-kinase/Akt pathway cause human Lhermitte-Duclos disease in adults. Am J Hum Genet . 2003;73(5):1191-1198. doi:10.1086/379382 Behjati S, Tarpey PS. What is next generation sequencing?. Arch Dis Child Educ Pract Ed . 2013;98(6):236-238. doi:10.1136/archdischild-2013-304340 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4271310","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":292127143,"identity":"6bb9815d-ac96-4047-86c8-e689f887c67f","order_by":0,"name":"Özge Güngör","email":"","orcid":"","institution":"EGE University School of Medicine Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Özge","middleName":"","lastName":"Güngör","suffix":""},{"id":292127144,"identity":"72285a89-e1cf-4cc9-a4fd-1bc769725816","order_by":1,"name":"Aslı Ece Solmaz","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFUlEQVRIie2RP0vDQBiH3xCIy9lbD4TkK1zoKLRf5ULBLMlaHEqNS6bQrHH2C/gRLr7QKTTrjYrgnElcLN5ViYNpxE3wnuk33HPvPwCL5U/iZvIzOSb4H9kbU5xeAROmvUJGlD4aJcp+UmhZX0u4nPlAUd6r1Tou6a2EbokwP5ODClORbqxZTIFdCEy2XnpTPQun2iGQiRguo/QsTi6jjBGOiUfSO9Vw9zTXypHOgrbWyl5eZbTRyp7Fc9V27tuIwvX/UhfSPSQc05wLTgtwnRElNLOI7SLMzSzpRoSV8nhd7GJCmmHFbxG7bjULKMX6KXlZB7TEx4fX5bl/UgwrB8xmvs7NxOFAxy/5HSp/8dhisVj+A+8+uWEbQucGEAAAAABJRU5ErkJggg==","orcid":"","institution":"EGE University School of Medicine Medical Genetics","correspondingAuthor":true,"prefix":"","firstName":"Aslı","middleName":"Ece","lastName":"Solmaz","suffix":""},{"id":292127145,"identity":"35c5beb7-2fa8-493b-942d-0fcc91137c73","order_by":2,"name":"Emin Karaca","email":"","orcid":"","institution":"EGE University School of Medicine Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Emin","middleName":"","lastName":"Karaca","suffix":""},{"id":292127146,"identity":"e51417a8-dbba-49f0-91e0-2ee7f44d9163","order_by":3,"name":"Taner Akalın","email":"","orcid":"","institution":"EGE University School of Medicine Medical pathology","correspondingAuthor":false,"prefix":"","firstName":"Taner","middleName":"","lastName":"Akalın","suffix":""},{"id":292127147,"identity":"ef9384b8-92bd-4049-9f44-0bc184f548fb","order_by":4,"name":"Elif Bolat","email":"","orcid":"","institution":"EGE University","correspondingAuthor":false,"prefix":"","firstName":"Elif","middleName":"","lastName":"Bolat","suffix":""},{"id":292127148,"identity":"a1c56378-99a8-4303-ad71-94cfb8f82fe9","order_by":5,"name":"Haluk Akın","email":"","orcid":"","institution":"EGE University School of Medicine Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Haluk","middleName":"","lastName":"Akın","suffix":""}],"badges":[],"createdAt":"2024-04-15 18:16:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4271310/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4271310/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55249926,"identity":"3ed17f75-fa4c-40b7-a135-f2f8bb5bc4e1","added_by":"auto","created_at":"2024-04-24 17:31:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":453039,"visible":true,"origin":"","legend":"\u003cp\u003eThe model on the left of Figure 1 shows that SPOP downregulates SUFU via PTEN. The SPOP-PTEN axis promotes tumor progression by modulating SUFU repressor activity in the SHH and WNT pathways.\u003c/p\u003e\n\u003cp\u003eOn the right of Figure 1, loss of SUFU leads to LAMTOR3-mediated AKT and mTOR activation. It also reduces inhibition of GLI translocation and inhibits all negative regulators of mTOR once GLI translocates to the nucleus. This translocation phosphorylates p4EBP1 and mTOR and activates them. In addition, phosphorylation of pAKT473 and pAKT308 increases with AKT activation.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4271310/v1/0f167fdfa5df1909c7baf860.png"},{"id":55249927,"identity":"2a294ae0-1f2b-4c1b-853d-987f315b2013","added_by":"auto","created_at":"2024-04-24 17:31:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1348136,"visible":true,"origin":"","legend":"\u003cp\u003eCranial MRI examination A. Axial T2-weighted, precontrast B. Axial T1-weighted, precontrast C. Axial T1-weighted, postcontrast D. Coronal T1-weighted, postcontrast. E.-F. Diffussion MR images. These images revealed a well-defined solid mass with moderate contrast enhancement within the cerebellum. Based on the imaging findings, the initial diagnostic evaluation was primarily medulloblastoma.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4271310/v1/ddc186b769519b894592413c.png"},{"id":55249928,"identity":"5599d02f-479f-46c9-bc1e-03942e7ebb25","added_by":"auto","created_at":"2024-04-24 17:31:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":737574,"visible":true,"origin":"","legend":"\u003cp\u003eA. Gangliocytoma: Ganglion cell population clustered on the neuropil (HEX 100). B. Sequencing analysis results at IGV software of the c.183-2G\u0026gt;A (NM_016169.4) variant identified in the proband (heterozygous) and his family (no variant). C. Agarose (4%) gel. The amplification of the proband's cDNA with primers forward exon 1 and reverse exon 4 revealed two bands (sample P: 520 bp and 385 bp), unlike the control (sample C: 520 bp). D. The sequencing of the amplification products from the patient compared with the control (up) revealed the excision of the entire exon 2 (135 bp) from the SUFU-cDNA (down). P, patient; C, control; MK, marker (100bp DNA Ladder GeneDirex Hercules, CA, USA)\u003c/p\u003e","description":"","filename":"Figure33.png","url":"https://assets-eu.researchsquare.com/files/rs-4271310/v1/aa3f788008a1861d1056c8d6.png"},{"id":56569587,"identity":"a2332c88-e148-4033-aa51-5cb8532c9d0a","added_by":"auto","created_at":"2024-05-16 02:19:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3242719,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4271310/v1/a12bc597-1bd4-4fd6-b74d-ba44d09a6d41.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"SUFU: A potential novel gene responsible for Lhermitte Duclos disease","fulltext":[{"header":"1 INTRODUCTION","content":"\u003cp\u003eLDD, or dysplastic gangliocytoma of the cerebellum, is a rare benign mass primarily located in the posterior fossa [\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e]. The pathological characteristics of LDD involve the displacement of the inner granular layer of the cerebellum by dysplastic ganglion cells of varying sizes, resulting in diffuse expansion [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]. Typically emerging in the third to fourth decades, LDD exhibits a broad age range without gender predominance. Symptoms vary in duration and may include cranial nerve palsies, gait instability, ataxia, and, in advanced stages, manifestations such as headaches, nausea, vomiting, and mental disorders [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eLDD, typically sporadic, can also have a familial form linked to Phosphatase And Tensin Homolog (PTEN) gene variants. \u003cem\u003ePTEN\u003c/em\u003e, a phosphatase, controls crucial cellular processes through the PI3K/PTEN/AKT pathway, impacting apoptosis, growth, migration, and differentiation. Inactivation of PTEN increases p-AKT levels and activates the mTOR pathway, promoting cell growth, proliferation, and survival. This pathway has a role in the pathogenesis of most LDD cases. [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e]. Germline variants in the \u003cem\u003ePTEN\u003c/em\u003e gene are responsible for developing Cowden syndrome, an autosomal-dominant disorder characterized by age-related penetrance. Cowden syndrome has multiple hamartomas, affecting tissues derived from all three germ layers [\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSUFU\u003c/em\u003e, a tumor suppressor gene, negatively regulates the Hh signaling pathway [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. Inactivation of SUFU unleashes control of GLI1 transcription factors, promoting tumorigenesis in various cancers [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e]. Homozygous \u003cem\u003eSUFU\u003c/em\u003e variants cause Joubert syndrome, while heterozygous variants pose risks of medulloblastoma in childhood, gonadal tumors in adolescence, and BCC, Gorlin syndrome, and meningiomas in adulthood [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. In recent studies, SUFU is a crucial link between the Hh and WNT pathways, interacting with SPOP and PTEN in clear renal cell carcinoma pathogenesis. Additionally, SUFU aids in the nuclear export of \u0026beta;-CATENIN, contributing to the negative regulation of WNT signaling [\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e]. Polydactyly/syndactyly and brain overgrowth, common in Hh pathway mutations, suggest a link between the Hh pathway and the PTEN/AKT/mTOR pathway, which is associated with overgrowth. In Steven D Klein\u0026apos;s study, loss of SUFU triggers LAMTOR3-mediated AKT and mTOR activation. At the same time, GLI passes into the nucleus and inhibits mTOR negative regulators. These regulations lead to mTOR-mediated activation of p4EBP1 and p70S6K. (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe aim of this article is to present a rare case with both LDD and a germline, \u003cem\u003ede novo SUFU\u003c/em\u003e variant, and to discuss the relationship between them.\u003c/p\u003e"},{"header":"2 METHODS","content":"\u003cp\u003e\u003cstrong\u003e2.1 Clinical Report\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe case presented here is a 10-year-old female patient who was incidentally found to have a mass in the posterior fossa. This well-circumscribed mass in the cerebellum was detected by cranial magnetic resonance imaging (MRI), done due to the persistence of headaches after head trauma (Figure 2). Although she had no active complaints during the examination, the patient was taken into surgery with the preliminary diagnosis of medulloblastoma. However, The operation material examined by pathology was evaluated as dysplastic gangliocytoma (Figure 3A). The patient was referred to the medical genetics department, and there were no remarkable dysmorphic features on examination. During the 5-year follow-up, mild scoliosis and mild falx cerebri calcification were detected. The patient recently applied for plastic surgery with the complaint of a palpable mass on the skin of the mandible and thoracic spine. The pathology result was compatible with an epidermoid cyst. His family is healthy and has no history of tumors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Germline Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenomic DNA was extracted from the proband\u0026apos;s blood using the QIAamp DNA Mini QIA-cube Kit (Qiagen, Hilden, Germany), following the manufacturer\u0026apos;s instructions. Sanger sequencing of the \u003cem\u003ePTEN\u003c/em\u003e gene was performed, but no clinically relevant variant was detected. Therefore, a targeted next-generation sequencing panel (TruSight Cancer Sequencing Panel, Illumina, San Diego, CA), which contains 94 high-risk genes associated with both common and rare cancers, was performed according to the manufacturer\u0026apos;s instructions. The sequence data were analyzed using VariantStudio variant analysis software (Illumina) and Integrative Genomics Viewer (Broad Institute, Cambridge, MA, USA). Variants were filtered on mapping quality, call quality, minimum depth of coverage of 30\u0026thinsp;\u0026times;, and minor allele frequency\u0026thinsp;\u0026lt;\u0026thinsp;1%. The detection threshold for constitutional analysis was 20% of reads. The technical sensitivity was greater than 95%.\u003c/p\u003e\n\u003cp\u003eVariants were assessed with in silico prediction programs (DANN, MutationTaster, BayesDel, GenoCanyon). Splice variants were interpreted using SpliceAI (v1.3) and SPIP (v1.0) software. Variants were annotated with the Genome Aggregation Database (gnomAD), Database of Short Genetic Variation (dbSNP), ClinVar, and Human Gene Mutation Database (HGMD). Variants were classified according to the recommendations of the American College of Medical Genetics (ACMG).\u003c/p\u003e\n\u003cp\u003eA novel, heterozygous, pathogenic splice site variant c.183-2A\u0026gt;G (NM_016169.4) in \u003cem\u003eSUFU\u0026nbsp;\u003c/em\u003ewas detected. Segregation analysis was performed with NGS, and the variant was not found in the patient\u0026apos; s parents (Figure ). Sanger DNA sequencing confirmed the heterozygous variant in the patient and showed that his parents and healthy sister did not have this variant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 mRNA Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from blood using the hybrid-r blood RNA GeneAll\u0026reg; kit and then reverse-transcribed with the iScriptTM cDNA Synthesis kit (BIO-RAD, Waltham, MA, USA), following the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003cp\u003eWe analyzed the novel \u003cem\u003eSUFU\u003c/em\u003e c.183-2G\u0026gt;A (NM_016169.4) variant by amplifying the complementary DNA of the SUFU mRNA via RealTime-PCR using the TaqTM Universal SYBR\u0026reg; Green Supermix kit (BIO-RAD, Waltham, MA, USA) and a specific primer set within the exons flanking exon 2 (forward in exon 1, GCCTTCGCTTCGCTCTTTC; reverse in exon 4, CTGCATCTGTGGGTCCTCTG). The PCR cycle included an initial denaturation step at 95 \u0026deg;C for 30 s, followed by 40 cycles consisting of denaturation at 95 \u0026deg;C for 15 s and an annealing step at 60 \u0026deg;C for 1 min. The PCR product, loaded onto a 4% agarose gel, revealed a second band of lower height (385 bp) in the patient compared to the control sample (520 bp), corresponding to the excision of exon 2 (long 135 bp) (Figure 3C). Sequencing of the PCR product confirmed the heterozygous excision of the entire exon 2 (Figure 3D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Tumour Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer\u0026apos;s recommendation, DNA from the microdissected formalin-fixated paraffin-embedded (FFPE) tumor tissue was extracted with a DNeasy Blood Tissue Kit (Qiagen). The sequencing library was prepared with the TWIST Exome 2.0 Panel (Twist Bioscience), and next-generation sequencing (NGS) was performed on the NextSeq 550 platform (Illumina, San Diego, CA, USA). All procedures were performed according to the manufacturer\u0026apos;s instructions. The sequence data were analyzed using A Variant Analysis Platform for Rare Disease, Cancer and Preventive Genomics (genomize-SEQ). Variant calling was performed according to a minor allele frequency threshold of 1% (gnomAD database); the detection threshold was 10% of reads, with coverage of 200\u0026thinsp;\u0026times;. The observed frequency of the variant in the patient\u0026apos;s tumor site and histology is determined using databases such as the Catalog of Somatic Mutations in Cancer (COSMIC)18 and The Cancer Genome Atlas (TCGA). Variants were classified according to the ACMG, the Association for Molecular Pathology (AMP), and the College of American Pathologists (CAP) recommendations.\u003c/p\u003e"},{"header":"3 DISCUSSION","content":"\u003cp\u003eWe present a rare case with LDD and germline \u003cem\u003eSUFU\u003c/em\u003e variants and discuss their relationship. LDD can occur in isolation or with Cowden Syndrome, caused by loss-of-function (LOF) variants in the \u003cem\u003ePTEN\u003c/em\u003e gene. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. LDD has not been associated with variants in any other gene before. Therefore, \u003cem\u003ePTEN\u003c/em\u003e gene Sanger sequencing was initially performed on this patient's genomic DNA, but no clinically relevant variant was detected. A new germline variant in the \u003cem\u003eSUFU\u003c/em\u003e gene was subsequently identified with the targeted next-generation sequencing panel studied. In the segregation analysis, this variant was not detected in her family, so the variant was considered de novo. A novel de novo variant c.183-2A\u0026thinsp;\u0026gt;\u0026thinsp;G (NM_016169.4) affects an acceptor splice site in intron 1 of the \u003cem\u003eSUFU\u003c/em\u003e gene. The variant disrupts RNA splicing and results in the absence or degradation of the protein product [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In-silico predictions (DANN, MutationTaster, SpliceAl, BayesDel, GenoCanyon) were aggregated deleterious for the replacement. The variant had not previously been reported in the public databases (gnomAD, HGMD, dbSNP). According to the ACMG criteria, the variant is pathogenic (PVS1-PM2-PS2). \u003cem\u003eSUFU\u003c/em\u003e is a potential novel gene in LDD.\u003c/p\u003e \u003cp\u003eVariants in \u003cem\u003ePTEN\u003c/em\u003e and S\u003cem\u003eUFU\u003c/em\u003e were detected in the NGS analysis from FFPE tumor tissue. The \u003cem\u003ePTEN\u003c/em\u003e variant c.389G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.R130Q ) is enlisted in the Catalogue of Somatic Mutations in Cancer (COSMIC) database (COSV64288376), but The \u003cem\u003eSUFU\u003c/em\u003e variant c.183-2A\u0026thinsp;\u0026gt;\u0026thinsp;G (NM_016169.4) is not included in the COSMIC database. A missense variant, p.Arg130Gln, is in exon 5 of \u003cem\u003ePTEN\u003c/em\u003e and induces a conservative amino acid alteration within the Tyrosine-specific protein phosphatase domain (IPR000387) of the encoded protein sequence. This genetic alteration, demonstrated by published functional studies, manifests a detrimental impact, notably marked by a reduction in phosphatase activity and an elevation in pAKT levels [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. This variant is not found at a significant frequency in large population cohorts (gnomAD). This variant is in silico analysis, which is consistent with the idea that this missense variant exerts a deleterious effect on protein structure and function. Several clinical laboratories at ClinVar and an expert panel at ClinGen have classified it as pathogenic. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. This variant is also interpreted as pathogenic according to the COSMIC database and considered oncogenic when mutated on the somatic level in PTEN syndrome-associated tumor forms. These forms include PTEN hamartoma tumor syndrome, breast cancer, endometrial cancer, prostate cancer, and gliomas [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The variant is also oncogenic for all solid tumors in the MSK's Precision Oncology Knowledge Base (OncoKB).\u003c/p\u003e \u003cp\u003eLDD is a rare benign tumor affecting the granular cell layer of the cerebellar parenchyma. It is primarily diagnosed in the middle age group. The onset of the symptoms may take up to 10 years. The symptoms of LDD are nonspecific and are caused by intracranial space-occupying formation. Our 10-year-old patient had no symptoms; incidentally, a mass was detected in the cerebellum. The patient was operated on with a preliminary diagnosis of medulloblastoma due to the location of the mass, age of the patient, and radiological images. The patient, who was evaluated as having dysplastic gangliocytoma in her pathology, has been followed for five years without progression.\u003c/p\u003e \u003cp\u003eHomozygous \u003cem\u003eSUFU\u003c/em\u003e variants cause Joubert syndrome, while heterozygous variants pose risks of medulloblastoma in childhood, gonadal tumors in adolescence, and BCC, Gorlin syndrome, and meningiomas in adulthood [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. A similar variant at the same position and splice site of the \u003cem\u003eSUFU\u003c/em\u003e gene [c.183-2A\u0026thinsp;\u0026gt;\u0026thinsp;C (NM_016169.4)] has been previously reported in a case with Gorlin syndrome and medulloblastoma in ClinVar (RCV001990795.2) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Our patient had no history of medulloblastoma. However, during the 5-year follow-up of the patient, mild scoliosis, mild falx cerebri calcification, and two epidermoid cysts were detected as features of Gorlin syndrome. We informed the patient and referred her to a surveillance program as recommended by clinical guidelines.\u003c/p\u003e \u003cp\u003eGliomas and meningiomas from CNS tumors have been associated with the deletion of the q arm of chromosome 10. LOF variants in the \u003cem\u003ePTEN\u003c/em\u003e located at 10q23 are observed in gliomas, while LOF variants in the \u003cem\u003eSUFU\u003c/em\u003e located at 10q24 are detected in meningiomas [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Our patient has germline \u003cem\u003eSUFU\u003c/em\u003e and somatic \u003cem\u003ePTEN\u003c/em\u003e pathogenic variants. Somatic \u003cem\u003ePTEN\u003c/em\u003e pathogenic variants were identified in sporadic LDD patients during adulthood. However, these studies did not observe somatic \u003cem\u003ePTEN\u003c/em\u003e pathogenic variants in young individuals and children with LDD. This situation suggests a potential age-related pattern. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the study by Ty W. Abel et al., immunohistochemical results indicate that the PTEN/AKT/mTOR pathway is involved in the pathogenesis of most LDD cases. Most lesions were negative for PTEN, suggesting that the inhibitory effect of this protein on the pathway was lost. Consistent with this interpretation, nearly all tumors showed immunoreactivity to p-AKT in abnormal ganglion cells, while one of the patients studied, a 13-year-old male, was positive for PTEN negative for p-AKT. This result suggests that other pathways play a role, especially in young patients.[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In Xiao-Ping Zhou's study, the PTEN/AKT/mTOR pathway was responsible for the pathogenesis in most cases. However, in three cases aged 1, 3, and 11 years, there was no \u003cem\u003ePTEN\u003c/em\u003e-related variant, and the tissues were PTEN positive, although p-AKT was also positive [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In studies, while the PTEN/AKT/mTOR pathway was active in the pathogenesis of adult LDD patients, p-AKT was positive in child and adolescent cases even when there was no LOF variant in \u003cem\u003ePTEN\u003c/em\u003e. This result suggests that dysfunction in genes other than PTEN causes p-AKT positivity in early LDD cases during childhood and adolescence. Additionally, the intricate genomic architecture of these tumors contributes to a significant diversity, thereby predisposing individuals harboring multiple genetic variants to an earlier onset of LDD manifestation.\u003c/p\u003e \u003cp\u003eAlthough SUFU is primarily a negative regulator of the Hh pathway, it has also been shown to play a role in the PI3K/AKT/mTOR pathway in macrocephaly-associated conditions [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It also regulated the \u0026szlig;-catenin pathway via PTEN in the pathogenesis of ccRCC [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This result suggests that there is a connection between PTEN and SUFU. In conclusion, we present a 10-year-old case with LDD and the germline pathogenic \u003cem\u003eSUFU\u003c/em\u003e variant and It shows that LOF of SUFU is associated with the pathogenesis of LDD.\u003c/p\u003e \u003cp\u003eThe emergence of NGS technology and the widespread use of multi-gene testing in clinical practice has accelerated the detection of hereditary cancer syndromes and reduced costs [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Detection of variants that cause cancer is critical in the clinical management of the patient, both in determining the cancer risk and, if necessary, in reducing the risk of cancer that may develop in the patient. They may include screening programs or conservative surgeries. In addition, detecting these variants is necessary for family screening, risk assessment, and family planning.\u003c/p\u003e"},{"header":"4 CONCLUSIONS","content":"\u003cp\u003eAlthough germline and pathogenic variants in the \u003cem\u003eSUFU\u003c/em\u003e gene are associated with various cancers in the central nervous system, their association with LDD has not yet been demonstrated. The patient is the first case in the literature to show an association between LDD and a germline, novel de novo \u003cem\u003eSUFU\u003c/em\u003e variant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConception and design: \u0026Ouml;zge G\u0026uuml;ng\u0026ouml;r, Aslı Ece Solmaz\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDevelopment of methodology: \u0026Ouml;zge G\u0026uuml;ng\u0026ouml;r, Aslı Ece Solmaz Data collection (including animal provisioning, patient management, facility arrangement, etc.): \u0026Ouml;zge G\u0026uuml;ng\u0026ouml;r, Aslı Ece Solmaz, Haluk Akın, Taner Akalın\u003c/p\u003e\n\u003cp\u003eWriting, review, and/or revision of the manuscript: \u0026Ouml;zge G\u0026uuml;ng\u0026ouml;r, Aslı Ece Solmaz\u003c/p\u003e\n\u003cp\u003eAdministrative, technical, or material support: \u0026Ouml;zge G\u0026uuml;ng\u0026ouml;r, Aslı Ece Solmaz, Taner Akalın\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStudy supervision: Aslı Ece Solmaz, Taner Akalın, Emin Karaca, Haluk Akın\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors express their gratitude to the patient for granting consent for publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST STATEMENT\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors assert that they do not possess any conflicting interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS STATEMENT\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe patient has given their written informed consent for genetic research and publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING DECLARATİON\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThere was no Funding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are available upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eHuang S, Zhang G, Zhang J. Similar MR imaging characteristics but different pathological changes: a misdiagnosis for Lhermitte-Duclos disease and review of the literature. \u003cem\u003eInt J Clin Exp Pathol\u003c/em\u003e. 2015;8(6):7583-7587. Published 2015 Jun 1.\u003c/li\u003e\n \u003cli\u003eThomas B, Krishnamoorthy T, Radhakrishnan VV, Kesavadas C. Advanced MR imaging in Lhermitte-Duclos disease: moving closer to pathology and pathophysiology. \u003cem\u003eNeuroradiology\u003c/em\u003e. 2007;49(9):733-738. doi:10.1007/s00234-007-0241-1\u003c/li\u003e\n \u003cli\u003eNowak DA, Trost HA. Lhermitte-Duclos disease (dysplastic cerebellar gangliocytoma): a malformation, hamartoma or neoplasm?. \u003cem\u003eActa Neurol Scand\u003c/em\u003e. 2002;105(3):137-145. doi:10.1034/j.1600-0404.2002.1r127.x\u003c/li\u003e\n \u003cli\u003eNowak DA, Trost HA, Porr A, St\u0026ouml;lzle A, Lumenta CB. Lhermitte-Duclos disease (Dysplastic gangliocytoma of the cerebellum). \u003cem\u003eClin Neurol Neurosurg\u003c/em\u003e. 2001;103(2):105-110. doi:10.1016/s0303-8467(01)00124-x\u003c/li\u003e\n \u003cli\u003eCheng CS, Ou CH, Chen JS, Lui CC, Yeh LR. Lhermitte-Duclos disease: A case report with radiologic-pathologic correlation. \u003cem\u003eRadiol Case Rep\u003c/em\u003e. 2019;14(6):734-739. Published 2019 Apr 3. doi:10.1016/j.radcr.2019.03.020\u003c/li\u003e\n \u003cli\u003eAmbler M, Pogacar S, Sidman R. Lhermitte-Duclos disease (granule cell hypertrophy of the cerebellum) pathological analysis of the first familial cases. \u003cem\u003eJ Neuropathol Exp Neurol\u003c/em\u003e. 1969;28(4):622-647. doi:10.1097/00005072-196910000-00005\u003c/li\u003e\n \u003cli\u003eAbel TW, Baker SJ, Fraser MM, et al. Lhermitte-Duclos disease: a report of 31 cases with immunohistochemical analysis of the PTEN/AKT/mTOR pathway. \u003cem\u003eJ Neuropathol Exp Neurol\u003c/em\u003e. 2005;64(4):341-349. doi:10.1093/jnen/64.4.341\u003c/li\u003e\n \u003cli\u003eAavikko M, Li SP, Saarinen S, et al. Loss of SUFU function in familial multiple meningioma. \u003cem\u003eAm J Hum Genet\u003c/em\u003e. 2012;91(3):520-526. doi:10.1016/j.ajhg.2012.07.015\u003c/li\u003e\n \u003cli\u003eSerpieri V, D\u0026apos;Abrusco F, Dempsey JC, et al. \u003cem\u003eSUFU\u003c/em\u003e haploinsufficiency causes a recognisable neurodevelopmental phenotype at the mild end of the Joubert syndrome spectrum. \u003cem\u003eJ Med Genet\u003c/em\u003e. 2022;59(9):888-894. doi:10.1136/jmedgenet-2021-108114\u003c/li\u003e\n \u003cli\u003eVarjosalo M, Taipale J. Hedgehog: functions and mechanisms. \u003cem\u003eGenes Dev\u003c/em\u003e. 2008;22(18):2454-2472. doi:10.1101/gad.1693608\u003c/li\u003e\n \u003cli\u003eDoheny D, Manore SG, Wong GL, Lo HW. Hedgehog Signaling and Truncated GLI1 in Cancer. \u003cem\u003eCells\u003c/em\u003e. 2020;9(9):2114. Published 2020 Sep 17. doi:10.3390/cells9092114\u003c/li\u003e\n \u003cli\u003eSkoda AM, Simovic D, Karin V, Kardum V, Vranic S, Serman L. The role of the Hedgehog signaling pathway in cancer: A comprehensive review. \u003cem\u003eBosn J Basic Med Sci\u003c/em\u003e. 2018;18(1):8-20. Published 2018 Feb 20. doi:10.17305/bjbms.2018.2756\u003c/li\u003e\n \u003cli\u003eBrugi\u0026egrave;res L, Remenieras A, Pierron G, et al. High frequency of germline SUFU mutations in children with desmoplastic/nodular medulloblastoma younger than 3 years of age. \u003cem\u003eJ Clin Oncol\u003c/em\u003e. 2012;30(17):2087-2093. doi:10.1200/JCO.2011.38.7258\u003c/li\u003e\n \u003cli\u003eGuerrini-Rousseau L, Masliah-Planchon J, Waszak SM, et al. Cancer risk and tumour spectrum in 172 patients with a germline \u003cem\u003eSUFU\u003c/em\u003e pathogenic variation: a collaborative study of the SIOPE Host Genome Working Group. \u003cem\u003eJ Med Genet\u003c/em\u003e. Published online June 29, 2022. doi:10.1136/jmedgenet-2021-108385\u003c/li\u003e\n \u003cli\u003eHan B, Sun Z, Yu T, et al. SPOP-PTEN-SUFU axis promotes progression of clear cell renal cell carcinoma via activating SHH and WNT pathway. \u003cem\u003eCell Death Discov\u003c/em\u003e. 2021;7(1):120. Published 2021 May 21. doi:10.1038/s41420-021-00484-2\u003c/li\u003e\n \u003cli\u003eKlein SD, Nguyen DC, Bhakta V, et al. Mutations in the sonic hedgehog pathway cause macrocephaly-associated conditions due to crosstalk to the PI3K/AKT/mTOR pathway. \u003cem\u003eAm J Med Genet A\u003c/em\u003e. 2019;179(12):2517-2531. doi:10.1002/ajmg.a.61368\u003c/li\u003e\n \u003cli\u003eJornayvaz FR, Philippe J. Mucocutaneous papillomatous papules in Cowden\u0026apos;s syndrome. \u003cem\u003eClin Exp Dermatol\u003c/em\u003e. 2008;33(2):151-153. doi:10.1111/j.1365-2230.2007.02602.x\u003c/li\u003e\n \u003cli\u003eMcMahon ME, Murray D, MacNally S, O\u0026apos;Brien DF. Lhermitte-Duclos disease (dysplastic cerebellar gangliocytoma) in the setting of cowden syndrome: a case report and literature review on COLD syndrome. \u003cem\u003eBr J Neurosurg\u003c/em\u003e. Published online August 1, 2022. doi:10.1080/02688697.2022.2106354\u003c/li\u003e\n \u003cli\u003eSmith MJ, Beetz C, Williams SG, et al. Germline mutations in SUFU cause Gorlin syndrome-associated childhood medulloblastoma and redefine the risk associated with PTCH1 mutations. \u003cem\u003eJ Clin Oncol\u003c/em\u003e. 2014;32(36):4155-4161. doi:10.1200/JCO.2014.58.2569\u003c/li\u003e\n \u003cli\u003eMighell TL, Evans-Dutson S, O\u0026apos;Roak BJ. A Saturation Mutagenesis Approach to Understanding PTEN Lipid Phosphatase Activity and Genotype-Phenotype Relationships. \u003cem\u003eAm J Hum Genet\u003c/em\u003e. 2018;102(5):943-955. doi:10.1016/j.ajhg.2018.03.018\u003c/li\u003e\n \u003cli\u003eAndr\u0026eacute;s-Pons A, Rodr\u0026iacute;guez-Escudero I, Gil A, et al. In vivo functional analysis of the counterbalance of hyperactive phosphatidylinositol 3-kinase p110 catalytic oncoproteins by the tumor suppressor PTEN. \u003cem\u003eCancer Res\u003c/em\u003e. 2007;67(20):9731-9739. doi:10.1158/0008-5472.CAN-07-1278\u003c/li\u003e\n \u003cli\u003eHan SY, Kato H, Kato S, et al. Functional evaluation of PTEN missense mutations using in vitro phosphoinositide phosphatase assay. \u003cem\u003eCancer Res\u003c/em\u003e. 2000;60(12):3147-3151.\u003c/li\u003e\n \u003cli\u003eTate JG, Bamford S, Jubb HC, et al. COSMIC: the Catalogue Of Somatic Mutations In Cancer. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2019;47(D1):D941-D947. doi:10.1093/nar/gky1015\u003c/li\u003e\n \u003cli\u003eZhou XP, Marsh DJ, Morrison CD, et al. Germline inactivation of PTEN and dysregulation of the phosphoinositol-3-kinase/Akt pathway cause human Lhermitte-Duclos disease in adults. \u003cem\u003eAm J Hum Genet\u003c/em\u003e. 2003;73(5):1191-1198. doi:10.1086/379382\u003c/li\u003e\n \u003cli\u003eBehjati S, Tarpey PS. What is next generation sequencing?. \u003cem\u003eArch Dis Child Educ Pract Ed\u003c/em\u003e. 2013;98(6):236-238. doi:10.1136/archdischild-2013-304340\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Lhermitte Duclos, SUFU, PTEN, NGS","lastPublishedDoi":"10.21203/rs.3.rs-4271310/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4271310/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLhermitte-Duclos disease (LDD) is a rare dysplastic gangliocytoma of the cerebellum, typically presenting as a hamartomatous lesion in the posterior fossa. \u003cem\u003ePTEN\u003c/em\u003e and the PI3K/AKT/mTOR pathway are involved in the pathogenesis of LDD. We present a case of a patient who incidentally was detected with LDD. A novel, pathogenic, heterozygous, de novo, splice site variant c.183-2A\u0026thinsp;\u0026gt;\u0026thinsp;G (NM_016169.4) in the \u003cem\u003eSUFU\u003c/em\u003e gene was identified with targeted next-generation sequencing from genomic DNA. \u003cem\u003eSUFU\u003c/em\u003e, a tumor suppressor gene, negatively regulates the hedgehog (Hh) signaling pathway. SUFU also influences WNT and PTEN/AKT/mTOR signaling pathways. While \u003cem\u003eSUFU\u003c/em\u003e pathogenic variants are associated with various central nervous system (CNS) tumors, this is the first reported link between \u003cem\u003eSUFU\u003c/em\u003e and LDD. The study delves into the role of \u003cem\u003eSUFU\u003c/em\u003e in LDD development, establishing the novel \u003cem\u003eSUFU\u003c/em\u003e variant as a potential genetic marker for the disease. Sanger sequencing and gel electrophoresis were applied to RNA isolated from blood to show that the variant disrupts splicing. DNA extracted from tumor tissue underwent NGS with the TWIST Exome 2.0 Panel. Results unveiled the de novo pathogenic SUFU (c.183-2A\u0026thinsp;\u0026gt;\u0026thinsp;G) and PTEN (c.389G\u0026thinsp;\u0026gt;\u0026thinsp;A) variants. In conclusion, this study establishes the first reported association between LDD and a germline, de novo \u003cem\u003eSUFU\u003c/em\u003e variant, and sheds light on the crucial role of \u003cem\u003eSUFU\u003c/em\u003e in LDD pathogenesis. It contributes to the broader understanding of genetic factors influencing this rare cerebellar disorder.\u003c/p\u003e","manuscriptTitle":"SUFU: A potential novel gene responsible for Lhermitte Duclos disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-24 17:31:33","doi":"10.21203/rs.3.rs-4271310/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9c62a12b-23f8-42b6-92c3-30e80402dc5f","owner":[],"postedDate":"April 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-16T02:11:24+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-24 17:31:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4271310","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4271310","identity":"rs-4271310","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0