Metformin inhibits melanin synthesis and melanosome transfer through the cAMP pathway

Metformin inhibits melanin synthesis and melanosome transfer through the cAMP pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Metformin inhibits melanin synthesis and melanosome transfer through the cAMP pathway Xing Liu, Xiaojie Sun, Yunyao Liu, Wenzhu Wang, Hedan Yang, Yiping Ge, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4861391/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Several studies have demonstrated the inhibitory effect of metformin on pigmentation. However, the effect of metformin on melanosome transfer remains unknown. The goals of this study were to elucidate the effects of metformin on melanogenesis and melanosome transfer and explore the related mechanisms. We determined that, compared with those in the control zebrafish, the area occupied by pigment granules, melanin content, tyrosinase activity, and the expression levels of melanogenesis genes and melanosome transfer-related genes were reduced in metformin-treated zebrafish. In human primary melanocytes, MNT1 cells/B16F10 cells, metformin also plays a negative role in melanin synthesis regardless of health status and α-MSH-induced pigmentation. Unlike arbutin, metformin inhibited the formation of dendrites and filopodia-like structures and suppressed melanosome transfer. After treatment with metformin, the cAMP content was reduced, the expression of MITF and downstream molecules was downregulated, and the expression of Rho GTPases was changed. Furthermore, metformin partially abrogated the changes in genes regulating melanin synthesis, melanosome transfer and the cytoskeleton induced by a cAMP activator. Our study revealed that metformin can serve as a candidate depigmentation agent. Health sciences/Diseases/Skin diseases Biological sciences/Drug discovery Metformin Melanogenesis Melanosome transfer cAMP Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Melanin pigments, which are produced by melanocytes, mainly determine skin colour and protect the skin from external damage 1 . Melanin metabolism includes melanin synthesis, melanin transfer to neighbouring keratinocytes and melanin degradation. Abnormal metabolism of melanin pigment leads to skin pigmentary disorders, including hyperpigmentary diseases such as melasma, postinflammatory hyperpigmentation (PIH), and hypopigmentary conditions such as vitiligo. These conditions are not life-threatening, but they cause cosmetic troubles and psychological burdens, negatively affecting quality of life, especially in exposed areas, including the face and arms 2 , 3 . Melanin is produced via a series of complex and delicate enzymatic biochemical reactions, beginning with the amino acid tyrosine and its metabolite DOPA, which occur mainly in lysosome-related organelles called melanosomes 1 . Microphthalmia transcription factor (MITF) is pivotal not only for melanocyte survival 4 but also for the expression of several pigmentation enzymes involved in melanogenesis and differentiation factors, such as tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1) and tyrosinase-related protein-2 (TYRP2)/dopachrome tautomerase (DCT) 5 – 7 . Upon ultraviolet radiation, α-MSH secreted by keratinocytes binds to the melanocortin-1 receptor (MC1R) on the surface of melanocytes, stimulating the upregulation of cAMP in melanocytes 6 – 8 . cAMP mostly functions through the activation of cAMP-dependent protein kinase A (PKA) and its phosphorylation of cAMP response element (CREB) 7 , 9 . Phosphorylated CREB promotes the transcription of genes whose promoters have a cAMP-response element sequence, including MITF 7 , 8 . The cAMP-CREB-MITF pathway is the classic melanogenesis pathway 6 – 8 . Moreover, the dendrites of melanocytes contribute not only to specialized cellular morphology but also, more importantly, to the effect of melanosome transfer to adjacent keratinocytes. Studies have revealed that the cAMP pathway affects the formation of dendrites and the redistribution of the actin cytoskeleton by actin stress fibers 10 . The formation and regulation of stress fibres are regulated by small GTP-binding proteins of the Rho family, which include Rho, Rac and Cdc42 11,12 . Melasma is a common hyperpigmentary disorder affecting millions of people worldwide. Melasma occurs primarily in the facial area of darker-skinned individuals with skin types IV-VI, with at least 90% of the affected individuals being female 13 . Multiple treatments, including oral agents, topical agents, chemical peels, and laser- and light-based therapies, have been used in the clinic but are partially ineffective or unsatisfactory, resulting in high rates of treatment failure and recurrence 14 . Therefore, developing more effective and safe drugs is important for the treatment of melasma. Metformin, which is the mainstay of diabetes mellitus treatment, has been found to have therapeutic effects on several cutaneous diseases in recent years, including hyperinsulinaemia, hormonal acne, hidradenitis suppurativa, acanthosis nigricans, and polycystic ovarian syndrome, as well as cancer and aging 15 , 16 . Metformin suppresses hepatic glucagon signalling to achieve antidiabetic effects, leading to the accumulation of AMP and relevant nucleotides, which inhibit adenylate cyclase, decrease the production of cAMP and reduce the activity of PKA 17 . A previous study revealed that metformin inhibited melanogenesis by decreasing cAMP accumulation 18 , and two studies have shown that topical treatment with 30% metformin is effective in alleviating melasma 19 , 20 . However, the effect of metformin on melanosome transfer is still not understood. This research aims to elucidate the role of melanin in melanin synthesis and transport and explore its mechanism. Results Metformin inhibits melanin synthesis and melanosome transfer in zebrafish The development and morphology of zebrafish embryos treated with 10 mM metformin were normal and did not differ from those of the control group (Fig. 1 a). At 48 hpf, 72 hpf, and 96 hpf, an obvious reduction in melanin content was observed in metformin-treated zebrafish (Fig. 1 a), and the mean percentage area of melanin granules in the head region significantly decreased, according to the ImageJ analysis(Fig. 1 b). Melanin content and tyrosinase activity were both markedly lower in the metformin group than in the control group (Fig. 1 c, 1 d). To determine whether treatment with metformin affects key molecules of the melanogenesis pathway and melanosome transfer, we examined the mRNA expression of MITF, TYR, TYRP1, DCT, MLPH, Rab27a and Myo5a via q‒PCR. All genes were significantly downregulated in the metformin-treated zebrafish (Fig. 1 e, 1 f). Metformin inhibits melanin synthesis in melanocytes, MNT1 cells and B16F10 cells To determine whether metformin can affect cellular viability, primary human melanocytes, MNT1 cells and B16F10 cells were treated with four concentrations of metformin (5 mM, 10 mM, 20 mM, 40 mM) for 24 h, 48 h and 72 h, and the results of the cell counting kit-8 (CCK8) assay are shown in Figure S1 . The relative cell viability after treatment with 5 mM or 10 mM metformin was approximately 90% or greater, so these two concentrations were used in subsequent research. Arbutin (Arb) is known for its inhibitory effect on tyrosinase activity and is commonly used as a skin-whitening agent. To study the inhibitory effect of metformin on melanogenesis, arbutin was also used for comparison. In melanocytes and B16F10 cells, both 5 mM and 10 mM metformin significantly reduced melanin content and tyrosinase activity (Figure S2 a-S2f), whereas the inhibitory effect of 1 mM arbutin was more obvious in MNT1 cells (Figure S2 b, S2e). To assess the inhibitory effect on melanogenesis under hyperpigmented conditions, melanin content and tyrosinase activity were detected in melanocytes and B16F10 cells after α-MSH stimulation in the presence or absence of metformin. As shown in Figures S2 g and S2h, 5 mM metformin, 10 mM metformin and 1 mM arbutin significantly reduced the melanin content compared with that in after α-MSH treatment. Tyrosinase activity was also markedly decreased in hyperpigmented conditions (Figure S2 i, S2j). Metformin inhibits melanogenesis in part via the cAMP-MITF pathway The cAMP-MITF pathway is the main pathway involved in the regulation of pigment production. To elucidate the mechanism by which metformin affects melanogenesis and verify whether metformin plays a role in this pathway, we detected the cAMP content of cell supernatants treated with 10 mM metformin for 72 h. The results showed that the cAMP level was lower in the metformin-treated group than in the control group (Fig. 2 a). MITF plays a crucial role in melanogenesis, regulating the expression of key molecules downstream and promoting melanin synthesis, including TYR and TYRP1. The mRNA levels of these molecules were also determined after intervention for 12 h; only the expression of MITF and TYR significantly decreased, whereas TYRP1 expression did not significantly differ (Fig. 2 b). Treatment of melanocytes with metformin or arbutin significantly reduced the protein levels of MITF, TYR and TYRP1 (Fig. 2 c). In B16F10 cells, the melanin content and tyrosinase activity increased after treatment with 20 µM Forskolin, a cAMP activator, whereas 10 mM metformin partially abrogated the upregulation induced by Forskolin (Fig. 2 d, 2 e). Similarly, in melanocytes, metformin abrogated the upregulation of TYR and TYRP1 expression induced by Forskolin (Fig. 2 f). Metformin alters cellular morphology and inhibits melanosome transfer The morphology and formation of dendrites are essential for melanocyte function and especially melanosome transfer. After culture with medium containing 5 mM or 10 mM metformin for 24 h, the dendrites of B16F10 cells were thinner and shorter, and the number of dendrites was reduced (Figure S3 ). The results were the same after treatment with 5 mM or 10 mM metformin for 96 h(Fig. 3 a). The percentage of cells with fewer than 3 dendrites was significantly increased (Fig. 3 b), while the percentage of cells with more than 3 dendrites was significantly decreased (Fig. 3 c). The percentage of arbutin-treated melanocytes with more or fewer than 3 dendrites did not significantly differ from that of the control group (Fig. 3 b, 3 c). Additionally, scanning electron microscopy revealed that the number of dendrites and filopodia-like structures in 10 mM metformin-treated melanocytes was lower than that in control melanocytes (Fig. 3 d). In the coculture system of primary melanocytes and HaCaT cells, melanosomes with gp100 labelling coupled with FITC (green) in melanocytes and cytokeratin-positive HaCaT cells coupled with Alexa Fluor ® 647 (red) were visualized. A reduction in the number of green fluorescence spots was observed after treatment with metformin and arbutin for 48 h (Fig. 3 e), and the reduction was more pronounced in the metformin-treated group. To further determine the effect of metformin on melanosome transfer, we examined its effects on key molecules involved in melanosome transfer, including MLPH, Rab27a and Myo5a. In melanocytes, treatment with 5 mM and 10 mM metformin for 12 h reduced the mRNA levels of melanophilin (MLPH) and Rab27a, whereas the mRNA levels of myosin Va (Myo5a) did not significantly change. The mRNA expression of these genes did not change in the arbutin-treated melanocytes (Fig. 3 f). The levels of MLPH, Rab27a and Myo5a were obviously decreased at the protein level in melanocytes treated with metformin or arbutin for 72 h (Fig. 3 g). Metformin may inhibit melanosome transfer by altering the cytoskeleton and Rho small GTPases Changes in cell morphology involve proteins that comprise the cytoskeleton. To investigate the mechanism by which metformin induces the dendritic changes in melanocytes, we observed the expression of F-actin after metformin treatment via immunofluorescence. Figure 4 a shows that the expression of phalloides-binding F-actin was significantly increased and that F-actin was polymerized in metformin-treated melanocytes. RhoA and Rac1, members of the Rho small GTPases, are key molecules in cytoskeletal regulatory pathways. The protein levels of RhoA and downstream ROCK1 were increased, and Rac1 was decreased after metformin treatment (Fig. 4 b). In melanocytes, 30 µM RhoA partially abrogated the inhibitory effect of 10 mM metformin on dendrite formation (Fig. 4 c and 4 d). Moreover, metformin partially abrogated the increase in MLPH, Rab27a, and Rac1 expression and the decrease in RhoA expression induced by Forskolin (Fig. 4 e). Discussion Metformin, which is a type of biguanide, is the most frequently prescribed drug for type 2 diabetes mellitus (T2DM) 21 . Moreover, it has been found to be effective in the treatment of other disorders. Previous studies have verified that the antidiabetic mechanism of metformin involves reducing the production of cAMP 17 , and cAMP signalling is a well-known regulator of melanogenesis 22 , which supports the potential application of metformin in the treatment of melanin production disorders. Zebrafish serves as a reliable model for screening and evaluating the effects of depigmentation agents on melanin production and transfer 23 . As shown in Fig. 1 , metformin obviously inhibited melanogenesis in vivo . In primary melanocytes, MNT1 cells, and B16F10 cells, melanin content and tyrosinase activity were obviously reduced after 5 mM, 10 mM metformin, or 1 mM arbutin treatment regardless of health status and α-MSH-induced pigmentation. Overall, metformin may affect melanin synthesis and can serve as a candidate skin-whitening agent. In addition to melanin synthesis, melanosome transfer also plays an important role. Several studies using reflectance confocal microscopy (RCM) have shown that the number of dendrites in melanocytes in the basal layer of melasma patient skin is increased, which is considered a sign of disease activity 24 – 26 . Dendrites are pivotal morphological markers of melanocytes and are involved in diverse modes of melanosome transfer to surrounding keratinocytes 27 , 28 . In response to metformin treatment, the cellular morphology apparently changed, and the number of dendrites and filopodia-like structures markedly decreased in melanocytes. Furthermore, melanosome transfer was also decreased. These findings demonstrated that metformin, rather than arbutin, inhibited the formation of dendrites and subsequently decreased melanosome transfer. To elucidate the mechanisms of metformin, we first compared the cAMP level in metformin-treated melanocytes with that in control melanocytes. Figure 2 a shows the reduction in cAMP levels after treatment with metformin. Moreover, cAMP-PKA-MITF serves as the primary pathway in the regulation of melanogenesis, and we illustrated the downregulation of MITF and its downstream pigmentation enzymes, including TYR, TYRP1 and DCT after metformin treatment. These findings reveal that metformin inhibits melanogenesis via downregulation of members in the cAMP-MITF pathway. Moreover, in B16F10 cells or melanocytes, metformin partially abrogated the increases in melanin content, tyrosinase activity, and TYR and TYRP1 expression induced by the cAMP activator Forskolin. These results suggest that the cAMP-MITF pathway is at least partially involved in the regulation of melanin synthesis by metformin. Additionally, changes in cell morphology are mainly caused by alterations in the cytoskeleton. In this study, after metformin treatment, the cytoskeleton and the expression of Rho GTPases, including RhoA and Rac1, changed. Studies have reported that Rac1 promotes dendrite formation, whereas RhoA inhibits dendrite formation 29 , 30 , which is consistent with our results and the changes in dendrites observed in this study. A RhoA inhibitor can partially abrogate the inhibitory effect of metformin on dendritic formation, suggesting that the inhibitory effect is at least partially mediated by Rho GTPases. Moreover, the expression and activity of Rho and Rac are regulated by cAMP, and a previous study demonstrated that cAMP mediates dendrite formation in melanocytes by increasing Rac activity and decreasing Rho activity 31 . In melanocytes, a cAMP activator can increase the expression of MLPH and Rac1 and decrease the expression of RhoA. Moreover, metformin treatment partially reversed the effects of the cAMP activator on melanin transfer-related genes and Rho GTPases. These findings suggest that metformin regulates melanosome transport at least in part through cAMP-Rho GTPases. Conclusion Collectively, these results demonstrated that metformin not only reduced melanin production but also markedly reduced melanosome transfer, at least partially through the cAMP signalling pathway. In the future, metformin may serve as an effective depigmentation compound for the treatment and prevention of hyperpigmentation disorders. Methods All methods were carried out in accordance with relevant guidelines and regulations, and all methods are reported in accordance with ARRIVE guidelines. This study was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071). Zebrafish culture and treatments The wild-type zebrafish embryos were obtained from the China Zebrafish Resource Center (CZRC). This research was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071). Embryos were cultured at 28℃ with a photoperiod (14h light/10h darkness), and the fresh medium was changed daily. At 2 hours post fertilization (hpf), they were randomly divided into different groups. They were photoed at 48hpf, 72hpf, and 96hpf, and the area of melanin granules in the head regions was measured by Image J software. The pigmentation area (%) was determined as the area of melanin granules as a percentage of the area of the whole head. At 96hpf, the zebrafish were collected to conduct the experiments on melanin content, tyrosinase activity and extraction of RNA. Cell culture All methods were carried out in accordance with relevant guidelines and regulations. Primary melanocytes were separated from remanent human foreskin tissue after circumcision, which was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences (2022-KY-071). All subjects were over 18 years of age and their informed consent was obtained. Cells was cultured in MelM (Melanocyte Medium, ScienCell, USA), passage 2 to passage 8 were used. B16F10 and HaCaT cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Newzerum, New Zealand) and 1% penicillin-streptomycin (Gibco, USA), while MNT1 cells were cultured in DMEM medium supplemented with 20% FBS and 100U/mL penicillin-streptomycin. All cells were incubated at 37℃ and 5% CO 2 . Cell viability assay Cells were seeded in a 96-well Culture Plate (CORNING, New York, USA) at 4000 cells/well. The next day, different concentrations of metformin (Sigma, USA) was added and cultured for 24h or 48h, the wells were replaced with 100 µl culture medium plus 10 µl CCK-8 (Cell Counting Kit-8, Apex) and then measured at 450 nm. Relative cell viability was calculated as a percent of the control group. Measurement of melanin contents Cells (2×10 5 ) were cultured in a 6-well plate for 24h and treated with 5 mM metformin hydrochloride (metformin for short), 10 mM metformin or 1 mM arbutin (VangBrand, China) with or without 1 µM of α-melanocyte-stimulating hormone (α-MSH, Sigma, USA). Thereafter, the cells were washed twice with phosphate-buffered saline (PBS, Gibco, USA) and harvested in 1.5 ml tubes. Cells were lysed by incubating in 200 µl of 1 N NaOH, at 80℃ for 2 hours. The cell lysates were centrifuged at 12000xg for 10 min and the supernatants were transferred to a 96-well plate (50 µl/well, 3 wells each group), then measured at 450 nm and 405 nm. Melanin contents were analyzed as the percent of the control group in cells. Tyrosinase activity assay The cell culture, treatment and collection were the same as the above melanin contents assay. Cells were lysed by 300 µl of cell lysis buffer (includes 1 mM PMSF and 1 mM Triton-X 100) at -80℃ for 2 hours, melted at room temperature for about 30 min, and then centrifuged at 10000xg for 5 min. 80 µl supernatants plus 20 µl 0.01% L-DOPA were added to each well of a 96-well plate. After incubation at 37℃ for 2h, the dopachrome was measured at 475 nm and 490 nm. The results were analyzed as the percent of the control group. The dendrites counting of melanocytes After treatment with the presence or absence of 5 mM metformin, 10 mM metformin or 1 mM arbutin for 96h, melanocytes were taken photographs under optical microscopy (200×) that were used to count dendrites. A total of 300 cells were randomly selected for each group, the number of cells with less than or no less than 3 dendrites was recorded and the averages were taken for comparison and analysis. Scanning electron microscopy After treatment with metformin for 72h in melanocytes, the cell slivers were prepared and underwent the steps of cleaning, fixation, dehydration, drying and spraying, and finally observed under scanning electron microscopy. Melanosome transfer assay using immunofluorescence staining Melanocyte and HaCaT cells were co-cultured in confocal dishes (NEST, China) with a ratio of 1:2, the mixed medium was prepared with MelM and HaCaT medium with a ratio of 1:2. Mixed medium containing metformin or arbutin was separately added into each group for 72h. All the cells were rinsed with PBS, fixed with 4% paraformaldehyde, permeated with Triton-X 100, blocked with 5% BSA and incubated in mixed primary antibodies of rabbit polyclonal anti-wide spectrum cytokeratin (1:200, Abcam, USA) and mouse monoclonal anti-melanoma gp100 (1:50, Abcam, USA) overnight at 4℃. Followed by mixed secondary antibodies of donkey anti-rabbit IgG H&L coupling Alexa Fluor ® 647 (1:100, Abcam, USA) and goat anti-mouse IgG H&L coupling FITC (1:100, Abcam, USA), the cells in dishes were lastly stained with DAPI (1:1000, Beyotime, China) and melanosome transfer can be observed using Confocal Laser Scanning Microscopy (CLSM). RNA extraction and RT-qPCR Total RNA was extracted with RNAiso Plus (Takara, Japan), dissolved in DEPC-treated water (Beyotime, China) and quantified spectrophotometrically. cDNA was synthesized with HiScript ® III RT SuperMix for qPCR (Vazyme, China) and quantitative real-time PCR was conducted with ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) according to the manufacturer’s instructions. The expression levels of genes were normalized against β-actin, and folding change was calculated by comparing 2 −△△CT . The primers are listed below (Table 1 ). Table 1 Primers used for real-time quantitative PCR in zebrafish and cells Gene Forward sequence Reverse sequence MITF (zebrafish) CATTGAACGAAGAAGGCGGT GCAGGAGATGTCTGTTTGCG TYR (zebrafish) CTGTCAGGTGTGCACGGAT ACCCGTCACACAAAGCCTC TYRP1a (zebrafish) CTCCTATGAGGTGCAGTGGC GAACGAGAGCGAACGACACA DCT (zebrafish) AAAGCCATCGACTTCTCGCA GATTCGGGATGGGTCACTGG MLPHa (zebrafish) AAAGTGATGCGGTCCCTGTA GCGAGAGTGAACGGCATAGT Rab27a (zebrafish) CGAGGAGATCATCAGGCGTT CCCAGAGCGAGGAACTTGAT Myo5a (zebrafish) GGAGAAAGCCACAAGTCCCA CCTCTTGGGGTCAAACGTGA β-actin (zebrafish) TTGACAACGGCTCCGGTATG TCCCATGCCAACCATCACTC MITF (human) AAATACGTTGCCTGTCTCGG TGTTGGGAAGGTTGGCTGGA TYR (human) TCAGCCCAGCATCATTCTTC GGCATCCGCTATCCCAGTAA TYRP1 (human) ACCAGAGGGTTCTCATAGTCAG TTCTCAAATTGTGGCGTGTT DCT (human) GGGCAGCGAGACCAGACGAT TTGGCAATTTCATGCTGTTTCTTC MLPH (human) TGCCCATCTGAACGAGACC GAGCCGATCTTCACGACTCTG Rab27a (human) ACAACAGTGGGCATTGATTTCA AAGCTACGAAACCTCTCCTGC Myo5a (human) CAGAGTCCGCTTTATTGATTCCA ATCACCCATGTTCTGACCACT β-actin (human) GTGGCCGAGGACTTTGATTG CCTGTAACAACGCATCTCATATT Western blot Melanocytes were seeded in a 6-well plate at the density of 2×10 5 cells/well, and then stimulated with or without metformin or arbutin for 72h. The protein was harvested by rinsing with cold PBS followed by scraping from the flasks and lysis with RIPA buffer (Beyotime, China) containing protease inhibitors. All proteins were quantified using a BCA protein assay kit (KeyGEN BioTECH, China) according to the steps of the manual. Equal mass and volume of proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes by electro-blotting. The PVDF membrane (Millipore, USA) containing protein was incubated in diluted primary antibody (MITF, Proteintech, China, 1:1000; TYR, ABclonal, China, 1:1000; TYRP1, Santa Cruz, USA, 1:1000; β-actin, ABclonal, China, 1:1000; MLPH, Proteintech, China, 1:1000; Rab27a, Proteintech, China, 1:1000; Myo5a, ABclonal, China, 1:1000; RhoA, Proteintech, China, 1:1000; Rac1, Proteintech, China, 1:750; ROCK1, Proteintech, China, 1:1000) for about 14-18h at 4℃. Then after incubation of secondary antibody with HRP-labeled (ABclonal, China, 1:2000), the membrane was displayed using the ECL chromogenic system. Cytoskeleton staining Cells (2×10 5 ) were cultured in confocal dishes and treated with or without metformin for 48h or 72h. Cells were rinsed with PBS, fixed with 4% paraformaldehyde, permeated with Triton-X100 and then incubated in TRITC-Phalloidin (1:400, Servicebio, China) for 90min, following stained with DAPI, finally observed in CLSM. Determination of cAMP content Extracellular cyclic adenosine monophosphate (cAMP) was measured using an enzyme-linked immunosorbent assay (ELISA) (Elabscience ® , China). The preparation of cell supernatant and and procedure of cAMP detecting were carried out according to the instructions. Statistical analysis Each experiment was performed in triplicate and values were presented as mean ± standard deviation (SD). GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA) was used for data analysis and graphing formation. p<0.05 was defined as statistically significant (*p<0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Declarations Conflict of interest statement The authors have no conflict of interest to declare. Ethical statement This research was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071). Funding Information This research was supported by the National Natural Science Foundation of China (82103705) and CAMS Innovation Fund for Medical Sciences (CIFMS-2021-I2M-1-001). Author Contribution Xing Liu: Writing - original draft, Writing - review & editing, Investigation. Xiaojie Sun: Data curation, Formal analysis, Validation. Yunyao Liu: Methodology, Supervision. Wenzhu Wang: Formal analysis. Hedan Yang: Visualization, Software. Yiping Ge: Resources. Yin Yang: Funding acquisition, Conceptualization, Project administration. Xu Chen: Project administration, Writing - review & editing. Tong Lin: Conceptualization, Supervision, Funding acquisition. Acknowledgement We would like to thank Prof. Xu Chen for his expert assistance, thank Prof. Tong Lin and Yin Yang for their funding support and experimental project. Data Availability Data and materials supporting the findings of this study are available in the article and its Supplementary Figures. References Cui, Y. Z. & Man, X. Y. Biology of melanocytes in mammals. Front. Cell. Dev. Biol. 11 , 1309557 (2023). Taylor, A., Pawaskar, M., Taylor, S. L., Balkrishnan, R. & Feldman, S. R. Prevalence of pigmentary disorders and their impact on quality of life: a prospective cohort study. J. Cosmet. Dermatol. 7 , 164–168 (2008). Amatya, B. & Pokhrel, D. B. Assessment and Comparison of Quality of Life in Patients with Melasma and Vitiligo. Kathmandu Univ. Med. J. (KUMJ) . 17 , 114–118 (2019). Steingrímsson, E., Copeland, N. G. & Jenkins, N. A. Melanocytes and the microphthalmia transcription factor network. Annu. Rev. Genet. 38 , 365–411 (2004). Levy, C., Khaled, M. & Fisher, D. E. MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol. Med. 12 , 406–414 (2006). D’Mello, S. A. N., Finlay, G. J., Baguley, B. C. & Askarian-Amiri, M. E. Signaling Pathways in Melanogenesis. Int. J. Mol. Sci. 17 , 1144 (2016). Buscà, R. & Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell. Res. 13 , 60–69 (2000). Corre, S. et al. UV-induced expression of key component of the tanning process, the POMC and MC1R genes, is dependent on the p-38-activated upstream stimulating factor-1 (USF-1). J. Biol. Chem. 279 , 51226–51233 (2004). Edelman, A. M., Blumenthal, D. K. & Krebs, E. G. Protein serine/threonine kinases. Annu. Rev. Biochem. 56 , 567–613 (1987). Buscà, R. et al. Inhibition of Rho is required for cAMP-induced melanoma cell differentiation. Mol. Biol. Cell. 9 , 1367–1378 (1998). Ridley, A. J. & Hall, A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell . 70 , 389–399 (1992). Etienne-Manneville, S. & Hall, A. Rho GTPases in cell biology. Nature . 420 , 629–635 (2002). Sheth, V. M. & Pandya, A. G. Melasma: a comprehensive update: part I. J. Am. Acad. Dermatol. 65 , 689–697 (2011). Artzi, O. et al. The pathogenesis of melasma and implications for treatment. J. Cosmet. Dermatol. 20 , 3432–3445 (2021). Bubna, A. K. Metformin - For the dermatologist. Indian J. Pharmacol. 48 , 4–10 (2016). Fujita, Y., Inagaki, N. & Metformin New Preparations and Nonglycemic Benefits. Curr. Diab Rep. 17 , 5 (2017). Miller, R. A. et al. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature . 494 , 256–260 (2013). Lehraiki, A. et al. Inhibition of melanogenesis by the antidiabetic metformin. J. Invest. Dermatol. 134 , 2589–2597 (2014). Banavase Channakeshavaiah, R. Andanooru Chandrappa, N. K. Topical metformin in the treatment of melasma: A preliminary clinical trial. J. Cosmet. Dermatol. 19 , 1161–1164 (2020). AboAlsoud, E. S., Eldahshan, R. M., AbouKhodair Mohammed, H. & Elsaie, M. L. Safety and efficacy of topical metformin 30% cream versus triple combination cream (Kligman’s formula) in treating melasma: A randomized controlled study. J. Cosmet. Dermatol. 21 , 2508–2515 (2022). Nathan, D. M. et al. Medical management of hyperglycemia in type 2 diabetes: a consensus algorithm for the initiation and adjustment of therapy: a consensus statement of the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes Care . 32 , 193–203 (2009). Yusupova, M. et al. Distinct cAMP Signaling Microdomains Differentially Regulate Melanosomal pH and Pigmentation. J. Invest. Dermatol. 143 , 2019–2029e3 (2023). Lajis, A. F. B. A Zebrafish Embryo as an Animal Model for the Treatment of Hyperpigmentation in Cosmetic Dermatology Medicine. Med. (Kaunas) . 54 , 35 (2018). McKesey, J., Tovar-Garza, A. & Pandya, A. G. Melasma Treatment: An Evidence-Based Review. Am. J. Clin. Dermatol. 21 , 173–225 (2020). Kwon, S. H., Hwang, Y. J., Lee, S. K. & Park, K. C. Heterogeneous Pathology of Melasma and Its Clinical Implications. Int. J. Mol. Sci. 17 , 824 (2016). Sarkar, R., Bansal, A. & Ailawadi, P. Future therapies in melasma: What lies ahead? Indian J. Dermatol. Venereol. Leprol. 86 , 8–17 (2020). Tadokoro, R. & Takahashi, Y. Intercellular transfer of organelles during body pigmentation. Curr. Opin. Genet. Dev. 45 , 132–138 (2017). Tian, X., Cui, Z., Liu, S., Zhou, J. & Cui, R. Melanosome transport and regulation in development and disease. Pharmacol. Ther. 219 , 107707 (2021). Wettschureck, N. & Offermanns, S. Rho/Rho-kinase mediated signaling in physiology and pathophysiology. J. Mol. Med. (Berl) . 80 , 629–638 (2002). Wang, W. Q. et al. Narrow-band UVB radiation promotes dendrite formation by activating Rac1 in B16 melanoma cells. Mol. Clin. Oncol. 1 , 858–862 (2013). Scott, G. & Leopardi, S. The cAMP signaling pathway has opposing effects on Rac and Rho in B16F10 cells: implications for dendrite formation in melanocytic cells. Pigment Cell. Res. 16 , 139–148 (2003). Additional Declarations No competing interests reported. Supplementary Files figureS1.tif figureS2.tif figureS3.tif informedconsentofsubjects.pdf supplementaryinformationofgels.pdf Cite Share Download PDF Status: Published Journal Publication published 03 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 17 Oct, 2024 Reviews received at journal 16 Oct, 2024 Reviews received at journal 15 Oct, 2024 Reviewers agreed at journal 05 Oct, 2024 Reviewers agreed at journal 04 Oct, 2024 Reviewers invited by journal 03 Oct, 2024 Editor assigned by journal 13 Sep, 2024 Editor invited by journal 26 Aug, 2024 Submission checks completed at journal 26 Aug, 2024 First submitted to journal 05 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4861391","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":358274519,"identity":"2f66b7fe-9ec1-40e3-90f7-54253dbf59a8","order_by":0,"name":"Xing Liu","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Liu","suffix":""},{"id":358274520,"identity":"95897b15-2337-49bb-8dcf-418a931d5de6","order_by":1,"name":"Xiaojie Sun","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiaojie","middleName":"","lastName":"Sun","suffix":""},{"id":358274521,"identity":"e1c365cb-390f-4a27-b410-532276a686d6","order_by":2,"name":"Yunyao Liu","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yunyao","middleName":"","lastName":"Liu","suffix":""},{"id":358274522,"identity":"4b81d70a-de28-449f-a425-b737bff36c9c","order_by":3,"name":"Wenzhu Wang","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Wenzhu","middleName":"","lastName":"Wang","suffix":""},{"id":358274523,"identity":"79d28901-ef66-49a5-9533-3954b4bf747d","order_by":4,"name":"Hedan Yang","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hedan","middleName":"","lastName":"Yang","suffix":""},{"id":358274524,"identity":"b5330125-36f1-4d44-a6dc-ad2899696cc5","order_by":5,"name":"Yiping Ge","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yiping","middleName":"","lastName":"Ge","suffix":""},{"id":358274525,"identity":"10e9de01-1d14-4d1e-bf3f-256942d680b2","order_by":6,"name":"Yin Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYHACNoYEBgY5Nvb2A6RpMebjOZNAghYgSJwn4WBAnHqDG+nPHjxsO5zeJgG07EfFNmK05JgbJLYdzm2TbjzA2HPmNlFa2CTAWmQOJDAzthGlJf0ZSEs6m0SCAbFaEsxAWhKI1yJ55o2ZRMK5dMM2YCAfJMovfMfTn0n+KLOWl29vP/jgRwURWhQOAAlGtmYw5wBh9UAg3wAi/9QRpXgUjIJRMApGKAAAWJ4/YaQRb+8AAAAASUVORK5CYII=","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":true,"prefix":"","firstName":"Yin","middleName":"","lastName":"Yang","suffix":""},{"id":358274526,"identity":"f8d410f2-30c7-499e-8515-183a1a3ff64b","order_by":7,"name":"Xu Chen","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Chen","suffix":""},{"id":358274527,"identity":"d703eb39-3e74-406f-aa96-e640e13f8ee1","order_by":8,"name":"Tong Lin","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Lin","suffix":""}],"badges":[],"createdAt":"2024-08-05 10:49:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4861391/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4861391/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-95245-x","type":"published","date":"2025-04-03T15:57:17+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65297596,"identity":"157c9c82-c0c6-4041-9610-2fa84e995d51","added_by":"auto","created_at":"2024-09-25 19:59:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":7357853,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetformin inhibits melanin synthesis and melanosome transfer in zebrafish.\u003c/strong\u003e(a) Melanin granules in the head regions of zebrafish at 48hpf, 72hpf, and 96hpf (scale bar=500μm). (b) The percentage area of melanin granules in the head regions was significantly decreased after the effect of 10 mM metformin at 48hpf, 72hpf, and 96hpf by Image J software. (c) Metformin inhibited melanin content at 96hpf. (d) Metformin inhibited tyrosinase activity at 96hpf. (e) The mRNA expression levels of MITF, TYR, TYRP1a, and DCT in melanogenesis were down-regulated after the treatment of metformin at 96hpf by RT-qPCR. (f) The mRNA expression levels of MLPHa, Rab27a,and Myo5a in melanosome transfer were down-regulated after the treatment of metformin at 96hpf by RT-qPCR. Results were presented as mean ±SD. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/65761f7a2b736000c85a4c7c.png"},{"id":65297594,"identity":"f260d8c8-16fa-472e-baeb-ab6849d0beb7","added_by":"auto","created_at":"2024-09-25 19:59:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2831317,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetformin inhibits melanogenesis partly dependent on the cAMP-MITF pathway.\u003c/strong\u003e(a) Treated with metformin for 72h in melanocytes, the cAMP level was significantly decreased. (b) The mRNA expression levels of MITF, TYR, TYRP1, and DCT in melanogenesis were detected by RT-qPCR (12h) in melanocytes. (c) The protein expression of MITF, TYR, TYRP1, and DCT was reduced after the incubation with metformin for 72h in melanocytes by Western blot (the gels/blots was from the same protein sample which extracted from the same batch of cells). (d-e) In B16F10 cells, treated with 20 µM cAMP activator (Forskolin) for 48h, the melanin content(d), tyrosinase activity(e) were elevated, while the up-regulation induced by Forskolin was partially decreased after incubated with metformin. (f) In melanocytes, treated with 20 µM Forskolin for 72h, TYR and TYRP1 were increased, while the up-regulation induced by Forskolin was partially decreased after incubated with metformin (the gels/blots was from the same protein sample which extracted from the same batch of cells). Results were presented as mean ±SD. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001; ns, not significant.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/24d278717fbf3b9b46822690.png"},{"id":65297595,"identity":"470f13a0-1f7a-49a1-a166-27e5df2625eb","added_by":"auto","created_at":"2024-09-25 19:59:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":12054008,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetformin alters cellular morphology and inhibits melanosome transfer.\u003c/strong\u003e (a-c) Treated with metformin and arbutin for 96h, the cellular morphology of melanocytes was photographed under microscopy(a, scale bar=100μm), and the dendrites of melanocytes were counted. the number of bipolar melanocytes was notably increased(b) and the number of multi-polar melanocytes was prominently decreased(c) after being treated with metformin; the dendrites of melanocytes were not changed after the effect of arbutin. (d) In incubation with metformin for 72h in melanocytes, the number of melanocytes and filopodia-like structures were both reduced under scanning electron microscopy (SEM). (e) In the co-culture system of HaCaT cells and melanocytes, the melanosomes(gp100 labeling, green) transferred to keratinocytes(cytokeratin, red) were reduced after treatment with metformin and arbutin(presented as white arrow) (scale bar=50μm). (f-g) The mRNA and protein expression levels of melanosome transfer-related genes, MLPH, Rab27a, and Myo5a, were determined by RT-qPCR(f, 12h) and western blot(g, 72h; the gels/blots was from the same protein sample which extracted from the same batch of cells). Results were presented as mean ±SD. *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001; ns, not significant.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/60a010e7c785b3745f512a1a.png"},{"id":65297730,"identity":"ef8b50ff-57a1-43ca-bf7f-7a38893867cc","added_by":"auto","created_at":"2024-09-25 20:07:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6102603,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetformin inhibits melanosome transfer by altering the cytoskeleton and Rho small GTPases.\u003c/strong\u003e (a) Treated with metformin (5 and 10 mM) for 72h in melanocytes, the cytoskeleton (red) was stained with TRITC-Phalloidin and cell nuclei were stained with DAPI (blue) through laser confocal microscopy (LCM), the cytoskeleton was obviously changed (scale bar=50μm). (b) Treated with metformin (5 and 10 mM) for 72h in melanocytes, the Rho GTPases (ROCK1, RhoA, and Rac1) were determined by Western blot (the gels/blots was from the same protein sample which extracted from the same batch of cells). (c-d) In melanocytes, treated with 30 μM RhoA inhibitor and/or metformin for 96h, the number of dendrites was counted and compared. RhoA inhibitor partially reversed the inhibition effect on dendrite formation by metformin. (e) In melanocytes, treated with metformin and/or Forskolin for 72h, the protein levels of melanosome transfer-related genes (MLPH, Rab27a) and Rho GTPases (RhoA, Rac1) were detected by western blot (the gels/blots was from the same protein sample which extracted from the same batch of cells). Results were presented as mean ±SD. *p\u0026lt;0.05, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/ef9401d36a8f8c06872814f4.png"},{"id":80082120,"identity":"4c0875aa-9038-4d17-8634-508301acbf25","added_by":"auto","created_at":"2025-04-07 16:07:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":26491294,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/187bfe5a-01ee-417e-930d-ea5e9b563505.pdf"},{"id":65297597,"identity":"ada444d9-01e6-44a9-8add-285864662532","added_by":"auto","created_at":"2024-09-25 19:59:17","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":7322600,"visible":true,"origin":"","legend":"","description":"","filename":"figureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/87ed92e334e667e83bd7f049.tif"},{"id":65297732,"identity":"5f8f37fe-640d-4f0e-a62c-7bc78ab65fa1","added_by":"auto","created_at":"2024-09-25 20:07:17","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":31536860,"visible":true,"origin":"","legend":"","description":"","filename":"figureS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/4a6e07f24f49479cd3c5154c.tif"},{"id":65297602,"identity":"d141d845-9552-4481-a0c7-7f0ea9cf74a4","added_by":"auto","created_at":"2024-09-25 19:59:18","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":48992504,"visible":true,"origin":"","legend":"","description":"","filename":"figureS3.tif","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/56fafdde0820fee6c19554e0.tif"},{"id":65297924,"identity":"29f52546-0ac7-40a9-afe7-e685c1cbb6b0","added_by":"auto","created_at":"2024-09-25 20:15:17","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":749127,"visible":true,"origin":"","legend":"","description":"","filename":"informedconsentofsubjects.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/998ed7a0f76b311aeb0485a1.pdf"},{"id":65297600,"identity":"420f5a0a-42f4-4b5b-add2-eb2cfcb12769","added_by":"auto","created_at":"2024-09-25 19:59:17","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":723925,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryinformationofgels.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4861391/v1/145a8a98b7b7f3b36ff045d0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Metformin inhibits melanin synthesis and melanosome transfer through the cAMP pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMelanin pigments, which are produced by melanocytes, mainly determine skin colour and protect the skin from external damage\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Melanin metabolism includes melanin synthesis, melanin transfer to neighbouring keratinocytes and melanin degradation. Abnormal metabolism of melanin pigment leads to skin pigmentary disorders, including hyperpigmentary diseases such as melasma, postinflammatory hyperpigmentation (PIH), and hypopigmentary conditions such as vitiligo. These conditions are not life-threatening, but they cause cosmetic troubles and psychological burdens, negatively affecting quality of life, especially in exposed areas, including the face and arms\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Melanin is produced via a series of complex and delicate enzymatic biochemical reactions, beginning with the amino acid tyrosine and its metabolite DOPA, which occur mainly in lysosome-related organelles called melanosomes\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Microphthalmia transcription factor (MITF) is pivotal not only for melanocyte survival\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e but also for the expression of several pigmentation enzymes involved in melanogenesis and differentiation factors, such as tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1) and tyrosinase-related protein-2 (TYRP2)/dopachrome tautomerase (DCT)\u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eUpon ultraviolet radiation, α-MSH secreted by keratinocytes binds to the melanocortin-1 receptor (MC1R) on the surface of melanocytes, stimulating the upregulation of cAMP in melanocytes\u003csup\u003e\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. cAMP mostly functions through the activation of cAMP-dependent protein kinase A (PKA) and its phosphorylation of cAMP response element (CREB)\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Phosphorylated CREB promotes the transcription of genes whose promoters have a cAMP-response element sequence, including MITF\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The cAMP-CREB-MITF pathway is the classic melanogenesis pathway\u003csup\u003e\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Moreover, the dendrites of melanocytes contribute not only to specialized cellular morphology but also, more importantly, to the effect of melanosome transfer to adjacent keratinocytes. Studies have revealed that the cAMP pathway affects the formation of dendrites and the redistribution of the actin cytoskeleton by actin stress fibers\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The formation and regulation of stress fibres are regulated by small GTP-binding proteins of the Rho family, which include Rho, Rac and Cdc42\u003csup\u003e11,12\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMelasma is a common hyperpigmentary disorder affecting millions of people worldwide. Melasma occurs primarily in the facial area of darker-skinned individuals with skin types IV-VI, with at least 90% of the affected individuals being female\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Multiple treatments, including oral agents, topical agents, chemical peels, and laser- and light-based therapies, have been used in the clinic but are partially ineffective or unsatisfactory, resulting in high rates of treatment failure and recurrence\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Therefore, developing more effective and safe drugs is important for the treatment of melasma.\u003c/p\u003e \u003cp\u003eMetformin, which is the mainstay of diabetes mellitus treatment, has been found to have therapeutic effects on several cutaneous diseases in recent years, including hyperinsulinaemia, hormonal acne, hidradenitis suppurativa, acanthosis nigricans, and polycystic ovarian syndrome, as well as cancer and aging\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Metformin suppresses hepatic glucagon signalling to achieve antidiabetic effects, leading to the accumulation of AMP and relevant nucleotides, which inhibit adenylate cyclase, decrease the production of cAMP and reduce the activity of PKA\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. A previous study revealed that metformin inhibited melanogenesis by decreasing cAMP accumulation\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, and two studies have shown that topical treatment with 30% metformin is effective in alleviating melasma\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, the effect of metformin on melanosome transfer is still not understood. This research aims to elucidate the role of melanin in melanin synthesis and transport and explore its mechanism.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMetformin inhibits melanin synthesis and melanosome transfer in zebrafish\u003c/h2\u003e \u003cp\u003eThe development and morphology of zebrafish embryos treated with 10 mM metformin were normal and did not differ from those of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). At 48 hpf, 72 hpf, and 96 hpf, an obvious reduction in melanin content was observed in metformin-treated zebrafish (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), and the mean percentage area of melanin granules in the head region significantly decreased, according to the ImageJ analysis(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Melanin content and tyrosinase activity were both markedly lower in the metformin group than in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). To determine whether treatment with metformin affects key molecules of the melanogenesis pathway and melanosome transfer, we examined the mRNA expression of MITF, TYR, TYRP1, DCT, MLPH, Rab27a and Myo5a via q‒PCR. All genes were significantly downregulated in the metformin-treated zebrafish (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMetformin inhibits melanin synthesis in melanocytes, MNT1 cells and B16F10 cells\u003c/h2\u003e \u003cp\u003eTo determine whether metformin can affect cellular viability, primary human melanocytes, MNT1 cells and B16F10 cells were treated with four concentrations of metformin (5 mM, 10 mM, 20 mM, 40 mM) for 24 h, 48 h and 72 h, and the results of the cell counting kit-8 (CCK8) assay are shown in Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. The relative cell viability after treatment with 5 mM or 10 mM metformin was approximately 90% or greater, so these two concentrations were used in subsequent research. Arbutin (Arb) is known for its inhibitory effect on tyrosinase activity and is commonly used as a skin-whitening agent. To study the inhibitory effect of metformin on melanogenesis, arbutin was also used for comparison. In melanocytes and B16F10 cells, both 5 mM and 10 mM metformin significantly reduced melanin content and tyrosinase activity (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003ea-S2f), whereas the inhibitory effect of 1 mM arbutin was more obvious in MNT1 cells (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eb, S2e). To assess the inhibitory effect on melanogenesis under hyperpigmented conditions, melanin content and tyrosinase activity were detected in melanocytes and B16F10 cells after α-MSH stimulation in the presence or absence of metformin. As shown in Figures \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eg and S2h, 5 mM metformin, 10 mM metformin and 1 mM arbutin significantly reduced the melanin content compared with that in after α-MSH treatment. Tyrosinase activity was also markedly decreased in hyperpigmented conditions (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003ei, S2j).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMetformin inhibits melanogenesis in part via the cAMP-MITF pathway\u003c/h2\u003e \u003cp\u003eThe cAMP-MITF pathway is the main pathway involved in the regulation of pigment production. To elucidate the mechanism by which metformin affects melanogenesis and verify whether metformin plays a role in this pathway, we detected the cAMP content of cell supernatants treated with 10 mM metformin for 72 h. The results showed that the cAMP level was lower in the metformin-treated group than in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). MITF plays a crucial role in melanogenesis, regulating the expression of key molecules downstream and promoting melanin synthesis, including TYR and TYRP1. The mRNA levels of these molecules were also determined after intervention for 12 h; only the expression of MITF and TYR significantly decreased, whereas TYRP1 expression did not significantly differ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Treatment of melanocytes with metformin or arbutin significantly reduced the protein levels of MITF, TYR and TYRP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). In B16F10 cells, the melanin content and tyrosinase activity increased after treatment with 20 \u0026micro;M Forskolin, a cAMP activator, whereas 10 mM metformin partially abrogated the upregulation induced by Forskolin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). Similarly, in melanocytes, metformin abrogated the upregulation of TYR and TYRP1 expression induced by Forskolin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMetformin alters cellular morphology and inhibits melanosome transfer\u003c/h2\u003e \u003cp\u003eThe morphology and formation of dendrites are essential for melanocyte function and especially melanosome transfer. After culture with medium containing 5 mM or 10 mM metformin for 24 h, the dendrites of B16F10 cells were thinner and shorter, and the number of dendrites was reduced (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). The results were the same after treatment with 5 mM or 10 mM metformin for 96 h(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The percentage of cells with fewer than 3 dendrites was significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), while the percentage of cells with more than 3 dendrites was significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). The percentage of arbutin-treated melanocytes with more or fewer than 3 dendrites did not significantly differ from that of the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Additionally, scanning electron microscopy revealed that the number of dendrites and filopodia-like structures in 10 mM metformin-treated melanocytes was lower than that in control melanocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). In the coculture system of primary melanocytes and HaCaT cells, melanosomes with gp100 labelling coupled with FITC (green) in melanocytes and cytokeratin-positive HaCaT cells coupled with Alexa Fluor\u003csup\u003e\u0026reg;\u003c/sup\u003e 647 (red) were visualized. A reduction in the number of green fluorescence spots was observed after treatment with metformin and arbutin for 48 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ee), and the reduction was more pronounced in the metformin-treated group. To further determine the effect of metformin on melanosome transfer, we examined its effects on key molecules involved in melanosome transfer, including MLPH, Rab27a and Myo5a. In melanocytes, treatment with 5 mM and 10 mM metformin for 12 h reduced the mRNA levels of melanophilin (MLPH) and Rab27a, whereas the mRNA levels of myosin Va (Myo5a) did not significantly change. The mRNA expression of these genes did not change in the arbutin-treated melanocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ef). The levels of MLPH, Rab27a and Myo5a were obviously decreased at the protein level in melanocytes treated with metformin or arbutin for 72 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMetformin may inhibit melanosome transfer by altering the cytoskeleton and Rho small GTPases\u003c/h2\u003e \u003cp\u003eChanges in cell morphology involve proteins that comprise the cytoskeleton. To investigate the mechanism by which metformin induces the dendritic changes in melanocytes, we observed the expression of F-actin after metformin treatment via immunofluorescence. Figure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ea shows that the expression of phalloides-binding F-actin was significantly increased and that F-actin was polymerized in metformin-treated melanocytes. RhoA and Rac1, members of the Rho small GTPases, are key molecules in cytoskeletal regulatory pathways. The protein levels of RhoA and downstream ROCK1 were increased, and Rac1 was decreased after metformin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). In melanocytes, 30 \u0026micro;M RhoA partially abrogated the inhibitory effect of 10 mM metformin on dendrite formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ec and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Moreover, metformin partially abrogated the increase in MLPH, Rab27a, and Rac1 expression and the decrease in RhoA expression induced by Forskolin (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMetformin, which is a type of biguanide, is the most frequently prescribed drug for type 2 diabetes mellitus (T2DM)\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Moreover, it has been found to be effective in the treatment of other disorders. Previous studies have verified that the antidiabetic mechanism of metformin involves reducing the production of cAMP\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and cAMP signalling is a well-known regulator of melanogenesis\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, which supports the potential application of metformin in the treatment of melanin production disorders.\u003c/p\u003e \u003cp\u003eZebrafish serves as a reliable model for screening and evaluating the effects of depigmentation agents on melanin production and transfer\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, metformin obviously inhibited melanogenesis \u003cem\u003ein vivo\u003c/em\u003e. In primary melanocytes, MNT1 cells, and B16F10 cells, melanin content and tyrosinase activity were obviously reduced after 5 mM, 10 mM metformin, or 1 mM arbutin treatment regardless of health status and α-MSH-induced pigmentation. Overall, metformin may affect melanin synthesis and can serve as a candidate skin-whitening agent.\u003c/p\u003e \u003cp\u003eIn addition to melanin synthesis, melanosome transfer also plays an important role. Several studies using reflectance confocal microscopy (RCM) have shown that the number of dendrites in melanocytes in the basal layer of melasma patient skin is increased, which is considered a sign of disease activity\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Dendrites are pivotal morphological markers of melanocytes and are involved in diverse modes of melanosome transfer to surrounding keratinocytes\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. In response to metformin treatment, the cellular morphology apparently changed, and the number of dendrites and filopodia-like structures markedly decreased in melanocytes. Furthermore, melanosome transfer was also decreased. These findings demonstrated that metformin, rather than arbutin, inhibited the formation of dendrites and subsequently decreased melanosome transfer.\u003c/p\u003e \u003cp\u003eTo elucidate the mechanisms of metformin, we first compared the cAMP level in metformin-treated melanocytes with that in control melanocytes. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ea shows the reduction in cAMP levels after treatment with metformin. Moreover, cAMP-PKA-MITF serves as the primary pathway in the regulation of melanogenesis, and we illustrated the downregulation of MITF and its downstream pigmentation enzymes, including TYR, TYRP1 and DCT after metformin treatment. These findings reveal that metformin inhibits melanogenesis via downregulation of members in the cAMP-MITF pathway. Moreover, in B16F10 cells or melanocytes, metformin partially abrogated the increases in melanin content, tyrosinase activity, and TYR and TYRP1 expression induced by the cAMP activator Forskolin. These results suggest that the cAMP-MITF pathway is at least partially involved in the regulation of melanin synthesis by metformin.\u003c/p\u003e \u003cp\u003eAdditionally, changes in cell morphology are mainly caused by alterations in the cytoskeleton. In this study, after metformin treatment, the cytoskeleton and the expression of Rho GTPases, including RhoA and Rac1, changed. Studies have reported that Rac1 promotes dendrite formation, whereas RhoA inhibits dendrite formation\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, which is consistent with our results and the changes in dendrites observed in this study. A RhoA inhibitor can partially abrogate the inhibitory effect of metformin on dendritic formation, suggesting that the inhibitory effect is at least partially mediated by Rho GTPases. Moreover, the expression and activity of Rho and Rac are regulated by cAMP, and a previous study demonstrated that cAMP mediates dendrite formation in melanocytes by increasing Rac activity and decreasing Rho activity\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. In melanocytes, a cAMP activator can increase the expression of MLPH and Rac1 and decrease the expression of RhoA. Moreover, metformin treatment partially reversed the effects of the cAMP activator on melanin transfer-related genes and Rho GTPases. These findings suggest that metformin regulates melanosome transport at least in part through cAMP-Rho GTPases.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eCollectively, these results demonstrated that metformin not only reduced melanin production but also markedly reduced melanosome transfer, at least partially through the cAMP signalling pathway. In the future, metformin may serve as an effective depigmentation compound for the treatment and prevention of hyperpigmentation disorders.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eAll methods were carried out in accordance with relevant guidelines and regulations, and all methods are reported in accordance with ARRIVE guidelines. This study was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071).\u003c/p\u003e \u003cp\u003eZebrafish culture and treatments\u003c/p\u003e \u003cp\u003eThe wild-type zebrafish embryos were obtained from the China Zebrafish Resource Center (CZRC). This research was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071). Embryos were cultured at 28℃ with a photoperiod (14h light/10h darkness), and the fresh medium was changed daily. At 2 hours post fertilization (hpf), they were randomly divided into different groups. They were photoed at 48hpf, 72hpf, and 96hpf, and the area of melanin granules in the head regions was measured by Image J software. The pigmentation area (%) was determined as the area of melanin granules as a percentage of the area of the whole head. At 96hpf, the zebrafish were collected to conduct the experiments on melanin content, tyrosinase activity and extraction of RNA.\u003c/p\u003e \u003cp\u003eCell culture\u003c/p\u003e \u003cp\u003e All methods were carried out in accordance with relevant guidelines and regulations. Primary melanocytes were separated from remanent human foreskin tissue after circumcision, which was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences (2022-KY-071). All subjects were over 18 years of age and their informed consent was obtained. Cells was cultured in MelM (Melanocyte Medium, ScienCell, USA), passage 2 to passage 8 were used. B16F10 and HaCaT cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Newzerum, New Zealand) and 1% penicillin-streptomycin (Gibco, USA), while MNT1 cells were cultured in DMEM medium supplemented with 20% FBS and 100U/mL penicillin-streptomycin. All cells were incubated at 37℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003eCell viability assay\u003c/p\u003e \u003cp\u003eCells were seeded in a 96-well Culture Plate (CORNING, New York, USA) at 4000 cells/well. The next day, different concentrations of metformin (Sigma, USA) was added and cultured for 24h or 48h, the wells were replaced with 100 \u0026micro;l culture medium plus 10 \u0026micro;l CCK-8 (Cell Counting Kit-8, Apex) and then measured at 450 nm. Relative cell viability was calculated as a percent of the control group.\u003c/p\u003e \u003cp\u003eMeasurement of melanin contents\u003c/p\u003e \u003cp\u003eCells (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e) were cultured in a 6-well plate for 24h and treated with 5 mM metformin hydrochloride (metformin for short), 10 mM metformin or 1 mM arbutin (VangBrand, China) with or without 1 \u0026micro;M of α-melanocyte-stimulating hormone (α-MSH, Sigma, USA). Thereafter, the cells were washed twice with phosphate-buffered saline (PBS, Gibco, USA) and harvested in 1.5 ml tubes. Cells were lysed by incubating in 200 \u0026micro;l of 1 N NaOH, at 80℃ for 2 hours. The cell lysates were centrifuged at 12000xg for 10 min and the supernatants were transferred to a 96-well plate (50 \u0026micro;l/well, 3 wells each group), then measured at 450 nm and 405 nm. Melanin contents were analyzed as the percent of the control group in cells.\u003c/p\u003e \u003cp\u003eTyrosinase activity assay\u003c/p\u003e \u003cp\u003eThe cell culture, treatment and collection were the same as the above melanin contents assay. Cells were lysed by 300 \u0026micro;l of cell lysis buffer (includes 1 mM PMSF and 1 mM Triton-X 100) at -80℃ for 2 hours, melted at room temperature for about 30 min, and then centrifuged at 10000xg for 5 min. 80 \u0026micro;l supernatants plus 20 \u0026micro;l 0.01% L-DOPA were added to each well of a 96-well plate. After incubation at 37℃ for 2h, the dopachrome was measured at 475 nm and 490 nm. The results were analyzed as the percent of the control group.\u003c/p\u003e \u003cp\u003eThe dendrites counting of melanocytes\u003c/p\u003e \u003cp\u003eAfter treatment with the presence or absence of 5 mM metformin, 10 mM metformin or 1 mM arbutin for 96h, melanocytes were taken photographs under optical microscopy (200\u0026times;) that were used to count dendrites. A total of 300 cells were randomly selected for each group, the number of cells with less than or no less than 3 dendrites was recorded and the averages were taken for comparison and analysis.\u003c/p\u003e \u003cp\u003eScanning electron microscopy\u003c/p\u003e \u003cp\u003eAfter treatment with metformin for 72h in melanocytes, the cell slivers were prepared and underwent the steps of cleaning, fixation, dehydration, drying and spraying, and finally observed under scanning electron microscopy.\u003c/p\u003e \u003cp\u003eMelanosome transfer assay using immunofluorescence staining\u003c/p\u003e \u003cp\u003eMelanocyte and HaCaT cells were co-cultured in confocal dishes (NEST, China) with a ratio of 1:2, the mixed medium was prepared with MelM and HaCaT medium with a ratio of 1:2. Mixed medium containing metformin or arbutin was separately added into each group for 72h. All the cells were rinsed with PBS, fixed with 4% paraformaldehyde, permeated with Triton-X 100, blocked with 5% BSA and incubated in mixed primary antibodies of rabbit polyclonal anti-wide spectrum cytokeratin (1:200, Abcam, USA) and mouse monoclonal anti-melanoma gp100 (1:50, Abcam, USA) overnight at 4℃. Followed by mixed secondary antibodies of donkey anti-rabbit IgG H\u0026amp;L coupling Alexa Fluor\u003csup\u003e\u0026reg;\u003c/sup\u003e 647 (1:100, Abcam, USA) and goat anti-mouse IgG H\u0026amp;L coupling FITC (1:100, Abcam, USA), the cells in dishes were lastly stained with DAPI (1:1000, Beyotime, China) and melanosome transfer can be observed using Confocal Laser Scanning Microscopy (CLSM).\u003c/p\u003e \u003cp\u003eRNA extraction and RT-qPCR\u003c/p\u003e \u003cp\u003eTotal RNA was extracted with RNAiso Plus (Takara, Japan), dissolved in DEPC-treated water (Beyotime, China) and quantified spectrophotometrically. cDNA was synthesized with HiScript\u003csup\u003e\u0026reg;\u003c/sup\u003eIII RT SuperMix for qPCR (Vazyme, China) and quantitative real-time PCR was conducted with ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) according to the manufacturer\u0026rsquo;s instructions. The expression levels of genes were normalized against β-actin, and folding change was calculated by comparing 2\u003csup\u003e\u0026minus;△△CT\u003c/sup\u003e. The primers are listed below (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for real-time quantitative PCR in zebrafish and cells\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMITF\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTGAACGAAGAAGGCGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGAGATGTCTGTTTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTYR\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTCAGGTGTGCACGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCGTCACACAAAGCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTYRP1a\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCTATGAGGTGCAGTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGAGAGCGAACGACACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDCT\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGCCATCGACTTCTCGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTCGGGATGGGTCACTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLPHa\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGTGATGCGGTCCCTGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGAGAGTGAACGGCATAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRab27a\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGAGGAGATCATCAGGCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAGAGCGAGGAACTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMyo5a\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGAAAGCCACAAGTCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCTTGGGGTCAAACGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003cp\u003e(zebrafish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGACAACGGCTCCGGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCATGCCAACCATCACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMITF\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAATACGTTGCCTGTCTCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTGGGAAGGTTGGCTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTYR\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGCCCAGCATCATTCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCATCCGCTATCCCAGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTYRP1\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCAGAGGGTTCTCATAGTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCAAATTGTGGCGTGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDCT\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCAGCGAGACCAGACGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGCAATTTCATGCTGTTTCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMLPH\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCCATCTGAACGAGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCCGATCTTCACGACTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRab27a\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAACAGTGGGCATTGATTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGCTACGAAACCTCTCCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMyo5a\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGAGTCCGCTTTATTGATTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCACCCATGTTCTGACCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003cp\u003e(human)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGCCGAGGACTTTGATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGTAACAACGCATCTCATATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWestern blot\u003c/p\u003e \u003cp\u003eMelanocytes were seeded in a 6-well plate at the density of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003ecells/well, and then stimulated with or without metformin or arbutin for 72h. The protein was harvested by rinsing with cold PBS followed by scraping from the flasks and lysis with RIPA buffer (Beyotime, China) containing protease inhibitors. All proteins were quantified using a BCA protein assay kit (KeyGEN BioTECH, China) according to the steps of the manual. Equal mass and volume of proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes by electro-blotting. The PVDF membrane (Millipore, USA) containing protein was incubated in diluted primary antibody (MITF, Proteintech, China, 1:1000; TYR, ABclonal, China, 1:1000; TYRP1, Santa Cruz, USA, 1:1000; β-actin, ABclonal, China, 1:1000; MLPH, Proteintech, China, 1:1000; Rab27a, Proteintech, China, 1:1000; Myo5a, ABclonal, China, 1:1000; RhoA, Proteintech, China, 1:1000; Rac1, Proteintech, China, 1:750; ROCK1, Proteintech, China, 1:1000) for about 14-18h at 4℃. Then after incubation of secondary antibody with HRP-labeled (ABclonal, China, 1:2000), the membrane was displayed using the ECL chromogenic system.\u003c/p\u003e \u003cp\u003eCytoskeleton staining\u003c/p\u003e \u003cp\u003eCells (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e) were cultured in confocal dishes and treated with or without metformin for 48h or 72h. Cells were rinsed with PBS, fixed with 4% paraformaldehyde, permeated with Triton-X100 and then incubated in TRITC-Phalloidin (1:400, Servicebio, China) for 90min, following stained with DAPI, finally observed in CLSM.\u003c/p\u003e \u003cp\u003eDetermination of cAMP content\u003c/p\u003e \u003cp\u003eExtracellular cyclic adenosine monophosphate (cAMP) was measured using an enzyme-linked immunosorbent assay (ELISA) (Elabscience\u003csup\u003e\u0026reg;\u003c/sup\u003e, China). The preparation of cell supernatant and and procedure of cAMP detecting were carried out according to the instructions.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eEach experiment was performed in triplicate and values were presented as mean \u0026plusmn; standard deviation (SD). GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA) was used for data analysis and graphing formation. p\u0026lt;0.05 was defined as statistically significant (*p\u0026lt;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest statement\u003c/h2\u003e \u003cp\u003eThe authors have no conflict of interest to declare.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthical statement\u003c/h2\u003e \u003cp\u003eThis research was approved by the institutional ethics committee of the Institute of Dermatology, Peking Union Medical College, Chinese Academy of Medical Sciences(2022-KY-071).\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding Information\u003c/h2\u003e \u003cp\u003eThis research was supported by the National Natural Science Foundation of China (82103705) and CAMS Innovation Fund for Medical Sciences (CIFMS-2021-I2M-1-001).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eXing Liu: Writing - original draft, Writing - review \u0026amp; editing, Investigation. Xiaojie Sun: Data curation, Formal analysis, Validation. Yunyao Liu: Methodology, Supervision. Wenzhu Wang: Formal analysis. Hedan Yang: Visualization, Software. Yiping Ge: Resources. Yin Yang: Funding acquisition, Conceptualization, Project administration. Xu Chen: Project administration, Writing - review \u0026amp; editing. Tong Lin: Conceptualization, Supervision, Funding acquisition.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe would like to thank Prof. Xu Chen for his expert assistance, thank Prof. Tong Lin and Yin Yang for their funding support and experimental project.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData and materials supporting the findings of this study are available in the article and its Supplementary Figures.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCui, Y. Z. \u0026amp; Man, X. Y. Biology of melanocytes in mammals. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1309557 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor, A., Pawaskar, M., Taylor, S. L., Balkrishnan, R. \u0026amp; Feldman, S. R. Prevalence of pigmentary disorders and their impact on quality of life: a prospective cohort study. \u003cem\u003eJ. Cosmet. Dermatol.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 164\u0026ndash;168 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmatya, B. \u0026amp; Pokhrel, D. B. Assessment and Comparison of Quality of Life in Patients with Melasma and Vitiligo. \u003cem\u003eKathmandu Univ. Med. J. (KUMJ)\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e, 114\u0026ndash;118 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteingr\u0026iacute;msson, E., Copeland, N. G. \u0026amp; Jenkins, N. A. Melanocytes and the microphthalmia transcription factor network. \u003cem\u003eAnnu. Rev. Genet.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 365\u0026ndash;411 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevy, C., Khaled, M. \u0026amp; Fisher, D. E. MITF: master regulator of melanocyte development and melanoma oncogene. \u003cem\u003eTrends Mol. Med.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 406\u0026ndash;414 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026rsquo;Mello, S. A. N., Finlay, G. J., Baguley, B. C. \u0026amp; Askarian-Amiri, M. E. Signaling Pathways in Melanogenesis. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 1144 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBusc\u0026agrave;, R. \u0026amp; Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. \u003cem\u003ePigment Cell. Res.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 60\u0026ndash;69 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorre, S. et al. UV-induced expression of key component of the tanning process, the POMC and MC1R genes, is dependent on the p-38-activated upstream stimulating factor-1 (USF-1). \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cb\u003e279\u003c/b\u003e, 51226\u0026ndash;51233 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdelman, A. M., Blumenthal, D. K. \u0026amp; Krebs, E. G. Protein serine/threonine kinases. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cb\u003e56\u003c/b\u003e, 567\u0026ndash;613 (1987).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBusc\u0026agrave;, R. et al. Inhibition of Rho is required for cAMP-induced melanoma cell differentiation. \u003cem\u003eMol. Biol. Cell.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 1367\u0026ndash;1378 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRidley, A. J. \u0026amp; Hall, A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. \u003cem\u003eCell\u003c/em\u003e. \u003cb\u003e70\u003c/b\u003e, 389\u0026ndash;399 (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEtienne-Manneville, S. \u0026amp; Hall, A. Rho GTPases in cell biology. \u003cem\u003eNature\u003c/em\u003e. \u003cb\u003e420\u003c/b\u003e, 629\u0026ndash;635 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheth, V. M. \u0026amp; Pandya, A. G. Melasma: a comprehensive update: part I. \u003cem\u003eJ. Am. Acad. Dermatol.\u003c/em\u003e \u003cb\u003e65\u003c/b\u003e, 689\u0026ndash;697 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArtzi, O. et al. The pathogenesis of melasma and implications for treatment. \u003cem\u003eJ. Cosmet. Dermatol.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 3432\u0026ndash;3445 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBubna, A. K. Metformin - For the dermatologist. \u003cem\u003eIndian J. Pharmacol.\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 4\u0026ndash;10 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujita, Y., Inagaki, N. \u0026amp; Metformin New Preparations and Nonglycemic Benefits. \u003cem\u003eCurr. Diab Rep.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 5 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller, R. A. et al. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. \u003cem\u003eNature\u003c/em\u003e. \u003cb\u003e494\u003c/b\u003e, 256\u0026ndash;260 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLehraiki, A. et al. Inhibition of melanogenesis by the antidiabetic metformin. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e134\u003c/b\u003e, 2589\u0026ndash;2597 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanavase Channakeshavaiah, R. Andanooru Chandrappa, N. K. Topical metformin in the treatment of melasma: A preliminary clinical trial. \u003cem\u003eJ. Cosmet. Dermatol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 1161\u0026ndash;1164 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAboAlsoud, E. S., Eldahshan, R. M., AbouKhodair Mohammed, H. \u0026amp; Elsaie, M. L. Safety and efficacy of topical metformin 30% cream versus triple combination cream (Kligman\u0026rsquo;s formula) in treating melasma: A randomized controlled study. \u003cem\u003eJ. Cosmet. Dermatol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 2508\u0026ndash;2515 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNathan, D. M. et al. Medical management of hyperglycemia in type 2 diabetes: a consensus algorithm for the initiation and adjustment of therapy: a consensus statement of the American Diabetes Association and the European Association for the Study of Diabetes. \u003cem\u003eDiabetes Care\u003c/em\u003e. \u003cb\u003e32\u003c/b\u003e, 193\u0026ndash;203 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYusupova, M. et al. Distinct cAMP Signaling Microdomains Differentially Regulate Melanosomal pH and Pigmentation. \u003cem\u003eJ. Invest. Dermatol.\u003c/em\u003e \u003cb\u003e143\u003c/b\u003e, 2019\u0026ndash;2029e3 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLajis, A. F. B. A Zebrafish Embryo as an Animal Model for the Treatment of Hyperpigmentation in Cosmetic Dermatology Medicine. \u003cem\u003eMed. (Kaunas)\u003c/em\u003e. \u003cb\u003e54\u003c/b\u003e, 35 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcKesey, J., Tovar-Garza, A. \u0026amp; Pandya, A. G. Melasma Treatment: An Evidence-Based Review. \u003cem\u003eAm. J. Clin. Dermatol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 173\u0026ndash;225 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon, S. H., Hwang, Y. J., Lee, S. K. \u0026amp; Park, K. C. Heterogeneous Pathology of Melasma and Its Clinical Implications. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 824 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar, R., Bansal, A. \u0026amp; Ailawadi, P. Future therapies in melasma: What lies ahead? \u003cem\u003eIndian J. Dermatol. Venereol. Leprol.\u003c/em\u003e \u003cb\u003e86\u003c/b\u003e, 8\u0026ndash;17 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTadokoro, R. \u0026amp; Takahashi, Y. Intercellular transfer of organelles during body pigmentation. \u003cem\u003eCurr. Opin. Genet. Dev.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e, 132\u0026ndash;138 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, X., Cui, Z., Liu, S., Zhou, J. \u0026amp; Cui, R. Melanosome transport and regulation in development and disease. \u003cem\u003ePharmacol. Ther.\u003c/em\u003e \u003cb\u003e219\u003c/b\u003e, 107707 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWettschureck, N. \u0026amp; Offermanns, S. Rho/Rho-kinase mediated signaling in physiology and pathophysiology. \u003cem\u003eJ. Mol. Med. (Berl)\u003c/em\u003e. \u003cb\u003e80\u003c/b\u003e, 629\u0026ndash;638 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, W. Q. et al. Narrow-band UVB radiation promotes dendrite formation by activating Rac1 in B16 melanoma cells. \u003cem\u003eMol. Clin. Oncol.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e, 858\u0026ndash;862 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott, G. \u0026amp; Leopardi, S. The cAMP signaling pathway has opposing effects on Rac and Rho in B16F10 cells: implications for dendrite formation in melanocytic cells. \u003cem\u003ePigment Cell. Res.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 139\u0026ndash;148 (2003).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Metformin, Melanogenesis, Melanosome transfer, cAMP","lastPublishedDoi":"10.21203/rs.3.rs-4861391/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4861391/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSeveral studies have demonstrated the inhibitory effect of metformin on pigmentation. However, the effect of metformin on melanosome transfer remains unknown. The goals of this study were to elucidate the effects of metformin on melanogenesis and melanosome transfer and explore the related mechanisms. We determined that, compared with those in the control zebrafish, the area occupied by pigment granules, melanin content, tyrosinase activity, and the expression levels of melanogenesis genes and melanosome transfer-related genes were reduced in metformin-treated zebrafish. In human primary melanocytes, MNT1 cells/B16F10 cells, metformin also plays a negative role in melanin synthesis regardless of health status and α-MSH-induced pigmentation. Unlike arbutin, metformin inhibited the formation of dendrites and filopodia-like structures and suppressed melanosome transfer. After treatment with metformin, the cAMP content was reduced, the expression of MITF and downstream molecules was downregulated, and the expression of Rho GTPases was changed. Furthermore, metformin partially abrogated the changes in genes regulating melanin synthesis, melanosome transfer and the cytoskeleton induced by a cAMP activator. Our study revealed that metformin can serve as a candidate depigmentation agent.\u003c/p\u003e","manuscriptTitle":"Metformin inhibits melanin synthesis and melanosome transfer through the cAMP pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-25 19:59:12","doi":"10.21203/rs.3.rs-4861391/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-17T07:28:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-16T04:22:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-15T10:01:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"13151065113500107785075318142508572242","date":"2024-10-05T21:54:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"47303054275981794277082085813418254862","date":"2024-10-04T09:20:05+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-03T13:29:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-13T21:05:36+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-26T10:26:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-26T10:23:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-05T10:46:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"226cdfd5-ebf1-4473-bff4-5b898479c311","owner":[],"postedDate":"September 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":38115623,"name":"Health sciences/Diseases/Skin diseases"},{"id":38115624,"name":"Biological sciences/Drug discovery"}],"tags":[],"updatedAt":"2025-04-07T16:03:43+00:00","versionOfRecord":{"articleIdentity":"rs-4861391","link":"https://doi.org/10.1038/s41598-025-95245-x","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-04-03 15:57:17","publishedOnDateReadable":"April 3rd, 2025"},"versionCreatedAt":"2024-09-25 19:59:12","video":"","vorDoi":"10.1038/s41598-025-95245-x","vorDoiUrl":"https://doi.org/10.1038/s41598-025-95245-x","workflowStages":[]},"version":"v1","identity":"rs-4861391","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4861391","identity":"rs-4861391","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}