Molecular Characterization and Antibiotic Resistance Profile ofEscherichia coliIsolated From Liver Abscess

27

Bacterial liver abscess is the most common hepatic infection, which can lead to 28 death. Escherichia coli is among the many species of bacteria that cause it. This study was 29 conducted to isolate E. coli from liver abscess and then to characterise the bacteria's molecular 30 makeup and antibiotic resistance profile. 31

A total of 208 stool samples were collected from patients showing symptoms of liver 32 abscess. E. coli was isolated from these samples followed by identification by biochemical tests. 33 Pure and biochemically positive colonies were confirmed by polymerase chain reaction. The disk 34 diffusion method was used to ascertain the pattern of antibiotic resistance exhibited by E. coli 35 isolates. 36

The PCR amplification efficiency was nearly 100% since all of the samples appeared at 37 284 molecular base pairs (bp), which is considered to be the optimal parameter assay. The 38 antimicrobial susceptibility pattern showed that isolates were resistant to many drugs but 100% 39 and 92% of the isolates were susceptible to imipenem and azithromycin, respectively. All 40 isolates were resistant to ampicillin, vancomycin, and cefotaxime. This was followed by 41 ceftazidime (72%), tetracycline (84%), trimethoprim (80%), streptomycin (96%), linezolid 42 (92%), Teicoplanin (80%), nalidixic acid (84%), ciprofloxacin (92%), and chloramphenicol 43 (72%). 44

Multiple drug resistant E. coli is one of the causes of liver abscesses in humans. 45

Bacteria; Liver; PCR; Resistance; biochemical 46 47 48 49 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 3 1. Introduction 50 Enterobacteriales, a bacterial order in the phylum Proteobacteria, consists of several important 51 intestinal pathogens (Bujňáková et al., 2022). This order includes persistent gut colonizers that 52 make up small microbiota components under healthy conditions (Riccio and Rossano, 2020). As 53 long as the microbiota is in balance and the complex and dense bacterial population inhibits their 54 overgrowth, opportunistic Enterobacteria can continue to exist as gut commensals without 55 causing any infections (Rao et al., 2020). A disruption of the microbiota can result in a bloom of 56 Enterobacteria, which can cause pathogen-mediated illnesses and inflammatory reactions in the 57 host (Amaretti et al., 2020). 58 The most studied species among the Enterobacteria is Escherichia coli in terms of the 59 traits that differentiate pathogenicity and commensalism (Dalmasso et al., 2023). It mostly 60 colonizes the intestine, but it also includes many pathogenic variations that can cause infections 61 in other tissues or the gut, in addition to harmless commensals. E. coli is also found in patients 62 with liver complications such as ascites or urinary tract infections. Patients with liver disease 63 have a decreased ability to fight against bacterial infections, which exposes them to risk of 64 infections, sepsis, and even death. Among these patients, spontaneous bacterial peritonitis, 65 bacteremia, skin and soft tissue infections, pneumonia and urinary tract infections are the most 66 frequent bacterial illnesses (Bunchorntavakul et al., 2016). The most common causes are Gram 67 negative bacteria. The majority of research interest has been focused on virulent strains of E. coli 68 isolated from infected patients (Dalmasso et al., 2023), but there has also been a growing focus 69 on environmental strains and faecal isolates from healthy subjects in an effort to assess the 70 pathogenic potential of a larger reservoir of biodiversity (Keesing and Ostfeld, 2021). 71 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 4 Escherichia coli is a gram-negative, rod-shaped, facultatively anaerobic bacterium, which 72 is usually found in the lower intestine of worm-blooded species that are endotherms (Tenaillon et 73 al., 2010). Living in the lower digestive tract, E. coli is present within the first 24 hours of birth 74 (Bettelheim and Lennox-King, 1976). The gut microbiota is made up of over 500 different 75 species of bacteria, with 1010–1011 cells per gram of large-intestinal content. Along with other 76 facultative anaerobes, E. coli makes up around 0.1% of the local gut flora (Berg, 1996; Eckburg 77 et al., 2005). As a normal component of the flora, it is primarily regarded as helpful to humans 78 (Croxen and Finlay, 2010). E. coli has the unusual ability to be utilized as an indicator organism 79 to check for microbial contamination in water sources (Devane et al., 2020). Certain pathogenic 80 strains are also present. The pathogenicity of a given pathotype is determined by the presence of 81 a set of virulence factors, which facilitate the infection of humans and animals with the bacteria 82 and the manifestation of specific symptoms (Watkins et al., 2016). 83 Antimicrobials are usually used for treating infected patients and also for prophylaxis for 84 certain ailments. The antimicrobial abuse and inadequate selection are the key reasons for the 85 emergence of resistance among several bacteria and this makes the antibacterial therapy more 86 difficult (FR et al., 2019). Since E. coli are commensal bacteria, they are thought to be a 87 reservoir of pathogenic bacteria's resistance genes (Lambrecht et al., 2019). Their degree of 88 resistance is thought to be a useful indicator of the selection pressure brought on by the 89 administration of antibiotics as well as the likelihood that these pathogens may have resistance 90 challenges (Hoang et al., 2017). In addition to transmit antibiotic resistance genes to other E. coli 91 strains, resistant strains of the bacterium can also pick up resistance from other species and 92 transfer it to other bacteria in the gastrointestinal tract (Tawfick et al., 2022). Thus, determining 93 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 5 the prevalence of E. coli in liver abscess as well as characterizing the bacteria's molecular 94 makeup and antibiotic resistance profile was the main objective of this study. 95 96 2. Materials and Methods 97 2.1. Culture media and chemicals 98 Luria broth, nutrient agar, beef extract, MacConkey agar, Simmon’s citrate agar, crystal violet, 99 and antibiotic discs (ampicillin, tetracycline, streptomycin, cephotaxime, azithromycin, 100 chloramphenicol, linezolid, teicoplanin, nalidixic acid, ciprofloxacin, trimethoprim and 101 imipenem)., St Louis, MO, USA. Sodium chloride, were purchased from Sigma Chemical Co, 102 hydrogen peroxide, dextrose, lactose, and glucose were procured from Merck, Darmstadt, 103 Germany. All other chemicals were from Shandong Chemicals, China and were of the highest 104 grade available. 105 2.2. Sample collection and Enrichment 106 Early morning stool samples (~3 g) were collected from individuals at their residence in sterile 107 blue cap stool containers. The sample was enriched by adding fecal sample (20µl) to 2ml of 108 Luria broth followed by incubation overnight at 37°C. 109 2.3. Isolation and purification 110 The samples were initially grown (18–24 hours) in nutrient broth at 37ºC and then they were 111 sub-cultured using the streak plate method onto MacConkey agar (Zinnah et al., 2007). The 112 culture was incubated at 37°C for 24 hours until the pure culture with homogenous colonies were 113 obtained. Isolated red/pink colonies were re-streaked on the same agar. The re-streaked petri 114 plates were incubated for 24 hours at 37°C for further purification. 115 116 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 6 2.4. Identification 117 The purified colonies on re-streaked MacConkey agar were further identified by Gram staining 118 (Kohlerschmidt et al., 2021) and by different biochemical tests. 119 2.4.1. Biochemical Tests 120 Bacterial strains were biochemically identified by various tests, e.g., catalase (Chauhan et al., 121 2020), oxidase (Horne et al., 2024), indole (Alves et al., 2006), methyl red (Shoaib et al., 2020), 122 citrate (Rahman et al., 2021), triple sugar iron agar (Zinnah et al., 2007), and V oges-Proskauer 123 (Zinnah et al., 2007). 124 2.5. DNA Extraction 125 After 24h incubation the broth was centrifuged at 12,000g for 5 min. The supernatant was 126 discarded and distilled water was added to the pellet. After 5 sec vortexing, the samples were 127 transferred to Eppendorf tube followed by centrifugation at 12,000 rpm for 5 min. The pellet was 128 washed and centrifuged again. After removing supernatant, the pellet was resuspended in 300µl 129 10% Chelex. After 30 min incubation at 99°C, supernatant was isolated by centrifugation at 130 12000rpm for 5min (Mahmoud et al., 2020). 131 2.6. PCR amplification 132 Pure and biochemically positive colonies were confirmed by polymerase chain reaction. Using 133 the Sul 1 primer pairs forward (CGCACCGGAAACATCGCTGCAC) and reverse 134 (TGAAGTTCCGCCGCAAGGCTCG), resistant gene segments in bacterial positive isolates 135 (~284 bp) were amplified using PCR. The PCR mixes were prepared according to manufacturer's 136 directions. The PCR amplification was conducted in a 25.0 µl reaction mixture, consisting of 137 12.5 µl of master mix, 2.0 µl of DNA, 1.5 µl of each primer and 7.5 µl of distilled water. 138 Thermal cycling machine was set up to amplify DNA for 35 cycles. The PCR was 139 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 7 initially denaturated for 15 minutes at 95°C. Next, it was denaturated and annealed for 1 minute 140 at 94°C and 52°C, respectively. Finally, it was extended for 1 minute at 72°C and concluded the 141 PCR with a final extension for 15 minutes at 72°C (Mahmoud et al., 2020). 142 2.7. Gel Electrophoresis 143 PCR was followed by gel electrophoresis to visualize the bands. Extracted DNA (5 µl) was 144 added to each well after adding ethidium bromide (1.5 µl) into agarose gel (2%) and pouring into 145 the casting tray to solidify. The current was adjusted to 100 amps for 30 min while the applied 146 voltage was 60 volts. Following that, a UV transilluminator was used to view the PCR result 147 (Mahmoud et al., 2020). 148 2.8. Antibiotic Susceptibility Test 149 The Kirby-Bauer disc diffusion method was used to screen the 208 isolates for antibiotic 150 resistance. Fourteen antibiotics were tested, e.g., ampicillin, vancomycin, cefotaxime, 151 ceftazidime, imipenem, tetracycline, trimethoprim, streptomycin, linezolid, Teicoplanin, 152 nalidixic acid, ciprofloxacin, chloramphenicol, and azithromycin. The recommendations' stated 153 antibiotic minimum inhibitory concentration (MIC) was used to classify E. coli patterns as 154 "resistant", "intermediate resistant," or "sensitive". The word "resistant" was applied to all 155 isolates exhibiting "resistant" or "intermediate resistant" patterns (Mahmoud et al., 2020). 156 3. Results 157 3.1. Isolation of E. coli 158 Two hundred eight samples were taken and successfully grown on MacConkey agar media plus 159 Cefotaxime. Ninety one samples showed positive results which exhibit 43% samples were 160 identified as E. coli. 161 162 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 8 3.2. Biochemical tests 163 The biochemical characteristics of E. coli strains are shown in Table 4. In biochemical study all 164 the isolates revealed positive reaction in catalase, oxidase and TSI, with the production of acid 165 and gas within 24-48 hrs of incubation. The isolates also showed negative reaction in Simmon’s 166 citrate and VP test and differential results in Indole and methyl red test. 167 3.3. Polymerase chain reaction (PCR) 168 The PCR results showed that all subject's DNA was visible at the 284 bp DNA molecular ladder. 169 According to the findings, DNA was amplified to 284 bp and aligned using a DNA molecular 170 ladder (Figure 6). 171 172 Figure 3. PCR results after DNA molecular ladder analysis and agarose gel electrophoresis. 173 174 175 176 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 9 3.4. Phenotypic confirmation of extended spectrum beta-lactamase (ESBL) E. coli 177 The zone of inhibition of corner antibiotics (Aug and TZP) diffused into the center antibiotics 178 (CRO) showed positive results for ESBL production (20-25 mm from corner to center) as shown 179 in figure 4. Table 5 shows antimicrobial susceptibility pattern of E. coli. The antimicrobial 180 susceptibility pattern showed that isolates were resistant to most of the drugs, however 100% of 181 isolates were susceptible to imipenem and 92% to azithromycin respectively. The isolates 182 showed resistance to ampicillin (100%), vancomycin (100%) and cefotaxime (100%), were the 183 highest among the antibiotics used, followed by ceftazidime (72%), tetracycline (84%), 184 trimethoprim (80%), streptomycin (96%), linezolid (92%), Teicoplanin (80%), nalidixic acid 185 (84%), ciprofloxacin(92%) and chloramphenicol (72%). 186 Table 5. Antimicrobial susceptibility pattern of E. coli. 187 S. No. Antibiotics Resistance (%) Sensitivity (%) Intermediate (%) 1. Ampicillin 100 0 0 2. Cefotaxime 100 0 0 3. Ceftazidime 72 28 0 4. Tetracycline 84 16 0 5. Trimethoprim 80 20 0 6. Imipenem 0 100 0 7. Chloramphenicol 72 24 4 8. Streptomycin 96 0 4 9. Linezolid 92 0 8 10. Teicoplanin 80 0 20 11. Vancomycin 100 0 0 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 10 12. Nalidixic Acid 84 0 16 13. Ciprofloxacin 92 0 8 14. Azithromycin 4 92 4 188 4. Discussion 189 Multidrug resistant E. coli has grown to be a concerning issue and has been observed in 190 increasing numbers in humans. E. coli is a common cause of contaminated drinking water, which 191 can result in significant complications such liver abscess, diarrhoea, and enteritis. It is also one of 192 the main etiologic agents causing urinary tract infections, sepsis, enteritis, and meningitis (Su 193 and Brandt, 1995). Global public health is greatly affected by antibiotic resistant E. coli 194 (Galindo-Méndez, 2020; Puvača and de Llanos Frutos, 2021). These resistant bacteria could 195 raise the risk to human health (Nji et al., 2021; Ramos et al., 2020). Therefore, it is critical to get 196 further knowledge about such issues. 197 The antimicrobial susceptibility pattern of the isolates in this investigation revealed that 198 they were resistant to a majority of drugs tested; however, 100% of the isolates were responsive 199 to imipenem and 92% to azithromycin. Among the antibiotics used, the isolates exhibited the 200 highest levels of resistance to ampicillin (100%), vancomycin (100%), and cefotaxime (100%). 201 These were followed by ceftazidime (72%), tetracycline (84%), trimethoprim (80%), 202 streptomycin (96%), linezolid (92%), Teicoplanin (80%), nalidixic acid (84%), ciprofloxacin 203 (92%), and chloramphenicol (72%). These bacterial species can acquire a large number of 204 resistance genes, primarily by horizontal gene transfer (Zarei-Baygi and Smith, 2021). 205 The Gram stain is a commonly utilized technique for the identification and differentiation 206 of bacteria (Budin et al., 2012). This method is widely applied in clinical diagnostics, 207 environmental sample detection, and identification of bacterial species. Since crystal violet binds 208 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 11 to both Gram-positive and Gram-negative bacteria's peptidoglycan layer, it is employed in the 209 staining procedure for bacterial samples. Crystal violet produces an insoluble complex when it 210 comes into contact with an iodine solution (Becerra et al., 2016; Biswas et al., 1970; Claus, 211 1992). A thick peptidoglycan coating covers Gram-positive bacteria, while lipopolysaccharides 212 and lipoproteins cover Gram-negative bacteria. Gram-negative bacteria lose colour when 213 decolorized with acetone or alcohol, Gram-positive bacteria retain their purple colour 214 (Kohlerschmidt et al., 2021). The isolates of bacteria were Gram negative based on our Gram 215 staining results. Staining is a reliable and simple procedure, but the final detection is still done by 216 optical microscopy, which is often susceptible to user-dependent sampling error. 217 In this study, E. coli were isolated and identified through conventional microbiological 218 analysis. The outcomes of the microbiological detection of E. coli were comparable since, in 219 addition to culture-based detection, the selected isolates' molecular identity was determined by 220 PCR amplification using 16s rDNA. To establish specificity, we optimized primer and annealing 221 temperature for DNA amplification using a standard set of samples and precise calculations 222 based on nucleotide presence in the study's DNA sequence. The gradient temperature in this 223 experiment was determined using the forward and reverse primers. 224 The PCR amplification efficiency was very nearly 100% since all of the samples 225 appeared at 284 molecular base pairs (bp), which is considered to be the ideal parameter assay. A 226 pilot study would require an amplification efficiency of 90% – 105%. Inadequate primer design 227 or less-than-ideal reaction conditions in relation to the PCR's components can lead to low 228 reaction efficiency. (Bunu et al., 2020). Agarose gel electrophoresis of all the amplified products 229 produced bands that were positive for identification. All of the samples were confirmed to be E. 230 coli using molecular identification. 231 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 12 232

233 Antimicrobial susceptibility assay revealed that the most prevalent resistance patterns against 234 ampicillin, vancomycin, tetracycline, cefotaxime, streptomycin, linezolid, and ciprofloxacin. 235 These were followed by nalidixic acid, Teicoplanin, trimethoprim, and chloramphenicol. On the 236 other hand, azithromycin and imipenem were the most effective antimicrobials. It can be 237 concluded that E. coli showed anti-biotic resistance in liver abscess. 238 239 Ethical approval 240 Ethical approval was not applicable. 241 Financial disclosure 242 The authors declared that this study has received no financial support. 243 Declaration of Competing Interest 244 The authors declare that they have no known competing financial interests or personal 245 relationships that could have appeared to influence the work reported in this paper. 246

247 The authors thank the Department of Biosciences COMSATS University Islamabad for all the 248 support provided. 249 250 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 13

251 Alves, M.S., Dias, R.C.d.S., de Castro, A.C.D., Riley, L.W., Moreira, B.M., 2006. Identification of clinical 252 isolates of indole-positive and indole-negative Klebsiella spp. Journal of clinical microbiology 44, 253 3640-3646. 254 Amaretti, A., Righini, L., Candeliere, F., Musmeci, E., Bonvicini, F., Gentilomi, G.A., Rossi, M., Raimondi, S., 255 2020. Antibiotic resistance, virulence factors, phenotyping, and genotyping of non-Escherichia 256 coli Enterobacterales from the gut microbiota of healthy subjects. International journal of 257 molecular sciences 21, 1847. 258 Becerra, S.C., Roy, D.C., Sanchez, C.J., Christy, R.J., Burmeister, D.M., 2016. An optimized staining 259 technique for the detection of Gram positive and Gram negative bacteria within tissue. BMC 260 research notes 9, 1-10. 261 Berg, R.D., 1996. The indigenous gastrointestinal microflora. Trends in microbiology 4, 430-435. 262 Bettelheim, K., Lennox-King, S., 1976. The acquisition of Escherichia coli by new-born babies. Infection 4, 263 174-179. 264 Biswas, B., Basu, P ., Pal, M., 1970. Gram staining and its molecular mechanism. International review of 265 cytology 29, 1-27. 266 Budin, G., Chung, H.J., Lee, H., Weissleder, R., 2012. A ‘Magnetic’Gram Stain for Bacterial Detection. 267 Angewandte Chemie (International ed. in English) 51, 7752. 268 Bujňáková, D., Puvača, N., Ćirković, I. 2022. Virulence factors and antibiotic resistance of 269 enterobacterales (MDPI), 1588. 270 Bunchorntavakul, C., Chamroonkul, N., Chavalitdhamrong, D., 2016. Bacterial infections in cirrhosis: A 271 critical review and practical guidance. World Journal of Hepatology 8, 307. 272 Bunu, S.J., Otele, D., Alade, T., Dodoru, R.T., 2020. Determination of serum DNA purity among patients 273 undergoing antiretroviral therapy using NanoDrop-1000 spectrophotometer and polymerase 274 chain reaction. Biomed Biotechnol Res J 4, 214-219. 275 Chauhan, A., Jindal, T., Chauhan, A., Jindal, T., 2020. Biochemical and molecular methods for bacterial 276 identification. Microbiological methods for environment, food and pharmaceutical analysis, 425-277 468. 278 Claus, D., 1992. A standardized Gram staining procedure. World journal of Microbiology and 279 Biotechnology 8, 451-452. 280 Croxen, M.A., Finlay, B.B., 2010. Molecular mechanisms of Escherichia coli pathogenicity. Nature Reviews 281 Microbiology 8, 26. 282 Dalmasso, G., Beyrouthy, R., Brugiroux, S., Ruppé, E., Guillouard, L., Bonnin, V., Saint-Sardos, P ., 283 Ghozlane, A., Gaumet, V., Barnich, N., 2023. Genes mcr improve the intestinal fitness of 284 pathogenic E. coli and balance their lifestyle to commensalism. Microbiome 11, 12. 285 Devane, M.L., Moriarty, E., Weaver, L., Cookson, A., Gilpin, B., 2020. Fecal indicator bacteria from 286 environmental sources; strategies for identification to improve water quality monitoring. Water 287 Research 185, 116204. 288 Eckburg, P .B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R., Nelson, K.E., 289 Relman, D.A., 2005. Diversity of the human intestinal microbial flora. science 308, 1635-1638. 290 FR, E.S., AH, A., MM H, W., AS, B., Mwafy, A., 2019. Antimicrobial resistance and molecular 291 characterization of pathogenic E. coli isolated from chickens. Journal of Veterinary Medical 292 Research 26, 280-292. 293 Galindo-Méndez, M., 2020. Antimicrobial resistance in Escherichia coli. E. Coli Infections-Importance of 294 Early Diagnosis and Efficient Treatment, 1-20. 295 Hoang, P .H., Awasthi, S.P ., Do Nguyen, P ., Nguyen, N.L.H., Nguyen, D.T.A., Le, N.H., Van Dang, C., 296 Hinenoya, A., Yamasaki, S., 2017. Antimicrobial resistance profiles and molecular 297 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 14 characterization of Escherichia coli strains isolated from healthy adults in Ho Chi Minh City, 298 Vietnam. Journal of Veterinary Medical Science 79, 479-485. 299 Horne, B.A., Badji, H., Bhuiyan, M.T.R., Romaina Cachique, L., Cornick, J., Hotwani, A., Juma, J., Ochieng, 300 J.B., Abdou, M., Apondi, E. 2024. Microbiological methods used in the Enterics for Global Health 301 Shigella surveillance study. In: Open Forum Infectious Diseases, S25-S33. 302 Keesing, F., Ostfeld, R.S., 2021. Impacts of biodiversity and biodiversity loss on zoonotic diseases. 303 Proceedings of the National Academy of Sciences 118, e2023540118. 304 Kohlerschmidt, D.J., Mingle, L.A., Dumas, N.B., Nattanmai, G. 2021. Identification of aerobic Gram-305 negative bacteria, In: Practical handbook of microbiology. CRC Press, 59-70. 306 Lambrecht, E., Van Coillie, E., Van Meervenne, E., Boon, N., Heyndrickx, M., Van de Wiele, T., 2019. 307 Commensal E. coli rapidly transfer antibiotic resistance genes to human intestinal microbiota in 308 the Mucosal Simulator of the Human Intestinal Microbial Ecosystem (M-SHIME). International 309 journal of food microbiology 311, 108357. 310 Mahmoud, N.E., Altayb, H.N., Gurashi, R.M., 2020. Detection of carbapenem-resistant genes in 311 Escherichia coli isolated from drinking water in khartoum, Sudan. Journal of environmental and 312 public health 2020. 313 Nji, E., Kazibwe, J., Hambridge, T., Joko, C.A., Larbi, A.A., Damptey, L.A.O., Nkansa-Gyamfi, N.A., Stålsby 314 Lundborg, C., Lien, L.T.Q., 2021. High prevalence of antibiotic resistance in commensal 315 Escherichia coli from healthy human sources in community settings. Scientific reports 11, 3372. 316 Puvača, N., de Llanos Frutos, R., 2021. Antimicrobial resistance in Escherichia coli strains isolated from 317 humans and pet animals. Antibiotics 10, 69. 318 Rahman, M.S., Rana, M.S., Hosen, M.B., Habib, M.A., Nur, A., Kaly, M.K., Matin, M.N., Nasirujjaman, K., 319 Rahman, M.M., 2021. Isolation and characterization of bacteria from fermented cooked-rice. 320 Biologia 76, 2359-2364. 321 Ramos, S., Silva, V., Dapkevicius, M.d.L.E., Caniça, M., Tejedor-Junco, M.T., Igrejas, G., Poeta, P ., 2020. 322 Escherichia coli as commensal and pathogenic bacteria among food-producing animals: Health 323 implications of extended spectrum β-lactamase (ESBL) production. Animals 10, 2239. 324 Rao, K., Seekatz, A., Bassis, C., Sun, Y ., Mantlo, E., Bachman, M.A., 2020. Enterobacterales infection after 325 intestinal dominance in hospitalized patients. Msphere 5, 10.1128/msphere. 00450-00420. 326 Riccio, P ., Rossano, R., 2020. The human gut microbiota is neither an organ nor a commensal. FEBS 327 letters 594, 3262-3271. 328 Shoaib, M., Muzammil, I., Hammad, M., Bhutta, Z.A., Yaseen, I., 2020. A mini-review on commonly used 329 biochemical tests for identification of bacteria. International Journal of Research Publications 54, 330 1-7. 331 Su, C., Brandt, L.J., 1995. Escherichia coli O157: H7 infection in humans. Annals of internal medicine 123, 332 698-707. 333 Tawfick, M.M., Elshamy, A.A., Mohamed, K.T., El Menofy, N.G., 2022. Gut commensal Escherichia coli, a 334 high-risk reservoir of transferable plasmid-mediated antimicrobial resistance traits. Infection and 335 Drug Resistance, 1077-1091. 336 Tenaillon, O., Skurnik, D., Picard, B., Denamur, E., 2010. The population genetics of commensal 337 Escherichia coli. Nature Reviews Microbiology 8, 207. 338 Watkins, E.R., Maiden, M.C., Gupta, S., 2016. Metabolic competition as a driver of bacterial population 339 structure. Future microbiology 11, 1339-1357. 340 Zarei-Baygi, A., Smith, A.L., 2021. Intracellular versus extracellular antibiotic resistance genes in the 341 environment: Prevalence, horizontal transfer, and mitigation strategies. Bioresource technology 342 319, 124181. 343 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint 15 Zinnah, M., Bari, M., Islam, M., Hossain, M., Rahman, M., Haque, M., Babu, S., Ruma, R., Islam, M., 2007. 344 Characterization of Escherichia coli isolated from samples of different biological and 345 environmental sources. Bangladesh Journal of Veterinary Medicine 5, 25-32. 346 347 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted May 23, 2024. ; https://doi.org/10.1101/2024.05.23.595549doi: bioRxiv preprint