Expression and prognostic value of Melanoma-associated antigen D2 in gliomas | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression and prognostic value of Melanoma-associated antigen D2 in gliomas Jun Yan, Shenyu Li, Cameron Lenahan, Kaijing Fu, Yong Mo, Hainan Chen, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1635612/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction The melanoma-associated antigen D4 (MAGED2) is one of the melanoma-associated antigen family members. It is commonly overexpressed in a variety of malignancies. However, the mechanism and function of MAGED2 in glioma remain unknown. Methods The TCGA and Oncomine databases were used to determine the expression level of MAGED2 and its relationship to glioma. MAGED2 protein expression in 98 tumor tissues from glioma patients was measured using RT-qPCR, Western blot and immunohistochemistry, and the associations between MAGED4 expression and clinicopathological factors were evaluated. qRT-PCR and Western blots were used to assess the levels of MAGED2 and CDKN1A expression in glioma U251-MG cells following transfection of MAGED2 CRISPR. CCK-8, colony formation, and EdU assays were used to assess the effect of MAGED2 on U251-MG cell proliferation, and flowcytometry was used to track changes in the cell cycle and cell apoptosis following MAGED2 CRISPR transfection. Results In the current investigation, MAGED2 was shown to be substantially expressed in human glioma tissues, and high MAGED2 expression predicted poor recurrence-free survival (RFS) and overall survival (OS) for glioma patients. The presence of high MAGED2 expression was related to WHO grade, Ki-67, IDH1/2, MGMT, and survival status. Furthermore, MAGED2 expression knockdown significantly inhibited the proliferation and colony formation potential of U251-MG cells by preventing cell cycle arrest at the G0/G1 phase and triggering apoptosis. Moreover, our findings indicated that the mRNA and protein expression levels of CDKN1A were considerably up-regulated in vitro following MAGED2 CRISPR transfection. MAGED2 downregulation inhibited the ability of cell proliferation in the U251-MG cells through restoring CDKN1A. Conclusions To conclude, the current study's findings imply that a high level of MAGED2 expression predicts a poor prognosis for glioma patients. MAGED2 can stimulate the proliferation of glioma U251-MG cells by targeting CDKN1A. MAGED2 may be a possible biomarker for glioma and an important prognostic factor for glioma patients. melanoma-associated antigen-D2 CDKN1A glioma proliferation Prognosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Malignant glioma remains the most frequent and severe primary brain tumor, with substantial morbidity and fatality rates[ 1 ]. Glioma can be treated using a variety of methods, including surgery, radiation, and chemotherapy. However, the prognosis for glioma patients, particularly glioblastoma (GBM), remains poor as a result of the high tumor recurrence rate[ 2 ]. This dismal prognosis is largely due to the invasive nature of malignant glioma[ 3 ]. At present, the molecular processes driving glioma invasion remain unknown; consequently, it is vital that a more thorough understanding of the biological and molecular mechanisms underpinning glioma formation and progression is procured to develop more effective therapies. The melanoma-associated antigen D2 (MAGED2) is a member of the melanoma-associated antigen family which is consistent with Type I genes (MAGE-A, -B and -C) and type II genes (MAGE-D, -E, -F, -G and -H)[ 4 ]. MAGED2 has been identified as being critical for transcriptional regulation, epigenetic alteration, and cell development and differentiation[ 5 ]. Furthermore, numerous studies have shown that MAGED2 is a tumor-specific antigen that plays an important role in tumor progression and metastasis, including hepatocellular carcinoma[ 6 ],gastric cancer[ 7 ], and lymphoma[ 8 ]. As a result, MAGED2 is expected to become a potential cancer target, and may play an important role in tumor progression. However, the precise function and mechanism of MAGED2 in glioma is still unknown. The goal of current research aims to investigate the MAGED2 gene's potential as a cancer-associated tumor marker, which might serve as a beneficial prognostic biomarker and immunotherapeutic target for glioma. Materials And Methods Bioinformatic analyses On the basis of the Cancer Genome Atlas-Cancer Genome (TCGA database, https://cancergenome.nih.gov/), prognostic data from glioblastoma(GBM) patients and low grade glioma (LGG) patients were obtained from the OncoLnc database (https://www.oncolnc.org/). Furthermore, overall survival (OS) has been calculated in days from the time of diagnosis to the time of death. Additionally, the mRNA expression of MAGED2 in a variety of glioma types was collected from the Oncomine dataset (https://www.oncomine.org)[9]. The MAGED2 mRNA expression in various grades of glioma was obtained from the Chinese Glioma Genome Atlas (CGGA database, https://www.cgga.org.cn). The Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/) was used to acquire data on IDH1 and MGMT expression in LGG and GBM. The association between MAGED2 expression and IDH1 (or MGMT expression) was investigated. The immunohistochemistry staining data of MAGED2 in glioma and normal tissues were obtained from the Human Protein Atlas (www.proteinatlas.org) and were used to calculate the overall percentage of positive cells for MAGED2 protein. Patient characteristics and tissue specimens The current study included the evaluation of 98 cases of glioma from patients ranging in age from 19 to 82 years (median age, 39 years) at the time of diagnosis. There were 59 men and 39 females among these patients. In addition, 12 samples of normal brain biopsy tissue collected from epileptic resections were included as controls in the research. Preoperative radiation or chemotherapy were not administered to any of the patients. Tumor tissues were obtained sequentially from patients at Guangxi Medical University Cancer Hospital (Nanning, China) between September 2016 and June 2021, and were evaluated after receiving permission to conduct research from the Guangxi Medical University Ethics Committee. All patients gave their informed consent to participate in this study. The retrospective database was examined for demographics, tumor size, WHO Classification, Ki-67 expression, IDH1/2, and MGMT. A telephone interview was conducted with 98 patients (Table 1). Every 3-6 months, postoperative follow-up exams were performed, which included a physical examination and a computed tomography scan. Depending on the tumor status, tumor grade, and patient condition, a treatment approach was selected from options of surgery, adjuvant radiation, and chemotherapy. Prior to examination, tissue specimens were stored in liquid nitrogen at -80°C. The 2021 WHO Classification of Tumors of the Central Nervous System was used for histological analysis and tumor staging[10]. Cell lines and cell cultures. The Chinese Academy of Sciences (Shanghai, China) provided the human malignant glioma cell lines U251-MG. The cell lines were grown in a complete medium made up of Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, USA) and penicillin/streptomycin. Cells were grown at 37°C in a humidified environment with 5% CO2. Glioma U251-MG cell transfection Santa Cruz Biotechnology (Dallas, TX, MA, USA) provided the MAGED2 CRISPR knockout, which was transfected into U251-MG glioma cells using Lipofectamine 3000 according to the manufacturer's instructions. Meanwhile, cells that had been transfected with scrambled CRISPR were used as a control. U251-MG cells were plated at a density of 1 ×10 5 per well of a 6-well plate for plasmid transfection. Cells were examined under a fluorescence microscope 72 hours after transfection, and the knockdown effectiveness of MAGED2 CRISPR was confirmed by qRT-PCR and Western blot. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR). RT-qPCR was conducted as previously reported[11]. TRIzol® (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to extract total RNA from glioma tissues and normal brain specimens.Then, using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, USA), RNA was reverse-transcribed into cDNA according to the manufacturer's instructions. Primers of MAGED2[12] and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)[13] were obtained from Applied Biosystems (Thermo Fisher Scientific, Inc.). The forward primer sequence for MAGED2 was 5'-CCAGCAAGATGAAAGTCCTCA-3' and the reverse primer sequence was 5'- TCCATCGCCTCTCGGTACT-3'. The forward primer sequence for GAPDH was 5'- GAGCCCGCAGCCTCCCGCTT -3' and the reverse primer sequence was 5'- CCCGCGGCCATCACGCCACAG-3'. The 2 −ΔΔCT method was used to quantify MAGED2 mRNA expression levels, which were then normalized by the GAPDH mRNA expression level. Immunohistochemistry (IHC) IHC was conducted in accordance with previous research[11]. Paraffin-embedded tissues were formalin fixed for 24 hours at room temperature in 10% (v/v) formalin and cut into 4 µm-thick slices. Sections of paraffin-embedded tissues were dried for 1 hour at 60°C, dewaxed with xylene, and rehydrated with a declining sequence of alcohols (95, 80, 70, and 50%, v/v). Next, the slices were incubated overnight at 4°C with the primary antibody (anti-MAGED2; PA5-113520; 1:200; thermo fisher scientific). Subsequently, the slices were then treated for 20 min at room temperature with an HRP-conjugated secondary antibody (1:500). Finally, every antibody staining was developed for 5 min at room temperature using 3,3'-diaminobenzidine (DAB; Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China) as the chromogen and counterstained with hematoxylin. A known glioma tissue segment with MAGED2-positive expression served as a positive control, whereas omission of primary antibody served as a negative control. According to the staining characteristics of MAGED2 protein, MAGE-D2 is present in the cytoplasm and nucleus[14]. The total of the staining intensity and positive cell rate scores was used to get the final protein expression score as previously described [11]. Two independent pathologists used a blind technique to determine the presence of positive immunoreactivity.. At least five independent foci of neoplastic infiltration in each tissue specimen were observed using an optical microscope (Nikon Corporation, Tokyo, Japan) at magnification, x100 and x200. Western blot analysis Western blot was conducted as previously reported[15]. The total protein of cells or tissues was extracted. The cells were harvested 72 hours after transfection, and RIPA lysis solution was added for 30 minutes at 4 °C to obtain cell lysates. The concentration of protein was then determined using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). For each treatment, an equivalent quantity of total protein was separated using 12.5 percent SDS-PAGE and then transferred to PVDF membranes. The membrane was blocked and incubated overnight at 4 °C with the primary antibodies listed below: anti-MAGED2 (1:1000, PA5-113520), anti-CDKN1A (1:1000, ab109199), and anti-GAPDH antibodies (1:5000, ab8245). GAPDH was used as an internal loading control. The respective secondary antibodies (1:3000, Santa Cruz; 1:5000, Abcam) were incubated for 2 h at room temperature. Cell counting kit‑8 (CCK‑8) assay U251-MG cells were collected in the exponential phase, infected with MAGED2 CRISPR or Scramble CRISPR, injected at a density of 4×10 3 cells/well, and processed in 96-well plates. 10 μl of CCK-8 solution was added to each well after 0, 24, 48, 72, 96, and 120 hours. After 2 hours, the absorbance at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA).Five repeats per group were completed three times each. Colony formation assay For the colony formation experiment, U251-MG cells were estimated and injected onto 6-well plates at a density of 300 cells/well. Visible colonies were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for another 30 minutes after 20 days of cell incubation at 37 °C. Finally, the efficiency of the colony formation was calculated as the number of colonies (diameter >0.5 mm) per plated cells×100%. Ethynyl‑2′‑deoxyuridine (EdU) proliferation assay U251-MG cells were estimated and injected onto 24-well plates with a density of 1×10 4 cells/well after infection with MAGED2 CRISPR or Scramble CRISPR. Cells were exposed to 50 M EdU (Invitrogen) for 2.5 hours after incubation, Then, they were fixed, permeabilized, and stained with the Apollo® reaction cocktail for EdU and Hoechst 33,342 (5 g/mL) for U251-MG cell nuclei 48 hours later. After, samples were examined under a fluorescent microscope. Flow cytometry Before being harvested, Glioma U251-MG cells were infected with MAGED2 CRISPR or Scramble CRISPR and cultured at 37 °C. After, the cells were rinsed twice in phosphate-buffered saline (PBS) and fixed in 75% ice-cold ethanol. Next, the cells were stained with the Cell Cycle Staining Kit (Multi Sciences, China) and incubated in the dark for 30 min according to the manufacturer's instructions. U251-MG cells were also collected by trypsinization and treated with FITC conjugated Annexin V and PI according to the manufacturer's instructions to assess the influence of MAGED2 CRISPR infection on cell apoptosis (Keygen Biotech, China). Finally, flow cytometry was used to examine the cells. Statistical analysis. Statistical analysis was conducted using SPSS 24.0 (IBM Corp., USA). Data were presented as mean ± standard deviations (SD), unless otherwise stated. The χ2 or Fisher’s exact test was applied to determine statistical significance on the relationship between MAGED2 protein expression and clinicopathological parameters. One-way ANOVA was performed for comparison between normal brain tissues (NBS) and different glioma groups (>2 groups) followed by post-hoc test, including Bonferroni correction for multiple comparisons. Regression analysis was used to assess the prognostic significance of MAGED2 protein expression. Overall survival (OS) and recurrence-free survival (RFS) rates were calculated using the Kaplan-Meier technique, and differences in survival curves were analyzed using the log-rank test. During the multivariable regression analysis, prognostic variables were detected using Cox proportional hazard models. The final model includes variables with a P<0.05. A statistically significant difference was defined as a difference of P<0.05. Results TCGA dataset and Oncomine database MAGED2 mRNA and protein expression analysis in glioma MAGED2 expression levels have been shown to be considerably greater in GBM tissues than in LGG tissues, according to the TCGA dataset (t = 8.21, P < 0.001, Fig. 1A). Furthermore, the clinical data and gene expression profiles of the 152 GBM patients were matched with those of the 510 LGG patients to determine if MAGED2 expression levels were related to patient survival, which was accomplished using Kaplan-Maier analysis and log-rank comparison. The results are shown in Fig. 1B, which show that a greater MAGED2 expression level is associated with a shorter OS in glioma patients (c2= 6.32, P < 0.010). These data suggested that a low MAGED2 expression level in glioma may be responsible for the patients' good OS. Furthermore, by examining the ONCOMINE microarray datasets, researchers may detect variations in MAGED2 mRNA expression in distinct types of gliomas. The Beroukhim and Sun Brain dataset query results showed that MAGED2 mRNA expression in different types of glioma tissues, such as anaplastic astrocytoma (t=3.827, P < 0.001, Fig. 1C), glioblastoma (t=3.223, P<0.001, Fig. 1E), and oligodendroglioma (t=2.722, P=0.004, Fig. 1F), were all significantly increased when compared with normal brain tissue, with the exception for diffuse astrocytoma (t = 0.915, P=0.193, Fig. 1D). Moreover, the CGGA database results revealed that the expression of MAGED2 increased dramatically as the grade of glioma increased (Fig. 1G). Furthermore, the Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/) findings indicated that MAGED2 expression was considerably positive in LGG patients with (Fig. 1H), and it negatively correlated with MGMT expression (Fig. 1J). However, there is no significant correlation between MAGED2 expression and IDH1 in GBM patients, most likely because there are fewer individuals with IDH1 mutation (Fig. 1I). Moreover, there was no significant association between MAGED2 expression and MGMT expression (Fig. 1K). The association of Glioma grading with Genotyping is demonstrated in Table 2. There was a significant association between glioma grading and IDH1/2 (P<0.05)、1p/19q (P<0.05), MGMT (P<0.05), Ki67 (P<0.01), MAGE-D2 (P<0.01). By contrast, glioma grading was not associated with TERT (P=0.156), EGFR (P=0.090) (Table 2). In addition, utilizing the Human Protein Atlas (HPA) Database (http://www.proteinatlas.org), MAGED2 protein was found in 12 cases of glioma but not in normal tissue. According to the HPA database, the overall proportion of positive cells for MAGED2 protein was 100%. This included 33.33% with strong expression, 58.33% with moderate expression, and 0.08% with weak expression. The MAGED2 protein staining was primarily located in the cell cytoplasm and nucleus. These findings also revealed that MAGED2 may play a role in glioma formation, which may hold promise as a prognostic marker. MAGED2 was overexpressed in human glioma tissues . The expression levels of MAGED2 were analyzed in 98 glioma and 16 normal brain tissue specimens using RT-qPCR and Western blotting. There were significant differences between low or high-grade glioma compared with normal brain tissues for MAGED2 mRNA level (Fig. 2A, P<0.001). MAGED2 mRNA was considerably greater in low-grade glioma (P<0.001) and high-grade glioma (P<0.001) than in normal brain tissues, but there was no significant difference in MAGED2 mRNA between high-grade and low-grade gliomas (Fig. 2A). One-way ANOVA revealed significant differences between various kinds of glioma and normal brain tissues in terms of MAGED2 mRNA expression levels in each group (Fig. 2B, P<0.001). MAGED2 mRNA was highest in glioblastoma (P<0.001), and diffuse astrocytoma had the second highest value (P<0.001), followed by oligodendroglioma (P<0.001) and anaplastic astrocytoma (P<0.001), when compared with normal brain tissue. However, a post-hoc test determined that there was no significant effect of multiple comparisons (Fig.2B). High expression of MAGED2 was defined as a three-fold increase in the median value of MAGED2/GAPDH in normal brain tissues, as shown in Fig. 2C. The findings revealed that 57.14% of glioma tissues demonstrated high mRNA MAGED2 expression, whereas 0% of normal brain tissues did (P<0.001). When the percentage of high mRNA MAGED2 expression in low-grade (20.41%) and high-grade (36.73%) gliomas was compared to that of normal brain tissue, significant differences were found (P<0.001 and P<0.001, respectively); however, no significant differences were found between high-grade and low-grade glioma (P=0.82;Fig. 2C). Meanwhile, MAGED2 protein expression follows the same pattern as mRNA expression (p<0.001, Fig. 2D and E). IHC to examine the expression of the MAGED2 protein IHC was used to examine MAGED2 protein expression in 98 glioma tissues (Table 3). The overall proportion of cells positive for MAGED2 protein was 79.59%, according to the findings. The MAGED2 protein was stained mostly in the cytoplasm and nucleus of the cells. The percentage of cells in low-grade glioma samples that expressed MAGED2-positive protein was 30.61%, whereas it was 48.97 % in high-grade gliomas (Table 3). According to the staining intensity, 57.14 % of patients had high MAGED2 protein expression (Figs. 3A and 3B), whereas 42.86 % had low MAGED2 protein expression (Fig. 3C). Furthermore, the presence of MAGED2 was essentially non-existent in 12 normal brain tissues that were stained (Fig. 3D). The positive control was a known glioma tissue segment with MAGED2-positive expression (Fig. 3E), while the negative control was omission of primary antibody (Fig. 3F). Clinicopathological characteristics and MAGED2 protein expression. Table 3 shows the relationship between MAGED2 protein expression and clinical variables. MAGED2 protein expression was shown to be associated with WHO grade (P<0.01), Ki-67 (P<0.01), IDH1/2 (P<0.05), MGMT (P<0.05). Conversely, MAGED2 protein expression was not associated with sex (P=0.765), age (P=0.814), tumor size (P=0.860), or extent of resection (P=0.554) (Table 3). Prognostic impact of MAGED2 protein overexpression The influence of MAGED2 expression and tumor categorization was analyzed using Kaplan-Meier survival analysis to identify the prognostic value for MAGED2. In the current investigation, 98 patients with glioma were followed up on and had complete clinical data. Patient follow-up lasted an average of 27.4 months (range, 19-72 months). In patients with glioma, a substantial positive correlation between MAGED2 protein expression, OS, and RFS times were discovered using clinical records. When compared to patients with low MAGED2 expression in malignant tissues, all patients with high MAGED2 expression in cancerous tissues had a substantially shorter median OS (50.00 vs. 224.21 months; P<0.001) and RFS (22.00 vs. 122.10 months, P=0.0031) times (Fig. 4A and B). Patients with high MAGED2 protein expression had significantly shorter median OS (100.00 vs. 246.00 months; P0.05; Fig. 4E and F). Sex, age, tumor size (≥3.0 cm), extent of resection, WHO classification (High grade), IDH1 status (Mutant), Ki-67 expression (≥10%), and MAGED2 protein expression were used to categorize patients. Among these variables, an age of 39 years or older, WHO classification of High grade, IDH1 status (Mutant), Ki-67 expression ≥10% and high MAGED2 protein expression were all found to be important prognostic indicators in OS and RFS using univariate analysis. Patient survival was influenced by a variety of factors, necessitating the use of a multivariate analysis. The WHO classification, IDH1 status (Mutant), and MAGED2 protein expression were all found to have a substantial influence on OS and RFS in patients with glioma. Because there was a substantial positive relationship between high MAGED2 protein expression and glioma prognosis, it was assumed that MAGED2 protein expression may be identified as an independent prognostic factor for glioma patients (Table 4). MAGED2 knockdown in human glioma U251-MG cells using MAGED2 CRISPR The human glioma U251-MG cell line was one of the most widely used glioma cell lines, with high tumorigenicity in vivo. The GFP-expressing MAGED2 CRISPR and Scramble CRISPR were created and transfected into U251-MG cells to better understand the role of MAGED2 in glioma. After lentiviral infection, almost 90% of cells displayed positive green fluorescence, as indicated in the data (Fig. 5A). qRT-PCR and Western blotting were used to determine the knockdown effectiveness. MAGED2 mRNA (t = 4.47, P = 0.0012, Fig. 5B) and protein (t = 10.58, P<0.000, Fig. 5C) levels in U251-MG cells of the MAGED2 CRISPR group were significantly lower than those in the Scramble CRISPR group 72 hours after infection. MAGED2 knockdown significantly reduced glioma U251-MG cell growth CCK-8 and colony formation experiments were performed on glioma U251-MG cells transfected with MAGED2 CRISPR or Scramble CRISPR to better understand the role of MAGED2 in glioma cell proliferation. As shown in Fig. 6, MAGED2 knockdown significantly reduced the proliferation capacity and growth of U251-MG cells processed with MAGED2 CRISPR compared to the Scramble CRISPR group. Furthermore, the in vitro proliferation of the MAGED2 CRISPR-treated cells was significantly reduced at 72 hours (Scr CRISPR: 1.13±0.19 vs. MAGED2 CRISPR: 0.65±0.12, t=3.65, P=0.02), 96 hours (Scr CRISPR: 1.36±0.16 vs. MAGED2 CRISPR: 0.80±0.16, t=4.34, P=0.01), and 120 hours (Scr CRISPR: 1.41±0.17 vs. MAGED2 CRISPR: 0.86±0.12, t=4.62, P<0.01) (Fig. 6A). Similarly, inhibition of MAGED2 also resulted in a significant reduction in colony formation (t=5.22, P<0.001, Fig. 6B). The effect of MAGED2 on proliferation following MAGED2 downregulation was also assessed using the EDU cell-image assay. The results of the EDU cell image test were consistent with the results of the CCK-8 and colony formation assays, indicating that the EdU-positive rates of U251-MG cells were lower in the MAGED2 CRISPR group than in the Scramble CRISPR group (t=5.47, P<0.0001, Fig. 6C). As a result of these three tests, it was concluded that knocking down MAGED2 inhibited the proliferation of glioma U251-MG cells. Glioma U251-MG cells were arrested in G0/G1 phase and apoptosis was accelerated by MAGED2 suppression. The cell cycle distribution demonstrated a direct relationship with cell proliferation. On this basis, flow cytometry was used to study the cell cycle distribution of U251-MG cells following MAGED2 downregulation. As depicted in Fig. 7A and B, inhibiting MAGED2 increased the number of cells entering the G0/G1 phase by 43.27% (t=19.13, P<0.0001) while decreasing the number of cells entering the S phase by 35.16% (t=30.18, P<0.0001). Furthermore, the impact of MAGED2 knockdown on apoptosis in glioma U251-MG cells was also investigated. The results showed that the percentage of apoptosis in U251-MG cells from the MAGED2 CRISPR group ((17.40 ± 2.44) % was significantly greater than the Scramble CRISPR group (10.40 ± 1.90) % (t=3.93, P<0.05, Fig. 7C and D). These findings demonstrated that MAGED2 knockdown effectively inhibited U251-MG cell growth by increasing the proportion of cells in the G0/G1 phase, lowering the percentage of cells in the S phase, and triggering apoptosis. MAGED2 downregulation decreased cell growth through restoring CDKN1A U251-MG cells were transfected with MAGED2 CRISPR or Scramble CRISPR to investigate the target of MAGED2 in glioma cells in vitro. Following that, CDKN1A mRNA and protein expression levels were determined by qRT-PCR and Western blotting, respectively. The results showed that when compared to Scramble CRISPR transfection, CDKN1A mRNA expression levels were clearly up-regulated following transfection with MAGED2 CRISPR (t=12.33, P<0.0001, Fig. 7E). Furthermore, CDKN1A protein expression was much greater in the MAGED2 CRISPR transfection group (t=11.52, P<0.0001, Fig. 7F). Discussion The discovery of useful prognostic biomarkers will aid in early diagnosis, tumor therapy response prediction, prognosis, and eventually personalized treatment.The most recent version of the WHO Classification for 2021 was published, providing more accurate stratification than classification based solely on histopathology[ 10 ]. Indeed, it pioneered molecular indicators such as IDH1/2 mutation status and 1p/19q codeletion, which are now well acknowledged for their excellent predictive value across the world[ 10 ]. Despite the long history of molecular research into the glioma profile, MAGED2 has never been published to our knowledge, even though we have established that it is an intriguing prognostic marker. Many malignancies have high MAGED2 expression, and MAGED2 may play a vital role in cancer progression, making it a prospective target for tumor therapy. MAGE D2 mRNA overexpression leads to tumor growth in hepatocellular carcinoma, according to Kanda and colleagues, and thus may serve as a prognosis indicator after curative resection as well as a possible therapeutic target in hepatocellular carcinoma[ 6 ]. Further studies have confirmed that the MAGED2 expression level was associated with metastatic potential of gastric cancer, indicating that patients with gastric cancer had a poor prognosis. Such findings suggest that MAGED2 could be a viable biomarker for gastric cancer malignant behavior in both gastric tissue and serum samples[ 7 ]. Type 2 MAGE expression has recently been linked to crucial clinical and molecular aspects in glioma, according to research. However, in a bioinformatics study, MAGED2 did not show a distinct pattern of overexpression/downregulation[ 16 ]. As a result, the precise involvement of MAGED2 in the progression and prognosis of glioma patients remains unknown. The public expression profiles and clinical data of glioma patients from the TCGA were first used in the current investigation. According to the TCGA data, MAGED2 expression levels were significantly higher in GBM tissues than in LGG tissues. Furthermore, as compared to NBTs, MAGED2 was shown to be substantially expressed in human glioma tissues. In the CGGA database, the expression of MAGED2 rose dramatically as the grade of glioma increased. IDH1 mutation and MGMT expression were both linked to MAGED2 expression. Secondly, statistical analysis revealed that MAGED2 expression was closely related to WHO grade, Ki-67, IDH1/2, and MGMT. Patients with high MAGED2 expression in malignant tissues had significantly shorter median OS and RFS times than those with low MAGED2 expression, according to a Kaplan-Meier study. MAGED2 could be used as an independent predictive biomarker in glioma patients, according to multivariate and univariate survival studies. Thirdly, a MAGED2 CRISPR KO expressing lentiviral vector was created and transfected into glioma U251-MG cells, allowing it to stably down-regulate MAGED2’s expression levels in vitro. The findings suggested that MAGED2 knockdown could inhibit U251-MG cell growth by raising the percentage of cells in the G0/G1 phase while decreasing the percentage of cells in the S phase, and by triggering apoptosis. Papageorgio et al. recently showed that MAGED2 could boost lung cancer cell proliferation by targeting CDKN1A in lung cancer. Additionally, in certain malignancies, MAGED2, like NDN, may promote p53-mediated growth inhibition via a CDKN1A-independent mechanism[ 17 ]. Furthermore, when compared to Scramble CRISPR, this study found that mRNA and protein expression levels of CDKN1A were significantly up-regulated after transfection with MAGED2 CRISPR in vitro. CDKN1A is a cyclin-dependent kinase inhibitor that stops the cell cycle by inhibiting the CDK1 and CDK2 complexes[ 18 ]. Down-regulation of MAGED2 expression inhibited the growth of glioma cells in our investigation. However, our findings show that MAGED2 expression was related to the G1 phase of the cell cycle rather than the G2/M phase. This could be due to the varied cells that were selected. We also discovered that MAGED2 regulates glioma U251-MG cell growth via CDKN1A. CDKN1A has been demonstrated to influence cell cycle progression in the S and G1 phases in numerous earlier investigations[ 19 ]. It has been confirmed that CDKN1A interacts with the proliferating cell nuclear antigen (PCNA), which is involved in S-phase DNA replication and DNA damage repair[ 20 ]. As a result, the MAGED2/ CDKN1A pathway may be related to the G1 phase of the cell cycle in glioma U251-MG cells. Finally, by restoring CDKN1A, downregulation of MAGED2 partially suppressed cell proliferation in the U251-MG cells. The tumor suppressor protein, p53, regulates CDKN1A expression, and CDKN1A can induce p53-dependent cell cycle arrest at G1 in response to a variety of stressors[ 20 ]. Trussart et al. discovered that the Melanoma antigen-D2 regulates cell cycle progression and the DNA damage response in a variety of cancers[ 21 ]. According to Papageorgio et al., MAGED2 is a possible negative regulator of p53 activity, which could have consequences for cancer management and prognosis[ 17 ]. As a result, we hypothesize that MAGED2's function is partially dependent on the CDKN1A/P53 pathway. However, whether other key elements are also involved in MAGED2's regulatory network in glioma warrants additional investigation. As a result, the data suggest that MAGED2 may increase the proliferation of glioma U251-MG cells by inhibiting CDKN1A. The current study included a number of limitations. Firstly, the goal of this study was to determine the changes in MAGED2 expression between glioma and normal brain tissue, as well as the impact of MAGED2 on the prognosis of glioma patients. Future in vitro and in vivo investigations should use MAGED2-positive and -negative glioma cells to determine the biological function of MAGED2. Secondly, glioma progression involves a complicated network of pathophysiology. The role of ATR, SKP2, and CDC20 signaling in MAGED2-mediated cell cycle progression cannot be ruled out. Finally, because the current study was conducted in a single institute, there should be more patients included in the study, and the patient classification should be balanced. It is also critical to detect serum immunoreactivity in glioma patients. The ultimate goal of the experimental line of inquiry is to lay the groundwork for MAGED2-based immunotherapy. Conclusions In conclusion, the current study found that MAGED2 plays an important role in the prognosis and growth of human glioma. MAGED2 is often overexpressed in human glioma tissues, predicting a poor prognosis for glioma patients. Furthermore, down-regulation of MAGED2 expression by MAGED2 CRISPR inhibited the proliferation of glioma U251-MG cells in vitro by up-regulating CDKN1A. Furthermore, these findings suggest that MAGED2 can stimulate the growth of U251-MG cells by targeting CDKN1A, suggesting that MAGED2 may serve as a novel target in the clinical treatment of glioma. Abbreviations MAGE, melanoma-associated antigen; IHC, immunohistochemistry OS, overall survival; RFS, recurrence-free survival; TCGA, The Cancer Genome Atlas; NBS, normal brain tissues Declarations Author Contributions JY, SYL, CL and LGM conceived the study, analyzed the data and drafted the manuscript. KJF, YM, HNC, JW, QRH, ZDW, QJ, FZG and TD acquired patient records, performed the experiments, interpreted the data, and prepared the figures and tables. All authors contributed to the article and approved the submitted version. Funding This study was supported by Grants from Guangxi Natural Science Foundation (No. 2018GXNSFAA281151 and 2020GXNSFAA297154), Scientific Research Project of Guangxi Health Commission (No. S2018020), National Natural Science Foundation of China (No. 82060225) to Jun Yan. Availability of Data and Materials The datasets analyzed during the current study are available from the corresponding author on reasonable request. Compliance with ethical standards Conflict of interest The authors have no conflict of interest to declare. Ethics Approval This study was reviewed and approved by the ethics committee of Guangxi Medical University Cancer Hospital (No. LW2021082). Informed consent All patients provided written informed consent according to the local ethics committee regulations. References Omuro A, DeAngelis LM (2013) Glioblastoma and other malignant gliomas: a clinical review. JAMA 310: 1842-1850 doi:10.1001/jama.2013.280319 Bush NA, Chang SM, Berger MS (2017) Current and future strategies for treatment of glioma. Neurosurg Rev 40: 1-14 doi:10.1007/s10143-016-0709-8 Masui K, Kato Y, Sawada T, Mischel PS, Shibata N (2017) Molecular and Genetic Determinants of Glioma Cell Invasion. International journal of molecular sciences 18 doi:10.3390/ijms18122609 Florke Gee RR, Chen H, Lee AK, Daly CA, Wilander BA, Fon Tacer K, Potts PR (2020) Emerging roles of the MAGE protein family in stress response pathways. J Biol Chem 295: 16121-16155 doi:10.1074/jbc.REV120.008029 Reusch B, Bartram MP, Dafinger C, Palacio-Escat N, Wenzel A, Fenton RA, Saez-Rodriguez J, Schermer B, Benzing T, Altmüller J, Beck BB, Rinschen MM (2022) MAGED2 controls vasopressin-induced aquaporin-2 expression in collecting duct cells. Journal of proteomics 252: 104424 doi:10.1016/j.jprot.2021.104424 Hashimoto R, Kanda M, Takami H, Shimizu D, Oya H, Hibino S, Okamura Y, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Nomoto S, Fujiwara M, Kodera Y (2015) Aberrant expression of melanoma-associated antigen-D2 serves as a prognostic indicator of hepatocellular carcinoma outcome following curative hepatectomy. Oncol Lett 9: 1201-1206 doi:10.3892/ol.2014.2823 Kanda M, Nomoto S, Oya H, Takami H, Shimizu D, Hibino S, Hashimoto R, Kobayashi D, Tanaka C, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Fujiwara M, Kodera Y (2016) The Expression of Melanoma-Associated Antigen D2 Both in Surgically Resected and Serum Samples Serves as Clinically Relevant Biomarker of Gastric Cancer Progression. Annals of surgical oncology 23 Suppl 2: S214-221 doi:10.1245/s10434-015-4457-8 Shen Y, Zhang Y, Du J, Jiang B, Shan T, Li H, Bao H, Si Y (2021) CXCR5 down-regulation alleviates cognitive dysfunction in a mouse model of sepsis-associated encephalopathy: potential role of microglial autophagy and the p38MAPK/NF-κB/STAT3 signaling pathway. Journal of neuroinflammation 18: 246 doi:10.1186/s12974-021-02300-1 Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM (2004) ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia (New York, NY) 6: 1-6 Louis DN, Perry A, Wesseling P, Brat DJ, Cree IA, Figarella-Branger D, Hawkins C, Ng HK, Pfister SM, Reifenberger G, Soffietti R, von Deimling A, Ellison DW (2021) The 2021 WHO Classification of Tumors of the Central Nervous System: a summary. Neuro-oncology 23: 1231-1251 doi:10.1093/neuonc/noab106 Yan J, Wen J, Wei ZD, Li XS, Li P, Xiao SW (2018) Prognostic and clinicopathological value of melanoma-associated antigen D4 in patients with glioma. Oncol Lett 15: 4151-4160 doi:10.3892/ol.2018.7884 Fon Tacer K, Montoya MC, Oatley MJ, Lord T, Oatley JM, Klein J, Ravichandran R, Tillman H, Kim M, Connelly JP, Pruett-Miller SM, Bookout AL, Binshtock E, Kamiński MM, Potts PR (2019) MAGE cancer-testis antigens protect the mammalian germline under environmental stress. Science advances 5: eaav4832 doi:10.1126/sciadv.aav4832 Sun Y, Li Y, Luo D, Liao DJ (2012) Pseudogenes as weaknesses of ACTB (Actb) and GAPDH (Gapdh) used as reference genes in reverse transcription and polymerase chain reactions. PLoS One 7: e41659 doi:10.1371/journal.pone.0041659 Pirlot C, Thiry M, Trussart C, Di Valentin E, Piette J, Habraken Y (2016) Melanoma antigen-D2: A nucleolar protein undergoing delocalization during cell cycle and after cellular stress. Biochimica et biophysica acta 1863: 581-595 doi:10.1016/j.bbamcr.2015.12.010 Valiño-Rivas L, Cuarental L, Agustin M, Husi H, Cannata-Ortiz P, Sanz AB, Mischak H, Ortiz A, Sanchez-Niño MD (2019) MAGE genes in the kidney: identification of MAGED2 as upregulated during kidney injury and in stressed tubular cells. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 34: 1498-1507 doi:10.1093/ndt/gfy367 Arora M, Kumari S, Singh J, Chopra A, Chauhan SS (2020) Downregulation of Brain Enriched Type 2 MAGEs Is Associated With Immune Infiltration and Poor Prognosis in Glioma. Frontiers in oncology 10: 573378 doi:10.3389/fonc.2020.573378 Papageorgio C, Brachmann R, Zeng J, Culverhouse R, Zhang W, McLeod H (2007) MAGED2: a novel p53-dissociator. International journal of oncology 31: 1205-1211 Hernandez-Segura A, Nehme J, Demaria M (2018) Hallmarks of Cellular Senescence. Trends in cell biology 28: 436-453 doi:10.1016/j.tcb.2018.02.001 Gartel AL, Radhakrishnan SK (2005) Lost in transcription: p21 repression, mechanisms, and consequences. Cancer Res 65: 3980-3985 doi:10.1158/0008-5472.Can-04-3995 Zhang Y, Xu Z (2018) miR-93 enhances cell proliferation by directly targeting CDKN1A in nasopharyngeal carcinoma. Oncol Lett 15: 1723-1727 doi:10.3892/ol.2017.7492 Trussart C, Pirlot C, Di Valentin E, Piette J, Habraken Y (2018) Melanoma antigen-D2 controls cell cycle progression and modulates the DNA damage response. Biochemical pharmacology 153: 217-229 doi:10.1016/j.bcp.2018.01.035 Tables Table 1 Characteristics of patients with gliomas. Characteristic Numbers n = 98 (%) Gender Male 59 60.20 Female 39 39.79 Age (years) <39 47 47.96 ≥39 51 52.04 Tumor size(cm) <3 31 31.63 ≥3 67 68.36 Extent of resection Total resection 63 64.29 Subtotal resection 35 35.71 Tumor side Right 56 57.14 Left 42 42.86 Infiltrated part Single 36 36.73 Multiple 62 63.27 WHO classification a Low 40 40.81 High 58 59.18 KPS <70 37 37.76 ≥70 61 62.24 Treatment after first surgery RT 6 6.12 Chemo 21 21.43 RT+ Chemo 58 59.18 None 13 13.27 a According to the 2021 World Health Organization Classification of Tumors of the Nervous System. WHO, World Health Organization; KPS, Karnofsky Performance Scale; Table 2 Summary of molecular data of samples of included gliomas(n=98) Variable Lower Grade gliomas Higher Grade gliomas χ 2 P‑value IDH1/2 Mutant 22(22.45%) 30(30.61%) 6.184 0.013* Wildtype 31(31.63%) 15(15.31%) 1p/19q Codeletion 19(19.39%) 34(34.69%) 4.713 0.029* Noncodeletion 26(26.53%) 19(19.39%) TERT Positive 26(26.53%) 23(23.47%) 2.013 0.156 Negative 19(19.39%) 30(30.61%) MGMT Methylated 14(14.28%) 29(29.59%) 5.507 0.019* Unmethylated 31(31.63%) 24(24.49%) EGFR Positive 23(23.47%) 36(36.73%) 2.872 0.090 Negative 22(22.45%) 17(17.35%) Ki67 <10% 30(30.61%) 20(20.41%) 8.151 0.004* ≥10% 15(15.31%) 33(33.67%) MAGE-D2 Positive 17(17.35%) 37(37.67%) 10.09 0.002** Negative 28(28.57%) 16(16.33%) Table 3 Association between the MAGE-D2 protein and clinical characteristic of glioma patients(n=98) Characteristics Positive / Total test (%) Positive / total(%) χ 2 P High a Low b Gender 0.089 0.765 Male 44/98(44.89) 35/98 (35.71) 25/98 (25.51) Female 34/98(34.69) 21/98 (21.43) 17/98 (17.35) Age (years) 0.055 0.814 <39 40/98(40.81) 27/98(24.49) 19/98(19.39) ≥39 38/98(38.78) 32/98(32.65) 20/98(23.47) Tumor size (cm) 0.031 0.860 <3 39/98(39.71) 25/98(25.51) 18/98(18.37) ≥3 39/98(39.71) 31/98(31.63) 24/98(24.49) Extent of resection 0.350 0.554 Total resection 43/98(43.88) 34/98(34.69) 23/98(23.47) Subtotal resection 35/98(35.71) 22/98(22.45) 19/98(19.39) WHO grade 7.850 0.005 ** Low 30/98(30.61) 20/98(20.41) 27/98(27.55) High 48/98(48.97) 36/98(36.73) 15/98(15.31) Ki-67 (%) 6.908 0.008** <10% 40/98(40.81) 19/98(19.39) 26/98(26.53) ≥10% 38/98(38.77) 37/98(37.76) 17/98(16.33) IDH1/2 (%) 5.479 0.019* Mutant 30/98(30.61) 36/98(36.73) 17/98(17.35) wildtype 48/98(48.97) 20/98(20.41) 25/98(25.51) MGMT 4.901 0.027* Methylated 33/98(33.67) 17/98(17.35) 27/98(27.55) Unmethylated Total 45/98(45.92) 78/98(79.59) 33/98(33.67) 56/98(57.14) 21/98(21.43) 42/98(42.86) - - a:High MAGE-D2 protein expression (++/+++); b:Low MAGE-D2 protein expression (–/+); Table 4 Univariate and Multivariate analysis of different prognostic parameters All Gliomas Variable Overall survival Recurrence Free Survival Univariate analysis Hazard ratio(95% CI) P value Multivariate analysis Hazard ratio(95% CI) P value Univariate analysis Hazard ratio(95% CI) P value Multivariate analysis Hazard ratio(95% CI) P value Gender Male 0.644 (0.452-1.102) 0.169 0.764 (0.415-1.202) 0.309 Age ≥39 years 1.061 (1.030-1.089) 0.018 d 0.964 (0.902-1.031) 0.965 1.064 (1.022-1.083) 0.009 d 1.003(0.832-1.042) 0.368 Tumor size ≥3cm 1.129 (0.593-1.953) 0.969 1.079 (0.436-1.672) 0.089 - - Extent of resection Total resection 1.562 (0.724-2.362) 0.235 1.6889(0.944-2.687) 0.069 WHO grade High grade 3.595 (1.544-5.571) <0.001 d 3.556 (2.952-6.853) <0.001 d 3.148 (1.533-5.770) <0.001 d 3.048(1.519-5.453) <0.001 d IDH1 status Mutant 18.553(10.844-38.197) <0.001 d 12.877(6.053-23.167) <0.001 d 10.445(4.347-13.277) <0.001 d 8.756(3.649-12.486) <0.001 d Ki-67 ≥10% 6.179 (2.168-15.411) <0.001 d 2.766 (1.068-5.437) 0.575 9.474 (3.168-26.771) <0.001 d 5.476(1.705-12.656) 0.156 MAGE-D2 Positive 0.578 (0.182-0.927) 0.019 d 1.271 (0.502-2.327) 0.782 0.471 (0.102-0.827) 0.009 d 0.984 (0.508-1.947) 0.075 d a Univariate analysis was performed using the log-rank test. b Multivariate analysis was performed using the Cox proportional hazards model. c HR, Harzard ratio; 95 percent CI, 95 percent confidence interval for relative risk. d Statistically significant ( P <0.05). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1635612","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":104601300,"identity":"a6636400-288d-4b1c-a874-17ae4129e8b7","order_by":0,"name":"Jun Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYJACAyBm7GdmbHzwAcjiY2BgJk7LzPbmZsMZDAwSbMRoAQHGDWeOt0nzEKPF4PjZA8W8O7bJNtxIbJC2qThcx8befNiAocYmGqeWM3kJxrxnbhs3zkhsMM45c1iCjedYcgLDsbTcBlxaDuQYGPO23U5slkhsSM5tA2qRyDE+wNhwGLeW828gWtqAWg5bEqXlBtSWHp6Djc2MUC0J+LRI3nhjYDi37bbxDHagjp4z6ZJtQL8YJODxC9/5HDODt223ZfcfZn/+40eFNT8/MMQkPtTY4NSicICBzQBTOAGHchCQb2BgfoBHfhSMglEwCkYBAwMAQ65ejx7TSPUAAAAASUVORK5CYII=","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Yan","suffix":""},{"id":104601303,"identity":"4688c70b-3b34-4f99-8eba-95005413380f","order_by":1,"name":"Shenyu Li","email":"","orcid":"","institution":"Second Affiliated Hospital of Guilin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shenyu","middleName":"","lastName":"Li","suffix":""},{"id":104601304,"identity":"f6bb2f42-c5e6-4df7-a0dd-1644d0116254","order_by":2,"name":"Cameron Lenahan","email":"","orcid":"","institution":"Burrell College of Osteopathic Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cameron","middleName":"","lastName":"Lenahan","suffix":""},{"id":104601311,"identity":"bd579888-b1e1-44e8-9d69-4c82d2023f1b","order_by":3,"name":"Kaijing Fu","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kaijing","middleName":"","lastName":"Fu","suffix":""},{"id":104601314,"identity":"48f7988b-a045-4d56-b3b6-c0952319f01c","order_by":4,"name":"Yong Mo","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Mo","suffix":""},{"id":104601318,"identity":"6537d75b-c3e9-47ca-a828-7f56b3d6162e","order_by":5,"name":"Hainan Chen","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hainan","middleName":"","lastName":"Chen","suffix":""},{"id":104601320,"identity":"96d8141f-1b58-4e22-87ae-236c2e367091","order_by":6,"name":"Jing Wen","email":"","orcid":"","institution":"First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wen","suffix":""},{"id":104601322,"identity":"4f28ff74-1e77-4214-96e1-ad30393119e4","order_by":7,"name":"Qianrong Huang","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qianrong","middleName":"","lastName":"Huang","suffix":""},{"id":104601324,"identity":"372021d5-7ec1-4800-a7ea-17523ad6a92f","order_by":8,"name":"Zongdang Wei","email":"","orcid":"","institution":"The People's Hospital of Guangxi Zhuang Autonomous Region","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zongdang","middleName":"","lastName":"Wei","suffix":""},{"id":104601328,"identity":"b8fe9287-7f67-4b43-ae29-577ffec5af17","order_by":9,"name":"Qian Jiang","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Jiang","suffix":""},{"id":104601331,"identity":"7cc9ac21-ade8-4199-bb9b-d4e723addc28","order_by":10,"name":"Fangzhou Guo","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fangzhou","middleName":"","lastName":"Guo","suffix":""},{"id":104601332,"identity":"2988fd52-5190-4248-bdce-a110970b787e","order_by":11,"name":"Teng Deng","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Teng","middleName":"","lastName":"Deng","suffix":""},{"id":104601334,"identity":"6b45377a-72d3-4b68-9dbc-85ce6a787ead","order_by":12,"name":"Ligen Mo","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ligen","middleName":"","lastName":"Mo","suffix":""}],"badges":[],"createdAt":"2022-05-08 14:59:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1635612/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1635612/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":21399115,"identity":"896f399a-ceef-43d0-82c0-b038430c9516","added_by":"auto","created_at":"2022-05-12 15:53:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":157237,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMAGED2 expression profiles and predictive value in glioma. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e According to the TCGA dataset, MAGED2 expression levels are significantly higher in GBM tissues than in LGG tissues. \u003cstrong\u003eB\u003c/strong\u003e In glioma patients, higher MAGED2 expression is related to a shorter OS. \u003cstrong\u003eC–F\u003c/strong\u003e In the Oncomine database, MAGED2 expression in gliomas: \u003cstrong\u003eC\u003c/strong\u003e Anaplastic astrocytoma \u003cstrong\u003eD\u003c/strong\u003e Diffuse astrocytoma; \u003cstrong\u003eE\u003c/strong\u003e GBM; \u003cstrong\u003eF\u003c/strong\u003e Oligodendroglioma; \u003cstrong\u003eG\u003c/strong\u003e In the CGGA database, MAGED2 expression was found in gliomas of WHO grades II–IV. Horizontal lines represent the 25th, 50th, and 75th percentile values; whiskers represent the 10th and 90th percentile values; and dots represent the maximum and minimum values. \u003cstrong\u003eE\u003c/strong\u003e and \u003cstrong\u003eI t\u003c/strong\u003ehe TCGA database was used to investigate the connection between MAGED2 expression and IDH1 mutation in LGG and GBM. \u003cstrong\u003eJ\u003c/strong\u003e and \u003cstrong\u003eK\u003c/strong\u003e the TCGA database was used to investigate the connection between MAGED2 expression and MGMT expression in LGG and GBM.\u003c/p\u003e","description":"","filename":"Onlinefigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/21057742dee88f5d2b8ca5e7.png"},{"id":21399117,"identity":"74a3090c-55a1-42bc-92c6-f99bb8319cad","added_by":"auto","created_at":"2022-05-12 15:53:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":220063,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLevels of MAGED2 mRNA and protein expression in glioma versus healthy brain.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e(A、D)\u003c/strong\u003e The median values of MAGED2 mRNA and protein expression in low-grade glioma and high-grade glioma were significantly higher than that of normal brain tissue. (\u003cstrong\u003eB、E) \u003c/strong\u003eMAGED2 mRNA and protein expression in several forms of gliomas revealed that glioblastoma had the greatest expression; diffuse astrocytoma had the second highest expression, followed by oligodendroglioma and anaplastic astrocytoma. (\u003cstrong\u003eC\u003c/strong\u003e ) MAGED2 mRNA high expression was determined to be three times higher than the median value of MAGED2/GAPDH in normal brain tissues. For MAGED2 high expression above the line, the cutoff value is 3.21. The percentage of low-grade (WHO, I-II) and high-grade (WHO, III-IV) gliomas with high MAGED2 mRNA expression was compared to that of normal brain tissue. Values are presented as the mean ± SD. The error bars represent the SD. (\u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01 and \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001 when compared with normal brain tissue; χ\u003csup\u003e2\u003c/sup\u003e test with subsequent Bonferroni’s correction).\u0026nbsp;\u003c/p\u003e","description":"","filename":"Onlinefigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/01daf422f96163a1976f5895.png"},{"id":21399121,"identity":"a5739df8-d00b-4ad6-8f76-848d231e2b10","added_by":"auto","created_at":"2022-05-12 15:53:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":740163,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMAGED2 protein immunohistochemistry in (a-c) glioma tissues and (d) normal brain tissue.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eThe staining was concentrated in the cytoplasm and nucleus of the cells. Images \u003cstrong\u003eA-C\u003c/strong\u003e show strong, moderate, and mild immunoreactivities with the polyclonal MAGED2 antibody, respectively. (\u003cstrong\u003eD\u003c/strong\u003e) In normal brain tissue, MAGED2 protein staining was negative. (\u003cstrong\u003eE\u003c/strong\u003e) A known glioma tissue segment with MAGED2-positive expression was used as a positive control. (\u003cstrong\u003eF\u003c/strong\u003e) Omission of primary antibody was used as a negative control. Scale bar, 20 μm.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Onlinefigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/731cbbeb6010e3add24dc986.png"},{"id":21399800,"identity":"5b985679-a914-4c15-b55b-01ceecd3cc8a","added_by":"auto","created_at":"2022-05-12 15:58:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":239588,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGlioma survival curves for 98 individuals. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003eKaplan-Meier curves for OS and RFS times in (\u003cstrong\u003eA\u003c/strong\u003e and \u003cstrong\u003eB\u003c/strong\u003e) all follow-up patients, (\u003cstrong\u003eC\u003c/strong\u003e and \u003cstrong\u003eD\u003c/strong\u003e) patients with low-grade glioma, and (\u003cstrong\u003eE\u003c/strong\u003e and \u003cstrong\u003eF\u003c/strong\u003e) patients with high-grade glioma, respectively, according to MAGED2 expression levels. (\u003cstrong\u003eA\u003c/strong\u003e and \u003cstrong\u003eB\u003c/strong\u003e) All patients with high levels of MAGED2 expression in malignant tissues had substantially shorter OS (P\u0026lt;0.001) and RFS (P=0.0031) periods than those with low levels of MAGED2. (\u003cstrong\u003eC \u003c/strong\u003eand \u003cstrong\u003eD\u003c/strong\u003e) Patients with low-grade gliomas who had high levels of MAGED2 expression in malignant tissues had substantially shorter OS (P\u0026lt;0.001) and RFS (P=0.0013) periods than those who had low levels of MAGED2. (\u003cstrong\u003eE\u003c/strong\u003e and \u003cstrong\u003eF\u003c/strong\u003e) In patients with high-grade gliomas, there was no significant difference in OS and RFS (P\u0026gt;0.05) times between those with high and low MAGED2 expression levels. MAGE, melanoma-associated antigen; WHO, World Health Organization; RFS, recurrence-free survival; OS, overall survival.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/4abf71d9ed05942460da820b.png"},{"id":21399802,"identity":"8caf47c6-c958-4c39-a7fe-3f0762589360","added_by":"auto","created_at":"2022-05-12 15:58:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":178329,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe glioma U251-MG cells were transfected with a lentiviral vector expressing the MAGED2 CRISPR. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Fluorescence microscopy is used to assess transfection effectiveness 72 hours after transfection. \u003cstrong\u003eB\u003c/strong\u003e, \u003cstrong\u003eC\u003c/strong\u003e qRT-PCR test is used to determine the knockdown effectiveness of MAGED2. (\u003cstrong\u003eB\u003c/strong\u003e) and Western blotting (\u003cstrong\u003eC\u003c/strong\u003e). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01 and \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001 compared with the Scramble CRISPR group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/8249cd9953c1c842a6a8f77f.png"},{"id":21399801,"identity":"ad26828f-771f-4237-8bae-c8ccaebf1a61","added_by":"auto","created_at":"2022-05-12 15:58:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":169179,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGlioma cell proliferation and colony formation are inhibited when MAGED2 is downregulated. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e MAGED2 inhibition decreases the growth of glioma U251-MG cells in CCK-8 tests. \u003cstrong\u003eB\u003c/strong\u003e Colony formation also showed that the proliferation of U251-MG cells significantly reduced when MAGED2 is inhibited.\u003cstrong\u003e c\u003c/strong\u003e EdU tests indicate that down-regulation of MAGED2 inhibits the proliferation of glioma U251-MG cells. \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01 compared with the Scramble CRISPR group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/58c95939c5349b4c1d43dee4.png"},{"id":21399803,"identity":"4e352236-8497-46a5-b0d2-be5fcfcdcbe8","added_by":"auto","created_at":"2022-05-12 15:58:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":104245,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIn glioma U251-MG cells, MAGED2 regulates the cell cycle, apoptosis, and CDKN1A expression levels. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eA-D. \u003c/strong\u003eFlow cytometry of the cell cycle distribution (\u003cstrong\u003eA, B\u003c/strong\u003e) and apoptosis (\u003cstrong\u003eC, D\u003c/strong\u003e) level of U251-MG cells transfected with MAGED2 CRISPR or Scramble CRISPR. \u003cstrong\u003eE-F\u003c/strong\u003e. The mRNA (\u003cstrong\u003eE\u003c/strong\u003e) and protein (\u003cstrong\u003eF\u003c/strong\u003e) expression levels of CDKN1A detected by Western blotting and qRT-PCR after transfection with MAGED2 CRISPR or Scramble CRISPR. \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01, and \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001 compared with the Scramble CRISPR group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/d8fc38d1ba415136741d44c8.png"},{"id":21399804,"identity":"3f6ceb31-affd-4da0-a488-15d610887ce3","added_by":"auto","created_at":"2022-05-12 15:58:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2989511,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1635612/v1/939d2fe6-9973-4cc2-81f8-282bc1f298bf.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression and prognostic value of Melanoma-associated antigen D2 in gliomas","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalignant glioma remains the most frequent and severe primary brain tumor, with substantial morbidity and fatality rates[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Glioma can be treated using a variety of methods, including surgery, radiation, and chemotherapy. However, the prognosis for glioma patients, particularly glioblastoma (GBM), remains poor as a result of the high tumor recurrence rate[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This dismal prognosis is largely due to the invasive nature of malignant glioma[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. At present, the molecular processes driving glioma invasion remain unknown; consequently, it is vital that a more thorough understanding of the biological and molecular mechanisms underpinning glioma formation and progression is procured to develop more effective therapies.\u003c/p\u003e \u003cp\u003eThe melanoma-associated antigen D2 (MAGED2) is a member of the melanoma-associated antigen family which is consistent with Type I genes (MAGE-A, -B and -C) and type II genes (MAGE-D, -E, -F, -G and -H)[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. MAGED2 has been identified as being critical for transcriptional regulation, epigenetic alteration, and cell development and differentiation[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Furthermore, numerous studies have shown that MAGED2 is a tumor-specific antigen that plays an important role in tumor progression and metastasis, including hepatocellular carcinoma[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e],gastric cancer[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and lymphoma[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. As a result, MAGED2 is expected to become a potential cancer target, and may play an important role in tumor progression. However, the precise function and mechanism of MAGED2 in glioma is still unknown. The goal of current research aims to investigate the MAGED2 gene's potential as a cancer-associated tumor marker, which might serve as a beneficial prognostic biomarker and immunotherapeutic target for glioma.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eBioinformatic analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn the basis of the Cancer Genome Atlas-Cancer Genome (TCGA database, https://cancergenome.nih.gov/), prognostic data from glioblastoma(GBM) patients and low grade glioma (LGG) patients were obtained from the OncoLnc database (https://www.oncolnc.org/). Furthermore, overall survival (OS) has been calculated in days from the time of diagnosis to the time of death. Additionally, the mRNA expression of MAGED2 in a variety of glioma types was collected from the Oncomine dataset (https://www.oncomine.org)[9]. The MAGED2 mRNA expression in various grades of glioma was obtained from the Chinese Glioma Genome Atlas (CGGA database, https://www.cgga.org.cn). The Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/) was used to acquire data on IDH1 and MGMT expression in LGG and GBM. The association between MAGED2 expression and IDH1 (or MGMT expression) was investigated. The immunohistochemistry staining data of MAGED2 in glioma and normal tissues were obtained from the Human Protein Atlas (www.proteinatlas.org) and were used to calculate the overall percentage of positive cells for MAGED2 protein.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient characteristics and tissue specimens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe current study included the evaluation of 98 cases of glioma from patients ranging in age from 19 to 82 years (median age, 39 years) at the time of diagnosis. There were 59 men and 39 females among these patients. In addition, 12 samples of normal brain biopsy tissue collected from epileptic resections were included as controls in the research. Preoperative radiation or chemotherapy were not administered to any of the patients. Tumor tissues were obtained sequentially from patients at Guangxi Medical University Cancer Hospital (Nanning, China) between September 2016 and June 2021, and were evaluated after receiving permission to conduct research from the Guangxi Medical University Ethics Committee. All patients gave their informed consent to participate in this study. The retrospective database was examined for demographics, tumor size, WHO Classification, Ki-67 expression, IDH1/2, and MGMT. A telephone interview was conducted with 98 patients (Table 1). Every 3-6 months, postoperative follow-up exams were performed, which included a physical examination and a computed tomography scan. Depending on the tumor status, tumor grade, and patient condition, a treatment approach was selected from options of surgery, adjuvant radiation, and chemotherapy. Prior to examination, tissue specimens were stored in liquid nitrogen at -80\u0026deg;C. The 2021 WHO Classification of Tumors of the Central Nervous System was used for histological analysis and tumor staging[10]. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell lines and cell cultures.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Chinese Academy of Sciences (Shanghai, China) provided the human malignant glioma cell lines U251-MG. The cell lines were grown in a complete medium made up of Dulbecco\u0026apos;s modified Eagle\u0026apos;s medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, USA) and penicillin/streptomycin. Cells were grown at 37\u0026deg;C in a humidified environment with 5% CO2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGlioma U251-MG cell transfection\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSanta Cruz Biotechnology (Dallas, TX, MA, USA) provided the MAGED2 CRISPR knockout, which was transfected into U251-MG glioma cells using Lipofectamine 3000 according to the manufacturer\u0026apos;s instructions. Meanwhile, cells that had been transfected with scrambled CRISPR were used as a control. U251-MG cells were plated at a density of 1 \u0026times;10\u003csup\u003e5\u003c/sup\u003e per well of a 6-well plate for plasmid transfection. Cells were examined under a fluorescence microscope 72 hours after transfection, and the knockdown effectiveness of MAGED2 CRISPR was confirmed by qRT-PCR and Western blot.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription-quantitative polymerase chain reaction\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;(RT-qPCR).\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRT-qPCR was conducted as previously reported[11]. TRIzol\u0026reg; (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to extract total RNA from glioma tissues and normal brain specimens.Then, using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, USA), RNA was reverse-transcribed into cDNA according to the manufacturer\u0026apos;s instructions. Primers of MAGED2[12] and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)[13] were obtained from Applied Biosystems (Thermo Fisher Scientific, Inc.). The forward primer sequence for MAGED2 was 5\u0026apos;-CCAGCAAGATGAAAGTCCTCA-3\u0026apos; and the reverse primer sequence was 5\u0026apos;-\u0026nbsp;TCCATCGCCTCTCGGTACT-3\u0026apos;. The forward primer sequence for GAPDH was 5\u0026apos;-\u0026nbsp;GAGCCCGCAGCCTCCCGCTT\u0026nbsp;-3\u0026apos; and the reverse primer sequence was 5\u0026apos;-\u0026nbsp;CCCGCGGCCATCACGCCACAG-3\u0026apos;. The\u0026nbsp;2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u0026nbsp;\u003c/sup\u003emethod\u0026nbsp;was used to quantify MAGED2 mRNA expression levels, which were then normalized by the GAPDH mRNA expression level.\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry (IHC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIHC was conducted in accordance with previous research[11]. Paraffin-embedded tissues were formalin fixed for 24 hours at room temperature in 10% (v/v) formalin and cut into 4 \u0026micro;m-thick slices. Sections of paraffin-embedded tissues were dried for 1 hour at 60\u0026deg;C, dewaxed with xylene, and rehydrated with a declining sequence of alcohols (95, 80, 70, and 50%, v/v). Next, the slices were incubated overnight at 4\u0026deg;C with the primary antibody (anti-MAGED2; PA5-113520; 1:200; thermo fisher scientific). Subsequently, the slices were then treated for 20 min at room temperature with an HRP-conjugated secondary antibody (1:500). Finally, every antibody staining was developed for 5 min at room temperature using 3,3\u0026apos;-diaminobenzidine (DAB; Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China) as the chromogen and counterstained with hematoxylin. A known glioma tissue segment with MAGED2-positive expression served as a positive control, whereas omission of primary antibody served as a negative control. According to the staining characteristics of MAGED2 protein, MAGE-D2 is present in the cytoplasm and nucleus[14]. The total of the staining intensity and positive cell rate scores was used to get the final protein expression score as previously described [11]. Two independent pathologists used a blind technique to determine the presence of positive immunoreactivity.. At least five independent foci of neoplastic infiltration in each tissue specimen were observed using an optical microscope (Nikon Corporation, Tokyo, Japan) at magnification, x100 and x200.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blot was conducted as previously reported[15]. The total protein of cells or tissues was extracted. The cells were harvested 72 hours after transfection, and RIPA lysis solution was added for 30 minutes at 4 \u0026deg;C to obtain cell lysates. The concentration of protein was then determined using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). For each treatment, an equivalent quantity of total protein was separated using 12.5 percent SDS-PAGE and then transferred to PVDF membranes. The membrane was blocked and incubated overnight at 4 \u0026deg;C with the primary antibodies listed below: anti-MAGED2 (1:1000, PA5-113520), anti-CDKN1A (1:1000, ab109199), and anti-GAPDH antibodies (1:5000, ab8245). GAPDH was used as an internal loading control. The respective secondary antibodies (1:3000, Santa Cruz; 1:5000, Abcam) were incubated for 2 h at room temperature.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell counting kit‑8 (CCK‑8) assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eU251-MG cells were collected in the exponential phase, infected with MAGED2 CRISPR or Scramble CRISPR, injected at a density of 4\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well, and processed in 96-well plates. 10 \u0026mu;l of CCK-8 solution was added to each well after 0, 24, 48, 72, 96, and 120 hours. After 2 hours, the absorbance at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA).Five repeats per group were completed three times each.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony formation assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the colony formation experiment, U251-MG cells were estimated and injected onto 6-well plates at a density of 300 cells/well. Visible colonies were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for another 30 minutes after 20 days of cell incubation at 37 \u0026deg;C. Finally, the efficiency of the colony formation was calculated as the number of colonies (diameter \u0026gt;0.5 mm) per plated cells\u0026times;100%.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthynyl‑2\u0026prime;‑deoxyuridine (EdU) proliferation assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eU251-MG cells were estimated and injected onto 24-well plates with a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well after infection with MAGED2 CRISPR or Scramble CRISPR. Cells were exposed to 50 M EdU (Invitrogen) for 2.5 hours after incubation, Then, they were fixed, permeabilized, and stained with the Apollo\u0026reg; reaction cocktail for EdU and Hoechst 33,342 (5 g/mL) for U251-MG cell nuclei 48 hours later. After, samples were examined under a fluorescent microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore being harvested, Glioma U251-MG cells were infected with MAGED2 CRISPR or Scramble CRISPR and cultured at 37 \u0026deg;C. After, the cells were rinsed twice in phosphate-buffered saline (PBS) and fixed in 75% ice-cold ethanol. Next, the cells were stained with the Cell Cycle Staining Kit (Multi Sciences, China) and incubated in the dark for 30 min according to the manufacturer\u0026apos;s instructions. U251-MG cells were also collected by trypsinization and treated with FITC conjugated Annexin V and PI according to the manufacturer\u0026apos;s instructions to assess the influence of MAGED2 CRISPR infection on cell apoptosis (Keygen Biotech, China). Finally, flow cytometry was used to examine the cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was conducted using SPSS 24.0 (IBM Corp., USA). Data were presented as mean \u0026plusmn; standard deviations (SD), unless otherwise stated. The \u0026chi;2 or Fisher\u0026rsquo;s exact test was applied to determine statistical significance on the relationship between MAGED2 protein expression and clinicopathological parameters. One-way ANOVA was performed for comparison between normal brain tissues (NBS) and different glioma groups (\u0026gt;2 groups) followed by post-hoc test, including Bonferroni correction for multiple comparisons. Regression analysis was used to assess the prognostic significance of MAGED2 protein expression. Overall survival (OS) and recurrence-free survival (RFS) rates were calculated using the Kaplan-Meier technique, and differences in survival curves were analyzed using the log-rank test. During the multivariable regression analysis, prognostic variables were detected using Cox proportional hazard models. The final model includes variables with a P\u0026lt;0.05. A statistically significant difference was defined as a difference of P\u0026lt;0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eTCGA dataset and Oncomine database MAGED2 mRNA and protein expression analysis in glioma\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMAGED2 expression levels have been shown to be considerably greater in GBM tissues than in LGG tissues, according to the TCGA dataset (t = 8.21, P \u0026lt; 0.001, Fig. 1A). Furthermore, the clinical data and gene expression profiles of the 152 GBM patients were matched with those of the 510 LGG patients to determine if MAGED2 expression levels were related to patient survival, which was accomplished using Kaplan-Maier analysis and log-rank comparison. The results are shown in Fig. 1B, which show that a greater MAGED2 expression level is associated with a shorter OS in glioma patients (c2= 6.32, P \u0026lt; 0.010). These data suggested that a low MAGED2 expression level in glioma may be responsible for the patients\u0026apos; good OS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurthermore, by examining the ONCOMINE microarray datasets, researchers may detect variations in MAGED2 mRNA expression in distinct types of gliomas. The Beroukhim and Sun Brain dataset query results showed that MAGED2 mRNA expression in different types of glioma tissues, such as anaplastic astrocytoma (t=3.827, P \u0026lt; 0.001, Fig. 1C), glioblastoma (t=3.223, P\u0026lt;0.001, Fig. 1E), and oligodendroglioma\u0026nbsp;(t=2.722, P=0.004, Fig. 1F), were all significantly increased when compared with normal brain tissue, with the exception for diffuse astrocytoma\u0026nbsp;(t = 0.915, P=0.193, Fig. 1D). Moreover, the CGGA database results revealed that the expression of MAGED2 increased dramatically as the grade of glioma increased (Fig. 1G). Furthermore, the Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/) findings indicated that MAGED2 expression was considerably positive in LGG patients with (Fig. 1H), and it negatively\u0026nbsp;correlated with MGMT expression (Fig. 1J). However, there is no significant correlation between MAGED2 expression and IDH1 in GBM patients, most likely because there are fewer individuals with IDH1 mutation (Fig. 1I).\u0026nbsp;Moreover,\u0026nbsp;there was no significant association between MAGED2 expression and MGMT expression (Fig. 1K).\u003c/p\u003e\n\u003cp\u003eThe association of Glioma grading with Genotyping is demonstrated in Table 2. There was a significant association between glioma grading and IDH1/2 (P\u0026lt;0.05)、1p/19q (P\u0026lt;0.05), MGMT (P\u0026lt;0.05), Ki67 (P\u0026lt;0.01), MAGE-D2 (P\u0026lt;0.01). By contrast, glioma grading was not associated with TERT (P=0.156), EGFR (P=0.090) (Table 2).\u003c/p\u003e\n\u003cp\u003eIn addition, utilizing the Human Protein Atlas (HPA) Database (http://www.proteinatlas.org), MAGED2 protein was found in 12 cases of glioma but not in normal tissue. According to the HPA database, the overall proportion of positive cells for MAGED2 protein was 100%. This included 33.33% with strong expression, 58.33% with moderate expression, and 0.08% with weak expression. The MAGED2 protein staining was primarily located in the cell cytoplasm and nucleus. These findings also revealed that MAGED2 may play a role in glioma formation, which may hold promise as a prognostic marker.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAGED2\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ewas overexpressed in human glioma tissues\u003c/strong\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels of MAGED2 were analyzed in 98 glioma and 16 normal brain tissue specimens using RT-qPCR and\u0026nbsp;Western blotting.\u0026nbsp;There were significant differences between low or high-grade glioma compared with normal brain tissues for MAGED2 mRNA level (Fig. 2A, P\u0026lt;0.001). MAGED2 mRNA was considerably greater in low-grade glioma (P\u0026lt;0.001) and high-grade glioma (P\u0026lt;0.001) than in normal brain tissues, but there was no significant difference in MAGED2 mRNA between high-grade and low-grade gliomas (Fig. 2A). One-way ANOVA revealed significant differences between various kinds of glioma and normal brain tissues in terms of MAGED2 mRNA expression levels in each group (Fig. 2B, P\u0026lt;0.001). MAGED2 mRNA was highest in glioblastoma (P\u0026lt;0.001), and diffuse astrocytoma had the second highest value (P\u0026lt;0.001), followed by oligodendroglioma (P\u0026lt;0.001) and anaplastic astrocytoma (P\u0026lt;0.001), when compared with normal brain tissue. However, a post-hoc test determined that there was no significant effect of multiple comparisons (Fig.2B). High expression of MAGED2 was defined as a three-fold increase in the median value of MAGED2/GAPDH in normal brain tissues, as shown in Fig. 2C. The findings revealed that 57.14% of glioma tissues demonstrated high mRNA MAGED2 expression, whereas 0% of normal brain tissues did (P\u0026lt;0.001).\u0026nbsp;When the percentage of high mRNA MAGED2 expression in low-grade (20.41%) and high-grade (36.73%) gliomas was compared to that of normal brain tissue, significant differences were found (P\u0026lt;0.001\u0026nbsp;and\u0026nbsp;P\u0026lt;0.001, respectively); however, no significant differences were found between high-grade and low-grade glioma (P=0.82;Fig. 2C). Meanwhile, MAGED2 protein expression follows the same pattern as mRNA expression\u0026nbsp;(p\u0026lt;0.001, Fig. 2D and E).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIHC to examine the expression of the MAGED2 protein\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIHC was used to examine MAGED2 protein expression in 98 glioma tissues (Table 3). The overall proportion of cells positive for MAGED2 protein was 79.59%, according to the findings. The MAGED2 protein was stained mostly in the cytoplasm and nucleus of the cells. The percentage of cells in low-grade glioma samples that expressed MAGED2-positive protein was 30.61%, whereas it was 48.97 % in high-grade gliomas (Table 3). According to the staining intensity, 57.14 % of patients had high MAGED2 protein expression (Figs. 3A and 3B), whereas 42.86 % had low MAGED2 protein expression (Fig. 3C). Furthermore, the presence of MAGED2 was essentially non-existent in 12 normal brain tissues that were stained (Fig. 3D). The positive control was a known glioma tissue segment with MAGED2-positive expression (Fig. 3E), while the negative control was omission of primary antibody (Fig. 3F).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinicopathological characteristics and MAGED2 protein expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 3 shows the relationship between MAGED2 protein expression and clinical variables. MAGED2 protein expression was shown to be associated with WHO grade (P\u0026lt;0.01), Ki-67 (P\u0026lt;0.01), IDH1/2 (P\u0026lt;0.05), MGMT (P\u0026lt;0.05). Conversely, MAGED2 protein expression was not associated with sex (P=0.765), age (P=0.814), tumor size (P=0.860), or extent of resection (P=0.554) (Table 3).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrognostic impact of MAGED2 protein overexpression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe influence of MAGED2 expression and tumor categorization was analyzed using Kaplan-Meier survival analysis to identify the prognostic value for MAGED2. In the current investigation, 98 patients with glioma were followed up on and had complete clinical data. Patient follow-up lasted an average of 27.4 months (range, 19-72 months). In patients with glioma, a substantial positive correlation between MAGED2 protein expression, OS, and RFS times were discovered using clinical records. When compared to patients with low MAGED2 expression in malignant tissues, all patients with high MAGED2 expression in cancerous tissues had a substantially shorter median OS (50.00 vs. 224.21 months; P\u0026lt;0.001) and RFS (22.00 vs. 122.10 months, P=0.0031) times (Fig. 4A and B). Patients with high MAGED2 protein expression had significantly shorter median OS (100.00 vs. 246.00 months; P\u0026lt;0.001) and RFS (75.00 vs. 140.00 months; P=0.0013) times in low-grade gliomas (Fig. 4C and D); however, there was no significant difference in OS and RFS times in high-grade gliomas (P\u0026gt;0.05; Fig. 4E and F). Sex, age, tumor size (\u0026ge;3.0 cm), extent of resection, WHO classification (High grade), IDH1 status (Mutant), Ki-67 expression (\u0026ge;10%), and MAGED2 protein expression were used to categorize patients. Among these variables, an age of 39 years or older, WHO classification of High grade, IDH1 status (Mutant), Ki-67 expression \u0026ge;10% and high MAGED2 protein expression were all found to be important prognostic indicators in OS and RFS using univariate analysis. Patient survival was influenced by a variety of factors, necessitating the use of a multivariate analysis. The WHO classification, IDH1 status (Mutant), and MAGED2 protein expression were all found to have a substantial influence on OS and RFS in patients with glioma. Because there was a substantial positive relationship between high MAGED2 protein expression and glioma prognosis, it was assumed that MAGED2 protein expression may be identified as an independent prognostic factor for glioma patients (Table 4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAGED2 knockdown in human glioma U251-MG cells using MAGED2 CRISPR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human glioma U251-MG cell line was one of the most widely used glioma cell lines, with high tumorigenicity in vivo. The GFP-expressing MAGED2 CRISPR and Scramble CRISPR were created and transfected into U251-MG cells to better understand the role of MAGED2 in glioma. After lentiviral infection, almost 90% of cells displayed positive green fluorescence, as indicated in the data (Fig. 5A). qRT-PCR and Western blotting were used to determine the knockdown effectiveness. MAGED2 mRNA (t = 4.47, P = 0.0012, Fig. 5B) and protein (t = 10.58, P<0.000, Fig. 5C) levels in U251-MG cells of the MAGED2 CRISPR group were significantly lower than those in the Scramble CRISPR group 72 hours after infection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAGED2 knockdown significantly reduced glioma U251-MG cell growth\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCCK-8 and colony formation experiments were performed on glioma U251-MG cells transfected with MAGED2 CRISPR or Scramble CRISPR to better understand the role of MAGED2 in glioma cell proliferation. As shown in Fig. 6, MAGED2 knockdown significantly reduced the proliferation capacity and growth of U251-MG cells processed with MAGED2 CRISPR compared to the Scramble CRISPR group. Furthermore, the in vitro proliferation of the MAGED2 CRISPR-treated cells was significantly reduced at 72 hours (Scr CRISPR: 1.13\u0026plusmn;0.19 vs. MAGED2 CRISPR: 0.65\u0026plusmn;0.12, t=3.65, P=0.02), 96 hours (Scr CRISPR: 1.36\u0026plusmn;0.16 vs. MAGED2 CRISPR: 0.80\u0026plusmn;0.16, t=4.34, P=0.01), and 120 hours (Scr CRISPR: 1.41\u0026plusmn;0.17 vs. MAGED2 CRISPR: 0.86\u0026plusmn;0.12, t=4.62, P\u0026lt;0.01) (Fig. 6A). Similarly, inhibition of MAGED2 also resulted in a significant reduction in colony formation (t=5.22, P<0.001, Fig. 6B). The effect of MAGED2 on proliferation following MAGED2 downregulation was also assessed using the EDU cell-image assay. The results of the EDU cell image test were consistent with the results of the CCK-8 and colony formation assays, indicating that the EdU-positive rates of U251-MG cells were lower in the MAGED2 CRISPR group than in the Scramble CRISPR group (t=5.47, P\u0026lt;0.0001, Fig. 6C). As a result of these three tests, it was concluded that knocking down MAGED2 inhibited the proliferation of glioma U251-MG cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGlioma U251-MG cells were arrested in G0/G1 phase and apoptosis was accelerated by MAGED2 suppression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell cycle distribution demonstrated a direct relationship with cell proliferation. On this basis, flow cytometry was used to study the cell cycle distribution of U251-MG cells following MAGED2 downregulation. As depicted in Fig. 7A and B, inhibiting MAGED2 increased the number of cells entering the G0/G1 phase by 43.27% (t=19.13, P\u0026lt;0.0001) while decreasing the number of cells entering the S phase by 35.16% (t=30.18, P\u0026lt;0.0001). Furthermore, the impact of MAGED2 knockdown on apoptosis in glioma U251-MG cells was also investigated. The results showed that the percentage of apoptosis in U251-MG cells from the MAGED2 CRISPR group ((17.40 \u0026plusmn; 2.44) % was significantly greater than the Scramble CRISPR group (10.40 \u0026plusmn; 1.90) % (t=3.93, P\u0026lt;0.05, Fig. 7C and D). These findings demonstrated that MAGED2 knockdown effectively inhibited U251-MG cell growth by increasing the proportion of cells in the G0/G1 phase, lowering the percentage of cells in the S phase, and triggering apoptosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAGED2 downregulation decreased cell growth through restoring CDKN1A\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eU251-MG cells were transfected with MAGED2 CRISPR or Scramble CRISPR to investigate the target of MAGED2 in glioma cells in vitro. Following that, CDKN1A mRNA and protein expression levels were determined by qRT-PCR and Western blotting, respectively. The results showed that when compared to Scramble CRISPR transfection, CDKN1A mRNA expression levels were clearly up-regulated following transfection with MAGED2 CRISPR (t=12.33, P\u0026lt;0.0001, Fig. 7E). Furthermore, CDKN1A protein expression was much greater in the MAGED2 CRISPR transfection group (t=11.52, P\u0026lt;0.0001, Fig. 7F).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe discovery of useful prognostic biomarkers will aid in early diagnosis, tumor therapy response prediction, prognosis, and eventually personalized treatment.The most recent version of the WHO Classification for 2021 was published, providing more accurate stratification than classification based solely on histopathology[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Indeed, it pioneered molecular indicators such as IDH1/2 mutation status and 1p/19q codeletion, which are now well acknowledged for their excellent predictive value across the world[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Despite the long history of molecular research into the glioma profile, MAGED2 has never been published to our knowledge, even though we have established that it is an intriguing prognostic marker.\u003c/p\u003e \u003cp\u003eMany malignancies have high MAGED2 expression, and MAGED2 may play a vital role in cancer progression, making it a prospective target for tumor therapy. MAGE D2 mRNA overexpression leads to tumor growth in hepatocellular carcinoma, according to Kanda and colleagues, and thus may serve as a prognosis indicator after curative resection as well as a possible therapeutic target in hepatocellular carcinoma[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurther studies have confirmed that the MAGED2 expression level was associated with metastatic potential of gastric cancer, indicating that patients with gastric cancer had a poor prognosis. Such findings suggest that MAGED2 could be a viable biomarker for gastric cancer malignant behavior in both gastric tissue and serum samples[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Type 2 MAGE expression has recently been linked to crucial clinical and molecular aspects in glioma, according to research. However, in a bioinformatics study, MAGED2 did not show a distinct pattern of overexpression/downregulation[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. As a result, the precise involvement of MAGED2 in the progression and prognosis of glioma patients remains unknown.\u003c/p\u003e \u003cp\u003eThe public expression profiles and clinical data of glioma patients from the TCGA were first used in the current investigation. According to the TCGA data, MAGED2 expression levels were significantly higher in GBM tissues than in LGG tissues. Furthermore, as compared to NBTs, MAGED2 was shown to be substantially expressed in human glioma tissues. In the CGGA database, the expression of MAGED2 rose dramatically as the grade of glioma increased. IDH1 mutation and MGMT expression were both linked to MAGED2 expression. Secondly, statistical analysis revealed that MAGED2 expression was closely related to WHO grade, Ki-67, IDH1/2, and MGMT. Patients with high MAGED2 expression in malignant tissues had significantly shorter median OS and RFS times than those with low MAGED2 expression, according to a Kaplan-Meier study. MAGED2 could be used as an independent predictive biomarker in glioma patients, according to multivariate and univariate survival studies. Thirdly, a MAGED2 CRISPR KO expressing lentiviral vector was created and transfected into glioma U251-MG cells, allowing it to stably down-regulate MAGED2\u0026rsquo;s expression levels in vitro. The findings suggested that MAGED2 knockdown could inhibit U251-MG cell growth by raising the percentage of cells in the G0/G1 phase while decreasing the percentage of cells in the S phase, and by triggering apoptosis.\u003c/p\u003e \u003cp\u003ePapageorgio et al. recently showed that MAGED2 could boost lung cancer cell proliferation by targeting CDKN1A in lung cancer. Additionally, in certain malignancies, MAGED2, like NDN, may promote p53-mediated growth inhibition via a CDKN1A-independent mechanism[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Furthermore, when compared to Scramble CRISPR, this study found that mRNA and protein expression levels of CDKN1A were significantly up-regulated after transfection with MAGED2 CRISPR in vitro. CDKN1A is a cyclin-dependent kinase inhibitor that stops the cell cycle by inhibiting the CDK1 and CDK2 complexes[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDown-regulation of MAGED2 expression inhibited the growth of glioma cells in our investigation. However, our findings show that MAGED2 expression was related to the G1 phase of the cell cycle rather than the G2/M phase. This could be due to the varied cells that were selected. We also discovered that MAGED2 regulates glioma U251-MG cell growth via CDKN1A. CDKN1A has been demonstrated to influence cell cycle progression in the S and G1 phases in numerous earlier investigations[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. It has been confirmed that CDKN1A interacts with the proliferating cell nuclear antigen (PCNA), which is involved in S-phase DNA replication and DNA damage repair[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. As a result, the MAGED2/ CDKN1A pathway may be related to the G1 phase of the cell cycle in glioma U251-MG cells.\u003c/p\u003e \u003cp\u003eFinally, by restoring CDKN1A, downregulation of MAGED2 partially suppressed cell proliferation in the U251-MG cells. The tumor suppressor protein, p53, regulates CDKN1A expression, and CDKN1A can induce p53-dependent cell cycle arrest at G1 in response to a variety of stressors[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Trussart et al. discovered that the Melanoma antigen-D2 regulates cell cycle progression and the DNA damage response in a variety of cancers[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. According to Papageorgio et al., MAGED2 is a possible negative regulator of p53 activity, which could have consequences for cancer management and prognosis[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. As a result, we hypothesize that MAGED2's function is partially dependent on the CDKN1A/P53 pathway. However, whether other key elements are also involved in MAGED2's regulatory network in glioma warrants additional investigation. As a result, the data suggest that MAGED2 may increase the proliferation of glioma U251-MG cells by inhibiting CDKN1A.\u003c/p\u003e \u003cp\u003eThe current study included a number of limitations. Firstly, the goal of this study was to determine the changes in MAGED2 expression between glioma and normal brain tissue, as well as the impact of MAGED2 on the prognosis of glioma patients. Future in vitro and in vivo investigations should use MAGED2-positive and -negative glioma cells to determine the biological function of MAGED2. Secondly, glioma progression involves a complicated network of pathophysiology. The role of ATR, SKP2, and CDC20 signaling in MAGED2-mediated cell cycle progression cannot be ruled out. Finally, because the current study was conducted in a single institute, there should be more patients included in the study, and the patient classification should be balanced. It is also critical to detect serum immunoreactivity in glioma patients. The ultimate goal of the experimental line of inquiry is to lay the groundwork for MAGED2-based immunotherapy.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, the current study found that MAGED2 plays an important role in the prognosis and growth of human glioma. MAGED2 is often overexpressed in human glioma tissues, predicting a poor prognosis for glioma patients. Furthermore, down-regulation of MAGED2 expression by MAGED2 CRISPR inhibited the proliferation of glioma U251-MG cells in vitro by up-regulating CDKN1A. Furthermore, these findings suggest that MAGED2 can stimulate the growth of U251-MG cells by targeting CDKN1A, suggesting that MAGED2 may serve as a novel target in the clinical treatment of glioma.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eMAGE, melanoma-associated antigen; IHC, immunohistochemistry OS, overall survival; RFS, recurrence-free survival; TCGA, The Cancer Genome Atlas; NBS, normal brain tissues\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJY, SYL, CL and LGM conceived the study, analyzed the data and drafted the manuscript. KJF, YM, HNC, JW, QRH, ZDW, QJ, FZG and TD acquired patient records, performed the experiments, interpreted the data, and prepared the figures and tables. All authors contributed to the article and approved the submitted version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Grants from Guangxi Natural Science Foundation (No. 2018GXNSFAA281151 and 2020GXNSFAA297154), Scientific Research Project of Guangxi Health Commission (No. S2018020), National Natural Science Foundation of China (No. 82060225) to Jun Yan.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed during the current study are available from the corresponding author on reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest to declare.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was reviewed and approved by the ethics committee of Guangxi Medical University Cancer Hospital (No. LW2021082).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed consent\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll patients provided written informed consent according to the local ethics committee regulations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eOmuro A, DeAngelis LM (2013) Glioblastoma and other malignant gliomas: a clinical review. JAMA 310: 1842-1850 doi:10.1001/jama.2013.280319\u003c/li\u003e\n\u003cli\u003eBush NA, Chang SM, Berger MS (2017) Current and future strategies for treatment of glioma. Neurosurg Rev 40: 1-14 doi:10.1007/s10143-016-0709-8\u003c/li\u003e\n\u003cli\u003eMasui K, Kato Y, Sawada T, Mischel PS, Shibata N (2017) Molecular and Genetic Determinants of Glioma Cell Invasion. International journal of molecular sciences 18 doi:10.3390/ijms18122609\u003c/li\u003e\n\u003cli\u003eFlorke Gee RR, Chen H, Lee AK, Daly CA, Wilander BA, Fon Tacer K, Potts PR (2020) Emerging roles of the MAGE protein family in stress response pathways. J Biol Chem 295: 16121-16155 doi:10.1074/jbc.REV120.008029\u003c/li\u003e\n\u003cli\u003eReusch B, Bartram MP, Dafinger C, Palacio-Escat N, Wenzel A, Fenton RA, Saez-Rodriguez J, Schermer B, Benzing T, Altm\u0026uuml;ller J, Beck BB, Rinschen MM (2022) MAGED2 controls vasopressin-induced aquaporin-2 expression in collecting duct cells. Journal of proteomics 252: 104424 doi:10.1016/j.jprot.2021.104424\u003c/li\u003e\n\u003cli\u003eHashimoto R, Kanda M, Takami H, Shimizu D, Oya H, Hibino S, Okamura Y, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Nomoto S, Fujiwara M, Kodera Y (2015) Aberrant expression of melanoma-associated antigen-D2 serves as a prognostic indicator of hepatocellular carcinoma outcome following curative hepatectomy. Oncol Lett 9: 1201-1206 doi:10.3892/ol.2014.2823\u003c/li\u003e\n\u003cli\u003eKanda M, Nomoto S, Oya H, Takami H, Shimizu D, Hibino S, Hashimoto R, Kobayashi D, Tanaka C, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Fujiwara M, Kodera Y (2016) The Expression of Melanoma-Associated Antigen D2 Both in Surgically Resected and Serum Samples Serves as Clinically Relevant Biomarker of Gastric Cancer Progression. Annals of surgical oncology 23 Suppl 2: S214-221 doi:10.1245/s10434-015-4457-8\u003c/li\u003e\n\u003cli\u003eShen Y, Zhang Y, Du J, Jiang B, Shan T, Li H, Bao H, Si Y (2021) CXCR5 down-regulation alleviates cognitive dysfunction in a mouse model of sepsis-associated encephalopathy: potential role of microglial autophagy and the p38MAPK/NF-\u0026kappa;B/STAT3 signaling pathway. Journal of neuroinflammation 18: 246 doi:10.1186/s12974-021-02300-1\u003c/li\u003e\n\u003cli\u003eRhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM (2004) ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia (New York, NY) 6: 1-6 \u003c/li\u003e\n\u003cli\u003eLouis DN, Perry A, Wesseling P, Brat DJ, Cree IA, Figarella-Branger D, Hawkins C, Ng HK, Pfister SM, Reifenberger G, Soffietti R, von Deimling A, Ellison DW (2021) The 2021 WHO Classification of Tumors of the Central Nervous System: a summary. Neuro-oncology 23: 1231-1251 doi:10.1093/neuonc/noab106\u003c/li\u003e\n\u003cli\u003eYan J, Wen J, Wei ZD, Li XS, Li P, Xiao SW (2018) Prognostic and clinicopathological value of melanoma-associated antigen D4 in patients with glioma. Oncol Lett 15: 4151-4160 doi:10.3892/ol.2018.7884\u003c/li\u003e\n\u003cli\u003eFon Tacer K, Montoya MC, Oatley MJ, Lord T, Oatley JM, Klein J, Ravichandran R, Tillman H, Kim M, Connelly JP, Pruett-Miller SM, Bookout AL, Binshtock E, Kamiński MM, Potts PR (2019) MAGE cancer-testis antigens protect the mammalian germline under environmental stress. Science advances 5: eaav4832 doi:10.1126/sciadv.aav4832\u003c/li\u003e\n\u003cli\u003eSun Y, Li Y, Luo D, Liao DJ (2012) Pseudogenes as weaknesses of ACTB (Actb) and GAPDH (Gapdh) used as reference genes in reverse transcription and polymerase chain reactions. PLoS One 7: e41659 doi:10.1371/journal.pone.0041659\u003c/li\u003e\n\u003cli\u003ePirlot C, Thiry M, Trussart C, Di Valentin E, Piette J, Habraken Y (2016) Melanoma antigen-D2: A nucleolar protein undergoing delocalization during cell cycle and after cellular stress. Biochimica et biophysica acta 1863: 581-595 doi:10.1016/j.bbamcr.2015.12.010\u003c/li\u003e\n\u003cli\u003eVali\u0026ntilde;o-Rivas L, Cuarental L, Agustin M, Husi H, Cannata-Ortiz P, Sanz AB, Mischak H, Ortiz A, Sanchez-Ni\u0026ntilde;o MD (2019) MAGE genes in the kidney: identification of MAGED2 as upregulated during kidney injury and in stressed tubular cells. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 34: 1498-1507 doi:10.1093/ndt/gfy367\u003c/li\u003e\n\u003cli\u003eArora M, Kumari S, Singh J, Chopra A, Chauhan SS (2020) Downregulation of Brain Enriched Type 2 MAGEs Is Associated With Immune Infiltration and Poor Prognosis in Glioma. Frontiers in oncology 10: 573378 doi:10.3389/fonc.2020.573378\u003c/li\u003e\n\u003cli\u003ePapageorgio C, Brachmann R, Zeng J, Culverhouse R, Zhang W, McLeod H (2007) MAGED2: a novel p53-dissociator. International journal of oncology 31: 1205-1211 \u003c/li\u003e\n\u003cli\u003eHernandez-Segura A, Nehme J, Demaria M (2018) Hallmarks of Cellular Senescence. Trends in cell biology 28: 436-453 doi:10.1016/j.tcb.2018.02.001\u003c/li\u003e\n\u003cli\u003eGartel AL, Radhakrishnan SK (2005) Lost in transcription: p21 repression, mechanisms, and consequences. Cancer Res 65: 3980-3985 doi:10.1158/0008-5472.Can-04-3995\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu Z (2018) miR-93 enhances cell proliferation by directly targeting CDKN1A in nasopharyngeal carcinoma. Oncol Lett 15: 1723-1727 doi:10.3892/ol.2017.7492\u003c/li\u003e\n\u003cli\u003eTrussart C, Pirlot C, Di Valentin E, Piette J, Habraken Y (2018) Melanoma antigen-D2 controls cell cycle progression and modulates the DNA damage response. Biochemical pharmacology 153: 217-229 doi:10.1016/j.bcp.2018.01.035\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eCharacteristics of patients with gliomas.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse: collapse; margin: 0px auto;\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCharacteristic\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumbers\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003en = 98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u003cstrong\u003e(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e60.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e39.79\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026lt;39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e47.96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026ge;39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e52.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eTumor size(cm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026lt;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e31.63\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026ge;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e68.36\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eExtent of resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eTotal resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e64.29\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eSubtotal resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e35.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eTumor side\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eRight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e57.14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eLeft\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e42.86\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eInfiltrated part\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eSingle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e36.73\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eMultiple\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e63.27\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eWHO\u0026nbsp;classification\u003csup\u003e\u0026nbsp;a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e40.81\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e59.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eKPS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026lt;70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e37.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003e\u0026ge;70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e62.24\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eTreatment after first surgery\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eRT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e6.12\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eChemo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e21.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eRT+ Chemo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e59.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.342756183745585%\"\u003e\n \u003cp\u003eNone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.26501766784452%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"33.3922261484099%\"\u003e\n \u003cp\u003e13.27\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003ea\u0026nbsp;\u003c/sup\u003eAccording to the 2021 World Health Organization Classification of Tumors of the Nervous System. WHO, World Health Organization; KPS, Karnofsky Performance Scale;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003e\u0026nbsp;Summary of molecular data of samples of included gliomas(n=98)\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse: collapse; margin: 0px auto;\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eVariable\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003eLower Grade gliomas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003eHigher Grade gliomas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003eP‑value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eIDH1/2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eMutant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e22(22.45%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e30(30.61%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e6.184\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.013*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eWildtype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e31(31.63%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e15(15.31%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003e1p/19q\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eCodeletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e19(19.39%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e34(34.69%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e4.713\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.029*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eNoncodeletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e26(26.53%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e19(19.39%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eTERT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e26(26.53%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e23(23.47%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e2.013\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.156\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e19(19.39%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e30(30.61%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eMGMT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eMethylated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e14(14.28%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e29(29.59%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e5.507\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.019*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eUnmethylated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e31(31.63%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e24(24.49%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eEGFR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e23(23.47%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e36(36.73%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e2.872\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.090\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e22(22.45%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e17(17.35%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eKi67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003e\u0026lt;10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e30(30.61%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e20(20.41%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e8.151\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.004*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003e\u0026ge;10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e15(15.31%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e33(33.67%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eMAGE-D2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e17(17.35%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e37(37.67%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e10.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e0.002**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.718381112984822%\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.78920741989882%\"\u003e\n \u003cp\u003e28(28.57%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.60876897133221%\"\u003e\n \u003cp\u003e16(16.33%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.200674536256322%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.682967959527824%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAssociation\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;between the MAGE-D2 protein and clinical characteristic of glioma patients(n=98)\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"20.933977455716587%\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"18.19645732689211%\"\u003e\n \u003cp\u003ePositive / Total test (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"33.97745571658615%\"\u003e\n \u003cp\u003ePositive / total(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"9.339774557165862%\"\u003e\n \u003cp\u003e\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"17.55233494363929%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eHigh\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eLow\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e0.089\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.765\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Male\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e44/98(44.89)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e35/98 (35.71)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e25/98 (25.51)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Female\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e34/98(34.69)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e21/98 (21.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e17/98 (17.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e0.055\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.814\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;<39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e40/98(40.81)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e27/98(24.49)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e19/98(19.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026ge;39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e38/98(38.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e32/98(32.65)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e20/98(23.47)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eTumor size (cm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e0.031\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.860\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e<3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e39/98(39.71)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e25/98(25.51)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e18/98(18.37)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026ge;3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e39/98(39.71)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e31/98(31.63)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e24/98(24.49)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eExtent of resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e0.350\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.554\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eTotal resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e43/98(43.88)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e34/98(34.69)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e23/98(23.47)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eSubtotal resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e35/98(35.71)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e22/98(22.45)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e19/98(19.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eWHO\u0026nbsp;grade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e7.850\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.005\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e30/98(30.61)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e20/98(20.41)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e27/98(27.55)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e48/98(48.97)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e36/98(36.73)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e15/98(15.31)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eKi-67 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e6.908\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.008**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e<10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e40/98(40.81)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e19/98(19.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e26/98(26.53)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003e\u0026ge;10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e38/98(38.77)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e37/98(37.76)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e17/98(16.33)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eIDH1/2\u0026nbsp;(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e5.479\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.019*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eMutant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e30/98(30.61)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e36/98(36.73)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e17/98(17.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003ewildtype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e48/98(48.97)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e20/98(20.41)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e25/98(25.51)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eMGMT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e4.901\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e0.027*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eMethylated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e33/98(33.67)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e17/98(17.35)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e27/98(27.55)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.90032154340836%\"\u003e\n \u003cp\u003eUnmethylated\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.167202572347268%\"\u003e\n \u003cp\u003e45/98(45.92)\u003c/p\u003e\n \u003cp\u003e78/98(79.59)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e33/98(33.67)\u003c/p\u003e\n \u003cp\u003e56/98(57.14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.041800643086816%\"\u003e\n \u003cp\u003e21/98(21.43)\u003c/p\u003e\n \u003cp\u003e42/98(42.86)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.32475884244373%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"17.524115755627008%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003ea:High MAGE-D2 protein expression \u0026nbsp; (++/+++);\u003c/p\u003e\n\u003cp\u003eb:Low MAGE-D2 protein expression \u0026nbsp; (\u0026ndash;/+);\u0026nbsp;\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003eTable 4\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003eUnivariate and Multivariate analysis of different prognostic parameters\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"8.842105263157896%\"\u003e\n \u003cp\u003eAll Gliomas Variable\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.473684210526316%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" width=\"41.36842105263158%\"\u003e\n \u003cp\u003eOverall survival\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" width=\"42.31578947368421%\"\u003e\n \u003cp\u003eRecurrence Free Survival\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"8.189158016147635%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.916955017301039%\"\u003e\n \u003cp\u003eUnivariate analysis Hazard ratio(95% CI)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.113033448673587%\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.185697808535178%\"\u003e\n \u003cp\u003eMultivariate analysis Hazard ratio(95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.113033448673587%\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"16.839677047289506%\"\u003e\n \u003cp\u003eUnivariate analysis Hazard ratio(95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.113033448673587%\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.185697808535178%\"\u003e\n \u003cp\u003eMultivariate analysis Hazard ratio(95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.113033448673587%\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2306805074971165%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e0.644 (0.452-1.102)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.169\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e0.764 (0.415-1.202)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.309\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003e\u0026ge;39 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e1.061 (1.030-1.089)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.018\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e0.964 (0.902-1.031)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.965\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e1.064 (1.022-1.083)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.009\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e1.003(0.832-1.042)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.368\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003e\u0026ge;3cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e1.129 (0.593-1.953)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.969\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e1.079 (0.436-1.672)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.089\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eExtent of resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003eTotal resection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e1.562 (0.724-2.362)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.235\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e1.6889(0.944-2.687)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eWHO grade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003eHigh grade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e3.595 (1.544-5.571)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e3.556 (2.952-6.853)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e3.148 (1.533-5.770)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e3.048(1.519-5.453)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eIDH1 status\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003eMutant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e18.553(10.844-38.197)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e12.877(6.053-23.167)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e10.445(4.347-13.277)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e8.756(3.649-12.486)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eKi-67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003e\u0026ge;10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e6.179 (2.168-15.411)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e2.766 (1.068-5.437)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.575\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e9.474 (3.168-26.771)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e<0.001\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e5.476(1.705-12.656)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.156\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"8.832807570977918%\"\u003e\n \u003cp\u003eMAGE-D2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.465825446898002%\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.511041009463723%\"\u003e\n \u003cp\u003e0.578 (0.182-0.927)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.019\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e1.271 (0.502-2.327)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.782\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"15.352260778128286%\"\u003e\n \u003cp\u003e0.471 (0.102-0.827)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.009\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.667718191377498%\"\u003e\n \u003cp\u003e0.984 (0.508-1.947)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.573080967402734%\"\u003e\n \u003cp\u003e0.075\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.2103049421661409%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003ea\u003c/sup\u003eUnivariate analysis was performed using the log-rank test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003csup\u003eb\u003c/sup\u003eMultivariate analysis was performed using the Cox proportional hazards model.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003csup\u003ec\u003c/sup\u003eHR, Harzard ratio; 95 percent CI, 95 percent confidence interval for relative risk.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003ed\u003c/sup\u003eStatistically significant (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"melanoma-associated antigen-D2, CDKN1A, glioma, proliferation, Prognosis","lastPublishedDoi":"10.21203/rs.3.rs-1635612/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1635612/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction\u003c/strong\u003e The melanoma-associated antigen D4 (MAGED2) is one of the melanoma-associated antigen family members. It is commonly overexpressed in a variety of malignancies. However, the mechanism and function of MAGED2 in glioma remain unknown. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e The TCGA and Oncomine databases were used to determine the expression level of MAGED2 and its relationship to glioma. MAGED2 protein expression in 98 tumor tissues from glioma patients was measured using RT-qPCR, Western blot and immunohistochemistry, and the associations between MAGED4 expression and clinicopathological factors were evaluated. qRT-PCR and Western blots were used to assess the levels of MAGED2 and CDKN1A expression in glioma U251-MG cells following transfection of MAGED2 CRISPR. CCK-8, colony formation, and EdU assays were used to assess the effect of MAGED2 on U251-MG cell proliferation, and flowcytometry was used to track changes in the cell cycle and cell apoptosis following MAGED2 CRISPR transfection. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e In the current investigation, MAGED2 was shown to be substantially expressed in human glioma tissues, and high MAGED2 expression predicted poor recurrence-free survival (RFS) and overall survival (OS) for glioma patients. The presence of high MAGED2 expression was related to WHO grade, Ki-67, IDH1/2, MGMT, and survival status. Furthermore, MAGED2 expression knockdown significantly inhibited the proliferation and colony formation potential of U251-MG cells by preventing cell cycle arrest at the G0/G1 phase and triggering apoptosis. Moreover, our findings indicated that the mRNA and protein expression levels of CDKN1A were considerably up-regulated in vitro following MAGED2 CRISPR transfection. MAGED2 downregulation inhibited the ability of cell proliferation in the U251-MG cells through restoring CDKN1A. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions \u003c/strong\u003eTo conclude, the current study's findings imply that a high level of MAGED2 expression predicts a poor prognosis for glioma patients. MAGED2 can stimulate the proliferation of glioma U251-MG cells by targeting CDKN1A. MAGED2 may be a possible biomarker for glioma and an important prognostic factor for glioma patients.\u003c/p\u003e","manuscriptTitle":"Expression and prognostic value of Melanoma-associated antigen D2 in gliomas","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-05-12 15:53:39","doi":"10.21203/rs.3.rs-1635612/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"77ae839c-9816-4f63-bdda-fafc54ef9a38","owner":[],"postedDate":"May 12th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-05-12T15:53:41+00:00","versionOfRecord":[],"versionCreatedAt":"2022-05-12 15:53:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1635612","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1635612","identity":"rs-1635612","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.