miRNA-769-5p and Smad2 Differential Expression in Patients with or without Oral cGVHD

miRNA-769-5p and Smad2 Differential Expression in Patients with or without Oral cGVHD | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article miRNA-769-5p and Smad2 Differential Expression in Patients with or without Oral cGVHD Xiangzhi Yong, YuXi Zhou, Qiaozhi Jiang, Zhenmin Liu, Tiantian Wu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2530234/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Oral chronic graft versus host disease (Oral cGVHD) affects the life quality of patient. But its pathogenesis is still unclear. MicroRNA (miRNA) involves in numerous pathologic and physiologic processes. Objective: To preliminarily observe the change of miRNAs in oral cGVHD. Methods: Peripheral venous blood was taken from 8 cases of oral cGVHD, 8 cases without oral cGVHD, and 8 cases of healthy control group to construct the miRNAs library by Illumina Hiseq 2500 platform. The expression of miRNA-769-5p was detected by qRT-PCR in each group with subjects adding to 15. The interactions between miRNA-769-5p and Smad2 mRNA was verified by dual-luciferase assay. qRT-PCR and ELISA was used to detect the mRNA and protein level of Smad2 in peripheral blood respectively. Results: All three groups expressed 518 miRNAs and 191 miRNAs showed significantly different expression. The expression of miRNA-769-5p was the higher in non-oral cGVHD patients than that in oral cGVHD patients, and were of certain value in the diagnosis of oral cGVHD. The levels of Smad2 mRNA and protein were higher in the oral cGVHD group than those without oral cGVHD. As a target of miRNA-769-5p, Smad2 mRNA was negatively related to it. Conclusion: Differential expression of miRNAs, especially miRNA-769-5p may be involved in oral cGVHD. High expression of circulating Smad2 may be associated with the oral cGVHD, which might be regulated by miRNA-769-5p. allogeneic hematopoietic stem cell transplantation chronic graft-versus-host-disease oral mucosa miRNAs Figures Figure 1 Figure 2 1. Introduction Chronic graft versus host disease (cGVHD) is the leading cause of death after allogeneic hematopoietic stem cell transplantation (allo-HSCT) [1]. As an alloimmune and autoimmune disease, it is characterized by lichenoid changes and fibrosis affecting a multitude of tissues and compromising organ function. Its clinical signs often first appear in the mucosa[2]. Oral cavity is a main organ involved in cGVHD, affecting 45-83% of cGVHD patients[3]. Covering lichen planus-like changes, erythema, ulceration, mucoceles, etc., the clinical presentation of oral cGVHD is diverse and can influence any site in oral cavity such as oral mucosa, salivary gland and periodontium [4, 5]. Lichen planus-like changes, characterized by hyperkeratotic white lines and lacy-appearing lesions on the oral mucosa, serve as the diagnostic feature of oral cGVHD among oral manifestations [6]. In our previous study, the oral lichen planus-like changes will exist persistently even when the systemic disease severity was controlled [7]. The consequences of oral CGVHD will affect patient’s life quality in any aspect, especially eating and nutrition absorption [8]. Besides, oral cGVHD is a risk for the development of oral squamous cell carcinomas [9, 10]. Given the deleterious impact on oral even system health caused by oral cGVHD, consciousness is needed in the occurrence and progress of oral cGVHD. The pathogenesis of cGVHD, especially oral cGVHD, is complex and remains controversial. Recent studies have revealed microRNAs (miRNAs) played a role in autoimmune diseases pathogenesis [11]. Most studies have focused on the miRNAs in aGVHD[12].For example, Xie reported that the change of miRNA was related to aGVHD patients[13] and Crossland further supported that miRNAs could be clinically relevant biomarkers for aGvHD[14]. Recently, Reikvam have firstly reported the miRNAs serum profiles in cGVHD [15]. However, each organ and tissue affected by cGVHD has a variety of altered miRNAs due to their specific microenvironment [16, 17]. Therefore, is there also miRNAs change in oral cGVHD patients, and how it will influence the diseases? The study aims to preliminarily analyze the possible regulatory role of miRNA in the occurrence and development of oral cGVHD, through detection and bioinformatics analysis of the differential expression of miRNAs in the peripheral blood of allo-HSCT patients with oral cGVHD and those without oral cGVHD. 2. Methods 2.1 Study approval Each participant signed an informed consent form in accordance with the declaration of Helsinki. The study was approved by Research Ethics Committee of Guangxi Medical University (IRB:20170301-4). 2.2 Clinical examination The Demographic data were obtained through a structured questionnaire. Clinical assessments and examination were recorded. Oral cGVHD was diagnosed and scored depending on diagnosis and scoring criteria[6]. Oral discomfort was recorded by visual analogous scale (VAS). 2.2 RNA sequencing 16 patients after allo-HSCT including 8 patients with Oral cGVHD (Oral cGVHD group) and without any symptom of cGVHD (without cGVHD group) in other organ or tissue and 8 patients without any symptom of cGVHD. Besides, matching by age and gender, 8 healthy volunteers recruited as control. Peripheral venous blood was taken from 24 participants to construct the miRNAs library. Illumina Hiseq 2500 platform was used for sequencing and analyzing the differential expression of miRNAs (LC-BIO, Hangzhou, China). 2.3 RT-qPCR Participants in “Oral cGVHD” and “without cGVHD” groups were added to 15. Peripheral venous blood was taken to detect miRNA and PBMC was isolated to detect Smad mRNA. Total RNA was isolated from cells by TRIZOL (Invitrogen), and reversely transcribed into cDNA using TUREscript 1st Strand cDNA SYNTHESIS Kit. qRT-PCR was undertaken using a QTOWER2.2 system (ANALYTIKJENA). cel-miR-39-5p was used as the control for miRNA detection and GAPDH as the control for Smads mRNA. Primer sequences were listed in Tab1. Formulas were used to analyze the data: R=2 − ( Δ Ct sample − Δ Ct control). 2.4 ELISA Plasma from participants was collected and analyzed using human Smad2 immunoblot assay ELISA kit (CUSABIO). The spectrophotometry was measured at 450nm with Wellscan Mk3(ThermoScientific). 2.5 Luciferase reporter assay The 3'-UTR of Smad2, with wild-type (WT) or mutated (MUT) binding sites for miRNA-769-5p, was amplified and cloned into the pGL3 vector to generate the plasmid pGL3-WT-Smad2-3'-UTR or pGL3- MUT- Smad2-3'-UTR, respectively. For the luciferase reporter assay, HEK-293 cells were cotransfected with the luciferase reporter vectors and miRNA-769-5p mimics, or the corresponding negative control using Lipofectamine LTX (Invitrogen, Carlsbad, CA). The pRL-TK plasmid (Promega, Madison, USA) was used as a normalization control. After 24 hours of incubation, a Luciferase Reporter Assay kit (Promega) was used to detect luciferase activity according to the manufacturer’s instructions. 2.6 Statistical Analysis Results are expressed as the mean±standard deviation(X±SD). Bioinformatic analysis of miRNAs was conducted by Omicstudio. miRNAs different expression defined based on Benjamini-Hochberg adjusted P-value <5% and |log2 (fold-change FC)| ≥ 1. The difference of miRNAs expression between groups was analyzed by Mann-Whitney test. Receiver operating characteristic (ROC) curve analysis was used for diagnostic analysis The levels of Smad2 mRNA and protein were compared between the two groups was analyzed by t test. Spearman rank correlation analysis was used to analyze the correlation. p < 0.05 was considered statistically significant. Statistical software SPSS 22.0 was used for analysis. 3. Results 3.1 miRNAs differential expression The demographic and clinical characteristics of subjects showed in Tab 2. 518 miRNAs expressed in all three groups and 191 miRNAs were significantly different expression. Enrichment analysis of differential miRNAs expression levels was performed by GO functional annotation and KEGG Pathway functional annotation (Fig 1). The information of top 5 different expression miRNAs (see Tab 3), sorted by p value of differences. 3.2 Different expressions of miRNA-769-5p To further confirm the different expressions of miRNA-769-5p, participants in “Oral cGVHD” and “without cGVHD” groups were added to 15 (see Tab 4). The expression of miRNA-769-5p was higher in patients without oral cGVHD than that in oral cGVHD patients (see Tab 5). Among patients after allo-HSCT, ROC analysis indicated miRNA-769-5p was of certain value in the diagnosis of oral cGVHD (p＜0.05). Areas under the curves of miRNA-769-5p was 0.809 the moderate diagnostic value (Fig 2A). The GO term an KEGG enrichment analysis was shown in Fig 2B. 3.3 Different expressions of Smad2 After being predicted by TargetScan and miRanda, it was verified Smad2 was potential target genes of miRNA-769-5p by dual-luciferase test (Fig 2C). Among 30 participants, it is found miRNA-769-5p was negatively related to Smad2 mRNA ( r=-0.585， p ＜0.05) (Fig 2D).. Smad2 mRNA and protein levels were higher in the oral cGVHD group than those in patients without cGVHD (Fig 2E). 4. Discussion The study first determined the circulating miRNAs' expression profile for oral cGVHD. According to studies, circulating miRNAs are biological markers that can be used to predict, diagnose, and even predict the outcome of aGVHD [18]. Independent miRNA markers also exist in the case of skin aGVHD due to tissue specificity. [19]. However, there are few studies on miRNA as markers for the prediction, diagnosis and prognosis of cGVHD, particularly oral cGVHD. We paid attention to the oral cGVHD, and established a control group of patients without oral cGVHD who had received transplantation over a year ago based on our prior clinical observations and the fact that oral cGVHD almost always occurred within 300 days after transplantation. We have revealed that 518 miRNAs were found to be expressed in all three groups and 191 miRNAs showed significantly different expression. In bioinformatics analysis, it is found that membrane proteins in cellular components, protein binding in molecular functions, and transcription of biochemical processes are where these miRNAs are most concentrated. Furthermore, KEGG Pathway annotation showed that the PI3K-Akt signaling pathway and cancer signaling pathways were the main targets of differential miRNAs. Both cancer signaling and PI3K-Akt pathway are closely related to the occurrence and development of tumors. Studies have shown that patients after Allo-HSCT are 2-3 times more likely to develop solid tumors than healthy individuals [20]. About one-third of solid tumors are secondary tumors in the skin and mucosa of recipients of transplants, with oral squamous cell carcinoma accounting for 50% of these patients. [21, 22]. Therefore, among the miRNAs differentially expressed in patients with oral cGVHD, those related to cancer signaling pathways or PI3K-Akt signaling pathway and involved in carcinogenesis draw our attention. Studies has been reported that miRNAs can assist in the diagnosis of many diseases[23]. It is found that miRNA-769-5p was of certain value in the diagnosis of oral cGVHD. Bioinformatics analysis of miRNA-769-5p showed that target genes of it were mainly concentrated in the TGF-β signaling pathway. TGF-β was found to influence the occurrence of oral cGVHD in our previous study [24], so we concentrated on the TGF-β/Smads signaling pathway as a result of the findings. TGF-β/Smads signaling pathway could promote the Th17 immunoreaction[25] and tissue fibrosis[26] after activation with phosphorylated TβR combined to Smad 2[27].Smads could be modulated by miRNAs [28, 29]. In the study, after being predicted by TargetScan and miRanda, we verified Smad 2 was target genes of miRNA-769-5p by dual-luciferase test. Negative relation between miRNA-769-5p and Smad2 mRNA was also observed. Both mRNA and protein levels were higher in the oral cGVHD group than those in patients without cGVHD. The high expression of Smad2 hinted the activation of TGF-β/Smads which leads to oral cGVHD. Studies have revealed that downmodulating Smad2 could ameliorate cGVHD severity [30] through reducing fibrosis [31] and generation of Th17[32]. Therefore, high expression of miRNA-769-5p silencing Smad2 would contribute to avoiding oral cGVHD. 5. Conclusion In summary, it is speculated that differential expression of miRNAs, especially miRNA-769-5p may be involved in oral cGVHD. High expression of Smad2 in peripheral blood may be associated with the oral cGVHD. Declarations 6. Funding The study was supported by National Natural Science Foundation of China (81771073, 82160180), Youth Science Foundation Project of Guangxi Natural Science Foundation (2020GXNSFBA297159) and Guangxi Medical High-level Talents Training Program. 7. Conflict of Interest Statement The authors declare that there are no conflicts of interest 8. Author Contributions Xiangzhi Yong: Methodology, experiments, statistical analysis, and original draft; YuXi Zhou: Methodology, experiments, and statistical analysis; Qiaozhi Jiang: Experiments; Zhenmin Liu: Experiments and statistical analysis; Tiantian Wu: Experiments; Zhongming Zhang: Supervision and Experiments; Rongquan He: Experiments and statistical analysis; Gang Chen: Supervision and review&editing; Renchuan Tao: Supervision, review&editing, study conception and coordination, and project administration. 9. Ethics Approval and Consent to Participate The informed consent in accordance with the declaration of Helsinki was obtained from all subjects.The study was approved by Research Ethics Committee of Guangxi Medical University (IRB:20170301-4).All methods were carried out in accordance with relevant guidelines and regulations. 10. Consent for publication Not applicable. 11. Availability of data and materials The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request. 12. Acknowledgements We thank Ms. Xu Ying (Nanning, China) for the critical reading and language improvement of this paper. References Kroger N, Solano C, Wolschke C, Bandini G, Patriarca F, Pini M, Nagler A, Selleri C, Risitano A, Messina G et al : Antilymphocyte Globulin for Prevention of Chronic Graft-versus-Host Disease . N Engl J Med 2016, 374 (1):43-53. MacDonald KP, Hill GR, Blazar BR: Chronic graft-versus-host disease: biological insights from preclinical and clinical studies . Blood 2017, 129 (1):13-21. Fall-Dickson JM, Pavletic SZ, Mays JW, Schubert MM: Oral Complications of Chronic Graft-Versus-Host Disease . J Natl Cancer Inst Monogr 2019, 2019 (53). Bassim CW, Fassil H, Mays JW, Edwards D, Baird K, Steinberg SM, Cowen EW, Naik H, Datiles M, Stratton P et al : Oral disease profiles in chronic graft versus host disease . J Dent Res 2015, 94 (4):547-554. Haverman TM, Raber-Durlacher JE, Raghoebar, II, Rademacher WMH, Rozema FR, Hazenberg MD, Epstein JB, Treister NS: Oral chronic graft-versus-host disease: What the general dental practitioner needs to know . J Am Dent Assoc 2020, 151 (11):846-856. Jagasia MH, Greinix HT, Arora M, Williams KM, Wolff D, Cowen EW, Palmer J, Weisdorf D, Treister NS, Cheng GS et al : National Institutes of Health Consensus Development Project on Criteria for Clinical Trials in Chronic Graft-versus-Host Disease: I. The 2014 Diagnosis and Staging Working Group report . Biol Blood Marrow Transplant 2015, 21 (3):389-401 e381. Xiao L, Peng Y, Tao R, Lai Y: Oral Mucosa Health Status among Patients after AIIogeneic Hematopoietic Stem Cell Transplantation in Guangxi District . Journal of Oral Science Research 2011, 27 (10):881-885. Bassim CW, Fassil H, Dobbin M, Steinberg SM, Baird K, Cole K, Joe G, Comis LE, Mitchell SA, Grkovic L et al : Malnutrition in patients with chronic GVHD . Bone Marrow Transplant 2014, 49 (10):1300-1306. Wu T, Liu Z, Yong X, Mei G, Jiang Q, Fang M, Li P, Zhang Z, Tao R: P16-positive secondary tongue squamous cell carcinoma following allogeneic hematopoietic stem cell transplantation: A case report and literature review . Oral Oncol 2021:105399. Liu Z, Peng Y, Yong X, Mei G, Yang Y, Yi C, Tao R: A case report of secondary oral squamous cell carcinoma after allogeneic hematopoietic stem cell transplantation . Oral Oncol 2020, 109 :104629. Salvi V, Gianello V, Tiberio L, Sozzani S, Bosisio D: Cytokine Targeting by miRNAs in Autoimmune Diseases . Front Immunol 2019, 10 :15. Newmarch M, Kostantin E, Tsongalis GJ, Guimond M, Roy J, De Guire V, Ahmad I: MicroRNAs in graft-versus-host disease: a review of the latest data . Bone Marrow Transplantation 2020, 55 (6):1014-1020. Xie LN, Zhou F, Liu XM, Fang Y, Yu Z, Song NX, Kong FS: Serum microRNA155 is increased in patients with acute graft-versus-host disease . Clin Transplant 2014, 28 (3):314-323. Crossland RE, Norden J, Ghimire S, Juric MK, Pearce KF, Lendrem C, Collin M, Mischak-Weissinger E, Holler E, Greinix HT et al : Profiling Tissue and Biofluid miR-155-5p, miR-155(*), and miR-146a-5p Expression in Graft vs. Host Disease . Front Immunol 2021, 12 :639171. Reikvam H, Vo AK, Johansen S, Hemsing AL, Solheim MH, Mosevoll KA, Tvedt THA, Hatfield KJ: MicroRNA serum profiles and chronic graft-versus-host disease . Blood Adv 2022, 6 (18):5295-5306. Vajari MK, Moradinasab S, Yousefi AM, Bashash D: Noncoding RNAs in diagnosis and prognosis of graft-versus-host disease (GVHD) . J Cell Physiol 2022, 237 (9):3480-3495. Lv Q, Tian Z, Dong E, Cao X: Tissue/organ-specialized immunologic features and disease mechanisms (in chinese) . Chinese Science Bulletin 2012, 36 :3450-3458. Ramzi M, Shokrgozar N: MicroRNAs: Regulatory Biomarkers in Acute Myeloid Leukemia and Graft Versus Host Disease . Clin Lab 2022, 68 (2). Atarod S, Norden J, Bibby LA, Janin A, Ratajczak P, Lendrem C, Pearce KF, Wang XN, O'Reilly S, Van Laar JM et al : Differential MicroRNA Expression Levels in Cutaneous Acute Graft-Versus-Host Disease . Front Immunol 2018, 9 :1485. Shimada K, Yokozawa T, Atsuta Y, Kohno A, Maruyama F, Yano K, Taji H, Kitaori K, Goto S, Iida H et al : Solid tumors after hematopoietic stem cell transplantation in Japan: incidence, risk factors and prognosis . Bone Marrow Transplantation 2005, 36 (2):115-121. Mawardi H, Elad S, Correa ME, Stevenson K, Woo SB, Almazrooa S, Haddad R, Antin JH, Soiffer R, Treister N: Oral epithelial dysplasia and squamous cell carcinoma following allogeneic hematopoietic stem cell transplantation: clinical presentation and treatment outcomes . Bone Marrow Transplantation 2011, 46 (6):884-891. Santarone S, Natale A, Angelini S, Papalinetti G, Vaddinelli D, Di Bartolomeo A, Di Bartolomeo P: Secondary oral cancer following hematopoietic cell transplantation . Bone Marrow Transplantation 2021, 56 (5):1038-1046. Galindo Torres BP, Garcia Giron C, Alcaraz Ortega R, Saiz Lopez P, Adiego Leza MI, Grijalba Uche MV: Knowledge and expectations about miRNAs as biomarkers in head and neck squamous cell cancers . Am J Otolaryngol 2022, 44 (2):103771. Yong X, Peng Y, Liu Z, Li Q, Lai Y, Wu T, Tao R: Analysis of serum and salivary cytokines among patients with oral cGVHD after Allo-HSCT . Oral Dis 2021, 27 (5):1320-1324. Wang F, Yang Y, Li Z, Wang Y, Zhang Z, Zhang W, Mu Y, Yang J, Yu L, Wang M: Mannan-Binding Lectin Regulates the Th17/Treg Axis Through JAK/STAT and TGF-β/SMAD Signaling Against Infection . J Inflamm Res 2022, 15 :1797-1810. Chen C, Chen J, Wang Y, Fang L, Guo C, Sang T, Peng H, Zhao Q, Chen S, Lin X et al : Ganoderma lucidum polysaccharide inhibits HSC activation and liver fibrosis via targeting inflammation, apoptosis, cell cycle, and ECM-receptor interaction mediated by TGF-β/Smad signaling . Phytomedicine 2022, 110 :154626. Wang H, Li M, Fei L, Xie C, Ding L, Zhu C, Zeng F, Liu N: Bone Marrow-Derived Mesenchymal Stem Cells Transplantation Attenuates Renal Fibrosis Following Acute Kidney Injury in Rats by Diminishing Pericyte-Myofibroblast Transition and Extracellular Matrix Augment . Transplant Proc 2023. Li S, Fan Q, He S, Tang T, Liao Y, Xie J: MicroRNA-21 negatively regulates Treg cells through a TGF-beta1/Smad-independent pathway in patients with coronary heart disease . Cell Physiol Biochem 2015, 37 (3):866-878. Liang J, Zhu W, Zhang Z, Zhu J, Fu Y, Lin Q, Kuang S, Zhang M, Shan Z: [MicroRNA-199a-3p enhances expressions of fibrosis-associated genes through targeting Smad1 in mouse cardiac fibroblasts] . Nan Fang Yi Ke Da Xue Xue Bao 2018, 38 (10):1203-1208. Marinelli Busilacchi E, Costantini A, Mancini G, Tossetta G, Olivieri J, Poloni A, Viola N, Butini L, Campanati A, Goteri G et al : Nilotinib Treatment of Patients Affected by Chronic Graft-versus-Host Disease Reduces Collagen Production and Skin Fibrosis by Downmodulating the TGF-beta and p-SMAD Pathway . Biol Blood Marrow Transplant 2020, 26 (5):823-834. Chen H, Moreno-Moral A, Pesce F, Devapragash N, Mancini M, Heng EL, Rotival M, Srivastava PK, Harmston N, Shkura K et al : WWP2 regulates pathological cardiac fibrosis by modulating SMAD2 signaling . Nat Commun 2019, 10 (1):3616. Martinez GJ, Zhang Z, Reynolds JM, Tanaka S, Chung Y, Liu T, Robertson E, Lin X, Feng XH, Dong C: Smad2 positively regulates the generation of Th17 cells . J Biol Chem 2010, 285 (38):29039-29043. Tables Table 1 Primer information Name Sequence(5'to3') has-miR-769-5p F: TCGCGTGAGACCTCTGGG R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCTCA cel-miR-39-5p F: TGGGAGCTGATTTCGTCTTG R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATTAC Smad2 F: TGTTAACCGAAATGCCACGGTA R: GGCTCTGCACAAAGATTGCACTA GAPDH F: GCACCGTCAAGGCTGAGAAC R: TGGTGAAGACGCCAGTGGA Table 2 Demographic and clinical characteristics of subjects Oral cGVHD (n=8) without cGVHD (n=8) Healthy control (n=8) Demographic information Age (years, Mean±SD) * 35.12±14.38 34.37±15.31 32.12±4.79 Gender(male/female) 6/2 6/2 6/2 Donor Donor relationship (Unrelated / Related) 1/6 3/5 / HLA match (Non-identical / Identical) 5/3 4/4 / Blood type (Non-identical / Identical) 5/3 4/4 / Cell source BMT/PBSCT/BMT+PBSCT/ BMT+Cord blood 0/5/3/0 0/4/3/1 / Clinical sign Severity score of oral manifestation 4.25±2.19 0 0 Oral pain VAS scores 4.5±2.39 0 0 note：BMT: Bone marrow, PB: Peripheral blood Table 3 The information of top 5 different expression miRNAs miR_name miR sequence Oral cGVHD (n=8) without cGVHD (n=8) Healthy control (n=8) P value (ANOVA) hsa-miR-505-5p GGGAGCCAGGAAGTATTGATGT 203 301 169 2.26E-05 hsa-miR-769-5p TGAGACCTCTGGGTTCTGAGCT 1,145 1,178 752 3.83E-04 hsa-miR-4732-3p GCCCTGACCTGTCCTGTTCTG 344 644 1,435 4.59E-04 hsa-miR-450a-5p TTTTGCGATGTGTTCCTAATAT 812 876 387 5.45E-04 hsa-miR-3200-5p AATCTGAGAAGGCGCACAAGGT 16 15 59 7.53E-04 Table 4 Demographic and clinical characteristics of subjects Oral cGVHD (n=15) without cGVHD (n=15) Demographic information Age (years, Mean±SD) * 33.33±16.70 33.40±12.61 Gender(male/female) 12/3 11/4 Donor Donor relationship (Unrelated / Related) 4/11 5/10 HLA match (Non-identical / Identical) 8/7 7/8 Blood type (Non-identical / Identical) 7/8 8/7 Cell source BMT/PBSCT/BMT+PBSCT/ BMT+Cord blood 0/5/10/0 0/8/7/0 Clinical sign Severity score of oral manifestation 4.27±2.22 0 Oral pain VAS scores 3.40±2.72 0 Note：BMT: Bone marrow, PB: Peripheral blood Table 5 The expression of circulating miRNA-769-5p in peripheral blood miRNA-769-5p Oral cGVHD (n=15) 0.07（0.03，0.18） without cGVHD (n=15) 0.66（0.12，4.99）* Note: * Oral cGVHD V.S without cGVHD p ＜0.05 tested by Mann-Whitney Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2530234","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":180215988,"identity":"ad770b79-4c7a-4c57-abb0-2c47331fe451","order_by":0,"name":"Xiangzhi Yong","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiangzhi","middleName":"","lastName":"Yong","suffix":""},{"id":180215989,"identity":"dbbc2473-e5f7-4689-be45-26be8808253d","order_by":1,"name":"YuXi Zhou","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"YuXi","middleName":"","lastName":"Zhou","suffix":""},{"id":180215990,"identity":"859687d0-e739-4f57-ba87-fa0279cb9317","order_by":2,"name":"Qiaozhi Jiang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qiaozhi","middleName":"","lastName":"Jiang","suffix":""},{"id":180215991,"identity":"46772afc-4d2a-45df-98e8-018e1ff5a937","order_by":3,"name":"Zhenmin Liu","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhenmin","middleName":"","lastName":"Liu","suffix":""},{"id":180215992,"identity":"6512568a-4649-43ed-b788-b64b6edda3e9","order_by":4,"name":"Tiantian Wu","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Wu","suffix":""},{"id":180215993,"identity":"c562aa0f-9fd2-45b4-a74f-47b77ca338e6","order_by":5,"name":"Zhongming Zhang","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhongming","middleName":"","lastName":"Zhang","suffix":""},{"id":180215994,"identity":"28723ba5-df70-41ac-ba03-c986ca0e8ec8","order_by":6,"name":"Rongquan He","email":"","orcid":"","institution":"First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Rongquan","middleName":"","lastName":"He","suffix":""},{"id":180215996,"identity":"6fd5afda-0d95-4352-a32c-41301f8d91af","order_by":7,"name":"Gang Chen","email":"","orcid":"","institution":"First Affiliated Hospital of Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Chen","suffix":""},{"id":180215998,"identity":"d83e4be9-c405-4ec5-9932-03c066fc3718","order_by":8,"name":"Renchuan Tao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYBCDBCBmfADlGOBVyoOkhRmmlHgtbBJEabFnP3zsw8cddnkGx88eq/zati2xgb15mwRDzR3ctvCkJc+ceSa52OBMXtptmTO3Ext4jpVJMBx7hsdhOcbMvG0HEjccyDG7LVEB1CKRYybB2HAYtxb+N8bMf0Fazr8xK5YwAGqRf0NAiwTQFkaQlhs5ZowfwLbwENBy41kyY29bcuLMG2+MpRnO3DZu40krtkg4hlsLe3/yYYafbXaJfedzDD/+bLst289+eOONDzW4taAAZlAssYFYCcRpAKaYH8SqHAWjYBSMghEFAI0BV28NEAD2AAAAAElFTkSuQmCC","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Renchuan","middleName":"","lastName":"Tao","suffix":""}],"badges":[],"createdAt":"2023-01-30 14:59:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2530234/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2530234/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":33905657,"identity":"cbe6726e-e596-4c30-a58d-c13945a95922","added_by":"auto","created_at":"2023-03-07 14:56:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1181679,"visible":true,"origin":"","legend":"\u003cp\u003emiRNAs differential expression\u003c/p\u003e\n\u003cp\u003eA: Venn diagrams of detected miRNAs among three groups.\u003c/p\u003e\n\u003cp\u003eB: Volcano plot of detected miRNAs among three groups.\u003c/p\u003e\n\u003cp\u003eC: The GO richment of miRNAs target genes\u003c/p\u003e\n\u003cp\u003eD: The KEGG richment of miRNAs target genes\u003c/p\u003e\n\u003cp\u003eNote: without cGVHD group (nOcG), Oral cGVHD group (OcG), healthy control (HC)\u003c/p\u003e","description":"","filename":"FIG1.png","url":"https://assets-eu.researchsquare.com/files/rs-2530234/v1/f0e36cc47ca182e4963a7bda.png"},{"id":33905675,"identity":"9a52045b-5acf-4742-9b17-bbd3e79fd290","added_by":"auto","created_at":"2023-03-07 14:56:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1435012,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent expressions of miRNA-769-5p and Smad2\u003c/p\u003e\n\u003cp\u003eA: ROC curve of circulating miRNA-769-5p in peripheral blood\u003c/p\u003e\n\u003cp\u003eB: The GO and KEGG richment on target genes of miRNA-769-5p\u003c/p\u003e\n\u003cp\u003eC: Dual-Luciferase detection of the interaction between hsa-miR-769-5p and Smad2\u003c/p\u003e\n\u003cp\u003eD: The relationship between miRNA-769-5p and Smad2 mRNA in PBMC\u003c/p\u003e\n\u003cp\u003eE: The expression of Smad2 mRNA and protein\u003c/p\u003e\n\u003cp\u003eNote: without cGVHD group (nOcG), Oral cGVHD group (OcG),\u003cem\u003ep\u003c/em\u003e＜0.05\u003c/p\u003e","description":"","filename":"FIG2.png","url":"https://assets-eu.researchsquare.com/files/rs-2530234/v1/746a4781285b581e25cf3889.png"},{"id":39453567,"identity":"6a19eb0a-badb-4c47-b2f4-8ae5f2b5967d","added_by":"auto","created_at":"2023-07-03 10:59:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1537791,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2530234/v1/fd218a46-30b6-4ab1-b66c-8326fa6e4d03.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"miRNA-769-5p and Smad2 Differential Expression in Patients with or without Oral cGVHD","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eChronic graft versus host disease (cGVHD) is the leading cause of death\u0026nbsp;after allogeneic hematopoietic stem cell transplantation (allo-HSCT)\u0026nbsp;[1].\u0026nbsp;As an alloimmune and autoimmune disease, it is characterized by lichenoid changes and fibrosis affecting a multitude of tissues and compromising organ function. Its clinical signs often first appear in the mucosa[2]. Oral cavity is a main organ involved in cGVHD, affecting 45-83% of cGVHD patients[3].\u0026nbsp;Covering\u0026nbsp;lichen planus-like changes, erythema, ulceration, mucoceles, etc., the clinical presentation of oral cGVHD is diverse and can influence any site in oral cavity such as oral mucosa, salivary gland and periodontium\u0026nbsp;[4, 5]. Lichen planus-like changes, characterized by hyperkeratotic white lines and lacy-appearing lesions on the oral mucosa, serve as the diagnostic feature of oral cGVHD among oral manifestations\u0026nbsp;[6]. In our previous study, the oral lichen planus-like changes will exist persistently even when the systemic disease severity was controlled\u0026nbsp;[7]. The consequences of oral CGVHD will affect patient\u0026rsquo;s life quality in any aspect, especially eating and nutrition absorption\u0026nbsp;[8]. Besides, oral cGVHD is a risk for the development of oral squamous cell carcinomas\u0026nbsp;[9, 10]. Given the deleterious impact on oral even system health caused by oral cGVHD, consciousness is needed in the occurrence and progress of oral cGVHD.\u003c/p\u003e\n\u003cp\u003eThe pathogenesis of cGVHD, especially oral cGVHD, is complex and remains controversial. Recent studies have revealed microRNAs (miRNAs) played a role in autoimmune diseases pathogenesis\u0026nbsp;[11]. Most studies have focused on the miRNAs in aGVHD[12].For example, Xie reported that the change of miRNA was related to aGVHD patients[13]\u0026nbsp;and Crossland further supported that miRNAs could be clinically relevant biomarkers for aGvHD[14]. Recently, Reikvam have firstly reported the miRNAs serum profiles in cGVHD\u0026nbsp;[15]. However, each organ and tissue affected by cGVHD has a variety of altered miRNAs due to their specific microenvironment\u0026nbsp;[16, 17]. Therefore, is there also miRNAs change in oral cGVHD patients, and how it will influence the diseases?\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe study aims to preliminarily analyze the possible regulatory role of miRNA in the occurrence and development of oral cGVHD, through detection and bioinformatics analysis of the differential expression of miRNAs in the peripheral blood of allo-HSCT patients with oral cGVHD and those without oral cGVHD.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Study approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEach participant signed an informed consent form in accordance with the declaration of Helsinki. The study was approved by Research Ethics Committee of Guangxi Medical University (IRB:20170301-4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Clinical examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Demographic data were obtained through a structured questionnaire. Clinical assessments and examination were recorded. Oral cGVHD was diagnosed and scored depending on diagnosis and scoring criteria[6]. Oral discomfort was recorded by visual analogous scale (VAS).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 RNA sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e16 patients\u0026nbsp;after\u0026nbsp;allo-HSCT including 8 patients with Oral cGVHD (Oral cGVHD group) and without any symptom of cGVHD (without cGVHD group) in other organ or tissue and 8 patients\u0026nbsp;without any symptom of cGVHD.\u0026nbsp;Besides, matching by age and gender, 8 healthy volunteers recruited as control. Peripheral venous blood was taken from 24 participants to construct the miRNAs library. Illumina Hiseq 2500 platform was used for sequencing and analyzing the differential expression of miRNAs (LC-BIO, Hangzhou, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 RT-qPCR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eParticipants in \u0026ldquo;Oral cGVHD\u0026rdquo; and \u0026ldquo;without cGVHD\u0026rdquo; groups were added to 15. Peripheral venous blood was taken to detect miRNA and PBMC was isolated to detect Smad mRNA. Total RNA was isolated from cells by TRIZOL (Invitrogen), and reversely transcribed into cDNA using TUREscript 1st Strand cDNA SYNTHESIS Kit. qRT-PCR was undertaken using a QTOWER2.2 system (ANALYTIKJENA). cel-miR-39-5p was used as the control for miRNA detection and GAPDH as the control for Smads mRNA. Primer sequences were listed in Tab1. Formulas were used to analyze the data: R=2 \u0026minus; (\u003csup\u003e\u0026Delta;\u003c/sup\u003eCt sample \u0026minus; \u003csup\u003e\u0026Delta;\u003c/sup\u003eCt control).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 ELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlasma from participants was collected and analyzed using human Smad2 immunoblot assay ELISA kit (CUSABIO). The spectrophotometry was measured at 450nm with Wellscan Mk3(ThermoScientific).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Luciferase reporter assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 3\u0026apos;-UTR of Smad2, with wild-type (WT) or mutated (MUT) binding sites for miRNA-769-5p, was amplified and cloned into the pGL3 vector to generate the plasmid pGL3-WT-Smad2-3\u0026apos;-UTR or pGL3- MUT- Smad2-3\u0026apos;-UTR, respectively. For the luciferase reporter assay, HEK-293 cells were cotransfected with the luciferase reporter vectors and miRNA-769-5p mimics, or the corresponding negative control using Lipofectamine LTX (Invitrogen, Carlsbad, CA). The pRL-TK plasmid (Promega, Madison, USA) was used as a normalization control. After 24 hours of incubation, a Luciferase Reporter Assay kit (Promega) was used to detect luciferase activity according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResults are expressed as the mean\u0026plusmn;standard deviation(X\u0026plusmn;SD). Bioinformatic analysis of miRNAs was conducted by Omicstudio. miRNAs different expression defined based on Benjamini-Hochberg adjusted P-value \u0026lt;5% and |log2 (fold-change FC)|\u0026nbsp;\u0026ge;\u0026nbsp;1. The difference of miRNAs expression between groups was analyzed by Mann-Whitney test. Receiver operating characteristic (ROC) curve analysis was used for diagnostic analysis The levels of Smad2 mRNA and protein were compared between the two groups was analyzed by t test. Spearman rank correlation analysis was used to analyze the correlation. \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant. Statistical software SPSS 22.0 was used for analysis.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 miRNAs differential expression\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe demographic and clinical characteristics of subjects showed in Tab 2. 518 miRNAs expressed in all three groups and 191 miRNAs\u0026nbsp;were significantly different expression.\u0026nbsp;Enrichment analysis of differential miRNAs expression levels was performed by GO functional annotation and KEGG Pathway functional annotation (Fig 1). The information of top 5 different expression miRNAs (see Tab 3), sorted by \u003cem\u003ep\u003c/em\u003e value of differences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Different expressions of miRNA-769-5p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further confirm the different expressions of miRNA-769-5p, participants in \u0026ldquo;Oral cGVHD\u0026rdquo; and \u0026ldquo;without cGVHD\u0026rdquo; groups were added to 15 (see Tab 4). The expression of miRNA-769-5p was higher in patients\u0026nbsp;without oral cGVHD than that in oral cGVHD patients (see Tab 5). Among patients\u0026nbsp;after\u0026nbsp;allo-HSCT, ROC analysis indicated miRNA-769-5p was of certain value in the diagnosis of oral cGVHD (p＜0.05). Areas under the curves of miRNA-769-5p was 0.809 the moderate diagnostic value (Fig 2A). The GO term an KEGG enrichment analysis was shown in Fig 2B.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Different expressions\u0026nbsp;of Smad2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter being predicted by TargetScan and miRanda, it was verified Smad2 was potential target genes of miRNA-769-5p by dual-luciferase test (Fig 2C). Among 30 participants, it is found miRNA-769-5p was negatively related to Smad2 mRNA ( r=-0.585，\u003cem\u003ep\u003c/em\u003e＜0.05) (Fig 2D).. Smad2 mRNA and protein levels were higher in the oral cGVHD group than those in patients without cGVHD (Fig 2E).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe study first determined the circulating miRNAs\u0026apos; expression profile for oral cGVHD. According to studies, circulating miRNAs are biological markers that can be used to predict, diagnose, and even predict the outcome of aGVHD\u0026nbsp;[18]. Independent miRNA markers also exist in the case of skin aGVHD due to tissue specificity.\u0026nbsp;[19]. However, there are few studies on miRNA as markers for the prediction, diagnosis and prognosis of cGVHD, particularly oral cGVHD. We paid attention to the oral cGVHD, and established a control group of patients without oral cGVHD who had received transplantation over a year ago based on our prior clinical observations and the fact that oral cGVHD almost always occurred within 300 days after transplantation.\u003c/p\u003e\n\u003cp\u003eWe have revealed that 518 miRNAs were found to be expressed in all three groups and 191 miRNAs showed significantly different expression. In bioinformatics analysis, it is found that membrane proteins in cellular components, protein binding in molecular functions, and transcription of biochemical processes are where these miRNAs are most concentrated. Furthermore, KEGG Pathway annotation showed that the PI3K-Akt signaling pathway and cancer signaling pathways were the main targets of differential miRNAs. Both cancer signaling and PI3K-Akt pathway are closely related to the occurrence and development of tumors. Studies have shown that patients after Allo-HSCT are 2-3 times more likely to develop solid tumors than healthy individuals\u0026nbsp;[20]. About one-third of solid tumors are secondary tumors in the skin and mucosa of recipients of transplants, with oral squamous cell carcinoma accounting for 50% of these patients.\u0026nbsp;[21, 22]. Therefore, among the miRNAs differentially expressed in patients with oral cGVHD, those related to cancer signaling pathways or PI3K-Akt signaling pathway and involved in carcinogenesis draw our attention.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStudies has been reported that miRNAs can assist in the diagnosis of many diseases[23]. It is found that miRNA-769-5p was of certain value in the diagnosis of oral cGVHD. Bioinformatics analysis of miRNA-769-5p showed that target genes of it were mainly concentrated in the TGF-\u0026beta; signaling pathway. TGF-\u0026beta; was found to influence the occurrence of oral cGVHD in our previous study [24], so we concentrated on the TGF-\u0026beta;/Smads signaling pathway as a result of the findings. TGF-\u0026beta;/Smads signaling pathway could promote the Th17 immunoreaction[25] and tissue fibrosis[26] after activation with phosphorylated T\u0026beta;R combined to Smad 2[27].Smads could be modulated by miRNAs [28, 29]. In the study, after being predicted by TargetScan and miRanda, we verified Smad 2 was target genes of miRNA-769-5p by dual-luciferase test. Negative relation between miRNA-769-5p and Smad2 mRNA was also observed. Both mRNA and protein levels were higher in the oral cGVHD group than those in patients without cGVHD. The high expression of Smad2 hinted the activation of TGF-\u0026beta;/Smads which leads to oral cGVHD. Studies have revealed that downmodulating Smad2 could ameliorate cGVHD severity [30] through reducing fibrosis [31] and generation of Th17[32]. Therefore, high expression of miRNA-769-5p silencing Smad2 would contribute to avoiding oral cGVHD.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, it is speculated that differential expression of miRNAs, especially miRNA-769-5p may be involved in oral cGVHD. High expression of Smad2 in peripheral blood may be associated with the oral cGVHD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e6.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported by National Natural Science Foundation of China (81771073, 82160180), Youth Science Foundation Project of Guangxi Natural Science Foundation (2020GXNSFBA297159) and Guangxi Medical High-level Talents Training Program.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7. Conflict of Interest Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no conflicts of interest\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8. Author Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiangzhi Yong: Methodology, experiments, statistical analysis, and original draft; YuXi Zhou: Methodology, experiments, and statistical analysis; Qiaozhi Jiang: Experiments; Zhenmin Liu: Experiments and statistical analysis; Tiantian Wu: Experiments; Zhongming Zhang: Supervision and Experiments; Rongquan He: Experiments and statistical analysis; Gang Chen: Supervision and review\u0026amp;editing; Renchuan Tao: Supervision, review\u0026amp;editing, study conception and coordination, and project administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e9. Ethics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe informed consent in accordance with the declaration of Helsinki was obtained from all subjects.The study was approved by Research Ethics Committee of Guangxi Medical University (IRB:20170301-4).All methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10. Consent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e11. Availability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e12. Acknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Ms. Xu Ying (Nanning, China) for the critical reading and language improvement of this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKroger N, Solano C, Wolschke C, Bandini G, Patriarca F, Pini M, Nagler A, Selleri C, Risitano A, Messina G\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAntilymphocyte Globulin for Prevention of Chronic Graft-versus-Host Disease\u003c/strong\u003e. \u003cem\u003eN Engl J Med \u003c/em\u003e2016, \u003cstrong\u003e374\u003c/strong\u003e(1):43-53.\u003c/li\u003e\n\u003cli\u003eMacDonald KP, Hill GR, Blazar BR: \u003cstrong\u003eChronic graft-versus-host disease: biological insights from preclinical and clinical studies\u003c/strong\u003e. \u003cem\u003eBlood \u003c/em\u003e2017, \u003cstrong\u003e129\u003c/strong\u003e(1):13-21.\u003c/li\u003e\n\u003cli\u003eFall-Dickson JM, Pavletic SZ, Mays JW, Schubert MM: \u003cstrong\u003eOral Complications of Chronic Graft-Versus-Host Disease\u003c/strong\u003e. \u003cem\u003eJ Natl Cancer Inst Monogr \u003c/em\u003e2019, \u003cstrong\u003e2019\u003c/strong\u003e(53).\u003c/li\u003e\n\u003cli\u003eBassim CW, Fassil H, Mays JW, Edwards D, Baird K, Steinberg SM, Cowen EW, Naik H, Datiles M, Stratton P\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eOral disease profiles in chronic graft versus host disease\u003c/strong\u003e. \u003cem\u003eJ Dent Res \u003c/em\u003e2015, \u003cstrong\u003e94\u003c/strong\u003e(4):547-554.\u003c/li\u003e\n\u003cli\u003eHaverman TM, Raber-Durlacher JE, Raghoebar, II, Rademacher WMH, Rozema FR, Hazenberg MD, Epstein JB, Treister NS: \u003cstrong\u003eOral chronic graft-versus-host disease: What the general dental practitioner needs to know\u003c/strong\u003e. \u003cem\u003eJ Am Dent Assoc \u003c/em\u003e2020, \u003cstrong\u003e151\u003c/strong\u003e(11):846-856.\u003c/li\u003e\n\u003cli\u003eJagasia MH, Greinix HT, Arora M, Williams KM, Wolff D, Cowen EW, Palmer J, Weisdorf D, Treister NS, Cheng GS\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNational Institutes of Health Consensus Development Project on Criteria for Clinical Trials in Chronic Graft-versus-Host Disease: I. The 2014 Diagnosis and Staging Working Group report\u003c/strong\u003e. \u003cem\u003eBiol Blood Marrow Transplant \u003c/em\u003e2015, \u003cstrong\u003e21\u003c/strong\u003e(3):389-401 e381.\u003c/li\u003e\n\u003cli\u003eXiao L, Peng Y, Tao R, Lai Y: \u003cstrong\u003eOral Mucosa Health Status among Patients after AIIogeneic Hematopoietic Stem Cell Transplantation in Guangxi District\u003c/strong\u003e. \u003cem\u003eJournal of Oral Science Research \u003c/em\u003e2011, \u003cstrong\u003e27\u003c/strong\u003e(10):881-885.\u003c/li\u003e\n\u003cli\u003eBassim CW, Fassil H, Dobbin M, Steinberg SM, Baird K, Cole K, Joe G, Comis LE, Mitchell SA, Grkovic L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eMalnutrition in patients with chronic GVHD\u003c/strong\u003e. \u003cem\u003eBone Marrow Transplant \u003c/em\u003e2014, \u003cstrong\u003e49\u003c/strong\u003e(10):1300-1306.\u003c/li\u003e\n\u003cli\u003eWu T, Liu Z, Yong X, Mei G, Jiang Q, Fang M, Li P, Zhang Z, Tao R: \u003cstrong\u003eP16-positive secondary tongue squamous cell carcinoma following allogeneic hematopoietic stem cell transplantation: A case report and literature review\u003c/strong\u003e. \u003cem\u003eOral Oncol \u003c/em\u003e2021:105399.\u003c/li\u003e\n\u003cli\u003eLiu Z, Peng Y, Yong X, Mei G, Yang Y, Yi C, Tao R: \u003cstrong\u003eA case report of secondary oral squamous cell carcinoma after allogeneic hematopoietic stem cell transplantation\u003c/strong\u003e. \u003cem\u003eOral Oncol \u003c/em\u003e2020, \u003cstrong\u003e109\u003c/strong\u003e:104629.\u003c/li\u003e\n\u003cli\u003eSalvi V, Gianello V, Tiberio L, Sozzani S, Bosisio D: \u003cstrong\u003eCytokine Targeting by miRNAs in Autoimmune Diseases\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2019, \u003cstrong\u003e10\u003c/strong\u003e:15.\u003c/li\u003e\n\u003cli\u003eNewmarch M, Kostantin E, Tsongalis GJ, Guimond M, Roy J, De Guire V, Ahmad I: \u003cstrong\u003eMicroRNAs in graft-versus-host disease: a review of the latest data\u003c/strong\u003e. \u003cem\u003eBone Marrow Transplantation \u003c/em\u003e2020, \u003cstrong\u003e55\u003c/strong\u003e(6):1014-1020.\u003c/li\u003e\n\u003cli\u003eXie LN, Zhou F, Liu XM, Fang Y, Yu Z, Song NX, Kong FS: \u003cstrong\u003eSerum microRNA155 is increased in patients with acute graft-versus-host disease\u003c/strong\u003e. \u003cem\u003eClin Transplant \u003c/em\u003e2014, \u003cstrong\u003e28\u003c/strong\u003e(3):314-323.\u003c/li\u003e\n\u003cli\u003eCrossland RE, Norden J, Ghimire S, Juric MK, Pearce KF, Lendrem C, Collin M, Mischak-Weissinger E, Holler E, Greinix HT\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eProfiling Tissue and Biofluid miR-155-5p, miR-155(*), and miR-146a-5p Expression in Graft vs. Host Disease\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e:639171.\u003c/li\u003e\n\u003cli\u003eReikvam H, Vo AK, Johansen S, Hemsing AL, Solheim MH, Mosevoll KA, Tvedt THA, Hatfield KJ: \u003cstrong\u003eMicroRNA serum profiles and chronic graft-versus-host disease\u003c/strong\u003e. \u003cem\u003eBlood Adv \u003c/em\u003e2022, \u003cstrong\u003e6\u003c/strong\u003e(18):5295-5306.\u003c/li\u003e\n\u003cli\u003eVajari MK, Moradinasab S, Yousefi AM, Bashash D: \u003cstrong\u003eNoncoding RNAs in diagnosis and prognosis of graft-versus-host disease (GVHD)\u003c/strong\u003e. \u003cem\u003eJ Cell Physiol \u003c/em\u003e2022, \u003cstrong\u003e237\u003c/strong\u003e(9):3480-3495.\u003c/li\u003e\n\u003cli\u003eLv Q, Tian Z, Dong E, Cao X: \u003cstrong\u003eTissue/organ-specialized immunologic features and disease mechanisms (in chinese)\u003c/strong\u003e. \u003cem\u003eChinese Science Bulletin \u003c/em\u003e2012, \u003cstrong\u003e36\u003c/strong\u003e:3450-3458.\u003c/li\u003e\n\u003cli\u003eRamzi M, Shokrgozar N: \u003cstrong\u003eMicroRNAs: Regulatory Biomarkers in Acute Myeloid Leukemia and Graft Versus Host Disease\u003c/strong\u003e. \u003cem\u003eClin Lab \u003c/em\u003e2022, \u003cstrong\u003e68\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eAtarod S, Norden J, Bibby LA, Janin A, Ratajczak P, Lendrem C, Pearce KF, Wang XN, O\u0026apos;Reilly S, Van Laar JM\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDifferential MicroRNA Expression Levels in Cutaneous Acute Graft-Versus-Host Disease\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2018, \u003cstrong\u003e9\u003c/strong\u003e:1485.\u003c/li\u003e\n\u003cli\u003eShimada K, Yokozawa T, Atsuta Y, Kohno A, Maruyama F, Yano K, Taji H, Kitaori K, Goto S, Iida H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSolid tumors after hematopoietic stem cell transplantation in Japan: incidence, risk factors and prognosis\u003c/strong\u003e. \u003cem\u003eBone Marrow Transplantation \u003c/em\u003e2005, \u003cstrong\u003e36\u003c/strong\u003e(2):115-121.\u003c/li\u003e\n\u003cli\u003eMawardi H, Elad S, Correa ME, Stevenson K, Woo SB, Almazrooa S, Haddad R, Antin JH, Soiffer R, Treister N: \u003cstrong\u003eOral epithelial dysplasia and squamous cell carcinoma following allogeneic hematopoietic stem cell transplantation: clinical presentation and treatment outcomes\u003c/strong\u003e. \u003cem\u003eBone Marrow Transplantation \u003c/em\u003e2011, \u003cstrong\u003e46\u003c/strong\u003e(6):884-891.\u003c/li\u003e\n\u003cli\u003eSantarone S, Natale A, Angelini S, Papalinetti G, Vaddinelli D, Di Bartolomeo A, Di Bartolomeo P: \u003cstrong\u003eSecondary oral cancer following hematopoietic cell transplantation\u003c/strong\u003e. \u003cem\u003eBone Marrow Transplantation \u003c/em\u003e2021, \u003cstrong\u003e56\u003c/strong\u003e(5):1038-1046.\u003c/li\u003e\n\u003cli\u003eGalindo Torres BP, Garcia Giron C, Alcaraz Ortega R, Saiz Lopez P, Adiego Leza MI, Grijalba Uche MV: \u003cstrong\u003eKnowledge and expectations about miRNAs as biomarkers in head and neck squamous cell cancers\u003c/strong\u003e. \u003cem\u003eAm J Otolaryngol \u003c/em\u003e2022, \u003cstrong\u003e44\u003c/strong\u003e(2):103771.\u003c/li\u003e\n\u003cli\u003eYong X, Peng Y, Liu Z, Li Q, Lai Y, Wu T, Tao R: \u003cstrong\u003eAnalysis of serum and salivary cytokines among patients with oral cGVHD after Allo-HSCT\u003c/strong\u003e. \u003cem\u003eOral Dis \u003c/em\u003e2021, \u003cstrong\u003e27\u003c/strong\u003e(5):1320-1324.\u003c/li\u003e\n\u003cli\u003eWang F, Yang Y, Li Z, Wang Y, Zhang Z, Zhang W, Mu Y, Yang J, Yu L, Wang M: \u003cstrong\u003eMannan-Binding Lectin Regulates the Th17/Treg Axis Through JAK/STAT and TGF-\u0026beta;/SMAD Signaling Against Infection\u003c/strong\u003e. \u003cem\u003eJ Inflamm Res \u003c/em\u003e2022, \u003cstrong\u003e15\u003c/strong\u003e:1797-1810.\u003c/li\u003e\n\u003cli\u003eChen C, Chen J, Wang Y, Fang L, Guo C, Sang T, Peng H, Zhao Q, Chen S, Lin X\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGanoderma lucidum polysaccharide inhibits HSC activation and liver fibrosis via targeting inflammation, apoptosis, cell cycle, and ECM-receptor interaction mediated by TGF-\u0026beta;/Smad signaling\u003c/strong\u003e. \u003cem\u003ePhytomedicine \u003c/em\u003e2022, \u003cstrong\u003e110\u003c/strong\u003e:154626.\u003c/li\u003e\n\u003cli\u003eWang H, Li M, Fei L, Xie C, Ding L, Zhu C, Zeng F, Liu N: \u003cstrong\u003eBone Marrow-Derived Mesenchymal Stem Cells Transplantation Attenuates Renal Fibrosis Following Acute Kidney Injury in Rats by Diminishing Pericyte-Myofibroblast Transition and Extracellular Matrix Augment\u003c/strong\u003e. \u003cem\u003eTransplant Proc \u003c/em\u003e2023.\u003c/li\u003e\n\u003cli\u003eLi S, Fan Q, He S, Tang T, Liao Y, Xie J: \u003cstrong\u003eMicroRNA-21 negatively regulates Treg cells through a TGF-beta1/Smad-independent pathway in patients with coronary heart disease\u003c/strong\u003e. \u003cem\u003eCell Physiol Biochem \u003c/em\u003e2015, \u003cstrong\u003e37\u003c/strong\u003e(3):866-878.\u003c/li\u003e\n\u003cli\u003eLiang J, Zhu W, Zhang Z, Zhu J, Fu Y, Lin Q, Kuang S, Zhang M, Shan Z: \u003cstrong\u003e[MicroRNA-199a-3p enhances expressions of fibrosis-associated genes through targeting Smad1 in mouse cardiac fibroblasts]\u003c/strong\u003e. \u003cem\u003eNan Fang Yi Ke Da Xue Xue Bao \u003c/em\u003e2018, \u003cstrong\u003e38\u003c/strong\u003e(10):1203-1208.\u003c/li\u003e\n\u003cli\u003eMarinelli Busilacchi E, Costantini A, Mancini G, Tossetta G, Olivieri J, Poloni A, Viola N, Butini L, Campanati A, Goteri G\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNilotinib Treatment of Patients Affected by Chronic Graft-versus-Host Disease Reduces Collagen Production and Skin Fibrosis by Downmodulating the TGF-beta and p-SMAD Pathway\u003c/strong\u003e. \u003cem\u003eBiol Blood Marrow Transplant \u003c/em\u003e2020, \u003cstrong\u003e26\u003c/strong\u003e(5):823-834.\u003c/li\u003e\n\u003cli\u003eChen H, Moreno-Moral A, Pesce F, Devapragash N, Mancini M, Heng EL, Rotival M, Srivastava PK, Harmston N, Shkura K\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eWWP2 regulates pathological cardiac fibrosis by modulating SMAD2 signaling\u003c/strong\u003e. \u003cem\u003eNat Commun \u003c/em\u003e2019, \u003cstrong\u003e10\u003c/strong\u003e(1):3616.\u003c/li\u003e\n\u003cli\u003eMartinez GJ, Zhang Z, Reynolds JM, Tanaka S, Chung Y, Liu T, Robertson E, Lin X, Feng XH, Dong C: \u003cstrong\u003eSmad2 positively regulates the generation of Th17 cells\u003c/strong\u003e. \u003cem\u003eJ Biol Chem \u003c/em\u003e2010, \u003cstrong\u003e285\u003c/strong\u003e(38):29039-29043.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 Primer information\u003c/p\u003e\n\u003ctable border=\"1\" width=\"538\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.00371747211896%\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"78.99628252788104%\"\u003e\n \u003cp\u003eSequence(5\u0026apos;to3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"21.00371747211896%\"\u003e\n \u003cp\u003ehas-miR-769-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"78.99628252788104%\"\u003e\n \u003cp\u003eF: TCGCGTGAGACCTCTGGG\u003c/p\u003e\n \u003cp\u003eR: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"21.00371747211896%\"\u003e\n \u003cp\u003ecel-miR-39-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"78.99628252788104%\"\u003e\n \u003cp\u003eF: TGGGAGCTGATTTCGTCTTG\u003c/p\u003e\n \u003cp\u003eR: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"21.00371747211896%\"\u003e\n \u003cp\u003eSmad2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"78.99628252788104%\"\u003e\n \u003cp\u003eF: TGTTAACCGAAATGCCACGGTA\u003c/p\u003e\n \u003cp\u003eR: GGCTCTGCACAAAGATTGCACTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"21.00371747211896%\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"78.99628252788104%\"\u003e\n \u003cp\u003eF: GCACCGTCAAGGCTGAGAAC\u003c/p\u003e\n \u003cp\u003eR: TGGTGAAGACGCCAGTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2 Demographic and clinical characteristics of subjects\u003c/p\u003e\n\u003ctable border=\"1\" width=\"652\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"42.87901990811638%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003eOral cGVHD\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003ewithout cGVHD\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003eHealthy control\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eDemographic information\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.223583460949463%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eAge (years, Mean\u0026plusmn;SD)\u0026nbsp;*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e35.12\u0026plusmn;14.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e34.37\u0026plusmn;15.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.223583460949463%\"\u003e\n \u003cp\u003e32.12\u0026plusmn;4.79\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eGender(male/female)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e6/2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e6/2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.223583460949463%\"\u003e\n \u003cp\u003e6/2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eDonor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.223583460949463%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eDonor\u0026nbsp;relationship (Unrelated / Related)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e1/6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e3/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eHLA match (Non-identical / Identical)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e5/3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e4/4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eBlood type (Non-identical / Identical)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e5/3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e4/4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eCell source\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eBMT/PBSCT/BMT+PBSCT/\u0026nbsp;BMT+Cord blood\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e0/5/3/0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e0/4/3/1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003eClinical sign\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Severity score of oral manifestation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e4.25\u0026plusmn;2.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"42.87901990811638%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;Oral pain VAS scores\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.98928024502297%\"\u003e\n \u003cp\u003e4.5\u0026plusmn;2.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.90811638591118%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.223583460949463%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003enote：BMT: Bone marrow, PB: Peripheral blood\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3 The information of top 5 different expression miRNAs\u003c/p\u003e\n\u003ctable border=\"1\" width=\"763\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003emiR_name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003emiR sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003eOral cGVHD\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003ewithout cGVHD\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003eHealthy control\u003c/p\u003e\n \u003cp\u003e(n=8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.678899082568808%\"\u003e\n \u003cp\u003e\u003cem\u003eP\u0026nbsp;\u003c/em\u003evalue (ANOVA)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003ehsa-miR-505-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003eGGGAGCCAGGAAGTATTGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003e203\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003e301\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003e169\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.678899082568808%\"\u003e\n \u003cp\u003e2.26E-05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003ehsa-miR-769-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003eTGAGACCTCTGGGTTCTGAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003e1,145\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003e1,178\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003e752\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.678899082568808%\"\u003e\n \u003cp\u003e3.83E-04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003ehsa-miR-4732-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003eGCCCTGACCTGTCCTGTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003e344\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003e644\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003e1,435\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.678899082568808%\"\u003e\n \u003cp\u003e4.59E-04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003ehsa-miR-450a-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003eTTTTGCGATGTGTTCCTAATAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003e812\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003e876\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003e387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.678899082568808%\"\u003e\n \u003cp\u003e5.45E-04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.06684141546527%\"\u003e\n \u003cp\u003ehsa-miR-3200-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.013106159895152%\"\u003e\n \u003cp\u003eAATCTGAGAAGGCGCACAAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.747051114023591%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.66448230668414%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.82961992136304%\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.678899082568808%\"\u003e\n \u003cp\u003e7.53E-04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 4 Demographic and clinical characteristics of subjects\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003eOral cGVHD\u003c/p\u003e\n \u003cp\u003e(n=15)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003ewithout cGVHD\u003c/p\u003e\n \u003cp\u003e(n=15)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eDemographic information\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eAge (years, Mean\u0026plusmn;SD)\u0026nbsp;*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e33.33\u0026plusmn;16.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e33.40\u0026plusmn;12.61\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eGender(male/female)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e12/3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e11/4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eDonor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eDonor relationship (Unrelated / Related)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e4/11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e5/10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eHLA match (Non-identical / Identical)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e8/7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e7/8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eBlood type (Non-identical / Identical)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e7/8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e8/7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eCell source\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eBMT/PBSCT/BMT+PBSCT/\u0026nbsp;BMT+Cord blood\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e0/5/10/0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e0/8/7/0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eClinical sign\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eSeverity score of oral manifestation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e4.27\u0026plusmn;2.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"48.23943661971831%\"\u003e\n \u003cp\u003eOral pain VAS scores\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.823943661971832%\"\u003e\n \u003cp\u003e3.40\u0026plusmn;2.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"26.93661971830986%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote：BMT: Bone marrow, PB: Peripheral blood\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 5 The expression of circulating miRNA-769-5p in peripheral blood\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"559\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"40.714285714285715%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"59.285714285714285%\"\u003e\n \u003cp\u003emiRNA-769-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"40.714285714285715%\"\u003e\n \u003cp\u003eOral cGVHD\u0026nbsp;(n=15)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"59.285714285714285%\"\u003e\n \u003cp\u003e0.07（0.03，0.18）\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"40.714285714285715%\"\u003e\n \u003cp\u003ewithout cGVHD\u0026nbsp;(n=15)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"59.285714285714285%\"\u003e\n \u003cp\u003e0.66（0.12，4.99）*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote:\u0026nbsp;*\u0026nbsp;Oral cGVHD\u003cem\u003e\u0026nbsp;\u003c/em\u003eV.S\u003cem\u003e\u0026nbsp;\u003c/em\u003ewithout cGVHD\u003cem\u003e\u0026nbsp; p\u003c/em\u003e＜0.05\u0026nbsp;tested by Mann-Whitney\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"allogeneic hematopoietic stem cell transplantation, chronic graft-versus-host-disease, oral mucosa, miRNAs","lastPublishedDoi":"10.21203/rs.3.rs-2530234/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2530234/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Oral chronic graft versus host disease (Oral cGVHD) affects the life quality of patient. But its pathogenesis is still unclear. MicroRNA (miRNA) involves in numerous pathologic and physiologic processes.\u003c/p\u003e\n\u003cp\u003eObjective: To preliminarily observe the change of miRNAs in oral cGVHD.\u003c/p\u003e\n\u003cp\u003eMethods: Peripheral venous blood was taken from 8 cases of oral cGVHD, 8 cases without oral cGVHD, and 8 cases of healthy control group to construct the miRNAs library by Illumina Hiseq 2500 platform. The expression of miRNA-769-5p was detected by qRT-PCR in each group with subjects adding to 15. The interactions between miRNA-769-5p and Smad2 mRNA was verified by dual-luciferase assay. qRT-PCR and ELISA was used to detect the mRNA and protein level of Smad2 in peripheral blood respectively.\u003c/p\u003e\n\u003cp\u003eResults: All three groups expressed 518 miRNAs and 191 miRNAs showed significantly different expression. The expression of miRNA-769-5p was the higher in non-oral cGVHD patients than that in oral cGVHD patients, and were of certain value in the diagnosis of oral cGVHD. The levels of Smad2 mRNA and protein were higher in the oral cGVHD group than those without oral cGVHD. As a target of miRNA-769-5p, Smad2 mRNA was negatively related to it.\u003c/p\u003e\n\u003cp\u003eConclusion: Differential expression of miRNAs, especially miRNA-769-5p may be involved in oral cGVHD. High expression of circulating Smad2 may be associated with the oral cGVHD, which might be regulated by miRNA-769-5p.\u003c/p\u003e","manuscriptTitle":"miRNA-769-5p and Smad2 Differential Expression in Patients with or without Oral cGVHD","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-03-07 14:56:16","doi":"10.21203/rs.3.rs-2530234/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d312489a-eb56-48b7-9ef3-bab779c6062e","owner":[],"postedDate":"March 7th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-07-03T10:59:26+00:00","versionOfRecord":[],"versionCreatedAt":"2023-03-07 14:56:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2530234","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2530234","identity":"rs-2530234","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}