Development of a SYBR Green-based real-time RT-PCR method using a newly designed tomato mottle mosaic virus-specific primer set and the assessment of its seed transmission properties in tomato seeds.

Development of a SYBR Green-based real-time RT-PCR method using a newly designed tomato mottle mosaic virus-specific primer set and the assessment of its seed transmission properties in tomato seeds. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of a SYBR Green-based real-time RT-PCR method using a newly designed tomato mottle mosaic virus-specific primer set and the assessment of its seed transmission properties in tomato seeds. Yuya Imamura, Fumino Nito, Yuji Fujiwara, Takayuki Matsuura, Hironobu Yanagisawa This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6806693/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Nov, 2025 Read the published version in Journal of General Plant Pathology → Version 1 posted 4 You are reading this latest preprint version Abstract Tomato mottle mosaic virus (ToMMV), first reported in Mexico in 2009, is an emerging virus that globally threatens the yield of crops belonging to the family Solanaceae. The international trade of ToMMV-contaminated seeds is potentially associated with its global spread; however, the epidemiological features of virus-contaminated seeds remain unclear, and the availability of effective seed assays to detect ToMMV is limited. Therefore, we have developed a SYBR Green-based real-time RT-PCR (SYBR-RT-qPCR) for ToMMV detection, which supports the detection of ToMMV with 10–100 times improved sensitivity compared to available methods; up to 1.54 copies were detected while the common Solanaceae-infecting tobamoviruses were not amplified. Additionally, virus-contaminated seeds were obtained from two cultivars of ToMMV-infected tomato plants. A direct immunostaining assay revealed the presence of ToMMV in the seed coat and hair of both cultivars. Although ToMMV was detected in all tested seeds, seed-to-seedling ToMMV transmission rates were only 0.42% and 0.93% in tomato cvs. Carol Passion and Rejina, respectively. Using these seed lots harboring seed-to-seedling-transmissible ToMMV, we confirmed the efficacy of this SYBR-RT-qPCR method for detecting ToMMV in a bulk sample (n = 400, including one ToMMV-contaminated seed). Therefore, our detection method is effective in actual seed inspection. This is the first report of a practical ToMMV-specific seed inspection assay based on SYBR-RT-qPCR; moreover, crucial properties related to the seed transmission of ToMMV have been revealed. The insights and testing methods reported in this study could help prevent the spread of ToMMV through virus-contaminated seeds. ToMMV Tobamovirus Seed transmission SYBR Green RT-qPCR Tomato Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Tobamoviruses, belonging to the genus Tobamovirus and family Virgaviridae , pose a major threat, especially in Solanaceae and Cucurbitaceae crops (Dombrovsky and Smith 2017 ). Among the 37 viruses belonging to the genus, paprika mild mottle virus ( Tobamovirus paprikae ; PaMMV), pepper mild mottle virus ( Tobamovirus capsici ; PMMoV), rehmannia mosaic virus ( Tobamovirus rehmanniae ; ReMV), tobacco mild green mosaic virus ( Tobamovirus mititessellati ; TMGMV), tobacco mosaic virus ( Tobamovirus tabaci ; TMV), tomato brown rugose fruit virus ( Tobamovirus fructirugosum ; ToBRFV), tomato mosaic virus ( Tobamovirus tomatotessellati ; ToMV), and tomato mottle mosaic virus ( Tobamovirus maculatessellati ; ToMMV) are the most widespread ones infecting Solanaceae crops; they naturally infect tomato ( Solanum lycopersicum ) and/or pepper ( Capsicum annuum ) (CABI 2020 , 2021a , 2021b , 2021c , 2021d , 2021e ; Hamada et al. 2003 ; Kubota et al. 2012 ). ToMMV was first reported in Mexico in 2009 (CABI 2021d ; Li et al. 2013 ); it is an emerging tobamovirus harboring a positive-sense, single-stranded RNA (approximately 6,400 nucleotides) and rod-shaped particles of approximately 18 nm in diameter and 300 nm in length (CABI 2021d ; Ishibashi et al. 2023 ; Kon et al. 2024 ; Li et al. 2013 ; Tu et al. 2021 ). ToMMV can infect various tomato and pepper cultivars exhibiting various levels of tobamovirus resistance, which may lead to severe damage, including inhibited growth, leaf narrowing, leaf mosaicism, and necrosis symptoms, resulting in a significant decline in tomato fruit yield and quality (Ambrós et al. 2017 ; Kon et al. 2024 ; Li et al. 2013 , 2014 ; Mazumder et al. 2024 ; Nagai et al. 2019 ; Tu et al. 2021 ). Additionally, the experimental host range includes Amaranthaceae, Asteraceae, Brassicaceae, Verbenaceae, and other Solanaceae plants (Ambrós et al. 2017 ; Chanda et al. 2021 ; Li et al. 2017 ; Sui et al. 2017 ). ToMMV outbreaks have been reported in various countries (CABI 2021d ; Ishibashi et al. 2023 ; Li et al. 2013 ). Although some tobamoviruses have been reported to transmit through seeds, ToMMV has recently been reported to be seed-transmissible (Dombrovsky and Smith 2017 ; Ishibashi et al. 2023 ; Mazumder et al. 2024 ; Sastry 2013 ). ToMMV has also been detected in commercial tomato and pepper seeds during quarantine inspections (Dall et al. 2023 ; Fowkes et al. 2022 ; Kon et al. 2024 ; Lovelock et al. 2020 ). Therefore, considering ToMMV-contaminated seeds a major source of this global distribution, ToMMV is listed as one of the most significant quarantine pests in Japan. Host plants and seeds are regulated by the Japanese Plant Protection Act. Various studies have reported the biological and molecular features of ToMMV. However, seed transmission mechanism of ToMMV was never focused on, except for a recent report about the seed-transmission rate of this virus in tomato; however, a comprehensive knowledge of the epidemiological aspects of ToMMV in seeds is necessary to assess the risk of viral spread through ToMMV-contaminated seeds (Mazumder et al. 2024 ). The lack of this information has become an obstacle when considering ToMMV management methods. In some assessments, plant protection organizations have characterized ToMMV based on the properties of other tobamoviruses to address the lack of information (EPPO 2022 ; Yokohama Plant Protection Station 2021 ). Therefore, it is necessary to investigate whether ToMMV has properties similar to those of the other tobamoviruses. A suitable detection method for ToMMV in traded seeds can be a key to preventing viral spread. Conventional RT-PCR and real-time RT-PCR methods for ToMMV detection have been developed (Fowkes et al. 2022 ; Schoen et al. 2023 ; Sui et al. 2017 ). Generally, real-time RT-PCR exhibits lower contamination risks and less time consumption than conventional RT-PCR because real-time RT-PCR does not involve post-amplification handling (Kumar and Gupta 2020 ). Real-time RT-PCR has been used for ToMMV detection in some institutions (Fowkes et al. 2022 ; Schoen et al. 2023 ). Although real-time RT-PCR for plant pathogen detection has been performed with SYBR Green dye (SYBR-RT-qPCR) or TaqMan probe (TaqMan-RT-qPCR) as a fluorescent assay, these real-time RT-PCR methods for ToMMV were developed using TaqMan-RT-qPCR (Kumar and Gupta 2020 ). Comparison of these two detection assays revealed that SYBR-RT-qPCR is more economical than TaqMan-RT-qPCR because a target-specific fluorogenic probe is not used (Watzinger et al. 2006 ). Furthermore, melting curve analysis using SYBR-RT-qPCR can efficiently distinguish target-derived amplification from non-specific reactions. The melting temperature (Tm) profile significantly contributes to the determination of a positive result, especially when ambiguous amplification is observed at later PCR cycles. A recently reported SYBR-RT-qPCR method for ToBRFV detection reflected these advantages (Ota et al. 2025 ). Therefore, the development of a SYBR-RT-qPCR method can effectively support the inspection of Solanaceae seeds using ToMMV. Therefore, we investigated some epidemiological properties, such as seed transmission rate, seed contamination rate, and location of the viral infection in seeds, using contaminated seeds collected from ToMMV-infected tomatoes. Next, we designed a new primer set for SYBR-RT-qPCR to detect a wide range of ToMMV isolates from each country without non-specific amplification of the other Solanaceae-infecting tobamoviruses. We comparatively evaluated the sensitivity of our method along with previously reported methods. Finally, we attempted to detect ToMMV that presents in a bulk seed sample including one ToMMV-contaminated tomato seed using our SYBR-RT-qPCR method. To the best of our knowledge, this is the first report on the epidemiological features related to ToMMV seed transmission and a practical SYBR-RT-qPCR method for ToMMV, which will contribute to the management of the virus. Material and methods Preparation of virus-infected plants The ToMMV DSMZ PV-1267 isolate (GenBank/EMBL/DDBJ accession no. MW582804.1) used in this study was purchased from DSMZ (German Collection of Microorganisms and Cell Cultures GmbH). Dr. Aviv Dombrovsky kindly provided the ToBRFV Israeli isolate-infected tissue; its complete nucleotide sequence matched the DSMZ PV-1241 isolate’s sequence (accession no. MZ202349) (Luria et al. 2017 ; Matsushita et al. 2024 ; Ota et al 2025 ). PaMMV-J (MAFF no. 260251), PMMoV-Noei 1 (MAFF no. 104032), ReMV-J (MAFF no. 260249), TMGMV-Chiba 1 (MAFF no. 104036), TMV-OM (MAFF no. 260064), and ToMV-CH3 (MAFF no. 260008)-infected tissues were obtained from the Research Center of Genetic Resources, the National Agricultural and Food Research Organization ( https://www.gene.affrc.go.jp/index_en.php ). ToMMV-infected tissues were homogenized in 10 volumes (w/v) of 0.1 M phosphate buffer (pH 7.0) to prepare the inoculum. We transversely cut the stems of tomato plants (cv. Rejina: Sakata Seed, Kanagawa, Japan) at 5 − 6-leaf stage 20 times to a depth of approximately 0.5 mm using a disposable scalpel dipped in the ToMMV inoculum. The inoculated plants were grown in an insect-proof glasshouse at 23 − 27 ℃ with natural light. One month after inoculation, symptomatic leaf samples were collected from the inoculated plants, and viral infection was confirmed by conventional RT-PCR with the specific primer set ToMMV-F/ToMMV-R (Sui et al. 2017 ) before further analyses. Additionally, TMV-, ToBRFV-, and ToMV-infected tomato plants (cv. Rejina) and PaMMV-, PMMoV-, ReMV-, and TMGMV-infected pepper plants (cv. Fushimi-amanaga: Takii Seeds; Kyoto, Japan) were prepared as described above. Viral-infection was confirmed through conventional RT-PCR with specific primer sets P1F/P1R for PaMMV (Hamada et al. 2003 ), PMMoVdF/PMMoVdR for PMMoV (Zhou et al. 2021 ), ReMV-5608fw/ReMV-6220rv for ReMV (Kubota et al. 2012 ), TGF/TGR for TMGMV (Takeuchi et al. 2005 ), TMV-F/TMV-R for TMV (Sui et al. 2017 ), ToBRFV-F/ToBRFV-R for ToBRFV (Alkowni et al. 2019 ), and ToMV-F/ToMV-R for ToMV (Sui et al. 2017 ). Total RNA extraction Total RNA extraction Approximately 100 mg of the leaf or seed sample was ground in a 2 ml tube with a stainless-steel bead (6 mm in diameter) using a multi-bead shocker (Yasuikikai, Osaka, Japan) at 1,000 rpm for 1 min. Total RNA was extracted from the tissue homogenate following a method described by Dellaporta et al. ( 1983 ); 3.3% w/v polyvinylpyrrolidone (molecular weight 40,000) was added to the extraction buffer. The concentration of extracted RNA was measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Design of specific primers To design the ToMMV-specific primer for SYBR-RT-qPCR analysis, 29 ToMMV sequences longer than 5,000 nucleotides, corresponding to the complete or nearly complete genomes currently available in databases, were obtained from the GenBank database in 2024 (accessed: 25/12/2024). Furthermore, we acquired 14 sequences of Solanaceae-infecting tobamoviruses (Fig. 1 ). The obtained sequences were aligned to identify ToMMV-specific regions using the CLUSTAL W 2.1 program (Larkin et al. 2007 ). As a result, we designed ToMMV 3027-F (5’-TGTGATGTGCACTTCTGCAGAA-3’; nucleotide positions 3,027 to 3,048 with reference to ToMMV isolate MK5, KF477193.1) and ToMMV 3087-R (5’-GTGGTTTGGATACTGGATTGATTGTG-3’; nucleotide positions 3,087 to 3,112). Conventional RT-PCR and real-time RT-PCR Conventional and real-time RT-PCR analyses were performed as described below. [Conventional RT-PCR] Conventional RT-PCR was performed on a SimpliAmp thermal cycler (Thermo Fisher Scientific Inc.) using the QIAGEN OneStep RT-PCR Kit (QIAGEN, Hilden, Germany). The 20 µl reaction mixture contained 4 µl of 5 × QIAGEN OneStep RT-PCR Buffer, 0.8 µl of dNTP Mix (10 mM each), 0.8 µl of QIAGEN OneStep RT-PCR Enzyme Mix, and primers (0.8 µM each for forward and reverse), 2 µl of the extract. Thermal cycling conditions included the following steps: 50 ℃ for 30 min, 95 ℃ for 15 min, and 40 cycles of 94 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 1 min, followed by 72 ℃ for 10 min. The amplicons were electrophoresed using a 2% (w/v) agarose gel stained with GelRed (Biotium, Hayward, CA, USA). [Real-time RT-PCR] SYBR-RT-qPCR analysis was performed using the Power SYBR™ Green RNA-to-C T ™ 1-Step Kit (Thermo Fisher Scientific) on QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific). The 20 µl reaction mixture contained 10 µl of 2 × Power SYBR™ Green RT-PCR Mix, 0.16 µl of 125 × RT Enzyme Mix, and primers (200 nM each of forward and reverse), and 2 µl of the extract. Thermal cycling conditions included the following steps: 48 ℃ for 30 min, 95 ℃ for 10 min, and 40 cycles of 95 ℃ for 15 s and 60 ℃ for 1 min, followed by a melting temperature ramp from 60 ℃ to 95℃ at 0.02 ℃/s. To confirm that target-specific amplification occurred without non-specific amplification, if necessary, the amplicons were electrophoretically analyzed using a 5% (w/v) agarose gel stained with GelRed. TaqMan™ RNA-to-C T ™ 1-Step Kit (Thermo Fisher Scientific) was used for Taqman-RT-qPCR with QuantStudio 3 Real-Time PCR system. The 20 µl reaction mixture contained 10 µl of 2 × TaqMan™ RTPCR Mix, 0.5 µl of 40 × TaqMan™ RT Enzyme Mix, 100 nM of probe, primers (300 nM each of forward and reverse), and 2 µl of the extract. The following thermal cycling conditions were maintained: 48 ℃ for 15 min, 95 ℃ for 10 min, 40 cycles of 95 ℃ for 15 s, and 60 ℃ for 1 min. Detection specificity To test the specificity of ToMMV 3027-F/ToMMV 3087-R, SYBR-RT-qPCR was performed using ToMMV and other Solanaceae-infecting tobamoviruses. Total RNA extracted from viral-infected leaves (refer to the section “Preparation of virusinfected plants’’), diluted to 50 ng/µl using RNase-free sterile water, was used as a template. Estimation of ToMMV copy numbers To estimate the ToMMV copy number in each sample, an RNA standard control of ToMMV used for TaqMan-RT-qPCR was constructed. Initially, PCR using KOD FX (TOYOBO, Osaka, Japan) and primer pair of ToMMV-Standard-F + T7 (5’- TAATACGACTCACTATAGGGAGA GTGGAATCTTCCAGACAATTG-3’; nucleotide positions 5,140 to 5,160 with the reference to ToMMV isolate MK5, KF477193.1; the T7 RNA polymerase binding site is underlined) and ToMMV-Standard-R (5’-TTCTTGCAGCTCCAGTATAAT-3’; nucleotide positions 5,232 to 5,253) were conducted with artificial synthesized DNA (nucleotide positions 5,140 to 5,253) serving as template. The 40 µl reaction mixture contained 20 µl of 2 ×PCR Buffer for KOD FX, 8.0 µl of 2 mM dNTPs, primers (300 nM each for forward and reverse), 0.8 µl of KOD FX (1.0 U/µl), and 100 pg of template. Thermal cycling conditions were as follows: 94 ℃ for 2 min; 40 cycles of 98℃ for 10 s, 60℃ for 30 s, and 68℃ for 30 s; 68℃ for 10 min. The amplicon was purified using the QIAquick PCR Purification Kit (QIAGEN). The RNA standard was transcribed from the purified amplicon, and the number of ToMMV genome copies was calculated as reported by Yanagisawa and Matsushita ( 2022 ). To plot standard curves based on the cycle threshold value, a 10-fold standard dilution series of transcribed RNA (10 3 –10 8 copies) was analyzed using TaqMan-RT-qPCR with the primer probe set ToMMV 5228-F/ ToMMV 5249-Pe/ToMMV 5278-R (Fowkes et al. 2022 ). Detection sensitivity Furthermore, we tested the sensitivity of ToMMV 3027-F/ToMMV 3087-R. For this purpose, the copy number of ToMMV was estimated in total RNA extracted from ToMMV-infected tomato leaves, which was diluted to 50 ng/µl with RNase-free sterile water, using real-time RT-PCR and standard curves described in section “Estimation of ToMMV copy numbers”. Similarly, total RNA extracted from healthy tomato seeds and leaves was diluted to 50 ng/µl. Next, we made two types of a ten-fold dilution series corresponding to seed and leaf samples by further diluting the diluted RNA acquired from ToMMV-infected leaves with that acquired from healthy seeds or leaves. Two microliters (approximately 1.54×10 8 to 10 − 1 copies per reaction) of each solution was used as a template for SYBR-RT-qPCR analysis conducted using ToMMV 3027-F/ToMMV 3087-R. Additionally, we compared our method with previously published methods, including a conventional RT-PCR method (ToMMV-F/ToMMV-R) and two Taqman-RT-qPCR assays (ToMMV 5228-F/ToMMV 5249-Pe/ToMMV5278-R; Fowkes et al. 2022 , and ToMMV2-F/ToMMV2-P/ToMMV2-R; Schoen et al. 2023 ) using the same templates. Preparation of ToMMV-contaminated tomato seeds The ToMMV-infected plants (cvs. Rejina and Carol Passion, Sakata seed) were prepared as described in Section “Preparation of virusinfected plants’’ and mature tomato fruits were harvested 3–8 months after inoculation. The collected seeds were submerged in 0.025% cellulase solution at room temperature (20 − 25 ℃) for approximately 6 h to dissolve excess pulp and were washed in a sieve with sterile distilled water for 2 min. The washed seeds were dried at room temperature (20 − 25 ℃) for one week and stored in a desiccator until use. Seeds collected from the different fruits were mixed to constitute one lot per cultivar. Healthy seeds were collected from the uninoculated tomato plants and treated similarly. Evaluation of ToMMV contamination level in tomato seeds To evaluate the rate of seed contamination by ToMMV, 10 tomato seeds from each cultivar were individually used to detect ToMMV through conventional RT-PCR. We confirmed ToMMV localization in tomato seeds via direct immunostaining assay (DISA). As ToMMV-specific antibodies were not available, ELISA reagents for TMV (Agdia, Elkhart, IN, USA) that react with ToMMV were used for immunostaining to detect ToMMV in the seeds. The ToMMV-contaminated seeds were cut transversely using a razor. A piece of half seed was fixed by treating it with 4% w/v paraformaldehyde in PBS (pH 7.4) overnight at 4 ℃. After washing three times with PBS, the seeds were soaked in a blocking solution (1% w/v bovine serum albumin in PBS) at room temperature (20 − 25 ℃) for 2 h. The treated seeds were incubated with rabbit anti-TMV conjugate (Agdia) diluted 200 × with blocking solution at room temperature (20 − 25 ℃) for 2 h. After washing three times with PBS, immunoreactive signals were visualized using BCIP-NBT (Sigma-Aldrich Co., St. Louis, MO, USA) according to the manufacturer’s instructions. Confirmation of seed transmission To evaluate the seed transmission rate of ToMMV in tomato, 294 seeds of each cultivar were individually sown in 49-cell plug trays and grown for a week in an insect-proof glasshouse at 23 − 27 ℃ with natural light. Subsequently, all emerged seedlings (at the 1–2-leaf stage) were transplanted into 9 cm diameter pots. Four weeks after transplanting (at the 5–8-leaf stage), the uppermost leaves from each plant were used to confirm the presence of ToMMV through conventional RT-PCR analysis. Next, all viral-positive plants were transplanted into pots (diameter: 17 cm) to observe the development of viral symptoms in the growth process and further tested for infectivity via back inoculation using symptomatic leaves (refer to the section “Preparation of virusinfected plants”). Detection of ToMMV from a bulk sample of tomato seeds To confirm the effectiveness of the newly developed detection method, we performed ToMMV detection in a bulk sample of tomato seeds. Considering that a maximum sample size of 400 tomato seeds was used for the ToMMV test in the Japanese and Australian plant quarantines (Dall et al. 2023 ; Lovelock et al. 2020 ; Yokohama Plant Protection Station 2021 ), we attempted detecting a ToMMV-contaminated tomato seed in a 400-seed sample that included 399 healthy seeds, and hence, extracted total RNA from 400 seeds using the method described by Yanagisawa et al. ( 2012 ). Each RNA sample was further used as a template for SYBR-RT-qPCR analysis with ToMMV 3027-F/ToMMV 3087-R, TaqMan-RT-qPCR with ToMMV 5228-F/ToMMV 5249-Pe/ToMMV5278-R or ToMMV2-F/ToMMV2-P/ToMMV2-R, and conventional RT-PCR with ToMMV-F/ToMMV-R. Results Detection specificity A new primer set (ToMMV 3027-F/ToMMV 3087-R) was designed for the specific detection of ToMMV using SYBR-RT-qPCR. The primer set almost completely matched the genome sequences of 27 ToMMV isolates, except for one base in two ToMMV isolates; less than 80% match with the genome sequences of other Solanaceae-infecting tobamoviruses was detected (Fig. 1 ). The specificity of this primer set was tested using RNAs extracted from ToMMV-infected and closely related tobamovirus-infected leaves. Only ToMMV-infected samples revealed positive signals (Fig. 2 a). The melting curve also displayed a single peak (Tm value: approximately 76.8 ℃, Fig. 2 b). Agarose gel analysis indicated an approximately 86 bp single band (Fig. 2 c). Additionally, Sanger sequencing of this amplicon revealed a 100% similarity to ToMMV DSMZ PV-1267 isolate (accession no. MW582804.1). Contrastingly, Solanaceae-infecting tobamovirus samples and the non-template control (template solution replaced with distilled water) showed no reaction. Estimation of ToMMV copy numbers When carrying out Taqman-RT-qPCR with a ten-fold standard dilution series of transcribed RNA, a linear relationship between the Ct values and the log-transcribed RNA standard was obtained based on regression coefficients (R2) > 0.99 and the efficiency (E) was 98.3% (Fig. 3 ). The copy number of ToMMV in total RNA (50 ng/µl) extracted from ToMMV-infected tomato leaves was approximately 7.7×10 8 copies per µl. Using the total RNA, a 10-fold dilution series (7.7×10 7 to 10 − 2 copies per µl) was made to analyze the detection sensitivity described in the next subsection. Detection sensitivity We evaluated the detection limit of ToMMV in tomato leaves and seeds, using a 10-fold dilution series of RNA samples. SYBR-RT-qPCR with ToMMV 3027-F/ToMMV 3087-R detected up to 1.54 copies per reaction in both leaf and seed samples (Table 1). Additionally, we compared the detection sensitivity of our method with those of three previously reported methods using the same 10-fold serially diluted templates. Conventional RT-PCR with ToMMV-F/ToMMV-R detected up to 154 copies per reaction; Taqman-RT-qPCR with ToMMV 5228-F/5249-Pe/5278-R or ToMMV 2-F/ToMMV 2-P/ToMMV 2-R detected up to 15.4 or 154 copies per reaction, respectively (Table 1). Therefore, our method was 10–100 times more sensitive than the previously reported ones. Evaluation of ToMMV contamination level in tomato seeds Conventional RT-PCR analysis indicated that all 10 seeds collected from ToMMV-infected tomato plants were positive (Fig. 4 a, b). DISA detected viral signals in the seed coat and hair of tomato seeds collected from ToMMV-infected tomato plants. Contrastingly, healthy tomato seeds exhibited no viral signals (Fig. 4 c–f). However, the results did not differ between the two tested cultivars. Evaluation of seed transmission The seed transmission rates of ToMMV in tomato cvs. Rejina and Carol Passion were 0.93% (2/215) and 0.42% (1/238), respectively. Conventional RT-PCR analysis revealed that all virus-positive seedlings exhibited viral symptoms; no asymptomatic or latent infections were detected. In cv. Rejina, both ToMMV-positive progeny seedlings showed leaf narrowing and suppressed growth compared to those in non-infected seedlings (Fig. 5 a–c), and eventually developed severe symptoms (Fig. S1 a–c). In cv. Carol Passion, a ToMMV-positive progeny seedling, exhibited mottling and distortion of the leaves, inhibited growth compared to those in non-infected seedlings (Fig. 5 d–g), followed by severe symptom development (Fig. S1 d–f). Additionally, back-inoculation of healthy tomato seedlings with each virus-positive progeny seedling produced typical tobamovirus-associated symptoms (data not shown). Detection of ToMMV from 400 tomato seeds We evaluated whether the developed detection method could detect one ToMMV-contaminated tomato seed, which confirmed the above ToMMV contamination level, in 400 tomato seeds. In cvs. Rejina and Carol Passion, our method identified ToMMV in Ct values of 19.8–23.8 and 20.0–25.1 (Tm value: 76.2–76.5 ℃), respectively, from 400 tomato seed samples containing only a single tomato seed naturally contaminated with ToMMV without nonspecific reactions (Table 2). In contrast, previously reported conventional RT-PCR and TaqMan-RT-qPCR methods detected ToMMV from the same tomato seed samples, but the Ct values of TaqMan-RT-qPCR methods were 0.8 to 3.2 higher than those of our SYBR-RT-qPCR method. Discussion ToMMV has rapidly spread to many countries after its discovery in Mexico in 2009 (CABI 2021d ; Li et al. 2013 ). Although the rapid expansion of ToMMV outbreak areas was considered to be associated with the international seed trade involving contaminated seeds, reliable seed health tests for detecting ToMMV infection are limited. Moreover, the epidemiological aspects of ToMMV infection in seeds have not been sufficiently illustrated. Therefore, using ToMMV-contaminated seeds collected from infected tomato plants, we have developed a highly effective SYBR-RT-qPCR method to detect ToMMV in tomato seeds and assessed its effectiveness. Moreover, we clarified the features related to ToMMV seed transmission for the first time. We designed a new ToMMV-specific primer set (ToMMV-3027F/ToMMV-3087R) for SYBR-RT-qPCR analysis using the genome sequences of 29 ToMMV isolates (Fig. 1 ). ToMMV-3087R exhibited a complete match with all ToMMV isolates; ToMMV-3027F contained a single base mismatch compared with two ToMMV isolates, at the 19th position from the 3’ terminus. Either or both primers showed mismatches for two or more bases at the 3’ terminus with Solanaceae-infecting tobamoviruses. Mismatches located in the 3’ end region of a primer more significantly influence amplification efficiency than those at the 5’ end. Moreover, two mismatches for five bases from the 3’ primer terminus inhibit amplification (Ye et al. 2012 ). Therefore, the effect of the abovementioned primer-template mismatches on PCR amplification could be small for ToMMV, but large for Solanaceae-infecting tobamoviruses. In fact, SYBR-RT-qPCR conducted using our primer set amplified ToMMV, except for Solanaceae-infecting tobamoviruses, and a specific melting temperature for ToMMV was observed (Fig. 2 ). Although we did not confirm nonspecific reactions in this study, the melting curve analysis was performed to determine whether the reactions are positive or negative in later cycles. Next, our SYBR-RT-qPCR assay successfully detected up to approximately 1.54 copies per reaction and exhibited 10–100 times higher sensitivity than previously reported detection methods (Table 1). Additionally, our method exhibited the same detection sensitivity for leaves and seeds, which suggests its effectiveness for the diagnosis of infected plants and inspection of contaminated seeds. Therefore, our SYBR-RT-qPCR analysis exhibited high specificity and sensitivity for ToMMV and is superior to the previously reported methods. Using ToMMV-contaminated seeds collected from the infected tomato plants, seed-to-seedling transmission rates were 0.42% and 0.93% in tomato cvs. Carol Passion and Rejina, respectively; however, ToMMV was detected in all tested seeds (Fig. 4 a, b). These seed transmission rates were lower than that (4%) indicated in the first report of ToMMV seed transmission in tomatoes (Mazumder et al. 2024 ). A certain level of viral load on the seed coat ensures sufficient contact between the embryo or progeny seedlings and the inner surface of the virus-containing seed coat tissue, which is crucial for efficient seed transmission of tobamoviruses (Matsushita et al. 2024 ). The low seed transmission rates detected in this study are potentially attributed to the low amount of ToMMV on the seeds, which thoroughly were washed to remove jelly-like plant tissues that covered the seed surface. However, Mazumder et al. ( 2024 ) did not describe the details of the seed collection methods; therefore, it is unclear to what extent the seed processing method contributed to the differences in these seed transmission rates. In tomato seeds, the seed transmission rates of ToBRFV belonging to the genus Tobomovirus were 0.08% (Salem et al. 2022 ), 1.8 or 2.8% (Davino et al. 2020 ), 4.6 or 5.6% (Matsushita et al. 2024 ), 1.7, 4.8, or 5.0% (Kubota et al. 2023 ); these reports reflect differences in seed transmission rates depending on the test methods. The transmission rate of tobamoviruses is not high, however, their consistent seed transmission can be a significant problem for new cultivation areas, and seed-transmitted seedlings could become a new source of horizontal infection (Dombrovsky and Smith 2017 ). Therefore, awareness of the risk of spreading these viruses through virus-contaminated seeds is essential. The transmissibility of viruses through seeds depends on the location of the virus in the seed, and virus-infected embryos maximize the seed transmission rate (Sastry 2013 ). The DISA results in this study revealed the presence of ToMMV in the seed coat and hair but not in the embryo (Fig. 4 c–f). Additionally, seed-to-seedling transmission rates were low, as the above describing. These results indicated the absence of ToMMV in the embryo. Interestingly, viral symptoms developed in ToMMV-positive progeny seedlings on the third or younger leaves, however, the symptoms appeared only two weeks after the sap inoculation (Figs. 5 and S1), suggesting that ToMMV infection occurs during or after the germination rather than before this process. Most tobamoviruses contaminate the seed coat and are absent from the embryo. Seed-to-seedling transmission of tobamoviruses occurs when the progeny seedling comes into contact with the contaminated seed coats; these viruses infect wounds that occur mainly during germination and transplanting (Dombrovsky and Smith 2017 ; Ishibashi et al. 2023 ; Matsushita et al. 2024 ; Sastry 2013 ). Hence, this seed transmission mechanism may be associated with the ToMMV transmission. In summary, ToMMV is a seed-borne rather than seed-transmitted virus in case of tomatoes. This is the first report demonstrating similar properties of ToMMV and other tobamoviruses infecting tomatoes. This suggests the effectiveness of the seed management methods, which are used for other tobamoviruses, for managing ToMMV. In this study, ToMMV was transmitted from diseased seedlings grown from contaminated seeds to healthy tomato plants by sap inoculation, confirming that seed-transmitted seedlings comprise an infection source of ToMMV. Therefore, a reliable diagnostic method for detecting ToMMV can facilitate rejection of contaminated seeds in international seed trading. The reliability of the available molecular detection methods was not evaluated based on seed-to-seedling viral transmission in tomato; however, the reliability of our method was confirmed (Fowkes et al. 2022 ; Schoen et al. 2023 ; Sui et al. 2017 ). In common, the seed sample is divided into multiple subsamples, and then actual seed health tests are carried out against each subsample using an appropriate detection method, respectively. Japanese and Australian quarantines use 400 seeds as a subsample for tomato seed inspection for tobamoviruses. Therefore, we used a subsample size of 400 seeds in this study. As the result, our newly established method could detect one ToMMV-contaminated tomato seed from 400 tomato seeds/subsample, indicating its effectiveness in actual seed inspection. This study provides valuable insights into ToMMV detection, which, along with the novel detection method, can help prevent the spread of ToMMV. In this study, we used only tomatoes; however, ToMMV has also been detected in pepper seeds. However, we could not analyze pepper plants in this study because the ToMMV-inoculated plants were severely symptomatic, leading to insufficient seed availability and limiting further assays. Therefore, we attempted to obtain contaminated seeds from ToMMV-infected pepper plants. Further studies are required to further verify the applicability of this novel method and to assess seed transmissibility of the virus in pepper. Declarations Funding No funding was received for this study. Competing interests The authors have no relevant financial or non-financial interests to disclose. Ethical approval This article does not contain any studies involving human participants or animals performed by any author. References Alkowni R, Alabdallah O, Fadda Z (2019) Molecular identification of tomato brown rugose fruit virus in tomato in Palestine. J Plant Pathol 101:719–723. https://doi.org/10.1007/s42161-019-00240-7 Ambrós S, Martínez F, Ivars P, Hernández C, de la Iglesia F, Elena SF (2017) Molecular and biological characterization of an isolate of Tomato mottle mosaic virus (ToMMV) infecting tomato and other experimental hosts in eastern Spain. Eur J Plant Pathol 149:261–268. https://doi.org/10.1007/s10658-017-1180-2 CABI (2020) Tomato brown rugose fruit virus (Tomato brown rugose fruit virus). CABI compendium. Accessed 30 Jan 2025. https://doi.org/10.1079/cabicompendium.88757522 CABI (2021a) Pepper mild mottle virus (PMMV). CABI compendium. Accessed 30 Jan 2025. https://doi.org/10.1079/cabicompendium.43826 CABI (2021b) Tobacco mild green mosaic virus. CABI compendium. Tobacco mosaic virus (tobacco mosaic) | CABI Compendium. Accessed 30 Jan 2025 CABI (2021c) Tobacco mosaic virus (tobacco mosaic). CABI compendium. Accessed 30 Jan 2025. https://doi.org/10.1079/cabicompendium.88757522 CABI (2021d) Tomato mottle mosaic virus. CABI compendium. Accessed 30 Jan 2025. https://doi.org/10.1079/cabicompendium.121740 CABI (2021e) Tomato mosaic virus (tomato mosaic). CABI compendium. Accessed 30 Jan 2025. https://doi.org/10.1079/cabicompendium.54063 Chanda B, Gilliard A, Jaiswal N, Ling KS (2021) Comparative analysis of host range, ability to infect tomato cultivars with Tm-22 gene, and Real-Time Reverse Transcription PCR detection of tomato brown rugose fruit virus. Plant Dis 105:3643–3652. https://doi.org/10.1094/PDIS-05-20-1070-RE Dall DJ, Lovelock DA, Penrose LDJ, Constable FE (2023) Prevalences of Tobamovirus contamination in seed lots of tomato and Capsicum. Viruses 15:883. https://doi.org/10.3390/v15040883 Davino S, Caruso AG, Bertacca S, Barone S, Panno S (2020) Tomato brown rugose fruit virus: seed transmission rate and efficacy of different seed disinfection treatments. Plants (Basel) 9:1615. https://doi.org/10.3390/plants9111615 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: Version II. Plant Mol Biol Rep 1:19–21. https://doi.org/10.1007/BF02712670 Dombrovsky A, Smith E (2017) Seed transmission of tobamoviruses: aspects of global disease distribution. In: Jimenez-Lopez JC (ed) Advances in seed biology. IntechOpen, London, UK, pp 233–260. https://doi.org/10.5772/intechopen.70244 EPPO (2022) Pest Risk Analysis for Tomato mottle mosaic virus (Tobamovirus). https://gd.eppo.int/download/doc/1550_pra_exp_TOMMV0.pdf Fowkes AR, Botermans M, Frew L, de Koning PPM, Buxton-Kirk A, Westenberg M, Ward R, Schenk MF, Webster G, Alraiss K, Harju V, Skelton A, Conyers C, Barrett B, Adams IP, McGreig S, Fox A, Vazquez-Iglesias I (2022) First report of Tomato mottle mosaic virus in Solanum lycopersicum seeds in the Netherlands and intercepted in seed imported from Asia. New Dis Rep 45:e12067. https://doi.org/10.1002/ndr2.12067 Hamada H, Takeuchi S, Morita Y, Sawada H, Kiba A, Hikichi Y (2003) Characterization of Paprika mild mottle virus first isolated in Japan. J Gen Plant Pathol 69:199–204. https://doi.org/10.1007/s10327-002-0028-5 Ishibashi K, Kubota K, Kano A, Ishikawa M (2023) Tobamoviruses: old and new threats to tomato cultivation. J Gen Plant Pathol 89:305–321. https://doi.org/10.1007/s10327-023-01141-5 Kon T, Sato C, Fuji SI (2024) Molecular characterization and host reaction to tomato mottle mosaic virus isolated from sweet pepper seeds in Japan. Arch Virol 169:113. https://doi.org/10.1007/s00705-024-06035-1 Kubota K, Takeyama S, Matsushita Y, Tomitaka Y, Matsuyama M, Ishibashi K, Shinosaka H, Ohsaki K (2023) Evaluation of control measures against tomato brown rugose fruit virus: disinfestation of equipment and seeds and use of attenuated strain of tomato mosaic virus (in Japanese with English abstract). Jpn J Phytopathol 89:235–244. https://doi.org/10.3186/jjphytopath.89.235 Kubota K, Usugi T, Tomitaka Y, Matsushita Y, Higashiyama M, Kosaka Y, Tsuda S (2012) Characterization of Rehmannia mosaic virus isolated from chili pepper (Capsicum annuum) in Japan. J Gen Plant Pathol 78:43–48. https://doi.org/10.1007/s10327-011-0345-7 Kumar R, Gupta A (2020) Seed-borne diseases of agricultural crops: detection, diagnosis & management. Springer, Singapore Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. https://doi.org/10.1093/bioinformatics/btm404 Li R, Gao S, Fei Z, Ling K-S (2013) Complete genome sequence of a new tobamovirus naturally infecting tomatoes in Mexico. Genome Announc 1:e00794–e00713. https://doi.org/10.1128/genomeA.00794-13 Li Y, Wang Y, Hu J, Xiao L, Tan G, Lan P, Liu Y, Li F (2017) The complete genome sequence, occurrence and host range of Tomato mottle mosaic virus Chinese isolate. Virol J 14:15. https://doi.org/10.1186/s12985-016-0676-2 Li YY, Wang CL, Xiang D, Li RH, Liu Y, Li F (2014) First Report of Tomato mottle mosaic virus Infection of Pepper in China. Plant Dis 98:1447. https://doi.org/10.1094/PDIS-03-14-0317-PDN Lovelock DA, Kinoti WM, Bottcher C, Wildman O, Dall D, Rodoni BC, Constable FE (2020) Tomato mottle mosaic virus intercepted by Australian biosecurity in Capsicum annuum seed. Australas Plant Dis Notes 15:8. https://doi.org/10.1007/s13314-020-0378-x Luria N, Smith E, Reingold V, Bekelman I, Lapidot M, Levin I, Elad N, Tam Y, Sela N, Abu-Ras A, Ezra N, Haberman A, Yitzhak L, Lachman O, Dombrovsky A (2017) A new Israeli Tobamovirus isolate infects tomato plants harboring Tm-22 resistance genes. PLoS ONE 12:e0170429. https://doi.org/10.1371/journal.pone.0170429 Matsushita Y, Takeyama S, Tomitaka Y, Matsuyama M, Ishibashi K, Shinosaka H, Osaki K, Kubota K (2024) Elucidating the nature of seed-borne transmission of tomato brown rugose fruit virus in tomato, bell pepper, and eggplant. J Gen Plant Pathol 90:23–34. https://doi.org/10.1007/s10327-023-01159-9 Mazumder P, Mondal F, Sarkar M, Majumdar A, Biswas KK, Sharma SK, Lal MK, Tiwari RK, Kumar R, Roy A (2024) Biological and molecular characterization of a new isolate of tomato mottle mosaic virus causing severe shoestring and fruit deformities in tomato plants in India. Plants (Basel) 13:2811. https://doi.org/10.3390/plants13192811 Nagai A, Duarte LML, Chaves ALR, Peres LEP, dos Santos DYAC (2019) Tomato mottle mosaic virus in Brazil and its relationship with Tm-2 2 gene. Eur J Plant Pathol 155:353–359. https://doi.org/10.1007/s10658-019-01762-7 Ota E, Shinosaka H, Ishibashi K, Takeyama S, Matsuyama M, Tomitaka Y, Matsushita Y, Osaki K, Kubota K (2025) Development and evaluation of a SYBR Green-based RT-qPCR assay with a specific primer set for tomato seed testing against tomato brown rugose fruit virus. J Gen Plant Pathol 91:160–170. https://doi.org/10.1007/s10327-025-01222-7 Salem NM, Sulaiman A, Samarah N, Turina M, Vallino M (2022) Localization and mechanical transmission of tomato brown rugose fruit virus in tomato seeds. Plant Dis 106:275–281. https://doi.org/10.1094/PDIS-11-20-2413-RE Sastry KS (2013) Data. In: Seed-borne plant virus diseases. Springer, New Delhi. ISBN: 978-81-322-0812-9 Schoen R, de Koning P, Oplaat C, Roenhorst A, Westenberg M, van der Gaag DJ, Barnhoorn R, Koenraadt H, van Dooijeweert W, Lievers R, Woudt B, Tavares CP, Botermans M (2023) Identification of tomato mottle mosaic virus in historic seed accessions originating from France, the Netherlands and Spain, indicates a wider presence before its first description. Eur J Plant Pathol 166:485–489. https://doi.org/10.1007/s10658-023-02677-0 Sui X, Zheng Y, Li R, Padmanabhan C, Tian T, Groth-Helms D, Keinath AP, Fei Z, Wu Z, Ling KS (2017) Molecular and biological characterization of Tomato mottle mosaic virus and development of RT-PCR detection. Plant Dis 101:704–711. https://doi.org/10.1094/PDIS-10-16-1504-RE Takeuchi S, Hamada H, Toyoda K, Suzuki K, Kiba A, Hikichi Y, Okuno T (2005) Discrimination between tobamoviruses and their pathotypes for L-gene-mediated resistance in green pepper (Capsicum annuum L.) by reverse transcription-polymerase chain reaction. J Gen Plant Pathol 71:60–67. https://doi.org/10.1007/s10327-004-0161-4 Tu L, Wu S, Gao D, Liu Y, Zhu Y, Ji Y (2021) Synthesis and characterization of a full-length infectious cDNA clone of tomato mottle mosaic virus. Viruses 13:1050. https://doi.org/10.3390/v13061050 Watzinger F, Ebner K, Lion T (2006) Detection and monitoring of virus infections by real-time PCR. Mol Aspects Med 27:254–298. https://doi.org/10.1016/j.mam.2005.12.001 Yanagisawa H, Matsushita Y (2022) Effect of potato spindle tuber viroid variants and infection stage on seed transmission through pollen. Lett Appl Microbiol 75:836–843. https://doi.org/10.1111/lam.13756 Yanagisawa H, Tsutsumi N, Ishii K, Shiki Y, Kurihara K (2012) Modification on Detection method of Potato spindle tuber viroid using RT-LAMP. Res Bull Plant Protect Jpn 48:7–12 (in Japanese with English abstract). https://www.maff.go.jp/pps/j/guidance/r_bulletin/pdf/rb048_002.pdf Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform 13:134. https://doi.org/10.1186/1471-2105-13-134 Yokohama Plant Protection Station (2021) Pest risk analysis for Tomato mottle mosaic virus . https://www.maff.go.jp/j/syouan/keneki/kikaku/attach/pdf/pra_table1-1.pdf (in Japanese) Zhou WP, Li YY, Li F, Tan GL (2021) First report of natural infection of tomato by pepper mild mottle virus in China. J Plant Pathol 103:363. https://doi.org/10.1007/s42161-020-00688-y Tables Tables 1 and 2 are available in the Supplementary Files section. Supplementary Files SupplementaryFig.S1.pptx List of supplementary files supplementary Fig. S1Symptoms of seed-transmitted tomato seedlings infected with ToMMV through the tomato seeds on eight weeks after transplanting. (a) Inhibited growth of ToMMV-positive tomato (cv. Rejina) seedlings. (b) Leaf distortion (left) ToMMV-positive seedling in (a). (c) Leaf distortion (right) in ToMMV-positive seedling shown in (a). (d) Inhibited growth on ToMMV-positive tomato (cv. Carol Passion) seedling. (e) Mottling in the leaf on ToMMV-positive seedling shown in (d). (e) leaf distortion on ToMMV-positive seedling shown in (d). Table1.xlsx Table2.xlsx Cite Share Download PDF Status: Published Journal Publication published 10 Nov, 2025 Read the published version in Journal of General Plant Pathology → Version 1 posted Reviewers agreed at journal 05 Jun, 2025 Reviewers invited by journal 03 Jun, 2025 Editor assigned by journal 03 Jun, 2025 First submitted to journal 02 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6806693","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":466092996,"identity":"52a41841-948a-4b70-b7e3-52668c58df92","order_by":0,"name":"Yuya Imamura","email":"","orcid":"","institution":"Yokohama Plant Protection Station","correspondingAuthor":false,"prefix":"","firstName":"Yuya","middleName":"","lastName":"Imamura","suffix":""},{"id":466092997,"identity":"0dfd0c42-fa0d-444e-a312-90053f30f8cc","order_by":1,"name":"Fumino Nito","email":"","orcid":"","institution":"Yokohama Plant Protection Station","correspondingAuthor":false,"prefix":"","firstName":"Fumino","middleName":"","lastName":"Nito","suffix":""},{"id":466092998,"identity":"65b1437c-1ff3-4faa-94a7-72bf76177c2f","order_by":2,"name":"Yuji Fujiwara","email":"","orcid":"","institution":"Yokohama Plant Protection Station","correspondingAuthor":false,"prefix":"","firstName":"Yuji","middleName":"","lastName":"Fujiwara","suffix":""},{"id":466092999,"identity":"41c19ae8-a640-4362-9ad9-fb403da69e39","order_by":3,"name":"Takayuki Matsuura","email":"","orcid":"","institution":"Yokohama Plant Protection Station","correspondingAuthor":false,"prefix":"","firstName":"Takayuki","middleName":"","lastName":"Matsuura","suffix":""},{"id":466093000,"identity":"83a766eb-b947-49f0-ba0f-4da2f82de6e1","order_by":4,"name":"Hironobu Yanagisawa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQUlEQVRIie2RMUvDQBTHXzjoLa90vRKrXyFy0NpB81USCunSgiCUglADQlxS53wMXW4ORNoloG4ZMiQUMnXQRaJU8CJYrLXVUTC/5bj/3Y+79x5ASckfRCPvi/+xZwCE+P4DQI3aRYC/Uahjph5A3fU3KLCqFJdCznGprNOi1XR2PIxNm3WyJH850Gter6ke9o4YAr1PYCf+qrTPKedemEnFau2PL5npRdZA7YuOVPBEA8zWPhZUKmrVCaRiNFnVZQZEHSEVMtIBLQYYbFG6T/VXl+l7kdFU2+KseOUnRZaAOVOuwhvOFREUtUw2KIRjmHEb5wO1YTPzeiqbPBZThgSJZnxTy+1EmeEwbti0K+rzxUjfDeQon8UpQ3qRJo/uWseW6HcGgOJ8jghqYG6aTkGtOFusRDQByLcoJSUlJf+EN21CcA+nMM9tAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-6729-466X","institution":"Yokohama Plant Protection Station","correspondingAuthor":true,"prefix":"","firstName":"Hironobu","middleName":"","lastName":"Yanagisawa","suffix":""}],"badges":[],"createdAt":"2025-06-03 04:06:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6806693/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6806693/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10327-025-01263-y","type":"published","date":"2025-11-10T15:58:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84087127,"identity":"00cf9b64-a2da-4c11-a45a-2e7e89b22fa9","added_by":"auto","created_at":"2025-06-06 15:17:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":93301,"visible":true,"origin":"","legend":"\u003cp\u003eComparative sequences of tomato mottle mosaic virus and tobamoviruses which infect tomato and pepper. The regions considered to design primers ToMMV-3027F and ToMMV-3087R at nucleotide positions 3,027 to 3,048 and 3,087 to 3,112 with reference to ToMMV isolate MK5 (accession no. KF477193.1) are shown. *: KP202857.1, KR824950.1, KR824951.1, KT810183.1, KU594507.2, KX898033.1, KX898034.1, MG171192.1, MH128145.1, MH381817.1, MN654021.1, MN853592.1, MW373515.1, MW441234.1, MW582804.1, MZ713255.1, MZ713256.1, MZ713257.1, OK180812.1, OK334224.1, ON146334.1, ON987480.1, ON987481.1, ON987482.1, OR843985.1, PP894826.1\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/28895272e53072664c3f93c2.png"},{"id":84087128,"identity":"5cad93e9-f85e-4e2e-a87c-bdc78fdaf2ad","added_by":"auto","created_at":"2025-06-06 15:17:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":161119,"visible":true,"origin":"","legend":"\u003cp\u003eThe detection specificity of SYBR-RT-qPCR analysis for ToMMV. \u003cstrong\u003e(a)\u003c/strong\u003eAmplification plot, \u003cstrong\u003e(b)\u003c/strong\u003emelting curve analysis, and \u003cstrong\u003e(c)\u003c/strong\u003eagarose gel electrophoresis analysis of real-time RT-PCR products amplified using ToMMV-specific primer set ToMMV 3027-F/ToMMV 3087-R from leaves infected with ToMMV and closely related tobamoviruses. Other 7 tobamoviruses: PaMMV, PMMoV, ReMV, TMGMV, TMV, ToBRFV, and ToMV. NTC: non template control. M: 50 bp DNA ladder marker (Dye Plus) (Takara Bio., Kyoto, Japan).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/d2af4158570ba71cd8e56848.png"},{"id":84088310,"identity":"0ecaf905-689d-4f90-8e69-b9d452524f83","added_by":"auto","created_at":"2025-06-06 15:33:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":221540,"visible":true,"origin":"","legend":"\u003cp\u003eStandard curve of ToMMV was plotted based on the cycle threshold (Ct) values obtained from Taqman-RT-qPCR using a 10-fold standard dilution series of transcribed RNA and ToMMV 5228-F/5249-Pe/5278-R (Fowkes et al. 2022).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/df4619b317138acff8addf04.png"},{"id":84087936,"identity":"e998eb9d-6b5f-48c1-88d0-0208d7cb9000","added_by":"auto","created_at":"2025-06-06 15:25:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":787870,"visible":true,"origin":"","legend":"\u003cp\u003eThe detection of ToMMV from tomato seeds collected from ToMMV-infected plants through conventional RT-PCR and direct immunostaining assay. ToMMV was detected in all seeds (n=10) of ToMMV-infected tomato cv. Rejina (\u003cstrong\u003ea\u003c/strong\u003e) and Carol Passion (\u003cstrong\u003eb\u003c/strong\u003e) via conventional RT-PCR (Sui et al. 2017). M: 100 bp DNA ladder marker (Takara Bio Inc.). Lanes 1–10: one tomato seed collected from ToMMV-infected plants per lane. Lanes 11 and 12: one healthy tomato seed per lane. Lane 13: ToMMV-infected tomato leaf (positive control). Lane 14: nuclease-free water (negative control). Contaminated or healthy tomato seeds of Rejina (\u003cstrong\u003ec\u003c/strong\u003e, \u003cstrong\u003ed\u003c/strong\u003e) and Carol Passion (\u003cstrong\u003ee\u003c/strong\u003e, \u003cstrong\u003ef\u003c/strong\u003e) were treated with the rabbit anti-TMV conjugate that also binds to ToMMV. Dark purple indicates ToMMV-contaminated seeds. Scale bars represent 1mm.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/d606ca7d9d16abb72c2931ce.png"},{"id":84087130,"identity":"8afd3770-f09a-4d86-8fcc-c7a5de959d4e","added_by":"auto","created_at":"2025-06-06 15:17:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":471054,"visible":true,"origin":"","legend":"\u003cp\u003eSymptoms of seed-transmitted ToMMV infection in tomato seedlings four weeks after transplantation. \u003cstrong\u003e(a)\u003c/strong\u003e Inhibited growth of ToMMV-positive tomato (cv. Rejina) seedlings. (\u003cstrong\u003eb)\u003c/strong\u003e Distorted leaves (left) of ToMMV-positive seedling shown in \u003cstrong\u003e(a)\u003c/strong\u003e.\u003cstrong\u003e (c)\u003c/strong\u003e Distorted leaves (right) of ToMMV-positive seedling shown in \u003cstrong\u003e(a)\u003c/strong\u003e. \u003cstrong\u003e(d)\u003c/strong\u003e Inhibited growth of ToMMV-positive tomato (cv. Carol Passion) seedling. \u003cstrong\u003e(e)\u003c/strong\u003e ToMMV-positive seedling shown in \u003cstrong\u003e(d)\u003c/strong\u003e. \u003cstrong\u003e(f)\u003c/strong\u003e Mottled leaf at red arrow point shown in \u003cstrong\u003e(e)\u003c/strong\u003e on ToMMV-positive seedling.\u003cstrong\u003e (g)\u003c/strong\u003e Leaf distortion at the yellow arrow point in \u003cstrong\u003e(e)\u003c/strong\u003e on the ToMMV-positive seedling.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/4da5071263b9e3900a66fb75.png"},{"id":96105138,"identity":"80c4a39f-e061-42e6-a862-65fd3011686b","added_by":"auto","created_at":"2025-11-17 16:09:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2540785,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/715c86ad-9f59-4532-acf3-ec05e9b020db.pdf"},{"id":84087139,"identity":"8e7fbfb3-3e8d-459f-9a6d-d94642f40eee","added_by":"auto","created_at":"2025-06-06 15:17:09","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5652166,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eList of supplementary files\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003esupplementary Fig. S1\u003c/strong\u003eSymptoms of seed-transmitted tomato seedlings infected with ToMMV through the tomato seeds on eight weeks after transplanting. \u003cstrong\u003e(a)\u003c/strong\u003e Inhibited growth of ToMMV-positive tomato (cv. Rejina) seedlings. \u003cstrong\u003e(b)\u003c/strong\u003e Leaf distortion (left) ToMMV-positive seedling in \u003cstrong\u003e(a)\u003c/strong\u003e. \u003cstrong\u003e(c)\u003c/strong\u003e Leaf distortion (right) in ToMMV-positive seedling shown in \u003cstrong\u003e(a)\u003c/strong\u003e. \u003cstrong\u003e(d)\u003c/strong\u003e Inhibited growth on ToMMV-positive tomato (cv. Carol Passion) seedling. \u003cstrong\u003e(e)\u003c/strong\u003e Mottling in the leaf on ToMMV-positive seedling shown in \u003cstrong\u003e(d)\u003c/strong\u003e. \u003cstrong\u003e(e)\u003c/strong\u003e leaf distortion on ToMMV-positive seedling shown in \u003cstrong\u003e(d)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"SupplementaryFig.S1.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/0d554953bc2a55377686d186.pptx"},{"id":84087935,"identity":"17a2a9d2-dac9-40b8-b2d4-2fe962049621","added_by":"auto","created_at":"2025-06-06 15:25:09","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":13682,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/134575493259be68b580da23.xlsx"},{"id":84087136,"identity":"d04a1b0d-79fe-4b93-821e-5f2ab64a4332","added_by":"auto","created_at":"2025-06-06 15:17:09","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":14540,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6806693/v1/8de1eae1ba262de85915c0c1.xlsx"}],"financialInterests":"","formattedTitle":"Development of a SYBR Green-based real-time RT-PCR method using a newly designed tomato mottle mosaic virus-specific primer set and the assessment of its seed transmission properties in tomato seeds.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTobamoviruses, belonging to the genus \u003cem\u003eTobamovirus\u003c/em\u003e and family \u003cem\u003eVirgaviridae\u003c/em\u003e, pose a major threat, especially in Solanaceae and Cucurbitaceae crops (Dombrovsky and Smith \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Among the 37 viruses belonging to the genus, paprika mild mottle virus (\u003cem\u003eTobamovirus paprikae\u003c/em\u003e; PaMMV), pepper mild mottle virus (\u003cem\u003eTobamovirus capsici\u003c/em\u003e; PMMoV), rehmannia mosaic virus (\u003cem\u003eTobamovirus rehmanniae\u003c/em\u003e; ReMV), tobacco mild green mosaic virus (\u003cem\u003eTobamovirus mititessellati\u003c/em\u003e; TMGMV), tobacco mosaic virus (\u003cem\u003eTobamovirus tabaci\u003c/em\u003e; TMV), tomato brown rugose fruit virus (\u003cem\u003eTobamovirus fructirugosum\u003c/em\u003e; ToBRFV), tomato mosaic virus (\u003cem\u003eTobamovirus tomatotessellati\u003c/em\u003e; ToMV), and tomato mottle mosaic virus (\u003cem\u003eTobamovirus maculatessellati\u003c/em\u003e; ToMMV) are the most widespread ones infecting Solanaceae crops; they naturally infect tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) and/or pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e) (CABI \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021c\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021d\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021e\u003c/span\u003e; Hamada et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kubota et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). ToMMV was first reported in Mexico in 2009 (CABI \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021d\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e); it is an emerging tobamovirus harboring a positive-sense, single-stranded RNA (approximately 6,400 nucleotides) and rod-shaped particles of approximately 18 nm in diameter and 300 nm in length (CABI \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021d\u003c/span\u003e; Ishibashi et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Kon et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Tu et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). ToMMV can infect various tomato and pepper cultivars exhibiting various levels of tobamovirus resistance, which may lead to severe damage, including inhibited growth, leaf narrowing, leaf mosaicism, and necrosis symptoms, resulting in a significant decline in tomato fruit yield and quality (Ambr\u0026oacute;s et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Kon et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Mazumder et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Nagai et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Tu et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, the experimental host range includes Amaranthaceae, Asteraceae, Brassicaceae, Verbenaceae, and other Solanaceae plants (Ambr\u0026oacute;s et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Chanda et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sui et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). ToMMV outbreaks have been reported in various countries (CABI \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021d\u003c/span\u003e; Ishibashi et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Although some tobamoviruses have been reported to transmit through seeds, ToMMV has recently been reported to be seed-transmissible (Dombrovsky and Smith \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Ishibashi et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Mazumder et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Sastry \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). ToMMV has also been detected in commercial tomato and pepper seeds during quarantine inspections (Dall et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Fowkes et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kon et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Lovelock et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, considering ToMMV-contaminated seeds a major source of this global distribution, ToMMV is listed as one of the most significant quarantine pests in Japan. Host plants and seeds are regulated by the Japanese Plant Protection Act.\u003c/p\u003e \u003cp\u003eVarious studies have reported the biological and molecular features of ToMMV. However, seed transmission mechanism of ToMMV was never focused on, except for a recent report about the seed-transmission rate of this virus in tomato; however, a comprehensive knowledge of the epidemiological aspects of ToMMV in seeds is necessary to assess the risk of viral spread through ToMMV-contaminated seeds (Mazumder et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The lack of this information has become an obstacle when considering ToMMV management methods. In some assessments, plant protection organizations have characterized ToMMV based on the properties of other tobamoviruses to address the lack of information (EPPO \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Yokohama Plant Protection Station \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, it is necessary to investigate whether ToMMV has properties similar to those of the other tobamoviruses.\u003c/p\u003e \u003cp\u003eA suitable detection method for ToMMV in traded seeds can be a key to preventing viral spread. Conventional RT-PCR and real-time RT-PCR methods for ToMMV detection have been developed (Fowkes et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Schoen et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sui et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Generally, real-time RT-PCR exhibits lower contamination risks and less time consumption than conventional RT-PCR because real-time RT-PCR does not involve post-amplification handling (Kumar and Gupta \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Real-time RT-PCR has been used for ToMMV detection in some institutions (Fowkes et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Schoen et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Although real-time RT-PCR for plant pathogen detection has been performed with SYBR Green dye (SYBR-RT-qPCR) or TaqMan probe (TaqMan-RT-qPCR) as a fluorescent assay, these real-time RT-PCR methods for ToMMV were developed using TaqMan-RT-qPCR (Kumar and Gupta \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Comparison of these two detection assays revealed that SYBR-RT-qPCR is more economical than TaqMan-RT-qPCR because a target-specific fluorogenic probe is not used (Watzinger et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Furthermore, melting curve analysis using SYBR-RT-qPCR can efficiently distinguish target-derived amplification from non-specific reactions. The melting temperature (Tm) profile significantly contributes to the determination of a positive result, especially when ambiguous amplification is observed at later PCR cycles. A recently reported SYBR-RT-qPCR method for ToBRFV detection reflected these advantages (Ota et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Therefore, the development of a SYBR-RT-qPCR method can effectively support the inspection of Solanaceae seeds using ToMMV.\u003c/p\u003e \u003cp\u003eTherefore, we investigated some epidemiological properties, such as seed transmission rate, seed contamination rate, and location of the viral infection in seeds, using contaminated seeds collected from ToMMV-infected tomatoes. Next, we designed a new primer set for SYBR-RT-qPCR to detect a wide range of ToMMV isolates from each country without non-specific amplification of the other Solanaceae-infecting tobamoviruses. We comparatively evaluated the sensitivity of our method along with previously reported methods. Finally, we attempted to detect ToMMV that presents in a bulk seed sample including one ToMMV-contaminated tomato seed using our SYBR-RT-qPCR method. To the best of our knowledge, this is the first report on the epidemiological features related to ToMMV seed transmission and a practical SYBR-RT-qPCR method for ToMMV, which will contribute to the management of the virus.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of virus-infected plants\u003c/h2\u003e \u003cp\u003eThe ToMMV DSMZ PV-1267 isolate (GenBank/EMBL/DDBJ accession no. MW582804.1) used in this study was purchased from DSMZ (German Collection of Microorganisms and Cell Cultures GmbH). Dr. Aviv Dombrovsky kindly provided the ToBRFV Israeli isolate-infected tissue; its complete nucleotide sequence matched the DSMZ PV-1241 isolate\u0026rsquo;s sequence (accession no. MZ202349) (Luria et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Matsushita et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Ota et al \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). PaMMV-J (MAFF no. 260251), PMMoV-Noei 1 (MAFF no. 104032), ReMV-J (MAFF no. 260249), TMGMV-Chiba 1 (MAFF no. 104036), TMV-OM (MAFF no. 260064), and ToMV-CH3 (MAFF no. 260008)-infected tissues were obtained from the Research Center of Genetic Resources, the National Agricultural and Food Research Organization (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.gene.affrc.go.jp/index_en.php\u003c/span\u003e\u003cspan address=\"https://www.gene.affrc.go.jp/index_en.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eToMMV-infected tissues were homogenized in 10 volumes (w/v) of 0.1 M phosphate buffer (pH 7.0) to prepare the inoculum. We transversely cut the stems of tomato plants (cv. Rejina: Sakata Seed, Kanagawa, Japan) at 5\u0026thinsp;\u0026minus;\u0026thinsp;6-leaf stage 20 times to a depth of approximately 0.5 mm using a disposable scalpel dipped in the ToMMV inoculum. The inoculated plants were grown in an insect-proof glasshouse at 23\u0026thinsp;\u0026minus;\u0026thinsp;27 ℃ with natural light. One month after inoculation, symptomatic leaf samples were collected from the inoculated plants, and viral infection was confirmed by conventional RT-PCR with the specific primer set ToMMV-F/ToMMV-R (Sui et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) before further analyses.\u003c/p\u003e \u003cp\u003eAdditionally, TMV-, ToBRFV-, and ToMV-infected tomato plants (cv. Rejina) and PaMMV-, PMMoV-, ReMV-, and TMGMV-infected pepper plants (cv. Fushimi-amanaga: Takii Seeds; Kyoto, Japan) were prepared as described above. Viral-infection was confirmed through conventional RT-PCR with specific primer sets P1F/P1R for PaMMV (Hamada et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), PMMoVdF/PMMoVdR for PMMoV (Zhou et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), ReMV-5608fw/ReMV-6220rv for ReMV (Kubota et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), TGF/TGR for TMGMV (Takeuchi et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), TMV-F/TMV-R for TMV (Sui et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), ToBRFV-F/ToBRFV-R for ToBRFV (Alkowni et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and ToMV-F/ToMV-R for ToMV (Sui et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eTotal RNA extraction\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eTotal RNA extraction\u003c/div\u003e \u003cp\u003eApproximately 100 mg of the leaf or seed sample was ground in a 2 ml tube with a stainless-steel bead (6 mm in diameter) using a multi-bead shocker (Yasuikikai, Osaka, Japan) at 1,000 rpm for 1 min. Total RNA was extracted from the tissue homogenate following a method described by Dellaporta et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1983\u003c/span\u003e); 3.3% w/v polyvinylpyrrolidone (molecular weight 40,000) was added to the extraction buffer. The concentration of extracted RNA was measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).\u003c/p\u003e\n\u003ch3\u003eDesign of specific primers\u003c/h3\u003e\n\u003cp\u003eTo design the ToMMV-specific primer for SYBR-RT-qPCR analysis, 29 ToMMV sequences longer than 5,000 nucleotides, corresponding to the complete or nearly complete genomes currently available in databases, were obtained from the GenBank database in 2024 (accessed: 25/12/2024). Furthermore, we acquired 14 sequences of Solanaceae-infecting tobamoviruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The obtained sequences were aligned to identify ToMMV-specific regions using the CLUSTAL W 2.1 program (Larkin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). As a result, we designed ToMMV 3027-F (5\u0026rsquo;-TGTGATGTGCACTTCTGCAGAA-3\u0026rsquo;; nucleotide positions 3,027 to 3,048 with reference to ToMMV isolate MK5, KF477193.1) and ToMMV 3087-R (5\u0026rsquo;-GTGGTTTGGATACTGGATTGATTGTG-3\u0026rsquo;; nucleotide positions 3,087 to 3,112).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eConventional RT-PCR and real-time RT-PCR\u003c/h3\u003e\n\u003cp\u003eConventional and real-time RT-PCR analyses were performed as described below.\u003c/p\u003e\n\u003ch3\u003e[Conventional RT-PCR]\u003c/h3\u003e\n\u003cp\u003eConventional RT-PCR was performed on a SimpliAmp thermal cycler (Thermo Fisher Scientific Inc.) using the QIAGEN OneStep RT-PCR Kit (QIAGEN, Hilden, Germany). The 20 \u0026micro;l reaction mixture contained 4 \u0026micro;l of 5 \u0026times; QIAGEN OneStep RT-PCR Buffer, 0.8 \u0026micro;l of dNTP Mix (10 mM each), 0.8 \u0026micro;l of QIAGEN OneStep RT-PCR Enzyme Mix, and primers (0.8 \u0026micro;M each for forward and reverse), 2 \u0026micro;l of the extract. Thermal cycling conditions included the following steps: 50 ℃ for 30 min, 95 ℃ for 15 min, and 40 cycles of 94 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 1 min, followed by 72 ℃ for 10 min. The amplicons were electrophoresed using a 2% (w/v) agarose gel stained with GelRed (Biotium, Hayward, CA, USA).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e[Real-time RT-PCR]\u003c/h2\u003e \u003cp\u003eSYBR-RT-qPCR analysis was performed using the Power SYBR\u0026trade; Green RNA-to-C\u003csub\u003eT\u003c/sub\u003e\u0026trade; 1-Step Kit (Thermo Fisher Scientific) on QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific). The 20 \u0026micro;l reaction mixture contained 10 \u0026micro;l of 2 \u0026times; Power SYBR\u0026trade; Green RT-PCR Mix, 0.16 \u0026micro;l of 125 \u0026times; RT Enzyme Mix, and primers (200 nM each of forward and reverse), and 2 \u0026micro;l of the extract. Thermal cycling conditions included the following steps: 48 ℃ for 30 min, 95 ℃ for 10 min, and 40 cycles of 95 ℃ for 15 s and 60 ℃ for 1 min, followed by a melting temperature ramp from 60 ℃ to 95℃ at 0.02 ℃/s. To confirm that target-specific amplification occurred without non-specific amplification, if necessary, the amplicons were electrophoretically analyzed using a 5% (w/v) agarose gel stained with GelRed.\u003c/p\u003e \u003cp\u003eTaqMan\u0026trade; RNA-to-C\u003csub\u003eT\u003c/sub\u003e\u0026trade; 1-Step Kit (Thermo Fisher Scientific) was used for Taqman-RT-qPCR with QuantStudio 3 Real-Time PCR system. The 20 \u0026micro;l reaction mixture contained 10 \u0026micro;l of 2 \u0026times; TaqMan\u0026trade; RTPCR Mix, 0.5 \u0026micro;l of 40 \u0026times; TaqMan\u0026trade; RT Enzyme Mix, 100 nM of probe, primers (300 nM each of forward and reverse), and 2 \u0026micro;l of the extract. The following thermal cycling conditions were maintained: 48 ℃ for 15 min, 95 ℃ for 10 min, 40 cycles of 95 ℃ for 15 s, and 60 ℃ for 1 min.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetection specificity\u003c/h3\u003e\n\u003cp\u003eTo test the specificity of ToMMV 3027-F/ToMMV 3087-R, SYBR-RT-qPCR was performed using ToMMV and other Solanaceae-infecting tobamoviruses. Total RNA extracted from viral-infected leaves (refer to the section \u0026ldquo;Preparation of virusinfected plants\u0026rsquo;\u0026rsquo;), diluted to 50 ng/\u0026micro;l using RNase-free sterile water, was used as a template.\u003c/p\u003e\n\u003ch3\u003eEstimation of ToMMV copy numbers\u003c/h3\u003e\n\u003cp\u003eTo estimate the ToMMV copy number in each sample, an RNA standard control of ToMMV used for TaqMan-RT-qPCR was constructed. Initially, PCR using KOD FX (TOYOBO, Osaka, Japan) and primer pair of ToMMV-Standard-F\u0026thinsp;+\u0026thinsp;T7 (5\u0026rsquo;- \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTAATACGACTCACTATAGGGAGA\u003c/span\u003eGTGGAATCTTCCAGACAATTG-3\u0026rsquo;; nucleotide positions 5,140 to 5,160 with the reference to ToMMV isolate MK5, KF477193.1; the T7 RNA polymerase binding site is underlined) and ToMMV-Standard-R (5\u0026rsquo;-TTCTTGCAGCTCCAGTATAAT-3\u0026rsquo;; nucleotide positions 5,232 to 5,253) were conducted with artificial synthesized DNA (nucleotide positions 5,140 to 5,253) serving as template. The 40 \u0026micro;l reaction mixture contained 20 \u0026micro;l of 2 \u0026times;PCR Buffer for KOD FX, 8.0 \u0026micro;l of 2 mM dNTPs, primers (300 nM each for forward and reverse), 0.8 \u0026micro;l of KOD FX (1.0 U/\u0026micro;l), and 100 pg of template. Thermal cycling conditions were as follows: 94 ℃ for 2 min; 40 cycles of 98℃ for 10 s, 60℃ for 30 s, and 68℃ for 30 s; 68℃ for 10 min. The amplicon was purified using the QIAquick PCR Purification Kit (QIAGEN). The RNA standard was transcribed from the purified amplicon, and the number of ToMMV genome copies was calculated as reported by Yanagisawa and Matsushita (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). To plot standard curves based on the cycle threshold value, a 10-fold standard dilution series of transcribed RNA (10\u003csup\u003e3\u003c/sup\u003e\u0026ndash;10\u003csup\u003e8\u003c/sup\u003e copies) was analyzed using TaqMan-RT-qPCR with the primer probe set ToMMV 5228-F/ ToMMV 5249-Pe/ToMMV 5278-R (Fowkes et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDetection sensitivity\u003c/h2\u003e \u003cp\u003eFurthermore, we tested the sensitivity of ToMMV 3027-F/ToMMV 3087-R. For this purpose, the copy number of ToMMV was estimated in total RNA extracted from ToMMV-infected tomato leaves, which was diluted to 50 ng/\u0026micro;l with RNase-free sterile water, using real-time RT-PCR and standard curves described in section \u0026ldquo;Estimation of ToMMV copy numbers\u0026rdquo;. Similarly, total RNA extracted from healthy tomato seeds and leaves was diluted to 50 ng/\u0026micro;l. Next, we made two types of a ten-fold dilution series corresponding to seed and leaf samples by further diluting the diluted RNA acquired from ToMMV-infected leaves with that acquired from healthy seeds or leaves. Two microliters (approximately 1.54\u0026times;10\u003csup\u003e8\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e copies per reaction) of each solution was used as a template for SYBR-RT-qPCR analysis conducted using ToMMV 3027-F/ToMMV 3087-R. Additionally, we compared our method with previously published methods, including a conventional RT-PCR method (ToMMV-F/ToMMV-R) and two Taqman-RT-qPCR assays (ToMMV 5228-F/ToMMV 5249-Pe/ToMMV5278-R; Fowkes et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, and ToMMV2-F/ToMMV2-P/ToMMV2-R; Schoen et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) using the same templates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of ToMMV-contaminated tomato seeds\u003c/h2\u003e \u003cp\u003eThe ToMMV-infected plants (cvs. Rejina and Carol Passion, Sakata seed) were prepared as described in Section \u0026ldquo;Preparation of virusinfected plants\u0026rsquo;\u0026rsquo; and mature tomato fruits were harvested 3\u0026ndash;8 months after inoculation. The collected seeds were submerged in 0.025% cellulase solution at room temperature (20\u0026thinsp;\u0026minus;\u0026thinsp;25 ℃) for approximately 6 h to dissolve excess pulp and were washed in a sieve with sterile distilled water for 2 min. The washed seeds were dried at room temperature (20\u0026thinsp;\u0026minus;\u0026thinsp;25 ℃) for one week and stored in a desiccator until use. Seeds collected from the different fruits were mixed to constitute one lot per cultivar. Healthy seeds were collected from the uninoculated tomato plants and treated similarly.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of ToMMV contamination level in tomato seeds\u003c/h2\u003e \u003cp\u003eTo evaluate the rate of seed contamination by ToMMV, 10 tomato seeds from each cultivar were individually used to detect ToMMV through conventional RT-PCR. We confirmed ToMMV localization in tomato seeds via direct immunostaining assay (DISA). As ToMMV-specific antibodies were not available, ELISA reagents for TMV (Agdia, Elkhart, IN, USA) that react with ToMMV were used for immunostaining to detect ToMMV in the seeds. The ToMMV-contaminated seeds were cut transversely using a razor. A piece of half seed was fixed by treating it with 4% w/v paraformaldehyde in PBS (pH 7.4) overnight at 4 ℃. After washing three times with PBS, the seeds were soaked in a blocking solution (1% w/v bovine serum albumin in PBS) at room temperature (20\u0026thinsp;\u0026minus;\u0026thinsp;25 ℃) for 2 h. The treated seeds were incubated with rabbit anti-TMV conjugate (Agdia) diluted 200 \u0026times; with blocking solution at room temperature (20\u0026thinsp;\u0026minus;\u0026thinsp;25 ℃) for 2 h. After washing three times with PBS, immunoreactive signals were visualized using BCIP-NBT (Sigma-Aldrich Co., St. Louis, MO, USA) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eConfirmation of seed transmission\u003c/h2\u003e \u003cp\u003eTo evaluate the seed transmission rate of ToMMV in tomato, 294 seeds of each cultivar were individually sown in 49-cell plug trays and grown for a week in an insect-proof glasshouse at 23\u0026thinsp;\u0026minus;\u0026thinsp;27 ℃ with natural light. Subsequently, all emerged seedlings (at the 1\u0026ndash;2-leaf stage) were transplanted into 9 cm diameter pots. Four weeks after transplanting (at the 5\u0026ndash;8-leaf stage), the uppermost leaves from each plant were used to confirm the presence of ToMMV through conventional RT-PCR analysis. Next, all viral-positive plants were transplanted into pots (diameter: 17 cm) to observe the development of viral symptoms in the growth process and further tested for infectivity via back inoculation using symptomatic leaves (refer to the section \u0026ldquo;Preparation of virusinfected plants\u0026rdquo;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDetection of ToMMV from a bulk sample of tomato seeds\u003c/h2\u003e \u003cp\u003eTo confirm the effectiveness of the newly developed detection method, we performed ToMMV detection in a bulk sample of tomato seeds. Considering that a maximum sample size of 400 tomato seeds was used for the ToMMV test in the Japanese and Australian plant quarantines (Dall et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Lovelock et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Yokohama Plant Protection Station \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), we attempted detecting a ToMMV-contaminated tomato seed in a 400-seed sample that included 399 healthy seeds, and hence, extracted total RNA from 400 seeds using the method described by Yanagisawa et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Each RNA sample was further used as a template for SYBR-RT-qPCR analysis with ToMMV 3027-F/ToMMV 3087-R, TaqMan-RT-qPCR with ToMMV 5228-F/ToMMV 5249-Pe/ToMMV5278-R or ToMMV2-F/ToMMV2-P/ToMMV2-R, and conventional RT-PCR with ToMMV-F/ToMMV-R.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eDetection specificity\u003c/h2\u003e \u003cp\u003eA new primer set (ToMMV 3027-F/ToMMV 3087-R) was designed for the specific detection of ToMMV using SYBR-RT-qPCR. The primer set almost completely matched the genome sequences of 27 ToMMV isolates, except for one base in two ToMMV isolates; less than 80% match with the genome sequences of other Solanaceae-infecting tobamoviruses was detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The specificity of this primer set was tested using RNAs extracted from ToMMV-infected and closely related tobamovirus-infected leaves. Only ToMMV-infected samples revealed positive signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The melting curve also displayed a single peak (Tm value: approximately 76.8 ℃, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Agarose gel analysis indicated an approximately 86 bp single band (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Additionally, Sanger sequencing of this amplicon revealed a 100% similarity to ToMMV DSMZ PV-1267 isolate (accession no. MW582804.1). Contrastingly, Solanaceae-infecting tobamovirus samples and the non-template control (template solution replaced with distilled water) showed no reaction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eEstimation of ToMMV copy numbers\u003c/h2\u003e \u003cp\u003eWhen carrying out Taqman-RT-qPCR with a ten-fold standard dilution series of transcribed RNA, a linear relationship between the Ct values and the log-transcribed RNA standard was obtained based on regression coefficients (R2)\u0026thinsp;\u0026gt;\u0026thinsp;0.99 and the efficiency (E) was 98.3% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe copy number of ToMMV in total RNA (50 ng/\u0026micro;l) extracted from ToMMV-infected tomato leaves was approximately 7.7\u0026times;10\u003csup\u003e8\u003c/sup\u003e copies per \u0026micro;l. Using the total RNA, a 10-fold dilution series (7.7\u0026times;10\u003csup\u003e7\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e copies per \u0026micro;l) was made to analyze the detection sensitivity described in the next subsection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eDetection sensitivity\u003c/h2\u003e \u003cp\u003eWe evaluated the detection limit of ToMMV in tomato leaves and seeds, using a 10-fold dilution series of RNA samples. SYBR-RT-qPCR with ToMMV 3027-F/ToMMV 3087-R detected up to 1.54 copies per reaction in both leaf and seed samples (Table\u0026nbsp;1). Additionally, we compared the detection sensitivity of our method with those of three previously reported methods using the same 10-fold serially diluted templates. Conventional RT-PCR with ToMMV-F/ToMMV-R detected up to 154 copies per reaction; Taqman-RT-qPCR with ToMMV 5228-F/5249-Pe/5278-R or ToMMV 2-F/ToMMV 2-P/ToMMV 2-R detected up to 15.4 or 154 copies per reaction, respectively (Table\u0026nbsp;1). Therefore, our method was 10\u0026ndash;100 times more sensitive than the previously reported ones.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of ToMMV contamination level in tomato seeds\u003c/h2\u003e \u003cp\u003eConventional RT-PCR analysis indicated that all 10 seeds collected from ToMMV-infected tomato plants were positive (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). DISA detected viral signals in the seed coat and hair of tomato seeds collected from ToMMV-infected tomato plants. Contrastingly, healthy tomato seeds exhibited no viral signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec\u0026ndash;f). However, the results did not differ between the two tested cultivars.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of seed transmission\u003c/h2\u003e \u003cp\u003eThe seed transmission rates of ToMMV in tomato cvs. Rejina and Carol Passion were 0.93% (2/215) and 0.42% (1/238), respectively. Conventional RT-PCR analysis revealed that all virus-positive seedlings exhibited viral symptoms; no asymptomatic or latent infections were detected. In cv. Rejina, both ToMMV-positive progeny seedlings showed leaf narrowing and suppressed growth compared to those in non-infected seedlings (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea\u0026ndash;c), and eventually developed severe symptoms (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e a\u0026ndash;c). In cv. Carol Passion, a ToMMV-positive progeny seedling, exhibited mottling and distortion of the leaves, inhibited growth compared to those in non-infected seedlings (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed\u0026ndash;g), followed by severe symptom development (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e d\u0026ndash;f). Additionally, back-inoculation of healthy tomato seedlings with each virus-positive progeny seedling produced typical tobamovirus-associated symptoms (data not shown).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eDetection of ToMMV from 400 tomato seeds\u003c/h2\u003e \u003cp\u003eWe evaluated whether the developed detection method could detect one ToMMV-contaminated tomato seed, which confirmed the above ToMMV contamination level, in 400 tomato seeds. In cvs. Rejina and Carol Passion, our method identified ToMMV in Ct values of 19.8\u0026ndash;23.8 and 20.0\u0026ndash;25.1 (Tm value: 76.2\u0026ndash;76.5 ℃), respectively, from 400 tomato seed samples containing only a single tomato seed naturally contaminated with ToMMV without nonspecific reactions (Table\u0026nbsp;2). In contrast, previously reported conventional RT-PCR and TaqMan-RT-qPCR methods detected ToMMV from the same tomato seed samples, but the Ct values of TaqMan-RT-qPCR methods were 0.8 to 3.2 higher than those of our SYBR-RT-qPCR method.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eToMMV has rapidly spread to many countries after its discovery in Mexico in 2009 (CABI \u003cspan class=\"CitationRef\"\u003e2021d\u003c/span\u003e; Li et al. \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). Although the rapid expansion of ToMMV outbreak areas was considered to be associated with the international seed trade involving contaminated seeds, reliable seed health tests for detecting ToMMV infection are limited. Moreover, the epidemiological aspects of ToMMV infection in seeds have not been sufficiently illustrated. Therefore, using ToMMV-contaminated seeds collected from infected tomato plants, we have developed a highly effective SYBR-RT-qPCR method to detect ToMMV in tomato seeds and assessed its effectiveness. Moreover, we clarified the features related to ToMMV seed transmission for the first time.\u003c/p\u003e\n\u003cp\u003eWe designed a new ToMMV-specific primer set (ToMMV-3027F/ToMMV-3087R) for SYBR-RT-qPCR analysis using the genome sequences of 29 ToMMV isolates (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). ToMMV-3087R exhibited a complete match with all ToMMV isolates; ToMMV-3027F contained a single base mismatch compared with two ToMMV isolates, at the 19th position from the 3\u0026rsquo; terminus. Either or both primers showed mismatches for two or more bases at the 3\u0026rsquo; terminus with Solanaceae-infecting tobamoviruses. Mismatches located in the 3\u0026rsquo; end region of a primer more significantly influence amplification efficiency than those at the 5\u0026rsquo; end. Moreover, two mismatches for five bases from the 3\u0026rsquo; primer terminus inhibit amplification (Ye et al. \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). Therefore, the effect of the abovementioned primer-template mismatches on PCR amplification could be small for ToMMV, but large for Solanaceae-infecting tobamoviruses. In fact, SYBR-RT-qPCR conducted using our primer set amplified ToMMV, except for Solanaceae-infecting tobamoviruses, and a specific melting temperature for ToMMV was observed (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Although we did not confirm nonspecific reactions in this study, the melting curve analysis was performed to determine whether the reactions are positive or negative in later cycles. Next, our SYBR-RT-qPCR assay successfully detected up to approximately 1.54 copies per reaction and exhibited 10\u0026ndash;100 times higher sensitivity than previously reported detection methods (Table\u0026nbsp;1). Additionally, our method exhibited the same detection sensitivity for leaves and seeds, which suggests its effectiveness for the diagnosis of infected plants and inspection of contaminated seeds. Therefore, our SYBR-RT-qPCR analysis exhibited high specificity and sensitivity for ToMMV and is superior to the previously reported methods.\u003c/p\u003e\n\u003cp\u003eUsing ToMMV-contaminated seeds collected from the infected tomato plants, seed-to-seedling transmission rates were 0.42% and 0.93% in tomato cvs. Carol Passion and Rejina, respectively; however, ToMMV was detected in all tested seeds (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). These seed transmission rates were lower than that (4%) indicated in the first report of ToMMV seed transmission in tomatoes (Mazumder et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). A certain level of viral load on the seed coat ensures sufficient contact between the embryo or progeny seedlings and the inner surface of the virus-containing seed coat tissue, which is crucial for efficient seed transmission of tobamoviruses (Matsushita et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). The low seed transmission rates detected in this study are potentially attributed to the low amount of ToMMV on the seeds, which thoroughly were washed to remove jelly-like plant tissues that covered the seed surface. However, Mazumder et al. (\u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e) did not describe the details of the seed collection methods; therefore, it is unclear to what extent the seed processing method contributed to the differences in these seed transmission rates. In tomato seeds, the seed transmission rates of ToBRFV belonging to the genus \u003cem\u003eTobomovirus\u003c/em\u003e were 0.08% (Salem et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e), 1.8 or 2.8% (Davino et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e), 4.6 or 5.6% (Matsushita et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e), 1.7, 4.8, or 5.0% (Kubota et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e); these reports reflect differences in seed transmission rates depending on the test methods. The transmission rate of tobamoviruses is not high, however, their consistent seed transmission can be a significant problem for new cultivation areas, and seed-transmitted seedlings could become a new source of horizontal infection (Dombrovsky and Smith \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, awareness of the risk of spreading these viruses through virus-contaminated seeds is essential.\u003c/p\u003e\n\u003cp\u003eThe transmissibility of viruses through seeds depends on the location of the virus in the seed, and virus-infected embryos maximize the seed transmission rate (Sastry \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). The DISA results in this study revealed the presence of ToMMV in the seed coat and hair but not in the embryo (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec\u0026ndash;f). Additionally, seed-to-seedling transmission rates were low, as the above describing. These results indicated the absence of ToMMV in the embryo. Interestingly, viral symptoms developed in ToMMV-positive progeny seedlings on the third or younger leaves, however, the symptoms appeared only two weeks after the sap inoculation (Figs. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and S1), suggesting that ToMMV infection occurs during or after the germination rather than before this process. Most tobamoviruses contaminate the seed coat and are absent from the embryo. Seed-to-seedling transmission of tobamoviruses occurs when the progeny seedling comes into contact with the contaminated seed coats; these viruses infect wounds that occur mainly during germination and transplanting (Dombrovsky and Smith \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e; Ishibashi et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e; Matsushita et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e; Sastry \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). Hence, this seed transmission mechanism may be associated with the ToMMV transmission. In summary, ToMMV is a seed-borne rather than seed-transmitted virus in case of tomatoes. This is the first report demonstrating similar properties of ToMMV and other tobamoviruses infecting tomatoes. This suggests the effectiveness of the seed management methods, which are used for other tobamoviruses, for managing ToMMV.\u003c/p\u003e\n\u003cp\u003eIn this study, ToMMV was transmitted from diseased seedlings grown from contaminated seeds to healthy tomato plants by sap inoculation, confirming that seed-transmitted seedlings comprise an infection source of ToMMV. Therefore, a reliable diagnostic method for detecting ToMMV can facilitate rejection of contaminated seeds in international seed trading. The reliability of the available molecular detection methods was not evaluated based on seed-to-seedling viral transmission in tomato; however, the reliability of our method was confirmed (Fowkes et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e; Schoen et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sui et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). In common, the seed sample is divided into multiple subsamples, and then actual seed health tests are carried out against each subsample using an appropriate detection method, respectively. Japanese and Australian quarantines use 400 seeds as a subsample for tomato seed inspection for tobamoviruses. Therefore, we used a subsample size of 400 seeds in this study. As the result, our newly established method could detect one ToMMV-contaminated tomato seed from 400 tomato seeds/subsample, indicating its effectiveness in actual seed inspection.\u003c/p\u003e\n\u003cp\u003eThis study provides valuable insights into ToMMV detection, which, along with the novel detection method, can help prevent the spread of ToMMV. In this study, we used only tomatoes; however, ToMMV has also been detected in pepper seeds. However, we could not analyze pepper plants in this study because the ToMMV-inoculated plants were severely symptomatic, leading to insufficient seed availability and limiting further assays. Therefore, we attempted to obtain contaminated seeds from ToMMV-infected pepper plants. Further studies are required to further verify the applicability of this novel method and to assess seed transmissibility of the virus in pepper.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo funding was received for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article does not contain any studies involving human participants or animals performed by any author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlkowni R, Alabdallah O, Fadda Z (2019) Molecular identification of tomato brown rugose fruit virus in tomato in Palestine. J Plant Pathol 101:719\u0026ndash;723. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42161-019-00240-7\u003c/span\u003e\u003cspan address=\"10.1007/s42161-019-00240-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmbr\u0026oacute;s S, Mart\u0026iacute;nez F, Ivars P, Hern\u0026aacute;ndez C, de la Iglesia F, Elena SF (2017) Molecular and biological characterization of an isolate of Tomato mottle mosaic virus (ToMMV) infecting tomato and other experimental hosts in eastern Spain. Eur J Plant Pathol 149:261\u0026ndash;268. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10658-017-1180-2\u003c/span\u003e\u003cspan address=\"10.1007/s10658-017-1180-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2020) Tomato brown rugose fruit virus (Tomato brown rugose fruit virus). CABI compendium. Accessed 30 Jan 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/cabicompendium.88757522\u003c/span\u003e\u003cspan address=\"10.1079/cabicompendium.88757522\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2021a) Pepper mild mottle virus (PMMV). CABI compendium. Accessed 30 Jan 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/cabicompendium.43826\u003c/span\u003e\u003cspan address=\"10.1079/cabicompendium.43826\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2021b) Tobacco mild green mosaic virus. CABI compendium. Tobacco mosaic virus (tobacco mosaic) | CABI Compendium. Accessed 30 Jan 2025\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2021c) Tobacco mosaic virus (tobacco mosaic). CABI compendium. Accessed 30 Jan 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/cabicompendium.88757522\u003c/span\u003e\u003cspan address=\"10.1079/cabicompendium.88757522\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2021d) Tomato mottle mosaic virus. CABI compendium. Accessed 30 Jan 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/cabicompendium.121740\u003c/span\u003e\u003cspan address=\"10.1079/cabicompendium.121740\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCABI (2021e) Tomato mosaic virus (tomato mosaic). CABI compendium. Accessed 30 Jan 2025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1079/cabicompendium.54063\u003c/span\u003e\u003cspan address=\"10.1079/cabicompendium.54063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChanda B, Gilliard A, Jaiswal N, Ling KS (2021) Comparative analysis of host range, ability to infect tomato cultivars with Tm-22 gene, and Real-Time Reverse Transcription PCR detection of tomato brown rugose fruit virus. Plant Dis 105:3643\u0026ndash;3652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-05-20-1070-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-05-20-1070-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDall DJ, Lovelock DA, Penrose LDJ, Constable FE (2023) Prevalences of Tobamovirus contamination in seed lots of tomato and Capsicum. Viruses 15:883. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v15040883\u003c/span\u003e\u003cspan address=\"10.3390/v15040883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavino S, Caruso AG, Bertacca S, Barone S, Panno S (2020) Tomato brown rugose fruit virus: seed transmission rate and efficacy of different seed disinfection treatments. Plants (Basel) 9:1615. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants9111615\u003c/span\u003e\u003cspan address=\"10.3390/plants9111615\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: Version II. Plant Mol Biol Rep 1:19\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02712670\u003c/span\u003e\u003cspan address=\"10.1007/BF02712670\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDombrovsky A, Smith E (2017) Seed transmission of tobamoviruses: aspects of global disease distribution. In: Jimenez-Lopez JC (ed) Advances in seed biology. IntechOpen, London, UK, pp 233\u0026ndash;260. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/intechopen.70244\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.70244\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEPPO (2022) Pest Risk Analysis for \u003cem\u003eTomato mottle mosaic virus\u003c/em\u003e (Tobamovirus). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://gd.eppo.int/download/doc/1550_pra_exp_TOMMV0.pdf\u003c/span\u003e\u003cspan address=\"https://gd.eppo.int/download/doc/1550_pra_exp_TOMMV0.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFowkes AR, Botermans M, Frew L, de Koning PPM, Buxton-Kirk A, Westenberg M, Ward R, Schenk MF, Webster G, Alraiss K, Harju V, Skelton A, Conyers C, Barrett B, Adams IP, McGreig S, Fox A, Vazquez-Iglesias I (2022) First report of Tomato mottle mosaic virus in Solanum lycopersicum seeds in the Netherlands and intercepted in seed imported from Asia. New Dis Rep 45:e12067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ndr2.12067\u003c/span\u003e\u003cspan address=\"10.1002/ndr2.12067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamada H, Takeuchi S, Morita Y, Sawada H, Kiba A, Hikichi Y (2003) Characterization of \u003cem\u003ePaprika mild mottle virus\u003c/em\u003e first isolated in Japan. J Gen Plant Pathol 69:199\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-002-0028-5\u003c/span\u003e\u003cspan address=\"10.1007/s10327-002-0028-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshibashi K, Kubota K, Kano A, Ishikawa M (2023) Tobamoviruses: old and new threats to tomato cultivation. J Gen Plant Pathol 89:305\u0026ndash;321. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-023-01141-5\u003c/span\u003e\u003cspan address=\"10.1007/s10327-023-01141-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKon T, Sato C, Fuji SI (2024) Molecular characterization and host reaction to tomato mottle mosaic virus isolated from sweet pepper seeds in Japan. Arch Virol 169:113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00705-024-06035-1\u003c/span\u003e\u003cspan address=\"10.1007/s00705-024-06035-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKubota K, Takeyama S, Matsushita Y, Tomitaka Y, Matsuyama M, Ishibashi K, Shinosaka H, Ohsaki K (2023) Evaluation of control measures against tomato brown rugose fruit virus: disinfestation of equipment and seeds and use of attenuated strain of tomato mosaic virus (in Japanese with English abstract). Jpn J Phytopathol 89:235\u0026ndash;244. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3186/jjphytopath.89.235\u003c/span\u003e\u003cspan address=\"10.3186/jjphytopath.89.235\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKubota K, Usugi T, Tomitaka Y, Matsushita Y, Higashiyama M, Kosaka Y, Tsuda S (2012) Characterization of Rehmannia mosaic virus isolated from chili pepper (Capsicum annuum) in Japan. J Gen Plant Pathol 78:43\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-011-0345-7\u003c/span\u003e\u003cspan address=\"10.1007/s10327-011-0345-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar R, Gupta A (2020) Seed-borne diseases of agricultural crops: detection, diagnosis \u0026amp; management. Springer, Singapore\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947\u0026ndash;2948. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btm404\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btm404\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi R, Gao S, Fei Z, Ling K-S (2013) Complete genome sequence of a new tobamovirus naturally infecting tomatoes in Mexico. Genome Announc 1:e00794\u0026ndash;e00713. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/genomeA.00794-13\u003c/span\u003e\u003cspan address=\"10.1128/genomeA.00794-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Wang Y, Hu J, Xiao L, Tan G, Lan P, Liu Y, Li F (2017) The complete genome sequence, occurrence and host range of Tomato mottle mosaic virus Chinese isolate. Virol J 14:15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12985-016-0676-2\u003c/span\u003e\u003cspan address=\"10.1186/s12985-016-0676-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi YY, Wang CL, Xiang D, Li RH, Liu Y, Li F (2014) First Report of Tomato mottle mosaic virus Infection of Pepper in China. Plant Dis 98:1447. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-03-14-0317-PDN\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-03-14-0317-PDN\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLovelock DA, Kinoti WM, Bottcher C, Wildman O, Dall D, Rodoni BC, Constable FE (2020) Tomato mottle mosaic virus intercepted by Australian biosecurity in Capsicum annuum seed. Australas Plant Dis Notes 15:8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13314-020-0378-x\u003c/span\u003e\u003cspan address=\"10.1007/s13314-020-0378-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuria N, Smith E, Reingold V, Bekelman I, Lapidot M, Levin I, Elad N, Tam Y, Sela N, Abu-Ras A, Ezra N, Haberman A, Yitzhak L, Lachman O, Dombrovsky A (2017) A new Israeli Tobamovirus isolate infects tomato plants harboring Tm-22 resistance genes. PLoS ONE 12:e0170429. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0170429\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0170429\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsushita Y, Takeyama S, Tomitaka Y, Matsuyama M, Ishibashi K, Shinosaka H, Osaki K, Kubota K (2024) Elucidating the nature of seed-borne transmission of tomato brown rugose fruit virus in tomato, bell pepper, and eggplant. J Gen Plant Pathol 90:23\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-023-01159-9\u003c/span\u003e\u003cspan address=\"10.1007/s10327-023-01159-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazumder P, Mondal F, Sarkar M, Majumdar A, Biswas KK, Sharma SK, Lal MK, Tiwari RK, Kumar R, Roy A (2024) Biological and molecular characterization of a new isolate of tomato mottle mosaic virus causing severe shoestring and fruit deformities in tomato plants in India. Plants (Basel) 13:2811. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants13192811\u003c/span\u003e\u003cspan address=\"10.3390/plants13192811\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagai A, Duarte LML, Chaves ALR, Peres LEP, dos Santos DYAC (2019) Tomato mottle mosaic virus in Brazil and its relationship with Tm-2\u003csup\u003e2\u003c/sup\u003e gene. Eur J Plant Pathol 155:353\u0026ndash;359. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10658-019-01762-7\u003c/span\u003e\u003cspan address=\"10.1007/s10658-019-01762-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOta E, Shinosaka H, Ishibashi K, Takeyama S, Matsuyama M, Tomitaka Y, Matsushita Y, Osaki K, Kubota K (2025) Development and evaluation of a SYBR Green-based RT-qPCR assay with a specific primer set for tomato seed testing against tomato brown rugose fruit virus. J Gen Plant Pathol 91:160\u0026ndash;170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-025-01222-7\u003c/span\u003e\u003cspan address=\"10.1007/s10327-025-01222-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalem NM, Sulaiman A, Samarah N, Turina M, Vallino M (2022) Localization and mechanical transmission of tomato brown rugose fruit virus in tomato seeds. Plant Dis 106:275\u0026ndash;281. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-11-20-2413-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-11-20-2413-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSastry KS (2013) Data. In: Seed-borne plant virus diseases. Springer, New Delhi. ISBN: 978-81-322-0812-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchoen R, de Koning P, Oplaat C, Roenhorst A, Westenberg M, van der Gaag DJ, Barnhoorn R, Koenraadt H, van Dooijeweert W, Lievers R, Woudt B, Tavares CP, Botermans M (2023) Identification of tomato mottle mosaic virus in historic seed accessions originating from France, the Netherlands and Spain, indicates a wider presence before its first description. Eur J Plant Pathol 166:485\u0026ndash;489. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10658-023-02677-0\u003c/span\u003e\u003cspan address=\"10.1007/s10658-023-02677-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSui X, Zheng Y, Li R, Padmanabhan C, Tian T, Groth-Helms D, Keinath AP, Fei Z, Wu Z, Ling KS (2017) Molecular and biological characterization of Tomato mottle mosaic virus and development of RT-PCR detection. Plant Dis 101:704\u0026ndash;711. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-10-16-1504-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-10-16-1504-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeuchi S, Hamada H, Toyoda K, Suzuki K, Kiba A, Hikichi Y, Okuno T (2005) Discrimination between tobamoviruses and their pathotypes for L-gene-mediated resistance in green pepper (Capsicum annuum L.) by reverse transcription-polymerase chain reaction. J Gen Plant Pathol 71:60\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10327-004-0161-4\u003c/span\u003e\u003cspan address=\"10.1007/s10327-004-0161-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu L, Wu S, Gao D, Liu Y, Zhu Y, Ji Y (2021) Synthesis and characterization of a full-length infectious cDNA clone of tomato mottle mosaic virus. Viruses 13:1050. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v13061050\u003c/span\u003e\u003cspan address=\"10.3390/v13061050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatzinger F, Ebner K, Lion T (2006) Detection and monitoring of virus infections by real-time PCR. Mol Aspects Med 27:254\u0026ndash;298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mam.2005.12.001\u003c/span\u003e\u003cspan address=\"10.1016/j.mam.2005.12.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanagisawa H, Matsushita Y (2022) Effect of potato spindle tuber viroid variants and infection stage on seed transmission through pollen. Lett Appl Microbiol 75:836\u0026ndash;843. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/lam.13756\u003c/span\u003e\u003cspan address=\"10.1111/lam.13756\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanagisawa H, Tsutsumi N, Ishii K, Shiki Y, Kurihara K (2012) Modification on Detection method of Potato spindle tuber viroid using RT-LAMP. Res Bull Plant Protect Jpn 48:7\u0026ndash;12 (in Japanese with English abstract). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.maff.go.jp/pps/j/guidance/r_bulletin/pdf/rb048_002.pdf\u003c/span\u003e\u003cspan address=\"https://www.maff.go.jp/pps/j/guidance/r_bulletin/pdf/rb048_002.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform 13:134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2105-13-134\u003c/span\u003e\u003cspan address=\"10.1186/1471-2105-13-134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokohama Plant Protection Station (2021) Pest risk analysis for \u003cem\u003eTomato mottle mosaic virus\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.maff.go.jp/j/syouan/keneki/kikaku/attach/pdf/pra_table1-1.pdf\u003c/span\u003e\u003cspan address=\"https://www.maff.go.jp/j/syouan/keneki/kikaku/attach/pdf/pra_table1-1.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (in Japanese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou WP, Li YY, Li F, Tan GL (2021) First report of natural infection of tomato by pepper mild mottle virus in China. J Plant Pathol 103:363. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42161-020-00688-y\u003c/span\u003e\u003cspan address=\"10.1007/s42161-020-00688-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 and 2 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-general-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jgpp","sideBox":"Learn more about [Journal of General Plant Pathology](http://link.springer.com/journal/10327)","snPcode":"10327","submissionUrl":"https://www.editorialmanager.com/jgpp/default2.aspx","title":"Journal of General Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ToMMV, Tobamovirus, Seed transmission, SYBR Green, RT-qPCR, Tomato","lastPublishedDoi":"10.21203/rs.3.rs-6806693/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6806693/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTomato mottle mosaic virus (ToMMV), first reported in Mexico in 2009, is an emerging virus that globally threatens the yield of crops belonging to the family Solanaceae. The international trade of ToMMV-contaminated seeds is potentially associated with its global spread; however, the epidemiological features of virus-contaminated seeds remain unclear, and the availability of effective seed assays to detect ToMMV is limited. Therefore, we have developed a SYBR Green-based real-time RT-PCR (SYBR-RT-qPCR) for ToMMV detection, which supports the detection of ToMMV with 10\u0026ndash;100 times improved sensitivity compared to available methods; up to 1.54 copies were detected while the common Solanaceae-infecting tobamoviruses were not amplified. Additionally, virus-contaminated seeds were obtained from two cultivars of ToMMV-infected tomato plants. A direct immunostaining assay revealed the presence of ToMMV in the seed coat and hair of both cultivars. Although ToMMV was detected in all tested seeds, seed-to-seedling ToMMV transmission rates were only 0.42% and 0.93% in tomato cvs. Carol Passion and Rejina, respectively. Using these seed lots harboring seed-to-seedling-transmissible ToMMV, we confirmed the efficacy of this SYBR-RT-qPCR method for detecting ToMMV in a bulk sample (n\u0026thinsp;=\u0026thinsp;400, including one ToMMV-contaminated seed). Therefore, our detection method is effective in actual seed inspection. This is the first report of a practical ToMMV-specific seed inspection assay based on SYBR-RT-qPCR; moreover, crucial properties related to the seed transmission of ToMMV have been revealed. The insights and testing methods reported in this study could help prevent the spread of ToMMV through virus-contaminated seeds.\u003c/p\u003e","manuscriptTitle":"Development of a SYBR Green-based real-time RT-PCR method using a newly designed tomato mottle mosaic virus-specific primer set and the assessment of its seed transmission properties in tomato seeds.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-06 15:17:04","doi":"10.21203/rs.3.rs-6806693/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-06-05T06:02:11+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-03T23:10:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-03T09:10:10+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of General Plant Pathology","date":"2025-06-03T00:05:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-general-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jgpp","sideBox":"Learn more about [Journal of General Plant Pathology](http://link.springer.com/journal/10327)","snPcode":"10327","submissionUrl":"https://www.editorialmanager.com/jgpp/default2.aspx","title":"Journal of General Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"78b0e11a-384b-4141-b101-5c462935675a","owner":[],"postedDate":"June 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-17T16:03:47+00:00","versionOfRecord":{"articleIdentity":"rs-6806693","link":"https://doi.org/10.1007/s10327-025-01263-y","journal":{"identity":"journal-of-general-plant-pathology","isVorOnly":false,"title":"Journal of General Plant Pathology"},"publishedOn":"2025-11-10 15:58:37","publishedOnDateReadable":"November 10th, 2025"},"versionCreatedAt":"2025-06-06 15:17:04","video":"","vorDoi":"10.1007/s10327-025-01263-y","vorDoiUrl":"https://doi.org/10.1007/s10327-025-01263-y","workflowStages":[]},"version":"v1","identity":"rs-6806693","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6806693","identity":"rs-6806693","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}