An embryonic artery-forming niche reactivates in pulmonary arterial hypertension

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 120,437 characters · extracted from preprint-html · click to expand
An embryonic artery-forming niche reactivates in pulmonary arterial hypertension | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results An embryonic artery-forming niche reactivates in pulmonary arterial hypertension Wen Tian , Timothy Ting-Hsuan Wu , Shenbiao Gu , Jason L. Chang , Cerianne Huang , Ryan Vinh , View ORCID Profile Adam M. Andruska , Kyle K. Song , Dongeon Kim , Yu Zhu , Seunghee Lee , Junliang Pan , Peter N. Kao , Tushar Desai , Lawrence S. Prince , Lindsay D. Butcher , Xinguo Jiang , Marlene Rabinovitch , Kristy Red-Horse , Mark R. Nicolls doi: https://doi.org/10.1101/2025.05.02.651303 Wen Tian Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Timothy Ting-Hsuan Wu Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shenbiao Gu Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jason L. Chang Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Cerianne Huang Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ryan Vinh Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Adam M. Andruska Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Adam M. Andruska Kyle K. Song Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dongeon Kim Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yu Zhu Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Seunghee Lee Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Junliang Pan Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Peter N. Kao Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tushar Desai Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lawrence S. Prince Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lindsay D. Butcher Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Xinguo Jiang Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Marlene Rabinovitch Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kristy Red-Horse Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mark R. Nicolls Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: mnicolls{at}stanford.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Developmental mechanisms that precisely orchestrate cell fate and tissue architecture in organogenesis can be aberrantly reactivated to cause disease. Here we identify a previously uncharacterized population of endothelial niche cells, defined by the pioneer factor early B cell factor 1 (EBF1), that promotes both the development and pathological remodeling of pulmonary arteries (PAs). We show in the embryonic lung that the PA arises from an endothelial niche harbored within the vascular plexus, regulating Aplnr + progenitors that differentiate into arterial endothelial cells (ECs) and Ebf1 + ECs. Instead of directly incorporating into the PA endothelium, these Ebf1 + ECs secrete vasculotrophic signals that organize the proper expansion and arterialization of plexus progenitors with the recruitment of the mesenchymal cells that muscularize and ensheathe the maturing PA. Although essential in development, most Ebf1 + ECs disappear by completion of PA morphogenesis. In adult PAH, the embryonic artery-forming niche is reactivated. The normally quiescent Aplnr + general capillary stem cells re-enter the cell cycle and regenerate arterial ECs and Ebf1 + ECs. By expressing key vasculotrophic signals including Apelin, Cxcl12/Cxcr4, Notch, and Tgf-β, these Ebf1 + ECs promote angiogenesis, neo- arterialization, and neo-muscularization in a maladaptive process echoing their role in development. Our findings define a novel developmental mechanism featuring unusually transient PA organizing cells. We suggest their reemergence in adulthood drives vascular pathology and that targeting these Ebf1 + ECs could halt or reverse PAH. Main The pulmonary arteries (PA) of the mammalian lung have evolved to balance two seemingly opposing physiological demands: transporting the entire cardiac output for gas exchange while maintaining low resistance and pressure to protect the fragile alveolar capillaries 1 . To achieve the required high vascular capacitance, the PA rapidly bifurcates into right and left main arteries, which further branch into small-caliber arteries and highly distensible pre-capillary arterioles, composed of a single layer of endothelium (the intima), ensheathed by smooth muscle cells and an outer adventitial layer 2 . While the most proximal segments of the pulmonary trunk are derived from cardiac progenitors 3 , 4 , the cellular origins and source of signals that control the expansion, branching, and maturation of the distal PA remain incompletely understood. The delicate structure of distal PAs also renders them highly susceptible to injury-induced pathology, most notably in pulmonary hypertension (PH), a disease afflicting nearly 80 million people worldwide 5 . Pulmonary arterial hypertension (PAH) is the most lethal and accelerated form of PH, where lumen-occluding lesions, known as neointima, emerge in the pulmonary arterioles alongside smooth muscle hypertrophy and adventitial fibrosis 5 . Together, these vascular changes lead to obstructed blood flow, elevated pulmonary vascular resistance and, ultimately, right heart failure and death 6 , 7 . Despite decades of progress on PAH disease mechanims 8 – 12 , including the landmark discovery of pathogenic BMPR2 mutations 13 , the disease remains incurable with nearly 40% patients dying within five years of diagnosis. To design better therapies that address the underlying vascular pathology, a better understanding of the cellular origins, gene programs, and molecular signals that initiate, sustain, and propagate PA transformation is required. Here, we draw insights from PA development to redefine PAH pathogenesis. Integrating single- cell RNA sequencing (scRNA-seq), lineage tracing, and genetic perturbation experiments, we show that the PA originates from a specialized embryonic niche defined by Ebf1 + ECs within the developing vascular plexus of the lung. Through coordinated expression of vasculotrophic signals, these Ebf1 + niche ECs organize their neighboring plexus and stromal progenitors to establish the layered architecture of the PA. Although critical in development, most Ebf1 + niche ECs disappear upon completion of PA morphogenesis. Notably, we find that this embryonic artery-forming niche reactivates in PAH, with Ebf1 + ECs reemerging to promote angiogenesis, neo-arterialization, and neo-muscularization through a maladaptive vascular remodeling process that recapitulates development. Our findings identify EBF1 as a master regulator of an embryonic niche that orchestrates PA morphogenesis and, when aberrantly reactivated, can drive pathogenic PA remodeling in PAH. PAH neointima features a novel population of EBF1-expressing endothelial cells To investigate the nature of the pathological vessel-occluding cells that accumulate beneath the endothelial monolayer (“neointima”) in PAH, we performed single-cell transcriptional (scRNA- seq) profiling in our previously described rat model of genetic PAH ( Extended Data Fig. 1a ) 14 . In this model, lung inflammation by 5-LO instillation elicits severe vascular remodeling and neointimal formation exclusively in animals harboring heterozygous mutations of Bmpr2 (encoding Bone morphogenetic protein receptor type 2, the most common causal mutations in PAH 15 , 16 ). Using established protocols from mouse and human lung atlases 17 – 19 , we dissociated rat lungs from three experimental groups (wildtype, heterozygous silent-carriers, and PAH) and profiled vascular endothelial (CD45 - CD31 + ) and stromal (CD45 - CD31 - CD326 - ) cells ( Fig. 1a , scheme). Markers conserved between human and mouse 19 were used to identify the homologous molecular cell types of the rat pulmonary vasculature. A total of 23,075 cells with high quality transcriptomes were captured across all three conditions (11,648 cells from WT, 6,560 from silent- carriers, and 4,867 from PAH). We identified all major canonical EC and stromal subtypes, including artery, vein, general capillary (gCap) 20 , capillary aerocyte (aCap) 20 , lymphatic (Lymp), airway/vascular smooth muscle cells (ASM/VSM), pericytes (Peri), adventitial/alveolar fibroblasts (AdvF/AlvF), and proliferative fibroblasts (Fib-p) ( Fig. 1b-c , Extended Data Fig. 1b - c , and Supplementary Tables 1 - 2 ). Download figure Open in new tab Fig. 1 PAH neointima features a novel population of EBF1-expressing ECs. a, Scheme of the scRNA-seq workflow. Lung endothelial (CD31 + ), stromal (Epcam - CD31 - CD45 - ), epithelial (Epcam + ), and immune (CD45 + ) populations were enriched by FACS from healthy wildtype (WT), heterozygous control ( Bmpr2 +/- mutant), or PAH ( Bmpr2 +/- mutant with intratracheal instillation of AdAlox5) rats in a previously published animal model of PAH 14 . N=3 per animal group. The endothelial and stromal factions were submitted for scRNA-seq. b, Uniform manifold approximation and projection (UMAP) projection of annotated molecular clusters of profiled endothelial and stromal cells from all conditions. Abbreviations: Art, artery; aCap, capillary aerocyte; gCap, general capillary; EC, endothelial cell; Lym, lymphatic endothelial; ASM, airway smooth muscle; VSM, vascular smooth muscle; Peri, pericyte; AdvF, adventitial fibroblast; AlvF, alveolar fibroblast. c, Representative marker genes for each cluster visualized by dot plot, showing the fraction of expressing cells and mean expression (among expressing cells). Note novel PAH-associated cell types and their markers highlighted in red. d, Hierarchical tree showing rat lung vascular cell types and their annotated in the indicated tissue compartments. The number below the cell type name shows the total abundance of the cell type, and the stacked bar plot indicates, for each cell type, the relative abundance detected from each condition of WT, heterozygous control, or PAH rats. Black are canonical cell types per healthy reference human and mouse lung cell atlas, and red are cell types that are exclusively (100%) detected in PAH. Cell types in which a proliferative population was detected is indicated by the suffix (-p). e , Relative abundance of all the molecularly distinct cell types that were detected in PAH samples. f and g, Immunofluorescent staining of lung sections from heterozygous control or PAH rats. Protein markers shown: smooth muscle actin (SMA) for the arterial tunica media ; CD31 for endothelium, EBF1, and nuclear antigen DAPI. Yellow dotted lines outline the vessel wall and EBF1 + cells. 3D surface renderings were computed using Imaris. Note in PAH only, EBF1 + cells localizing to the sub-endothelial (“neointimal”) layer, with co-expression of CD31 antigen, with adjacent expression of SMA. h and i, Immunofluorescent staining combined with single molecule fluorescent in situ hybridization (smFISH) of human lung sections from healthy control or PAH patients. Markers shown: EBF1 (pink, RNA), endothelial marker CLDN5 (white, RNA), smooth muscle marker ACTA2 (green, RNA), smooth muscle antigen SMA (red, protein); endothelial antigen CD31 (yellow, protein), and nuclear antigen DAPI. h’ , perivascular EBF1 + cell, likely pericyte. h’’ , intimal CLDN5 + ECs and neighboring Acta2 + VSMs. White dotted lines highlight neointimal lesions in PAH. Inset shows split channel view of an occlusive neointimal lesion with co-expression of CD31 and SMA antigens, composed of 4 EBF1 + ECs ( EBF1 + CLDN5 + ACTA2 - , noted by asterisks). Although most cell types were recovered across all conditions, just three populations – all of which were endothelial – were found exclusively in PAH lungs, including a proliferative state of gCap cells (gCap-p) and two previously unreported EC clusters ( Fig. 1c-e and Supplementary Table 2 ). One minor cluster (0.8% of all PAH cells, referred to as Dll4 + arterial-like ECs) expressed the Notch ligand Dll4 alongside arterial markers ( Gja5 , Cxcr4 ) 21 . The other, a major cluster (4.9% of PAH cells, referred to as Ebf1 + ECs), did not resemble any known EC subtype and instead expressed mesenchymal genes ( Col18a1 , Vim ) 22 , 23 , the motility-regulating atypical T-cadherin ( Cdh13 ) 24 , and Ebf1 , a pioneer transcription factor 25 – 28 . Among PAH-specific populations, Ebf1 + ECs were the most abundant and transcriptionally distinct from canonical ECs ( Extended Data Fig. 1d). To localize Ebf1 + ECs in PAH lungs, we performed immunostaining and single-molecule fluorescent in situ hybridization (smFISH). While absent from the control PA endothelium ( Fig. 1f ), Ebf1 + ECs ( Cldn5 + Ebf1 + ) were prominently featured within the neointima (CD31 + SMA + ) of occlusive arterioles in PAH lungs ( Fig. 1g and Extended Data Fig. 2). We next assessed whether EBF1-expressing ECs are present in human PAH. We reanalyzed publicly available scRNA-seq datasets from human PAH lungs 29 and found that EBF1 + ECs were uniquely associated with PAH ( Extended Data Fig. 3a-d). Immunostaining and smFISH on precision-cut human lung sections from control donors and PAH patients with BMPR2 mutations confirmed that EBF1 + ECs ( CLDN5 + EBF1 + ) are absent from control PAs but prominently localized in the neointima of PAH lungs, as we had observed in our rat model ( Fig. 1h-i and Extended Data Fig. 3e ). To test whether EBF1 is sufficient to drive the neointimal endothelial phenotype it marks, we transduced human pulmonary arterial endothelial cells (hPAECs) with adenovirus encoding EBF1 (Ad EBF1 ). Overexpression of EBF1 induced a dramatic transition from a typical cobblestone-like endothelial morphology to a spindle-shaped, fibroblast-like one ( Extended Data Fig. 4a). RNA- seq analysis of EBF1- overexpressing hPAECs revealed 8,060 differentially expressed genes (DEGs), including upregulation of ECM components ( COL2A1 , COL6A3 , COL15A1, ELN , MMP25, MMP28 ) 30 , 31 , the fibroblast marker PDGFRA 32 , and downregulation of endothelial tight- junction protein CLDN5 ( Extended Data Fig. 4b and Supplementary Table 3 ), mirroring the mesenchymal signature of Ebf1 + ECs in rat PAH. Chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) of EBF1 in transformed hPAECs ( Supplementary Table 4 ) identified direct EBF1 binding at the promoter or gene body of 2,571 of these DEGs (31.9%, Fisher’s exact test, p = 2.3e-45, Extended Data Fig. 4c-e and Supplementary Table 5 ), indicating that EBF1 can directly drive their transcription. Notably, the EBF1-induced gene set showed striking overlap (81 genes) with those that defined Ebf1 + neointimal cells in our PAH model (Fisher’s exact test, p = 3.40e-08). Together, these results identify Ebf1 + ECs as a novel neointimal population in PAH and suggest that EBF1 is sufficient to drive this pathogenic endothelial phenotype. A differentiation trajectory of gCap stem cells reveals neo-arterialization and EBF1 programs in PAH Our scRNA-seq dataset provided comprehensive coverage of ECs yet detected no Ebf1 + ECs in either the wildtype or silent-carrier rats. Moreover, we found no evidence of active proliferation in Ebf1 + cells within PAH lungs, arguing against the expansion of a pre-existing Ebf1 + EC subset as precursors to neointimal cells. Instead, we found a distinct population of Aplnr + (encoding Apelin receptor APJ)-expressing gCap cells that proliferate exclusively in PAH lungs. As gCap cells have been shown to function as capillary endothelial stem cells 20 , 33 , 34 , we wondered if they could be the precursors to PAH neointimal cells. To test this hypothesis, we examined pairwise transitions between endothelial clusters in PAH lungs and reconstructed the gene expression program underlying neointimal transformation. The resulting lineage graph positioned gCap cells at the root and revealed two novel fate trajectories, in addition to their known differentiation into capillary aerocytes 20 . One trajectory connected gCap cells to the Dll4 + arterial-like ECs, while the other led to neointimal Ebf1 + ECs ( Fig. 2a-d ), suggesting that gCap cells are the source of both pathological EC populations found in PAH. Download figure Open in new tab Fig. 2 A differentiation trajectory from gCap cells reveals neo-arterialization and Ebf1 programs in PAH. a, UMAP plot overlaid by lineage graph of cells from neointimal-enriched cluster (see Extended Data Fig. 1) from rat PAH lungs with single cells colored by annotated cell type, lineage graph nodes are sub-cluster centroids with size scaled by number of cells, and the edge are scaled by interaction strength between the clusters (see methods). b, UMAP plot (as in panel a) overlaid by pseudotime progression visualizing bifurcating differentiation from gCap cells to either Dll4 + arterial-like ECs (lineage 1, ‘neo-arterialization program’) or to Ebf1 + ECs (lineage 2, ‘Ebf1 program’). Arrows are the corresponding principal curves computed by slingshot, and the cells included in each of the lineages are colored by their pseudotime value, scaled from 0-1. c-d, UMAP plot (as in panel a) showing marker gene expression in units of ln (UMIs per 10,000). e, Ebf1 gene expression plotted against developmental pseudotime for cells in the Ebf1 lineage (blue) or neo-arterialization lineage (red), same as those visualized in panel b; gray shading indicates a 95% confidence interval. f-g, Loess-regression smoothened gene expression profiles of cells in the Ebf1 lineage (blue) or neo-arterialization lineage (red) plotted against developmental pseudotime, as in panel e; differentially expression genes with statistically significant association with pseudotime, as computed by tradeseq. h - i , Chord diagrams visualizing inferred endothelial- originating signaling interactions between the molecular cell types of the rat pulmonary vasculature. The width of each connection corresponds to the relative strength of the interaction inferred by cellchat. Differential gene expression analysis identified 248 changing genes as gCap cells transitioned into arterial-like cells, defining a “neo-arterialization program” ( Fig. 2e-f and Supplementary Table 6 ). This program included key arterial markers ( Gja4 /CX37, Gja5 /CX40, both markers of pre- arterial ECs 35 ), along with Cxcr4 (critical regulator of arterial morphogenesis 36 ) and Dll4 (a Notch ligand essential for arterial specification 37 ). Similarly, the 120 DEGs in gCap-differentiation-into- Ebf1 + EC defined an “Ebf1 program” ( Fig. 2g and Supplementary Table 6 ). Despite retaining core EC markers ( Pecam1 , Cdh5 ), these transitioning cells downregulated a key endothelial barrier component ( Cldn5 ) and the gCap identity marker ( Car4 ) 20 . The majority of upregulated DEGs, alongside Ebf1 , involved ECM synthesis and remodeling ( Col18a1 , Fn1 ) 30 , 31 , cell adhesion and migration ( Tm4sf1, S100a4, Fblim1, Pdlim4 ) 38 – 43 , and angiogenesis ( Ptn, Jag2, Cxcl12 ) 44 – 47 . This EBF1-mediated transcriptional program closely resembles the previously-described partial endothelial-to-mesenchymal transition (pEndoMT 48 – 51 ) program, akin to the hybrid endothelial- mesenchymal phenotype observed in human PAH neointima 14 , 52 , 53 . Ebf1 + ECs are a rich endothelial source of developmental vasculotrophic signals in PAH A global receptor-ligand analysis of all profiled endothelial and stromal cells in PAH lungs revealed Ebf1 + ECs as a particularly rich endothelial source of vascular developmental signals 54 ( Fig. 2h-i and Supplementary Table 7 ). Specifically, Ebf1 + ECs expressed Apln (Apelin), a secreted peptide ligand that marks sprouting ECs 55 , 56 and regulates their migration and angiogenesis 57 . This suggests that Ebf1 + ECs could signal to Aplnr -expressing gCap cells to promote their proliferation and migration towards occluded arterioles and into the neointima. In addition, Ebf1 + EC expressed Cxcl12 , which could signal to Cxcr4 -expressing Dll4 + arterial-like ECs, reactivating a key migratory pathway in arterial morphogenesis 36 . Ebf1 + ECs also expressed Notch ligands Jag1 and Jag2 , which could mediate bidirectional Notch interactions with the Dll4 + arterial-like ECs, a critical pathway for arterial differentiation 21 , 37 . Beyond influencing the vascular endothelium, Ebf1 + ECs can also regulate the surrounding stroma through expression of ECM synthesis and remodeling gene pathways, including laminin signaling 58 . They also expressed classical pro-stromal Tgfβ ligands ( Tgfb1 , Tgfb2 ) 59 – 61 , semaphorin ligands ( Sema3f , Sema4c , Sema6b , Sema6d ) 62 – 64 , and prostaglandin synthesis enzymes ( Pge2 , Ptges3 ) 65 , 66 , suggesting a role of these Ebf1 + ECs in the direct recruitment and activation of fibroblasts and smooth muscle cells. These findings collectively suggest that in adult PAH, gCap cells acquire stem-like properties and differentiate into Dll4 + arterial-like cells or Ebf1 + ECs. These latter cells reside in the neointima, expressing developmental signals that can drive the proliferation of gCap cells, promote their neo- arterialization, and recruit stromal cells to neo-muscularize, thereby organizing the complex vascular remodeling in PAH. We refer to these EBF1-driven activities as “vasculotrophic” to reflect their broad signaling range across vascular layers. EBF1 + and arterial EC populations arise from Aplnr + multipotent progenitors in the lung plexus Our molecular analysis of PAH suggested that Aplnr + gCap cells can reprogram into Ebf1 + ECs, which coordinate the reactivation of key vasculotrophic signals known to be deployed during vascular development 54 . To explore whether PAH reflects a maladaptive recapitulation of normal vascular development, we closely examined the molecular and cellular programs governing PA morphogenesis in the embryonic mouse lung. During embryogenesis, the PA emerges 1-2 days after lung development begins 4 , 67 , 68 . Around embryonic day (E) 9.0, the ventral foregut buds to form the lung primordium. The splanchnic plexus, seeded by heart-derived progenitors, concurrently expands alongside the lung bud and forms a primitive endothelial network called the pulmonary plexus that envelops the branching airways 69 . Definitive PA morphogenesis then begins around E11.5, when proximal segments of the primitive PAs first become distinguishable, connecting proximally to the cardiac outflow tract through the VI th aortic arch and distally with the pulmonary plexus. The PA then undergoes rapid expansion, branching and maturing in a stereotyped program alongside the airways, establishing most of its main and distal branches by the onset of alveolarization (E14.5-E15.5) 70 , 71 . To better define the progenitor pools and sources of molecular signals controlling PA morphogenesis, and to investigate the possible role of EBF1 in this process, we densely sampled the developing pulmonary vasculature between E11.5 and E15.5 ( Fig. 3a ). This yielded 21,222 endothelial and 5,341 stromal cells with high quality transcriptomes during this critical stage of PA formation ( Supplementary Tables 8-9 ). Among ECs, the majority (18,827 cells, or 89%) were actively cycling Aplnr + plexus progenitors, accompanied by smaller clusters of emerging arterial ( Gja4 + Gja5 + Cxcr4 + ) and lymphatic ( Ccl21 + Prox1 + ) ECs. Notably, a distinct minor cluster of 603 cells (2.8%) displayed high Ebf1 expression, which we termed “ Ebf1 + ECs” ( Fig. 3b-c and Extended Data Fig. 5). These cells expressed canonical EC markers ( Pecam1 , Cdh5 , Cldn5 ), yet exhibited mesenchymal features, including the atypical cadherin ( Cdh11 ) 72 and collagen genes ( Col26a1 , Col23a1 ). These Ebf1 + ECs were molecularly distinct from the Ebf1 -expressing vascular stromal cells (mainly pericyte and smooth muscle precursors), with no intermediates detected. Download figure Open in new tab Fig. 3 E b f1 + ECs arise from Aplnr + multipotent lung plexus progenitors. a, Schematic of scRNA-seq studies of pulmonary vessels during lung morphogenesis (E11.5-E15.5). Endothelial (CD31 + ) and stromal (Epcam - CD31 - CD45 - ) compartments were enriched from C57BL/6 embryonic lungs at E11.5, E12.5, E13.5, and E15.5. Colored bar indicates corresponding mouse lung developmental stage. b, UMAP plot of annotated molecular clusters of profiled endothelial and stromal cells from all embryonic ages. Abbreviations: VSM, vascular smooth muscle; ASM, airway smooth muscle; AdvF, adventitial fibroblast. c , Representative marker genes for each cluster visualized by dot plot, showing the fraction of expressing cells and mean expression (among expressing cells). d, UMAP plot overlaid by lineage graph of cells from endothelial cells of developing mouse lungs with single cells colored by annotated cell type, lineage graph nodes are sub-cluster centroids with size scaled by number of cells, and the edge are scaled by interaction strength between the clusters (see methods). e , UMAP plot (as in panel d) overlaid by pseudotime progression visualizing bifurcating differentiation from Aplnr + plexus cells to either arterial ECs (lineage 1, ‘arterialization program’) or to Ebf1 + ECs (lineage 2, ‘Ebf1 program’). Arrows are the corresponding principal curves computed by slingshot, and the cells included in each of the lineages are colored by their pseudotime value, scaled from 0-1. f, Pseudotime analyses indicating Gja5 expression in both the Ebf1 program and arterialization program. g, Loess-regression-smoothened expression ( y axis) of the indicated genes along the pseudotime trajectories. h , Schematic of a growing lung highlighting relevant vascular structures. i - k , Whole-mount staining of TdTomato, CD31, aSMA, and E-cad in an Aplnr CreERT2 ;R26 TdT omato lineage-tracing sample at E13.5. Pulse labeling initiated by 4-hydroxytamoxifen (4-OHT) at E11.5. A schematic illustration (right) shows relevant lung vasculature structures, including the proximal PA, the L1 branch (the first branch of the PA in the left lung), and the lung plexus. Analyzing the developmental transitions of these early ECs revealed a bifurcating lineage graph with plexus ECs at the stem position connected to two fate trajectories: one toward arterial ECs (“arterialization program”) and the other toward Ebf1 + ECs (“Ebf1 program”) ( Fig. 3d-e and Supplementary Table 10 ). This suggests that, just as Aplnr + gCap cells can activate stem-like activities in PAH, Aplnr + plexus cells may serve as multipotent progenitors of the developing pulmonary endothelium. Pseudotime analysis of the arterialization program indicated that during PA morphogenesis, Aplnr + progenitors gradually downregulated Aplnr , losing their plexus identity ( Fig. 3f-g ), while upregulating key arterial markers ( Cxcl12 , Gja4 , Gja5, Eln ), BMP ligands ( Bmp4 , Bmp6 ), and key Notch signaling components ( Hey1 , Jag1 , Jag2 , Notch4 , Dll4 , known to couple cell cycle exit for arterial specification 21 ). To test if Aplnr + cells are a novel progenitor source of the PA during its morphogenesis, we performed lineage tracing using Aplnr CreERT2 ; Rosa26 TdTomato mice, which can be induced to label Aplnr lineage ( Aplnr lin ) cells with a tdTomato transgene ( Extended Data Fig. 6a). We focused our lineage analysis beginning at E11.5, after cardiac progenitors have seeded the pulmonary trunk and the most proximal segments of the primitive PA, at the onset of PA morphogenesis 70 , 71 , 73 . A pulsed recombination of Aplnr CreERT2 animals at E11.5 showed robust labeling of ECs (tdTomato + CD31 + ) residing in the pulmonary plexus at E12.0 ( Extended Data Fig. 6b). Over the next two embryonic days (E12.5 – E13.5), these Aplnr lin plexus ECs progressively incorporated into the growing PA tree, populating new PA branches ( Fig. 3h-k and Extended Data Fig. 6c-d ) . By E14.5, the near-complete labeling of the PA tree by Aplnr lin plexus ECs, comparable with pan-endothelial ( Cdh5 CreERT2 ) fate mapping ( Extended Data Fig. 6e-f), demonstrated that Aplnr + plexus progenitors are the major, if not exclusive, source of PA endothelium during morphogenesis. Ebf1 + ECs expand and migrate transiently within the pulmonary plexus Our single-cell analysis also suggested a second cell fate transition wherein Aplnr + plexus ECs can give rise to Ebf1 + ECs. To investigate the developmental origin of these cells, we examined EBF1 expression in Aplnr lineage-traced animals. We detected Ebf1 RNA in the pulmonary vasculature as early as E10.5 when the pulmonary circulation first forms. At this stage, Ebf1 expression was restricted to a subset of Aplnr lin plexus progenitors (TdTomato + Ebf1 + , E10.5 in Fig. 4a ). As the pulmonary vasculature expanded, EBF1 expression became most prominent in the lung plexus (CD31 + tdTomato + EBF1 + , E13.5 in Fig. 4b , and Extended Data Fig. 7a-d) yet remained a relatively rare subset of Aplnr lin cells. This fate transition appeared distinct from arterialization, because EBF1 was rarely expressed in Gja5 ( Cx40 ) CreERT2 -labeled arterial or pre-arterial ECs ( Extended Data Fig. 7e). Thus, our data collectively suggest that Aplnr + plexus cells are multipotent progenitors of the developing pulmonary vasculature with two distinct fates: (1) differentiating into arterial ECs, forming the PA endothelium, or (2) turning on Ebf1 expression in the pulmonary plexus. Below, we further characterize the molecular features, cellular behaviors, and fates of these novel Ebf1 + ECs during PA development. Download figure Open in new tab Fig. 4 E B F1 specifies a transient and mobile endothelial niche expressing rich vasculotrophic signals in PA development. a, Immunofluorescent staining for TdTomato (red) and smFISH for Ebf1 (white, RNA) in an Aplnr CreERT2 ;R26 TdT omato lineage-tracing embryo at E10.5 with pulse labeling initiated by 4-OHT at E8.5. b, Whole-mount staining of CD31 (white), TdTomato (red), and EBF1(yellow) in an Aplnr CreERT2 ;R26 TdT omato lineage-tracing embryo at E13.5 with pulse labeling initiated by 4-OHT at E11.5. c, Whole-mount staining of CD31, TdTomato, ECAD, or ERG in Ebf1 CreERT2 ;R26 TdT omato embryos at E8.5 with pulse labeling initiated by 4-OHT at E11.5. Cartoon illustration demonstrates Ebf1 Cre lineage-labeled ( Ebf1 lin ) ECs within the heart-lung region. OFT, cardiac outflow track. IFT, cardiac inflow track. d-f, Whole-mount staining of CD31, TdTomato, aSMA, ECAD, or ERG in Ebf1 CreERT2 ;R26 TdT omato lineage-tracing embryos at E13.5 with pulse labeling initiated by 4-OHT at E11.5. Relevant lung vascular structures were shown, including proximal PA, L1 branch, and plexus. Yellow arrowheads highlight ERG + Tdtomato + CD31 + Ebf1 lin ECs in the lung plexus. Pink arrowheads highlight aSMA + Tdtomato + PDGFRb + Ebf1 lin stromal cells in the proximal PA. g , Migration distance of Ebf1 lin cells in ex vivo E12.5 lung cultures with pulse labeling initiated at E11.5 (See Extended Data Video 1). Four representative cells at different locations were traced in 24hr. h, Whole-mount staining of an Ebf1 CreERT2 ;R26 TdT omato embryo at E14.5 with pulse labeling initiated by 4-OHT at E11.5. i , Quantification of Ebf1 lin ECs in the lung plexus between E12.5-E14.5. n=3 per each embryonic day. j, Pseudotime analyses (referencing Fig. 3a ) showing Ebf1 expression in both the Ebf1 program and arterialization program. k, Loess-regression-smoothened expression ( y axis) of the indicated genes along the pseudotime trajectories. l - m , Receptor-ligand interaction analyses within endothelial clusters or between endothelial and stromal populations. To visualize and track Ebf1 + ECs within the developing pulmonary vasculature, we generated an Ebf1 CreERT2 knock-in mouse line and crossed it with a Rosa26 tdTomato reporter to lineage label Ebf1 - expressing ( Ebf1 lin ) cells ( Extended Data Fig. 8a and Supplementary Fig. 1). Pulse-labeling Ebf1 CreERT2 animals at the beginning of lung development (E8.5) revealed a widespread distribution of Ebf1 lin cells throughout vascular structures by E9.5-11.5 ( Fig. 4c and Extended Data Fig. 8b - e ). Whole-mount staining confirmed that most Ebf1 lin cells co-expressed endothelial markers (CD31 and ERG), establishing their endothelial identity as Ebf1 lin ECs. To map their fate during PA morphogenesis, we pulse-labeled Ebf1 CreERT2 animals at E11.5 ( Fig. 4d-i ). As before, most labeled Ebf1 lin cells in the pulmonary plexus were endothelial (CD31 + ERG + TdTomato + , Fig. 4e ). However, plexus-derived Ebf1 lin ECs were rarely found in the PA intima and didn’t incorporate into the developing PA endothelium ( Fig. 4f and Extended Data Fig. 9). Instead, a pool of Ebf1 lin cells appeared around the mesenchyme of the PA, tracing into its stromal compartment ( Ebf1 lin stromal) ( Fig. 4f and Extended Data Fig. 9). Could this result indicate EndoMT of the plexus- derived Ebf1 lin ECs? Two lines of evidence argue against this and, instead, strongly suggest that Ebf1 lin stroma is a distinct Ebf1 -expressing lineage. First, lineage-tracing with Cdh5 CreERT2 or Aplnr CreERT2 lines failed to label the stomal layer ( Extended Data Fig. 6), indicating the source of Ebf1 lin stroma is not endothelial in origin. Second, scRNA-seq of the developing lung vasculature identified two clearly distinct Ebf1- expressing cell types, with no evidence of interconversion between Ebf1 + ECs and Ebf1 -expressing VSM/pericyte precursors. Instead of contributing to the PA endothelium, Ebf1 lin ECs proliferated and expanded within the pulmonary plexus between E11.5 and E13.5. To visualize their dynamic behavior during this period, we performed time-lapse microscopy on ex vivo cultures of lineage-labeled Ebf1 CreERT2 lungs. We observed clonal expansion of individual Ebf1 lin cells, as well as a dramatic migration pattern, with single labeled cells in the pulmonary plexus capable of migrating over 300 ums (approximately spanning 30 plexus cell lengths) within 24 hours (10-12.5 um/hr, Extended data video 1 , Fig. 4g , and Extended Data Fig. 10). This window of Ebf1 lin EC expansion was tightly regulated, as lineage labeled tdTomato + cells began disappearing from time-lapse microscopy by 48 hours ( Extended Data Fig. 10). Whole-mount immunostaining and quantification of lungs harvested at E14.5 confirmed a consistent 10-fold reduction of lineage-labeled cells ( Fig. 4h-i ). Thus, EBF1-expressing ECs transiently expand 10-fold and migrate long distances within a tightly regulated developmental window of around three embryonic days during PA morphogenesis. Ebf1 + ECs provide vasculotrophic signals for the surrounding plexus and stromal progenitors A molecular analysis of Ebf1 -expressing ECs explained their behavior and suggested their potential function in PA morphogenesis. Single-cell trajectory analysis of Ebf1 + ECs revealed a coordinated transcriptional program, which we termed the “Ebf1 program”: as the Aplnr + plexus progenitors began to express Ebf1 , they downregulated Aplnr , lost their plexus identity, and activated pEndoMT ( Fig. 4j-k and Supplementary Table 10 ), similar to what was observed in rat PAH. This included selective downregulation of canonical endothelial adhesion molecules ( Pecam1 , Cldn5 ), upregulation of mesenchymal genes broadly implicated in ECM synthesis and remodeling ( Col13a1 , Col25a1 , Col26a1, Col3a1 , Postn ) and a marked upregulation of cell cycle progression genes ( Mki67 , Cdk1 ) 74 ; findings which collectively explain the proliferative and migratory behavior of Ebf1 lin ECs. Indeed, a global receptor-ligand analysis of the early pulmonary vasculature revealed that Ebf1 + ECs are a particularly rich and central source of signals with broad vasculotrophic effects on other maturing endothelial and stromal progenitors ( Fig. 4k-m and Supplementary Table 11 ). Ebf1 + ECs expressed endothelial signals important for vascular development, including contact- dependent Esam 75 and adhesion GPCR signaling 76 , as well as Igf 77 , Ncam 78 – 80 , and Nrxn 81 , 82 pathways. In particular, Ebf1 + ECs expressed Apln , a critical arterial patterning pathway implicated in our PAH analysis that also predicts growth and migratory signaling to Apln r + plexus ECs 83 , 84 . Ebf1 + EC expression of alternative Notch receptor ( Notch2 ) and ligand ( Dlk1 ) could signal bidirectionally to their sister arterial ECs, promoting arterialization 45 , 85 , 86 . Their expression of Cxcr7 (Ackr3), a sink receptor for Cxcl12 87 , 88 , could establish the Cxcl12-Cxcr4 signaling gradient for arterial patterning. Finally, Ebf1 + ECs could promote the recruitment and maturation of the vascular stromal cells through the classical Tgfβ and Pdgfβ pathways; both are long implicated in PAH 10 , 89 – 91 . Their expression of ECM components (e.g., lamin, periostin, and fibronectin) 92 – 96 could also directly influence the composition and structure of the surrounding stroma. Thus, activation of the Ebf1 program in Aplnr lin cells specifies a novel population of Ebf1 + ECs that transiently proliferate and migrate within the pulmonary plexus during the critical window of PA morphogenesis. This program bears striking similarity to the Ebf1 + ECs that we discovered in PAH, including a pEndoMT expression of mesenchymal genes, and a rich source of developmental vasculotrophic signals. These data suggest that Ebf1 + ECs may be specialized niche cells with unusual mobility to accommodate the expanding arterial tree, coordinating the proliferation and arterialization of plexus progenitors, with the recruitment and maturation of stromal progenitors to organize PA morphogenesis. Below, we test this hypothesis using genetic perturbation experiments. Ebf1 + ECs control pulmonary vascular development To specifically knockout Ebf1 + ECs during precise developmental timepoints, we crossed a pan- endothelial Cre driver ( Cdh5 CreERT2 ) to animals carrying Cre-dependent conditional deletion Ebf1 alleles ( Ebf1 fl , with loxP sites flanking Ebf1 exons 6–16) 97 , as well as a tdTomato reporter. We then induced recombination either during the embryonic or pseudoglandular phase of lung development to examine the effect of endothelial Ebf1 on the pulmonary vasculature. Homozygous knockout of Ebf1 ( Ebf1 fl/fl ) during the embryonic stage (recombination at E8.5, Fig. 5a , and Extended Data Fig. 11a) was embryonic lethal, with no viable Cdh5 CreERT2 ;Ebf1 fl/fl pups recoverable at birth, consistent with prior global knockout studies showing perinatal lethality 98 , 99 . Examining the developing Cdh5 CreERT2 ;Ebf1 fl/fl embryos revealed a dramatic and global developmental delay of the entire lungs ( Fig. 5b-d and Extended Data Fig. 11b-d). Compared to heterozygous KO ( Ebf1 fl/wt , Fig. 5b ) and Cre - littermates, which exhibited normal PA development ( Extended Data Fig. 11b-c), homozygous mutants ( Ebf1 fl/fl , Fig. 5c ) had a drastically simplified pulmonary vasculature, with a 25% reduction in vascular plexus volume ( P = 0.0310) and 65% reduction in PA caliber ( P = 0.0304) ( Fig. 5d and Extended Data Fig. 11d). The PA in Ebf1 fl/fl animals also failed to branch and showed diminished SMA + muscular coverage ( Fig. 5c-d ). And, although Cdh5 lin ECs still traced into the proximal PA in Ebf1 fl/fl embryos, there was a marked decline in lineage-labeled cells in the pulmonary plexus. These histological data indicate that early endothelial Ebf1 deletion specifically impaired the expansion and arterialization of the plexus progenitors. Single-cell RNA-seq revealed a dearth of Ebf1 + ECs in the homozygotes ( Supplementary Table 9 ), confirming that Ebf1 is required cell-autonomously for the specification of Ebf1 + ECs, and that their loss underlies the observed phenotypes in Ebf1 fl/fl embryos. Differential expression analysis of the Aplnr + plexus population ( Cdh5-CreER + ;Ebf1 fl/fl vs. Cdh5-CreER - ;Ebf1 fl/fl , Fig. 5e , and Supplementary Table 12 ) revealed over 796 DEGs, including downregulation of proliferative markers ( Top2a , Mki67 ), Notch signaling components ( Notch3, Jag1, Jag2 ), angiogenic signaling genes ( Angptl1 , Tek /Tie2), and upregulation of stress response genes ( Hsp1a1 , Hspa1b , Gadd45g ). These findings indicate that, during the embryonic phase, Ebf1 + ECs are critical for the survival, proliferation, and arterialization of plexus progenitors. Download figure Open in new tab Fig. 5 E b f1 + ECs are essential for pulmonary vascular development. a, Schematic of the experimental designs for panels b-e , with gene deletion initiated by 4-OHT at E8.5 (onset of the embryonic stage of lung development). b and c, Whole-mount staining of TdTomato, CD31, and aSMA in Cdh5 CreERT2 ;R26Td;Ebf1 fl/wt and Cdh5 CreERT2 ;R26Td;Ebf1 fl/fl lungs at E13.5. Yellow dotted lines outline the PAs and their branches. d, Quantification of plexus volume and PA diameter in both genotypes. N=4 per group. e , Volcano plot displaying differential expressed genes in the plexus population, comparing Ebf1 fl/fl KOs vs Cre- littermates. Endothelial and stromal cells were enriched for scRNA-seq. n=8 per each genotype group. f , Schematic of the experimental designs for panels g-i , with gene deletion initiated by 4-OHT at E11.5 (onset of the pseudoglandular stage). g and h, Whole-mount staining of CD31, aSMA, and ECAD in Cdh5 CreERT2 ;Ebf1 fl/wt and Cdh5 CreERT2 ;Ebf1 fl/fl lungs at E15.5. Yellow dotted lines outline the distal PAs and their branches. Yellow arrowheads highlight defects in PA branching and reduced aSMA coverage in Ebf1 fl/fl KO embryos. i , Volcano plot displaying differential expressed genes in the stromal populations, comparing Ebf1 fl/fl KOs vs Cre- littermates. Endothelial and stromal cells were enriched for scRNA-seq. n=8 per each genotype group. j, Schematic of the experimental designs for panels k-m . k and l, Whole-mount staining of CD31 (white), aSMA (green), and Elastin (cyan) in adult Ebf1 lsl ;Cdh5 - ( Cre- control) and Cdh5 CreERT2 ; Ebf1 lsl lungs. Yellow dotted lines outline the distal PAs. Yellow arrowheads highlight less aSMA coverage in Cre- distal PAs. m, Quantification of aSMA coverage in distal PAs between genotype groups. N=6 per each genotype group. We next assessed the effects of endothelial Ebf1 knockout during the pseudoglandular phase (recombination at E11.5, Fig. 5f , and Extended Data Fig. 11e). Although the lung size of the homozygotes appeared normal at E15.5, there was widespread hemorrhage throughout the distal vasculature, bleeding into the mesothelial layer ( Extended Data Fig. 11f). Histological examination of the pulmonary vasculature revealed specific cellular defects ( Fig. 5g-h ): the pulmonary plexus that normally densely envelops the distal bronchioles was malformed with severely reduced cellularity. Additionally, the PVs were dilated, and, although the PAs were normal in size, there was reduced branching and smooth muscle coverage of the distal segments. ScRNA-seq during this period also revealed a significant reduction of Ebf1 + ECs ( Supplementary Table 9 ). Differential gene expression analysis of the mesenchyme revealed 194 DEGs ( Cdh5- CreER + ;Ebf1 fl/fl vs. Cdh5-CreER - ;Ebf1 fl/fl , Fig. 5i , and Supplementary Table 13 ), including marked downregulation of smooth muscle components ( Actg2 , Myh11 ), actin-binding proteins ( Tagln , Cnn1 ), and growth factors ( Igf1 , Pdgfc ). These results suggest that the maturation of mesenchyme into smooth muscle cells requires Ebf1 + ECs later during PA development. Indeed, endothelial overexpression of Ebf1 ( Fig. 5j and Supplementary Fig. 2) postnatally resulted in excessive distal PA muscularization ( Fig. 5k-m ), an established hallmark of PAH 100 . These non-cell-autonomous consequences of endothelial Ebf1 deletion, when considered together with scRNA-seq evidence identifying Ebf1 + ECs as a source of vasculotrophic signals, revealed that Ebf1 + ECs are niche cells for PA development. These Ebf1 + niche ECs organize PA morphogenesis by performing two temporally separated but functionally coupled roles. In the embryonic phase, Ebf1 + niche ECs are required for survival, proliferation and arterialization of the plexus progenitors as they incorporate into the intima of the expanding, branching PA tree, shaping the foundational architecture of the pulmonary vasculature. In the subsequent pseudoglandular phase, Ebf1 + niche ECs continue to promote vascular plexus expansion and orchestrate the recruitment and maturation of mesenchymal progenitors, building the outer muscular layers of the PA and arterioles to meet the physiological demands of gas exchange. Thus, EBF1 specifies an embryonic niche within the vascular plexus that organizes PA morphogenesis. This niche dynamically modulates its signaling function over time, initially supporting the proliferation and arterial specification of plexus progenitors, then guiding stromal organization and vascular stability, ultimately establishing the functional architecture of the pulmonary arterial tree. Discussion Originally discovered for its role in B cell development, the pioneer transcription factor EBF1 has since been recognized to regulate cell fates in multiple neural and mesodermal lineages across metazoans 26 , 27 , 99 , 101 – 107 . Here, our search for novel regulators of PAH revealed an unexpected new function of EBF1 in specifying a population of unusually mobile and transient niche cells that dynamically organize PA morphogenesis through vasculotrophic signaling. In adulthood, this embryonic artery-forming niche can be reactivated in PAH to drive vascular remodeling. Our findings show that, after cardiac progenitors seed the initial pulmonary trunk and proximal PA 4, 67 , the principal source of endothelial progenitors for the developing pulmonary vasculature is multipotent Aplnr -expressing ECs residing in the pulmonary plexus. This vascular plexus is an immature endothelial network that envelops the nascent lung buds and expands in parallel with branching morphogenesis of the airways and the PA tree 73 . Using single-cell trajectory analysis and lineage tracing, we show that, as this immature plexus progressively remodels into a mature arterial tree, with Aplnr + plexus ECs differentiating into both arterial ECs and a distinct population of Ebf1 -expressing cells ( Ebf1 + ECs). These Ebf1 + ECs proliferate and migrate extensively yet incorporate minimally into the PA endothelium. If Ebf1 + ECs do not trace into the arterial wall, how do they control PA development? Our scRNA-seq and genetic experiments led us to propose that the key role of Ebf1 + ECs is to organize PA development. Through coordinated expression of vasculotrophic signals, Ebf1 + ECs function as a niche cell, orchestrating the expansion and arterialization of the plexus progenitors with the maturation of the surrounding stromal progenitors to build the PA tree ( Fig. 6a ). Download figure Open in new tab Fig. 6 T h e core artery-forming niche driven by Ebf1 + ECs. a, Proposed model of the Ebf1 + ECs-driven, artery-forming niche in PA development. During lung morphogenesis, multipotent Aplnr + plexus progenitors give rise to both pre-arterial ECs and an Ebf1 + endothelial niche population. Without directly incorporating into the PA endothelium, these Ebf1 + ECs serve as the “ PA organizing cells ”. They secrete vasculotrophic signals required for the proliferation and arterialization of the plexus progenitors, as well as for the recruitment and muscularization of the stromal progenitors, thereby controlling the angiogenic expansion, branching, and maturation of the growing PAs. b , Working model of the Ebf1 + ECs-driven, artery-forming niche in adult PAH. Under conditions of inflammation and BMPR2 deficiency, Aplnr + gCap cells re-acquire stem-like properties and differentiate into Dll4 + arterial-like ECs and Ebf1 + ECs. Through comparable vasculotrophic signaling, these Ebf1 + ECs induce the proliferation and reprogramming of gCap cells, as well as the recruitment and activation of cells from the stromal layers, thereby contributing to PA vascular remodeling. Unlike most epithelial stem cell niches with well-defined locations and architectures 108 , 109 , Ebf1 + niche ECs act dynamically in space and time, broadly distributing throughout the pulmonary plexus and intermingling with the pre-arterial ECs ( Extended Data Fig. 6e), as well as sequentially activating distinct functions through broad vasculotrophic signals. Similar to the Spemann-Mangold organizer, the classic vertebrate signaling center that patterns the embryonic body axis 110 , Ebf1 + niche ECs are transient yet essential organizing centers, coordinating cell fate decisions and vascular architecture across tissue layers to induce PA formation. This organizing function of Ebf1 + niche cells may require pEndoMT-mediated proliferation and migration. Like neural crest cells, which undergo EMT to delaminate and migrate towards their target destinations 111 , Ebf1 + niche ECs may detach from their neighboring endothelium and migrate long distances to organize the rapidly expanding arterial tree. Perhaps the most unusual feature of these Ebf1 + niche ECs is their dynamic 10-fold expansion (E11.5- E13.5) followed by rapid attrition (E14.5) from the embryonic lungs within just three embryonic days. While Aplnr + plexus progenitors rely on Ebf1 + niche ECs for survival, expansion, and differentiation during this window, they are apparently not required for the survival of Aplnr + gCap stem cells in adulthood, as Ebf1 + ECs are virtually undetectable in the normal pulmonary endothelium. This contrasts sharply with neighboring alveolar epithelial type 2 cells that require lifelong FGF signaling from their developmental niche 112 . The tightly regulated disappearance of Ebf1 + niche ECs is reminiscent of developmental programmed cell death, including the transcriptionally controlled apoptosis in precisely 131 of the 1,090 cells in the C. elegans somatic lineage 113 and the Bmp-driven interdigital apoptosis critical for mammalian finger formation 114 . Bmp signaling is an attractive candidate for triggering the apoptosis of Ebf1 + niche ECs, given the well-established role of BMPR2 deficiency in PAH. The disruption of BMP signaling in PAH may allow the persistence of Ebf1 + niche ECs in the neointima to drive sustained vascular remodeling. Regardless of the mechanism, it will be important in the future to identify the controlling signal, as it can become a valuable treatment for PAH by eliminating the vessel- occluding neointima. This Ebf1 + EC-driven, artery-forming niche also explains how re-emergence of Ebf1 + ECs later in adulthood can cause vascular remodeling in PAH ( Fig. 6b ). We propose that in adult PAH, predisposing Bmpr2 mutations together with inflammatory injury can reactivate stem cell activities 20 , 34 in Aplnr + general capillary cells and induce their coupled differentiation to Dll4 + arterial-like ECs or to Ebf1 + ECs, effectively reconstituting the embryonic niche. These Ebf1 + niche ECs re-engage core developmental programs, undergo pEndoMT, and secrete vasculotrophic signals that promote gCap proliferation and Dll4 + neo-arterialization in a positive feedback loop. Concurrently, Ebf1 + niche ECs recruit pericytes, stimulate smooth muscle cells, and activate fibroblasts—in a maladaptive reprise of their embryonic PA-organizing role within the neointima. Although hybrid endothelial-mesenchymal phenotypes in PAH and other vascular diseases (notably atherosclerosis) are speculated to arise from EndoMT lineage conversion 50 , our results suggest that EBF1-driven pEndoMT regenerates a migratory endothelial niche that orchestrates vascular remodeling as a maladaptive reprise of development. This model offers a new conceptual framework for understanding diverse vascular diseases beyond PAH. Our unified approach to development and disease of the PA, focusing on the embryonic function and adult reactivation of EBF1, has unique advantages. The stereotyped developmental sequence of the PA allowed us to map the cellular behavior and function of EBF1 at single cell resolution, and the tools available for mouse genetic experiments led us to propose Ebf1 + ECs as specialized niche cells. The resulting disease model addresses enduring questions about the cellular origins and mixed phenotype of PAH neointimal lesions, the surprising proliferative behavior of normally quiescent pulmonary endothelium 115 , and the source of angiogenic cues. In PAH and other vascular diseases, targeting this EBF1-driven artery-forming niche may address the fundamental mechanism driving pathologic vascular transformation before it becomes irreversible. Methods Mice All mice used in the experiments were between the ages of 8 and 12 weeks and maintained on a C57BL/6 background (both male and female). Mice were housed with a 12-h light–dark cycle at 18–23 °C and 40–60% humidity in the animal facility at the Palo Alto Veterans Medical Center. Most mouse lines were described earlier 53 , 116 , 117 , including the Apj CreERT2 , Cdh5 CreERT2 , Gja5 CreERT2 , and Rosa26 TdTomato reporter (The Jackson Laboratory, B6.Cg- Gt(ROSA)26Sor tm9(CAG-TdTomato)Hze /J, Stock# 007909), and Ebf1 flox (The Jackson Laboratory, B6.Cg- Ebf1 tm2.1Mbu /J, Stock#028104). For embryonic studies, timed pregnancies were determined by defining the day of plug formation as E0.5. In pulse-chase and Ebf1 KO experiments, E/Z-4-hydroxytamoxifen (4-OHT, Cayman Chemical, #17308) was dissolved in ethanol at a concentration of 2.75 mg/ml and was injected into the peritoneal cavities of pregnant dams at 5-10mg/kg body weight. In regular lineage tracing experiments, regular tamoxifen (Sigma, T5648) was dissolved in corn oil at a concentration of 10 mg/ml and was given to the pregnant dams through oral gavage at 50-100mg/kg body weight. Dosing and dissection schedule for each study are indicated in their corresponding data sections. For postnatal studies, mice were intraperitoneally injected with 4mg tamoxifen dissolved in corn oil for 3 consecutive days to induce Cre recombinase activity. All mouse experiments and care were conducted in accordance with the procedures approved by the Institutional Animal Care and Use Committee (IACUC) guidance. Generation of Ebf1 P2A-CreERT2- and H11 lsl-Ebf1 mouse strains To generate the Ebf1 CreERT2-P2A mouse strain was generated by homology-directed repair at the endogenous Ebf1 locus aided by CRISPR-Cas9 endonuclease activity in C57BL/6 mice by Applied Stemcell. A targeting construct of cDNA encoding tamoxifen-inducible Cre recombinase (CreERT2) and a P2A self-cleaving peptide sequence followed by a FRT-flanked neomycin- resistance cassette was generated. A mixture of 2 guide RNAs (gRNAs), spCas9 mRNA, and the repair donor was injected into the C57BL/6J embryos. Recognition sequences of the gRNAs used in this study are as follow: 5g2F:5’-ACCAATGTCACGTGTGGATTGGG-3’ and 3g2R:5’- TCAAGGCAATTCTTTCACATGGG-3’. PAM sequence in grey is underlined. The donor Ebf1 sequence (see sequence details in Supplementary Fig. 1 ) , with homology arms (HA) at both sides, was constructed and used as a repair donor template. Linearized donor DNA and CRISPR–Cas9 complex were injected into C57BL/6 fertilized zygotes, which were then implanted into the oviducts of pseudopregnant female mice. Founders were identified by genotyping. To generate the H11 lsl-Ebf1 mouse strain, similar strategy was used by Applied Stemcell. A transgene of EF1a promoter- STOP (floxed)- Ebf1 cDNA-P2A-H2B-mTagBFP2 was knocked into H11 locus, in C57BL/6J background using CRISPR-Cas9 technology. A mixture of two guide RNAs (gRNA), spCas9 mRNA, and donor DNA was injected into the C57BL/6J embryos. Recognition sequences of the gRNAs used in this study are as follow: H11-L3: 5’- TGATGGAACAGGTAACAAAGG - 3’ and H11-R2: 5’-GCTTATCTTGAACTCTTGTGG-3. The donor DNA (see sequence details in Supplementary Fig. 2 ) , with homology arms (HA) at both sides, was constructed and used as a repair donor template. The injected embryos were transferred into the oviduct of CD-1 foster mothers. Pups were screened by PCR. Founders were sequenced and then bred to wild-type C57BL/6J male to produce F1 heterozygotes. Rats All rats used in this study were between the ages of 4-6 weeks (both male and female). Bmpr2 +/- and Bmpr2 +/+ rats were constructed by the Nicolls lab in the SAGE laboratory 14 . PAH was induced through intratracheal instillation of adenovirus expressing Alox5 using a published protocol 14 . The experimental protocol was approved by the Veteran Affairs Palo Alto Animal Care and Use Committee. Human lung sections De-identified lung sections were used in this study. Lung sections were obtained from PAH patients following lung transplantation. Control subject tissue was collected during lobectomy or pneumonectomy for localized lung cancer; pulmonary arteries were studied at a distance from the tumor areas. Transthoracic echocardiography was performed preoperatively in the control cohort to rule out PAH. All lung slices were obtained deidentified either from the Pulmonary Hypertension Breakthrough Initiative (PHBI) Network or from the French Network on Pulmonary Hypertension. Human pulmonary artery endothelial cell (hPAEC) culture Primary human PAECs were purchased from PromoCell (#C-12241) and grown in complete Endothelial Cell Growth Medium 2 from PromoCell (#C-22111) supplied with 5% FBS and Penicillin/Streptmycin. Cells between passage 4-7 were used in the study. HPAECs were transfected with adenovirus expressing EBF1 (Ad EBF1 , Vector Biolabs, #AAV-207511) or control vector (Ad Ctrl , Vector Biolabs, #7071) for 3 days before analysis. Whole genome mRNA sequencing (RNA-seq) of hPAECs Total RNA from the transfected hPAECs was extracted using the RNeasy Mini Kit (QIAGEN). N=3 per treatment group were analyzed. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina) and subjected to sequencing on 1–2 Illumina HiSeq 4000 lanes to obtain an average of approximately 100-150 million uniquely mapped reads for each sample (Novogene). Differential gene expression analysis was performed in R using EBSeq package, an empirical Bayes hierarchical model for inference in RNA-seq experiments, using false discovery rate (FDR) of 0.05 to retrieve list of differentially expressed genes (DEGs). Differentially expressed genes were ranked by posterior fold change and enriched for gene sets using The Molecular Signatures Database (MSigDB) and Gene Set Enrichment Analysis (GSEA) tools developed by the Broad Institute. Chromatin immunoprecipitation sequencing (ChIP-seq) of hPAECs For chromatin crosslinking, hPAECs were fixed with 1% formaldehyde (Thermo Fisher Scientific) in PBS at RT for 10min with gentle rocking. The reaction was quenched by 125 mM glycine. Cells were washed twice with ice-cold PBS and collected by scraping in PBS supplemented with protease inhibitors (complete™, Roche). Cell pellets were flash-frozen in liquid nitrogen and stored at -80°C before shipment to ActiveMotif for the following steps. N=2 per treatment condition were analyzed. To prepare chromatin fragment, fixed cells were lysed in ChIP lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5% SDS) supplemented with protease and phosphatase inhibitors. Chromatin was sheared to an average fragment size of 200-500 bp using a Bioruptor® Pico (Diagenode) for 20 cycles (30 sec ON, 30 sec OFF) at 4°C. Shearing efficiency was assessed by electrophoresis. Insoluble debris was removed by centrifuge at 12,000 × g for 10min, and the supernatant was collected for immunoprecipitation (IP). For each IP, 5 µg of sheared chromatin was diluted 1:10 with ChIP dilution buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 150 mM NaCl, 0.1% Triton X-100) and pre-cleared with 20 µL of Protein A/G magnetic beads (Thermo Fisher) for 1hr. Chromatin was then incubated overnight with 5 µg of anti-EBF1 antibody (Santa Cruz Biotech, Sc-137065, same one used in ENCODE project) or IgG isotype control. The next day, 40µL of pre-washed Protein A/G beads were added, and incubation continued for an additional 4h. Beads were then washed for 3 times before chromatin was eluted. Eluted chromatin and input controls were both reverse-crosslinked. DNA was purified using the MinElute PCR Purification Kit (Qiagen) and quantified. DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) following the manufacturer’s instructions. Size selection (200-500 bp) was performed using AMPure XP beads (Beckman Coulter). The final libraries were amplified using indexed primers and quantified using an Agilent Bioanalyzer. Libraries were sequenced on an Illumina NovaSeq 4000 platform. Whole mount immunofluorescence of embryonic samples Embryos were collected and dissected in PBS and immediately fixed in 4% PFA at 4°C for 1hr, followed by two 15min washes with PBS at 4°C. The samples were first incubated in primary antibodies prepared in at least 5 volumes of PBS containing 0.5% Triton (0.5% PBT) for 2-3 days at 4°C. Samples were washed in 20 volumes of 0.5% PBT for 6hr at RT. Embryos were then incubated in 1:400 dilution of secondary antibodies prepared in 5 volumes of 0.5% PBT for 2-3 days at 4°C, and were washed in 20 volumes of 0.5% PBT for 6hr. Stained samples were post- fixed in 4% PFA at 4°C for 1hr, dehydrated into methanol, and cleared in benzyl alcohol:benzyl benzoate (1:2; BABB, Sigma, #305197, #B6630) before imaging. All steps were performed with gentle but continuous shaking. Steps involving antibody or BABB incubations were performed in 15ml glass tubes. Primary antibodies used, at indicated concentrations, were: EBF1 (Abcam, ab221033; 1:150); PECAM1 (BD Biosciences, #553370, 1:500) or PECAM1 (R&D, AF3628, 1:250); Cy3-conjugated aSMA (Sigma, C6198; 1:500); tdTomato (Rockland, #44567; 1:300); E- cadherin (Invitrogen, ECCD-2, 1:500); ERG (Abcam, ab92513, 1:500); PDGFRb (Invitrogen, 14- 1402-82, 1:150). All secondary antibodies were Alexa Fluor conjugated (350, 488, 555, 647, 750, Invitrogen, 1:250 or 1:400). DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, Invitrogen, D1306; reconstituted in PBS, 2 μg/ml) was used to stain nuclei. Alexa Fluor 350 hydrazide (Invitrogen, A10439; reconstituted to 0.5 mg/ml in PBS, 1:100) or Alexa Fluor 633 hydrazide (Invitrogen, A30634; 0.5 mg/ml, 1:1,000) were used to visualize elastin fibers and were added along with secondary antibodies. All images were taken using Leica Stellaris confocal microscope. Maximum projection images and 3D reconstruction of the Z-stack images were performed using Imaris. Quantification of images All quantifications were performed using Imaris with images taken with 20x or 40x objectives. To quantify the lung plexus volume , confocal Z-stacks with CD31 channels were imported into Imaris. Metadata, including voxel dimensions and channel assignments, were verified in the ‘Properties’ panels. Images were cropped to include a lung plexus region of 2,250,000 um 3 . A “Surface” object was generated for the CD31 channel using the “Add Surfaces” wizard with a manually defined intensity threshold that best captured the vascular plexus. For validation, the segmented surface was inspected in 3D views and orthogonal slices. The volume of the CD31 + plexus (μm³) was then calculated in the ‘Statistics’ tab. For each sample, the total plexus volume was recorded and exported as a .csv file. To quantify numbers of Ebf1 lin CD31 + cells , confocal images containing TdTomato alongside DAPI and CD31 channels were used. The “Surface with Split Touching Object” tool was applied on the TdTomato channel with an estimated surface diameter of ∼5-10 μm. The threshold (Quality filter) was set to include bright, discrete TdTomato+ signals while minimizing background. The 3D viewer was used to rotate the volume and verify each TdTomato + cell had a distinct surface. If any surface encompassed multiple cells, or if cells were missed, the surface diameter or splitting parameters were modified using the “Morphological Split” option. The total number of TdTomato + spots (“Count”) was obtained from the “Statistics” tab. When focusing on a specific region (e.g., a segment of lung parenchyma or vessel), a “Surface” was created, and only the spots contained within that region were counted (using the “Filter” by location function). Such measurements from multiple embryos were then utilized to generate a graph. To quantify the percentage of aSMA coverage , the entire area of distal PA was manually traced to create a Surface Object for the distal PA based on CD31. Similarly, a second Surface Objective was generated for the aSMA channel by Image J plugin. The intensity threshold and smoothing factor were optimized to capture continuous αSMA structures without merging distinct bands of smooth muscle. The total surface area of the αSMA object and the vascular area were measured in the “Results” tab. Percentage of aSMA coverage was calculated by dividing Surface Area of aSMA with Surface Area of the Vessel x 100. To quantify PA diameters, confocal image stacks were imported into Imaris. Orthogonal cross-sections were generated at different positions along the vessel length (using the “Orthoslice” tool), and diameters were measured in each cross- section using Measurement Points or line segments. Multiple cross-sections were averaged to obtain a representative diameter for the PA segment. PA diameters were recorded from at least three slices (3D) per vessel, per sample. Each group included at least three replicates for all experiments. All data are presented as the mean ± s.e.m. using GraphPad Prism. Kruskal-Wallis or Mann-Whitney tests were used to determine statistical significance between groups. Single molecule fluorescent in situ hybridization (smFISH) smFISH was performed using the RNAscope Multiplex Fluorescent Reagent kit v2 (ACD). Tissues were fixed with 4% PFA overnight and cryoprotected with 30% sucrose (in PBS) for 24hr, followed by embedding in OCT for frozen blocks. Ten-micrometer sections were attached to Superfrost Plus microscope slides. Target retrieval was performed by heating in a steamer for 15min. Samples were photochemically bleached to remove autofluorescence using LED light. Sections were then treated with Protease III, followed by in situ hybridization according to the manufacturer’s protocol. Probe (for human RNA) and channels used are as follows: EBF1-C3 (TSA Vivid 650), CLDN5-C1 (TSA Vivid 570), ATAC2-C2 (TSA Vivid 520), APLNR-C2 (TSA Vivid 520). Probe (for mouse RNA) and channels used are as follows: EBF1-C1 (TSA Vivid 650). After smFISH, samples were incubated in DAPI (used at 2 μg/ml in PBS) for 5min to counterstain nuclei and mounted in Prolong Gold antifade reagent (Invitrogen) before imaging. Single-cell RNA sequencing Cell isolation for scRNA-seq studies. Rat lung scRNA-seq Rat lungs were collected after perfusion through the right ventricle with 50ml ice cold PBS. After mincing with scissors, tissue was suspended in dissociation buffer prepared using Multi Tissue Dissociation kit 2 (Miltenyi, #130-110-203). The suspension was transferred into a gentleMACS C tube (Miltenyi), which was then attached upside down onto the gentleMACS Dissociator (Miltenyi). Program 37C_Multi_C_01 was used to dissociate the lung samples. At the end of the program, digestion reaction is stopped by adding ice cold PBS with 1% FBS incubated at 37 °C for 15-25min with gently trituration by micropipette every 5min. Sample suspension was filtered through a 70um MACS SmartStraner. Cells were pelleted down by centrifuge at 500g for 5min and suspended inn Red Blood Cell Lysis Solution (Miltenyi, #130-094-183) to remove red blood cells and dead cells. Cells were then washed with staining buffer (PBS with 1% FBS) once and stained with BV480- anti-CD31 (BD, #746594), APC-Cy7-anti-Epcam (Biolegend, #324246), and PE-Cy5-anti-CD45 (BD, #559135) antibodies for 25min at RT, followed with incubation of Live/Dead cell dye for 10min. At the end of staining, cells were washed with staining buffer one more time and kept on ice until fluorescence-activated cell sorting (FACS). Embryonic scRNA-seq. Endothelial and stromal cells were separately enriched from the embryos of wildtype C57BL/6 using FACS. Lungs were first micro-dissected and minced with forceps. Samples were pooled into a 15ml tube with dissociation buffer consisting of 500 U/ml collagenase IV (Worthington #LS004186), 1.2 U/ml dispase (Worthington #LS02100), 32 U/ml DNase I (Worthington #LS002007) in Hanks’ Balanced Salt Solution (Thermo Fisher). The suspension was incubated at 37 °C for 15-25min with gently trituration by micropipette every 5min. After the incubation, digestion was stopped by topping off the 15ml tube with ice cold PBS with 1% FBS (staining buffer). The cells were then filtered through a 70-μm cell strainer (BD Bioscience). Cells were then washed with staining buffer once and stained with APC-anti-CD31(Biolegend, #102410, 1:400), PE-Cy7-anti-CD326 (Biolegend, #118216, 1:400), APC-Cy7-anti-CD45 or Percp-Cy5.5-anti-CD45 (Biolegend, #103116 or #103132, 1:400), and APC-Cy7-anti-Ter119 (Biolegend, #116223, 1:400) antibodies for 25min at RT, followed with incubation of Zombie NIR viability dye (Biolegend, #423106, 1:1000) for 10min. At the end of staining, cells were washed with staining buffer one more time and kept on ice until FACS. Library preparation and sequencing The dissociated cells were loaded onto a commercially available droplet-based single-cell barcoding system (10x Chromium Controller, 10x Genomics). The Chromium Single Cell 3′ Reagent Kit v3 (10x Genomics) was used to prepare single-cell 3′ barcoded cDNA and Illumina-ready sequencing libraries according to the manufacturer’s instructions. The cDNA libraries were sequenced using an Illumina HiSeq 4000 machine with a mean of ∼76,000 reads per cell. Bioinformatic methods Whole genome ChIP- and RNA-seq processing Whole genome sequencing data was processed according to the ENCODE Uniform Analysis Pipelines 118 . For RNA-seq, sequenced reads were aligned to the human reference genome (GRCh38) using STAR (v2.1.3). Transcript abundance was estimated using RSEM (v1.4.1) in paired-end mode. Differential gene expression analysis between EBF1 overexpressing PAECs and control PAECs was performed using limma (v3.58.1) by fitting a linear model. For ChIP-seq, reads were aligned to the human reference genome (GRCh38) using STAR (v2.1.3). Peaks were identified using MACS2 (v2.1.0) for narrow peaks. Reproducibility between biological replicates was assessed using the Irreproducible Discovery Rate (IDR) tool, and consistent peaks were annotated using HOMER2. BED file processing was performed with BEDtools (v2.25.0), and bigWIG tracks were generated using wigToBigWig (v4) for visualization. Single cell mRNA sequencing read alignment Using Cell Ranger (version 5.0, 10x Genomics), sequencing reads from single cells isolated using 10x Chromium were demultiplexed and then aligned to custom-built references: Rat Rnor 6.0 (rn6) supplemented with fluorescent gene EGFP , or Mouse GRCm38 (mm10) supplemented with the Cre transgene and fluorescent genes EGFP and tdTomato . Iterative cell clustering and annotation Expression profiles of cells from different conditions were clustered together using R software package Seurat (v4.3.3). Preprocessing and normalization were performed as described 19 . Briefly, Unique molecular identifiers (UMIs) were normalized across cells, scaled per 10,000 (10x), and converted to log scale using the ‘NormalizeData’ function. These values were converted to z-scores using the ‘ScaleData’ command and highly variable genes were selected with the ‘FindVariableGenes’ function with a dispersion cutoff of 0.5. Principle components were calculated for these selected genes and then projected onto all other genes with the ‘RunPCA’ command. Clusters of similar cells were detected using the Leiden method for community detection. After separating clusters by expression of tissue compartment markers, we assigned cell types to the canonical identities using the most sensitive and specific markers for mouse and human cell types identified in the human lung cell atlas 19 (e.g., ‘Arterial’). We used previously defined markers 20 for developmental annotation of the plexus endothelial progenitors. For subtypes that showed substantial transcriptional change, a representative marker gene was prepended to their presumed canonical identity (e.g., ‘ Dll4 + arterial-like EC’). Differential gene expression analysis Differentially expressed genes for each annotated cell clusters relative to the other cell clusters were identified using the ‘FindMarkers’ command in Seurat with the ‘MAST’ statistical framework. For differential gene expression by cell type, cells with the same annotation were grouped, and the ‘FindMarkers’ function was used within each annotated cell type to compare Ebf1 mutant (Ebf1 -/- ) to wild-type (Ebf1 +/+ ) cells. Trajectory inference Cell lineage relationships were reconstructed using Slingshot 16 , a trajectory inference method designed to identify branching differentiation pathways from single-cell transcriptomic data by first constructing a minimum spanning tree (MST) on cell clusters to identify ordered sets of lineages that share a common starting cluster and lead to distinct terminal clusters, and then assigning pseudotimes by extending principal curves to model transcriptional progression along each lineage. Specifically, we used the Seurat-defined clusters and computed UMAP coordinates to first obtain a global lineage structure with the ‘getLineages’ function which implements MST construction and identifies likely lineage transitions between the nodes. For the root cluster, we used the ‘gCap’ cluster in the PAH dataset and used the ‘ Aplnr + plexus’ cluster in the mouse developmental dataset. To estimate transition probabilities, we used the shared nearest-neighbor (SNN) graph constructed in Seurat. Transition strength between clusters was quantified by summing the number of intermediate cells connecting each pair of clusters in the SNN graph. Given an SNN adjacency matrix A , where Aij represents the connection strength between cells i and j , we computed a pairwise interaction matrix S : where Smn is the transition strength between clusters Cm and Cn , determined by summing edges in the SNN graph that connect cells from each cluster. Cluster centroids were computed as the mean UMAP coordinates. The final lineage graph was visualized with edge thickness proportional to transition probability, overlaid on the UMAP single cell visualization. Pseudotime gene expression analysis To identify genes exhibiting dynamic expression changes along pseudotime, we applied TradeSeq 119 , which models gene expression as a smooth function of pseudotime. The ‘fitGAM’ function was used to fit generalized additive models (GAMs) to individual gene expression profiles, and differential expression testing was performed using ‘associationTest’, which identified genes with significant lineage-dependent expression trends, revealing transcriptional programs associated with developmental processes or disease progression. Receptor-ligand analysis Receptor ligand analysis was performed using R package ‘cellchat’ (v2.1.2) from our single cell datasets from rat PAH, or the developing mouse pulmonary vasculature. Ligand-receptor pairs were inferred using ‘computeCommunProb’ and filtered to keep ligand-receptor interactions involving at least 10 cells per interacting group. To visualize interactions, we generated chord diagrams with ‘netVisual_aggregate (layout = "chord")’. Author contributions W.T. and S.G. performed immunostaining, imaging, and mouse genetic experiments. T.H.W. performed bioinformatic analyses for all animal studies and human cells. A.A. performed bioinformatic analyses for publicly available PAH dataset. W.T., S.G., J.C., C.H., and S.L. performed embryo dissection. D.K. and Y.Z. performed FACS sorting. W.T., S.G., and D.K. performed single cell library preparation. W.T., S.G., J.C., C.H., and K.S. managed animal colonies. A.A. and M. R. provided materials. W.T. and M.N supervised and supported the work. W.T. S.G., T.H.W., J.P., P.K., T.D., L.P., L.B., X. J., M.R., K.RH, and M.N. designed the experiments and interpreted the data. W.T., T.H.W., and M.N. conceived the study, interpreted the data, and wrote the manuscript. All authors reviewed and edited the manuscript. Supplementary Tables Supplementary Table 1 | Specific marker genes in rat PAH scRNA-seq analysis Supplementary Table 2| Cell counts per cluster in rat PAH scRNA-seq analysis Supplementary Table 3| DEGs in bulk RNA-seq analysis of human PAECs Supplementary Table 4| ChIP-seq analysis of EBF1-binding sites in human PAECs Supplementary Table 5| Cross-species gene overlap analysis integrating rat PAH scRNA- seq, human PAEC bulk RNA-seq, and mouse developmental scRNA-seq Supplementary Table 6| Pseudotime analysis of cell differentiation in rat PAH scRNA-seq dataset Supplementary Table 7| Global receptor and ligand interaction analysis in rat PAH scRNA-seq dataset Supplementary Table 8| Specific marker genes in mouse lung developmental scRNA-seq analysis Supplementary Table 9| Cluster-wise cell counts in mouse lung developmental scRNA-seq analysis Supplementary Table 10| Pseudotime analysis of plexus differentiation in mouse lung developmental scRNA-seq dataset Supplementary Table 11| Global receptor and ligand interaction analysis in mouse lung developmental scRNA-seq dataset Supplementary Table 12| scRNA-seq analysis of plexus population following early endothelial EBF1 deletion Supplementary Table 13| scRNA-seq analysis of stromal cells following late endothelial EBF1 deletion Extended Data Extended Data Fig. 1 | Single cell RNA-seq analysis of rat PAH vascular lesions. a, Schematic of the experimental design. Single cell libraries were generated for endothelial, stromal, immune, and epithelial cells enriched from the Bmpr2 +/- rat model of inflammatory PAH. b and c , UMAP plots indicate distinct vascular clusters. Each cluster is color-coded in b , while comparisons between wild type control, heterozygous control, and PAH samples were shown in c . d , Heatmap of gene expression correlations among vascular cell clusters. Bmpr2 encodes gene the bone morphogenetic protein receptor 2 (BMPR2). Extended Data Fig. 2 | EBF1 is expressed in rat PAH neointimal cells. a and b, Immunofluorescent staining of EBF1 and Elastin in heterozygous control ( Bmpr2 +/- ) and PAH ( Bmpr2 +/- + Ad Alox5 ) rat lungs. 3D renderings and sectional views highlight the intra-luminal localization of EBF1 + cells in the PAH group (red arrows) and abluminal localization of these cells in the control group (pink arrows). c and d, Immunofluorescent staining of CD31 and aSMA, combined with single molecular fluorescent in situ hybridization (smFISH), using RNAscope, for Ebf1 , Cldn5 , Acta2 , or Aplnr in lung samples collected from healthy heterozygous controls or PAH rats. DAPI (blue) marks nuclei. Ad Alox5 , adenovirus overexpressing Alox5 gene. αSMA, alpha smooth muscle actin. Extended Data Fig. 3 | EBF1 is uniquely expressed in human PAH vascular lesions. a, UMAP plots of publicly available clinical dataset from both control and PAH patients, where CLDN5 denotes the endothelial cell populations. b, Re-clustering and annotations of CLDN5 + endothelial cell types. Cells denoted by disease status and EBF1 transcripts were also shown. c, Representative marker genes of clusters exhibiting elevated EBF1 expression. d, Relative EBF1 expression in its most abundant endothelial cell types, gCap 5, gCap 6, and aCap2, stratified by disease status. e , Immunofluorescent staining of CD31 and αSMA, combined with smFISH for EBF1 , CLDN5 , and ACTA2 in PAH lung, with or without BMPR2 mutations. DAPI identifies nuclei. Extended Data Fig. 4 | EBF1 drives gene programs important for PA remodeling. a, Phase contrast and immunofluorescent images of human pulmonary arterial endothelial cells (hPAECs) transfected with either adenovirus overexpressing EBF1 (Ad EBF1 ) or the control virus (Ad Ctrl ). b, Volcano plot depicting representative differentially expressed genes in a bulk RNA-seq analysis of hPAECs treated with Ad EBF1 or Ad Ctrl . c, ChIP-seq analysis of EBF1 transcriptional activities in transduced hPAECs. d and e, Genome browser views show EBF1 binding peaks (coverage) at the MEOX1 and IGF1 locus; both are significantly upregulated genes in bulk RNA-seq and scRNA-seq. Extended Data Fig. 5 | Ebf1 expression in the developing mouse lung vasculature (E11.5- E15.5). a and b , UMAP clustering of main lung vascular cell types during the pseudoglandular stage of mouse lung development (E11.5-E15.5). Ebf1 is highly expressed in the Ebf1 + EC cluster and a population of Notch3 + stomal cells. Extended Data Fig. 6 | Pulmonary vasculature arises from Aplnr + multipotent lung plexus progenitors. a, Whole-mount staining of an Aplnr CreERT2 ;R26 TdT omato lineage-tracing embryo at E10.5 with pulse labeling initiated by 4-hydroxytamoxifen (4-OHT) at E8.5. Cartoon schematic (left) illustrates Aplnr + endothelial progenitors within the heart-lung complex. OFT, cardiac outflow tract. IFT, cardiac inflow tract. AO, aorta. b - e, Whole-mount staining in Aplnr CreERT2 ;R26 TdT omato lineage-tracing samples collected at E12.0 (in b ), 12.5 (in c ), 13.5 (in d ), or 14.5 (in e ) with pulse labeling initiated by 4-OHT at E11.5. Yellow dotted lines outline the proximal PAs. L1 branch, the first PA branch in the left lung. g, Whole-mount staining in a Cdh5 CreERT2 ;R26 TdT omato lineage-tracing embryo at E14.5 with lineage labeling initiated by TAM at E8.5. Extended Data Fig. 7 | Ebf1 + ECs are a subpopulation of Aplnr + lung plexus cells. a, Schematic of the experimental designs for panels b-d . b - d , Whole-mount staining of TdTomato, CD31, aSMA, and EBF1 in Aplnr CreERT2 ;R26 TdT omato lineage-tracing embryos collected at E12.5 (in b ), 13.5 (in c ), or 14.5 (in d ). Pulse labeling was initiated at E11.5 by 4-OHT. Cartoon illustrates the location of EBF1 + , Aplnr CreERT2 lineage-labeled cells in the developing pulmonary vasculature. e , Whole-mount staining of TdTomato, CD31, aSMA, and EBF1 in a Gja5 CreERT2 ;R26 TdT omato lineage- tracing embryo at E13.5, showing near absence of EBF1-expressing, Gja5 CreERT2 lineage-labeled mature arterial and pre-arterial ECs. Lineage label of Gja5 CreERT2 was initiated at E11.5 by 4-OHT. Blue arrow heads highlight the EBF1 + Gja5 -CreERT2 - cells and red arrow heads highlight the EBF1 + Gja5 -CreERT2 + ones in the proximal PA. Blue dotted line outline the PA branch. Extended Data Fig. 8 | EBF1 expression pattern during the embryonic stage of lung development. a, Schematic of the Ebf1 CreERT2 knock-in allele. b, Experimental designs for panels c - e . Pulse labeling was initiated by 4-OHT at E8.5. c - e, Whole-mount staining of TdTomato, CD31, and ECAD in Ebf1 CreERT2 ;R26 TdT omato lineage-tracing embryos collected at E9.5 (in c ), 10.5 (in d ), or 11.5 (in e ). Cartoons illustrate the location and possible behavior of Ebf1 CreERT2 lineage-labeled endothelial cells ( Ebf1 lin ECs). Extended Data Fig.9 | Ebf1 lineage labeled ECs ( Ebf1 lin ) do not directly trace into the mature PA endothelium. a, Schematic of the experimental designs of panels b-d . b and c, Whole-mount staining of TdTomato, CD31, aSMA or CD45 in Ebf1 CreERT2 ;R26 TdT omato lineage-tracing samples collected at E12.5 (in b ) or E13.5 (in c ). 3D rendering and sectional views, generated by Imaris, highlight the relative intra-luminal (yellow arrowheads) or abluminal (blue arrowheads) localization of Ebf1 lin cells. d, Quantification of CD31 + Ebf1 lin ECs between E12.5-E14.5. Extended Data Fig. 10 | Ebf1 lin cells are proliferative and migratory. a, Schematic of the experimental strategy for panels b-c . b, Time-lapse images of an E12.5 Ebf1 CreERT2 ;R26 TdT omato lung explant over 48hr. Note an increase in Ebf1 lin cells in 24hr and a decrease in cell number at 48hr. c, Representative example of clonal expansion of Ebf1 lin cell in 48hr. Extended Data Fig. 11 | Ebf1 + ECs are essential for PA development. a, Schematic of the experimental designs for panels b - d , with gene deletion initiated by 4-OHT at E8.5. b, Brightfield and fluorescent images of the lung-heart complex from Cdh5 Cre- ; Ebf1 fl/fl (Cre- control), Cdh5 CreERT2 ; R26 Td ; Ebf1 fl/wt (heterozygous KO), and Cdh5 CreERT2 ; R26 Td ; Ebf1 fl/fl (homozygous KO) embryos collected at E13.5. Note the comparable lung size between Ebf1 fl/wt KO and Cdh5 Cre- control, and the smaller lung size (with delayed development) in Ebf1 fl/fl KO ; heart sizes remain consistent across genotypes. c, Whole-mount staining of CD31, ECAD, aSMA, or TdTomato in Cdh5 Cre- ; Ebf1 fl/fl or Cdh5 CreERT2 ; R26 Td ; Ebf1 fl/wt lungs collected at E13.5, Yellow arrowheads highlight aSMA coverage in proximal PAs. Pink arrowheads indicate PA branching. d, Quantification of plexus volume, proximal PA diameter, and aSMA coverage between groups. e, Schematic of the experimental designs for panel f . f, Representative photos of Cdh5 CreERT2 ; Ebf1 fl/wt and Cdh5 CreERT2 ; Ebf1 fl/fl lungs at the time of collection (E15.5). Black arrowheads mark areas of hemorrhage. Supplementary Information Supplementary Fig. 1 | Generation of the Ebf1 CreERT2 mice. a, Schematic of the designs of generation of a mouse model with Ebf1-P2A-CreERT2 knock-in allele using CRISP/Cas9- mediated strategy. Cas9 creates double-strand breaks (DSB) at the location specifically targeted by two gRNAs (green arrows). DSBs are then repaired by homology-directed repair (HDR) using a donor template. Two pairs of screening primers (F1a/seq677 and seq557/R2a) are designed to screen founders. b, Genotyping primers. c, Repair donor sequence (2478 bp). Ones underlined are Ebf1 genomic sequences used as homology arms. Supplementary Fig. 2 | Generation of the Ebf1-overexpression mice. a, Schematic of the designs of generation of a mouse model with H11-EF1a pro-STOP-Ebf1-P2A-H2B-mtag BFP knock-in allele using CRISP/Cas9-mediated strategy. Cas9 creates double-strand breaks (DSB) at the location specifically targeted by two gRNAs (green arrows). DSBs are then repaired by homology-directed repair (HDR) using a donor template. Two pairs of screening primers are designed to screen founders. b, Genotyping primers. c, Repair donor sequence (5904bp). Homology arms in gray. Funder Information Declared Palo Alto Veterans Institute for Research, https://ror.org/008e03r59 , HL158714 , HL150583 , HL138473 VA Palo Alto Health Care System, https://ror.org/00nr17z89 , I01 BX005628 Footnotes ↵ # designated corresponding authors ( amytian{at}stanford.edu ), ( thsuanwu{at}stanford.edu ), ( gusb{at}stanford.edu ), ( jason_l_chang{at}alumni.brown.edu ), ( cerianne.huang{at}gmail.com ), ( rmvinh{at}bu.edu ), ( aandrusk{at}stanford.edu ), ( kksong{at}stanford.edu ), ( harrykim{at}stanford.edu ), ( zhuyu88{at}stanford.edu ), ( seunghee{at}stanford.edu ), ( jpan{at}stanford.edu ), ( peterkao{at}stanford.edu ), ( tdesai{at}stanford.edu ), ( lsprince{at}stanford.edu ), ( butcherl{at}stanford.edu ), ( xinguoj{at}stanford.edu ), ( marlener{at}stanford.edu ), ( kredhorse{at}stanford.edu ), ( mnicolls{at}stanford.edu ) References ↵ Townsley , M. I . Structure and composition of pulmonary arteries, capillaries, and veins . Compr Physiol 2 , 675 – 709 ( 2012 ). doi: 10.1002/cphy.c100081 OpenUrl CrossRef PubMed ↵ Kandathil , A. & Chamarthy, M. Pulmonary vascular anatomy & anatomical variants . Cardiovasc Diagn Ther 8 , 201 – 207 ( 2018 ). doi: 10.21037/cdt.2018.01.04 OpenUrl CrossRef PubMed ↵ deMello, D. E., Sawyer, D., Galvin, N. & Reid, L. M . Early fetal development of lung vasculature . Am J Respir Cell Mol Biol 16 , 568 – 581 ( 1997 ). doi: 10.1165/ajrcmb.16.5.9160839 OpenUrl CrossRef PubMed Web of Science ↵ Peng , T. et al. Coordination of heart and lung co-development by a multipotent cardiopulmonary progenitor . Nature 500 , 589 – 592 ( 2013 ). doi: 10.1038/nature12358 OpenUrl CrossRef PubMed Web of Science ↵ Humbert , M. et al. Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives . Eur Respir J 53 ( 2019 ). doi: 10.1183/13993003.01887-2018 OpenUrl Abstract / FREE Full Text ↵ Lai , Y. C. , Potoka , K. C. , Champion , H. C. , Mora , A. L. & Gladwin , M. T . Pulmonary arterial hypertension: the clinical syndrome . Circ Res 115 , 115 – 130 ( 2014 ). doi: 10.1161/CIRCRESAHA.115.301146 OpenUrl Abstract / FREE Full Text ↵ Schermuly , R. T. , Ghofrani , H. A. , Wilkins , M. R. & Grimminger , F . Mechanisms of disease: pulmonary arterial hypertension . Nat Rev Cardiol 8 , 443 – 455 ( 2011 ). doi: 10.1038/nrcardio.2011.87 OpenUrl CrossRef PubMed ↵ Chelladurai , P. et al. Epigenetic reactivation of transcriptional programs orchestrating fetal lung development in human pulmonary hypertension . Sci Transl Med 14 , eabe5407 ( 2022 ). doi: 10.1126/scitranslmed.abe5407 OpenUrl CrossRef PubMed Savai , R. et al. Pro-proliferative and inflammatory signaling converge on FoxO1 transcription factor in pulmonary hypertension . Nat Med 20 , 1289 – 1300 ( 2014 ). doi: 10.1038/nm.3695 OpenUrl CrossRef PubMed ↵ Rol , N. , Kurakula , K. B. , Happe , C. , Bogaard , H. J. & Goumans , M. J . TGF-beta and BMPR2 Signaling in PAH: Two Black Sheep in One Family . Int J Mol Sci 19 ( 2018 ). doi: 10.3390/ijms19092585 OpenUrl CrossRef Wu , Y. et al. The pathophysiological role of novel pulmonary arterial hypertension gene SOX17 . Eur Respir J 58 ( 2021 ). doi: 10.1183/13993003.04172-2020 OpenUrl Abstract / FREE Full Text ↵ Hu , C. J. , Zhang , H. , Laux , A. , Pullamsetti , S. S. & Stenmark , K. R . Mechanisms contributing to persistently activated cell phenotypes in pulmonary hypertension . J Physiol 597 , 1103 – 1119 ( 2019 ). doi: 10.1113/JP275857 OpenUrl CrossRef PubMed ↵ International , P. P. H. C. et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension . Nat Genet 26 , 81 – 84 ( 2000 ). doi: 10.1038/79226 OpenUrl CrossRef PubMed Web of Science ↵ Tian , W. et al. Phenotypically Silent Bone Morphogenetic Protein Receptor 2 Mutations Predispose Rats to Inflammation-Induced Pulmonary Arterial Hypertension by Enhancing the Risk for Neointimal Transformation . Circulation 140 , 1409 – 1425 ( 2019 ). doi: 10.1161/CIRCULATIONAHA.119.040629 OpenUrl CrossRef PubMed ↵ Morrell , N. W. et al. Genetics and genomics of pulmonary arterial hypertension . Eur Respir J 53 ( 2019 ). doi: 10.1183/13993003.01899-2018 OpenUrl Abstract / FREE Full Text ↵ Graf , S. et al. Identification of rare sequence variation underlying heritable pulmonary arterial hypertension . Nat Commun 9 , 1416 ( 2018 ). doi: 10.1038/s41467-018-03672-4 OpenUrl CrossRef PubMed ↵ Tabula Muris , C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris . Nature 562 , 367 – 372 ( 2018 ). doi: 10.1038/s41586-018-0590-4 OpenUrl CrossRef PubMed Tabula Sapiens , C., et al. The Tabula Sapiens: A multiple-organ, single-cell transcriptomic atlas of humans . Science 376 , eabl4896 ( 2022 ). doi: 10.1126/science.abl4896 OpenUrl CrossRef PubMed ↵ Travaglini , K. J. et al. A molecular cell atlas of the human lung from single-cell RNA sequencing . Nature 587 , 619 – 625 ( 2020 ). doi: 10.1038/s41586-020-2922-4 OpenUrl CrossRef PubMed ↵ Gillich , A. et al. Capillary cell-type specialization in the alveolus . Nature 586 , 785 – 789 ( 2020 ). doi: 10.1038/s41586-020-2822-7 OpenUrl CrossRef PubMed ↵ Trimm , E. & Red-Horse , K . Vascular endothelial cell development and diversity . Nat Rev Cardiol 20 , 197 – 210 ( 2023 ). doi: 10.1038/s41569-022-00770-1 OpenUrl CrossRef PubMed ↵ Seppinen , L. & Pihlajaniemi , T . The multiple functions of collagen XVIII in development and disease . Matrix Biol 30 , 83 – 92 ( 2011 ). doi: 10.1016/j.matbio.2010.11.001 OpenUrl CrossRef PubMed ↵ Liu , C. Y. , Lin , H. H. , Tang , M. J. & Wang , Y. K . Vimentin contributes to epithelial- mesenchymal transition cancer cell mechanics by mediating cytoskeletal organization and focal adhesion maturation . Oncotarget 6 , 15966 – 15983 ( 2015 ). doi: 10.18632/oncotarget.3862 OpenUrl CrossRef PubMed ↵ Philippova , M. et al. A guide and guard: the many faces of T-cadherin . Cell Signal 21 , 1035 – 1044 ( 2009 ). doi: 10.1016/j.cellsig.2009.01.035 OpenUrl CrossRef PubMed Web of Science ↵ Boller , S. et al. Pioneering Activity of the C-Terminal Domain of EBF1 Shapes the Chromatin Landscape for B Cell Programming . Immunity 44 , 527 – 541 ( 2016 ). doi: 10.1016/j.immuni.2016.02.021 OpenUrl CrossRef PubMed ↵ Sigvardsson , M . Early B-Cell Factor 1: An Archetype for a Lineage-Restricted Transcription Factor Linking Development to Disease . Adv Exp Med Biol 1459, 143 – 156 ( 2024 ). doi: 10.1007/978-3-031-62731-6_7 OpenUrl CrossRef ↵ Zolotarev , N. , Bayer , M. & Grosschedl , R . EBF1 is continuously required for stabilizing local chromatin accessibility in pro-B cells . Proc Natl Acad Sci U S A 119 , e2210595119 ( 2022 ). doi: 10.1073/pnas.2210595119 OpenUrl CrossRef PubMed ↵ Zolotarev , N. et al. Regularly spaced tyrosines in EBF1 mediate BRG1 recruitment and formation of nuclear subdiffractive clusters . Genes Dev 38 , 4 – 10 ( 2024 ). doi: 10.1101/gad.350828.123 OpenUrl Abstract / FREE Full Text ↵ Crnkovic , S. et al. Single-cell transcriptomics reveals skewed cellular communication and phenotypic shift in pulmonary artery remodeling . JCI Insight 7 ( 2022 ). doi: 10.1172/jci.insight.153471 OpenUrl CrossRef ↵ Zhang , W. , Liu , Y. & Zhang , H . Extracellular matrix: an important regulator of cell functions and skeletal muscle development . Cell Biosci 11 , 65 ( 2021 ). doi: 10.1186/s13578-021-00579-4 OpenUrl CrossRef PubMed ↵ Winkler , J. , Abisoye-Ogunniyan , A. , Metcalf , K. J. & Werb , Z . Concepts of extracellular matrix remodelling in tumour progression and metastasis . Nat Commun 11 , 5120 ( 2020 ). doi: 10.1038/s41467-020-18794-x OpenUrl CrossRef PubMed ↵ Muhl , L. et al. Single-cell analysis uncovers fibroblast heterogeneity and criteria for fibroblast and mural cell identification and discrimination . Nat Commun 11 , 3953 ( 2020 ). doi: 10.1038/s41467-020-17740-1 OpenUrl CrossRef PubMed ↵ Godoy , R. S. et al. Single-cell transcriptomic atlas of lung microvascular regeneration after targeted endothelial cell ablation . Elife 12 ( 2023 ). doi: 10.7554/eLife.80900 OpenUrl CrossRef ↵ Liu , B. et al. General Capillary Endothelial Cells Undergo Reprogramming Into Arterial Endothelial Cells in Pulmonary Hypertension Through HIF-2alpha/Notch4 Pathway . Circulation 150 , 414 – 417 ( 2024 ). doi: 10.1161/CIRCULATIONAHA.123.067981 OpenUrl CrossRef PubMed ↵ Su , T. et al. Single-cell analysis of early progenitor cells that build coronary arteries . Nature 559 , 356 – 362 ( 2018 ). doi: 10.1038/s41586-018-0288-7 OpenUrl CrossRef PubMed ↵ D’Amato , G. et al. Endocardium-to-coronary artery differentiation during heart development and regeneration involves sequential roles of Bmp2 and Cxcl12/Cxcr4 . Dev Cell 57 , 2517 – 2532 e2516 ( 2022 ). doi: 10.1016/j.devcel.2022.10.007 OpenUrl CrossRef PubMed ↵ Pitulescu , M. E. et al. Dll4 and Notch signalling couples sprouting angiogenesis and artery formation . Nat Cell Biol 19 , 915 – 927 ( 2017 ). doi: 10.1038/ncb3555 OpenUrl CrossRef PubMed ↵ Hou , S. et al. TM4SF1 promotes esophageal squamous cell carcinoma metastasis by interacting with integrin alpha6 . Cell Death Dis 13 , 609 ( 2022 ). doi: 10.1038/s41419-022-05067-2 OpenUrl CrossRef Lin , C. I. et al. TM4SF1: a new vascular therapeutic target in cancer . Angiogenesis 17 , 897 – 907 ( 2014 ). doi: 10.1007/s10456-014-9437-2 OpenUrl CrossRef PubMed Tarabykina , S. et al. Metastasis-associated protein S100A4: spotlight on its role in cell migration . Curr Cancer Drug Targets 7 , 217 – 228 ( 2007 ). doi: 10.2174/156800907780618329 OpenUrl CrossRef PubMed Web of Science Xiao , G. et al. Critical role of filamin-binding LIM protein 1 (FBLP-1)/migfilin in regulation of bone remodeling . J Biol Chem 287 , 21450 – 21460 ( 2012 ). doi: 10.1074/jbc.M111.331249 OpenUrl Abstract / FREE Full Text Ou , Y. et al. Migfilin promotes migration and invasion in glioma by driving EGFR and MMP-2 signalings: A positive feedback loop regulation . J Genet Genomics 44 , 557 – 565 ( 2017 ). doi: 10.1016/j.jgg.2017.09.008 OpenUrl CrossRef PubMed ↵ Kravchenko , D. S. , Ivanova , A. E. , Podshivalova , E. S. & Chumakov , S. P . PDLIM4/RIL- mediated regulation of Src and malignant properties of breast cancer cells . Oncotarget 11 , 22 – 30 ( 2020 ). doi: 10.18632/oncotarget.27410 OpenUrl CrossRef PubMed ↵ Antfolk , D. et al. Selective regulation of Notch ligands during angiogenesis is mediated by vimentin . Proc Natl Acad Sci U S A 114 , E4574 – E4581 ( 2017 ). doi: 10.1073/pnas.1703057114 OpenUrl Abstract / FREE Full Text ↵ Phng , L. K. & Gerhardt , H . Angiogenesis: a team effort coordinated by notch . Dev Cell 16 , 196 – 208 ( 2009 ). doi: 10.1016/j.devcel.2009.01.015 OpenUrl CrossRef PubMed Web of Science Liu , Z. L. , Chen , H. H. , Zheng , L. L. , Sun , L. P. & Shi , L . Angiogenic signaling pathways and anti-angiogenic therapy for cancer . Signal Transduct Target Ther 8 , 198 ( 2023 ). doi: 10.1038/s41392-023-01460-1 OpenUrl CrossRef ↵ Salcedo , R. & Oppenheim , J. J . Role of chemokines in angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses . Microcirculation 10 , 359 – 370 ( 2003 ). doi: 10.1038/sj.mn.7800200 OpenUrl CrossRef PubMed Web of Science ↵ Kovacic , J. C. et al. Endothelial to Mesenchymal Transition in Cardiovascular Disease: JACC State-of-the-Art Review . J Am Coll Cardiol 73 , 190 – 209 ( 2019 ). doi: 10.1016/j.jacc.2018.09.089 OpenUrl FREE Full Text Welch-Reardon , K. M. , Wu , N. & Hughes , C. C . A role for partial endothelial- mesenchymal transitions in angiogenesis? Arterioscler Thromb Vasc Biol 35 , 303 – 308 ( 2015 ). doi: 10.1161/ATVBAHA.114.303220 OpenUrl Abstract / FREE Full Text ↵ Yang , J. et al. Guidelines and definitions for research on epithelial-mesenchymal transition . Nat Rev Mol Cell Biol 21 , 341 – 352 ( 2020 ). doi: 10.1038/s41580-020-0237-9 OpenUrl CrossRef PubMed ↵ Haerinck , J. & Berx , G . Partial EMT takes the lead in cancer metastasis . Dev Cell 56 , 3174 – 3176 ( 2021 ). doi: 10.1016/j.devcel.2021.11.012 OpenUrl CrossRef PubMed ↵ Ranchoux , B. et al. Endothelial-to-mesenchymal transition in pulmonary hypertension . Circulation 131 , 1006 – 1018 ( 2015 ). doi: 10.1161/CIRCULATIONAHA.114.008750 OpenUrl Abstract / FREE Full Text ↵ Qiao , L. et al. Endothelial fate mapping in mice with pulmonary hypertension . Circulation 129 , 692 – 703 ( 2014 ). doi: 10.1161/CIRCULATIONAHA.113.003734 OpenUrl Abstract / FREE Full Text ↵ Rossant , J. & Howard , L . Signaling pathways in vascular development . Annu Rev Cell Dev Biol 18 , 541 – 573 ( 2002 ). doi: 10.1146/annurev.cellbio.18.012502.105825 OpenUrl CrossRef PubMed ↵ Red-Horse , K. , Ueno , H. , Weissman , I. L. & Krasnow , M. A . Coronary arteries form by developmental reprogramming of venous cells . Nature 464 , 549 – 553 ( 2010 ). doi: 10.1038/nature08873 OpenUrl CrossRef PubMed Web of Science ↵ Liu , Q. et al. Genetic targeting of sprouting angiogenesis using Apln-CreER . Nat Commun 6 , 6020 ( 2015 ). doi: 10.1038/ncomms7020 OpenUrl CrossRef PubMed ↵ Sharma , B. et al. Alternative Progenitor Cells Compensate to Rebuild the Coronary Vasculature in Elabela- and Apj-Deficient Hearts . Dev Cell 42 , 655 – 666 e653 ( 2017 ). doi: 10.1016/j.devcel.2017.08.008 OpenUrl CrossRef PubMed ↵ Givant-Horwitz , V. , Davidson , B. & Reich , R . Laminin-induced signaling in tumor cells . Cancer Lett 223 , 1 – 10 ( 2005 ). doi: 10.1016/j.canlet.2004.08.030 OpenUrl CrossRef PubMed Web of Science ↵ Deng , Z. et al. TGF-beta signaling in health, disease, and therapeutics . Signal Transduct Target Ther 9 , 61 ( 2024 ). doi: 10.1038/s41392-024-01764-w OpenUrl CrossRef PubMed Massague , J . TGFbeta signalling in context . Nat Rev Mol Cell Biol 13 , 616 – 630 ( 2012 ). doi: 10.1038/nrm3434 OpenUrl CrossRef PubMed ↵ Richardson , L. , Wilcockson , S. G. , Guglielmi , L. & Hill , C. S . Context-dependent TGFbeta family signalling in cell fate regulation . Nat Rev Mol Cell Biol 24 , 876 – 894 ( 2023 ). doi: 10.1038/s41580-023-00638-3 OpenUrl CrossRef PubMed ↵ Alto , L. T. & Terman, J. R. Semaphorins and their Signaling Mechanisms . Methods Mol Biol 1493, 1-25 ( 2017 ). doi: 10.1007/978-1-4939-6448-2_1 OpenUrl CrossRef PubMed Hu , S. & Zhu , L . Semaphorins and Their Receptors: From Axonal Guidance to Atherosclerosis . Front Physiol 9 , 1236 ( 2018 ). doi: 10.3389/fphys.2018.01236 OpenUrl CrossRef PubMed ↵ Sun , Q. , Liu , S. , Liu , K. & Jiao , K . Role of Semaphorin Signaling During Cardiovascular Development . J Am Heart Assoc 7 ( 2018 ). doi: 10.1161/JAHA.118.008853 OpenUrl FREE Full Text ↵ Dong , Y. J. , Jones , R. L. & Wilson , N. H . Prostaglandin E receptor subtypes in smooth muscle: agonist activities of stable prostacyclin analogues . Br J Pharmacol 87 , 97 – 107 ( 1986 ). doi: 10.1111/j.1476-5381.1986.tb10161.x OpenUrl CrossRef PubMed Web of Science ↵ Ruan , Y. C. , Zhou , W. & Chan , H. C . Regulation of smooth muscle contraction by the epithelium: role of prostaglandins . Physiology (Bethesda ) 26 , 156 – 170 ( 2011 ). doi: 10.1152/physiol.00036.2010 OpenUrl CrossRef PubMed ↵ Baral , K. et al. APJ+ cells in the SHF contribute to the cells of aorta and pulmonary trunk through APJ signaling . Dev Biol 498 , 77 – 86 ( 2023 ). doi: 10.1016/j.ydbio.2023.04.003 OpenUrl CrossRef PubMed ↵ Parera , M. C. et al. Distal angiogenesis: a new concept for lung vascular morphogenesis . Am J Physiol Lung Cell Mol Physiol 288 , L141 – 149 ( 2005 ). doi: 10.1152/ajplung.00148.2004 OpenUrl CrossRef PubMed ↵ Abe , S. , Murashima , A. , Kimura , E. , Ema , M. & Hitomi , J . Early development of the pulmonary vascular system: An anatomical and histochemical reinvestigation of the pulmonary venous return development in mice . Acta Histochem 124 , 151840 ( 2022 ). doi: 10.1016/j.acthis.2021.151840 OpenUrl CrossRef ↵ Metzger , R. J. , Klein , O. D. , Martin , G. R. & Krasnow , M. A . The branching programme of mouse lung development . Nature 453 , 745 – 750 ( 2008 ). doi: 10.1038/nature07005 OpenUrl CrossRef PubMed Web of Science ↵ Greif , D. M. et al. Radial construction of an arterial wall . Dev Cell 23 , 482 – 493 ( 2012 ). doi: 10.1016/j.devcel.2012.07.009 OpenUrl CrossRef PubMed Web of Science ↵ Schneider , D. J. et al. Cadherin-11 contributes to pulmonary fibrosis: potential role in TGF- beta production and epithelial to mesenchymal transition . FASEB J 26 , 503 – 512 ( 2012 ). doi: 10.1096/fj.11-186098 OpenUrl CrossRef PubMed Web of Science ↵ Hislop , A . Developmental biology of the pulmonary circulation . Paediatr Respir Rev 6 , 35 – 43 ( 2005 ). doi: 10.1016/j.prrv.2004.11.009 OpenUrl CrossRef PubMed ↵ Massacci , G. , Perfetto , L. & Sacco , F . The Cyclin-dependent kinase 1: more than a cell cycle regulator . Br J Cancer 129 , 1707 – 1716 ( 2023 ). doi: 10.1038/s41416-023-02468-8 OpenUrl CrossRef PubMed ↵ Yokota , T. et al. The endothelial antigen ESAM marks primitive hematopoietic progenitors throughout life in mice . Blood 113 , 2914 – 2923 ( 2009 ). doi: 10.1182/blood-2008-07-167106 OpenUrl Abstract / FREE Full Text ↵ Yona , S. , Lin , H. H. , Siu , W. O. , Gordon , S. & Stacey , M . Adhesion-GPCRs: emerging roles for novel receptors . Trends Biochem Sci 33 , 491 – 500 ( 2008 ). doi: 10.1016/j.tibs.2008.07.005 OpenUrl CrossRef PubMed Web of Science ↵ Wang , Z. et al. Insulin-Like Growth Factor-1 Signaling in Lung Development and Inflammatory Lung Diseases . Biomed Res Int 2018, 6057589 ( 2018 ). doi: 10.1155/2018/6057589 OpenUrl CrossRef ↵ Ditlevsen , D. K. , Povlsen , G. K. , Berezin , V. & Bock , E . NCAM-induced intracellular signaling revisited . J Neurosci Res 86 , 727 – 743 ( 2008 ). doi: 10.1002/jnr.21551 OpenUrl CrossRef PubMed Paratcha , G. , Ledda , F. & Ibanez , C. F . The neural cell adhesion molecule NCAM is an alternative signaling receptor for GDNF family ligands . Cell 113 , 867 – 879 ( 2003 ). doi: 10.1016/s0092-8674(03)00435-5 OpenUrl CrossRef PubMed Web of Science ↵ Bussolati , B. et al. Neural-cell adhesion molecule (NCAM) expression by immature and tumor-derived endothelial cells favors cell organization into capillary-like structures . Exp Cell Res 312 , 913 – 924 ( 2006 ). doi: 10.1016/j.yexcr.2005.12.004 OpenUrl CrossRef PubMed Web of Science ↵ Craig , A. M. & Kang , Y . Neurexin-neuroligin signaling in synapse development . Curr Opin Neurobiol 17 , 43 – 52 ( 2007 ). doi: 10.1016/j.conb.2007.01.011 OpenUrl CrossRef PubMed Web of Science ↵ Bottos , A. et al. The synaptic proteins neurexins and neuroligins are widely expressed in the vascular system and contribute to its functions . Proc Natl Acad Sci U S A 106 , 20782 – 20787 ( 2009 ). doi: 10.1073/pnas.0809510106 OpenUrl Abstract / FREE Full Text ↵ Kidoya , H. & Takakura , N . Biology of the apelin-APJ axis in vascular formation . J Biochem 152 , 125 – 131 ( 2012 ). doi: 10.1093/jb/mvs071 OpenUrl CrossRef PubMed Web of Science ↵ Kidoya , H. et al. Spatial and temporal role of the apelin/APJ system in the caliber size regulation of blood vessels during angiogenesis . EMBO J 27 , 522 – 534 ( 2008 ). doi: 10.1038/sj.emboj.7601982 OpenUrl Abstract / FREE Full Text ↵ Bray , S. J . Notch signalling: a simple pathway becomes complex . Nat Rev Mol Cell Biol 7 , 678 – 689 ( 2006 ). doi: 10.1038/nrm2009 OpenUrl CrossRef PubMed Web of Science ↵ Zhou , B. et al. Notch signaling pathway: architecture, disease, and therapeutics . Signal Transduct Target Ther 7 , 95 ( 2022 ). doi: 10.1038/s41392-022-00934-y OpenUrl CrossRef PubMed ↵ Sun , X. et al. CXCL12 / CXCR4 / CXCR7 chemokine axis and cancer progression . Cancer Metastasis Rev 29 , 709 – 722 ( 2010 ). doi: 10.1007/s10555-010-9256-x OpenUrl CrossRef PubMed Web of Science ↵ Naumann , U. et al. CXCR7 functions as a scavenger for CXCL12 and CXCL11 . PLoS One 5 , e9175 ( 2010 ). doi: 10.1371/journal.pone.0009175 OpenUrl CrossRef PubMed ↵ Becher , C. , Wits , M. , de Man , F. S. , Sanchez-Duffhues , G. & Goumans , M. J . Targeting Soluble TGF-beta Factors: Advances in Precision Therapy for Pulmonary Arterial Hypertension . JACC Basic Transl Sci 9 , 1360 – 1374 ( 2024 ). doi: 10.1016/j.jacbts.2024.04.005 OpenUrl CrossRef PubMed Barst , R. J . PDGF signaling in pulmonary arterial hypertension . J Clin Invest 115 , 2691 – 2694 ( 2005 ). doi: 10.1172/JCI26593 OpenUrl CrossRef PubMed Web of Science ↵ Perros , F. et al. Platelet-derived growth factor expression and function in idiopathic pulmonary arterial hypertension . Am J Respir Crit Care Med 178 , 81 – 88 ( 2008 ). doi: 10.1164/rccm.200707-1037OC OpenUrl CrossRef PubMed Web of Science ↵ Dorafshan , S. et al. Periostin: biology and function in cancer . Cancer Cell Int 22 , 315 ( 2022 ). doi: 10.1186/s12935-022-02714-8 OpenUrl CrossRef PubMed Longstreth , J. H. & Wang , K . The role of fibronectin in mediating cell migration . Am J Physiol Cell Physiol 326 , C1212 – C1225 ( 2024 ). doi: 10.1152/ajpcell.00633.2023 OpenUrl CrossRef PubMed Paavola , K. J. et al. The Fibronectin-ILT3 Interaction Functions as a Stromal Checkpoint that Suppresses Myeloid Cells . Cancer Immunol Res 9 , 1283 – 1297 ( 2021 ). doi: 10.1158/2326-6066.CIR-21-0240 OpenUrl Abstract / FREE Full Text Alcorta-Sevillano , N. , Macias , I. , Rodriguez , C. I. & Infante , A . Crucial Role of Lamin A/C in the Migration and Differentiation of MSCs in Bone . Cells 9 ( 2020 ). doi: 10.3390/cells9061330 OpenUrl CrossRef ↵ Malashicheva , A. & Perepelina , K . Diversity of Nuclear Lamin A/C Action as a Key to Tissue-Specific Regulation of Cellular Identity in Health and Disease . Front Cell Dev Biol 9 , 761469 ( 2021 ). doi: 10.3389/fcell.2021.761469 OpenUrl CrossRef PubMed ↵ Vilagos , B. et al. Essential role of EBF1 in the generation and function of distinct mature B cell types . J Exp Med 209 , 775 – 792 ( 2012 ). doi: 10.1084/jem.20112422 OpenUrl Abstract / FREE Full Text ↵ Lin , H. & Grosschedl , R . Failure of B-cell differentiation in mice lacking the transcription factor EBF . Nature 376 , 263 – 267 ( 1995 ). doi: 10.1038/376263a0 OpenUrl CrossRef PubMed ↵ Kim , E. E. et al. The transcription factor EBF1 non-cell-autonomously regulates cardiac growth and differentiation . Development 150 ( 2023 ). doi: 10.1242/dev.202054 OpenUrl CrossRef ↵ Boucherat , O. , Agrawal , V. , Lawrie , A. & Bonnet , S . The Latest in Animal Models of Pulmonary Hypertension and Right Ventricular Failure . Circ Res 130 , 1466 – 1486 ( 2022 ). doi: 10.1161/CIRCRESAHA.121.319971 OpenUrl CrossRef PubMed ↵ Nelson , T. , Velazquez , H. , Troiano , N. & Fretz , J. A . Early B Cell Factor 1 (EBF1) Regulates Glomerular Development by Controlling Mesangial Maturation and Consequently COX-2 Expression . J Am Soc Nephrol 30 , 1559 – 1572 ( 2019 ). doi: 10.1681/ASN.2018070699 OpenUrl Abstract / FREE Full Text Pagani , F. , Tratta , E. , Dell’Era , P. , Cominelli , M. & Poliani , P. L . EBF1 is expressed in pericytes and contributes to pericyte cell commitment . Histochem Cell Biol 156 , 333 – 347 ( 2021 ). doi: 10.1007/s00418-021-02015-7 OpenUrl CrossRef PubMed Catela , C. et al. An ancient role for collier/Olf/Ebf (COE)-type transcription factors in axial motor neuron development . Neural Dev 14 , 2 ( 2019 ). doi: 10.1186/s13064-018-0125-6 OpenUrl CrossRef Crozatier , M. & Vincent , A . Requirement for the Drosophila COE transcription factor Collier in formation of an embryonic muscle: transcriptional response to notch signalling . Development 126 , 1495 – 1504 ( 1999 ). doi: 10.1242/dev.126.7.1495 OpenUrl Abstract Garel , S. , Marin , F. , Grosschedl , R. & Charnay , P . Ebf1 controls early cell differentiation in the embryonic striatum . Development 126 , 5285 – 5294 ( 1999 ). doi: 10.1242/dev.126.23.5285 OpenUrl Abstract Razy-Krajka , F. et al. Collier/OLF/EBF-dependent transcriptional dynamics control pharyngeal muscle specification from primed cardiopharyngeal progenitors . Dev Cell 29 , 263 – 276 ( 2014 ). doi: 10.1016/j.devcel.2014.04.001 OpenUrl CrossRef PubMed Web of Science ↵ Davis , J. A. & Reed , R. R . Role of Olf-1 and Pax-6 transcription factors in neurodevelopment . J Neurosci 16 , 5082 – 5094 ( 1996 ). doi: 10.1523/JNEUROSCI.16-16-05082.1996 OpenUrl Abstract / FREE Full Text ↵ Morrison , S. J. & Spradling , A. C . Stem cells and niches: mechanisms that promote stem cell maintenance throughout life . Cell 132 , 598 – 611 ( 2008 ). doi: 10.1016/j.cell.2008.01.038 OpenUrl CrossRef PubMed Web of Science ↵ Hicks , M. R. & Pyle , A. D . The emergence of the stem cell niche . Trends Cell Biol 33 , 112 – 123 ( 2023 ). doi: 10.1016/j.tcb.2022.07.003 OpenUrl CrossRef ↵ Spemann , H. & Mangold , H . über Induktion von Embryonalanlagen durch Implantation artfremder Organisatoren . Archiv für mikroskopische Anatomie und Entwicklungsmechanik 100 , 599 – 638 ( 1924 ). doi: 10.1007/BF02108133 OpenUrl CrossRef ↵ Gilbert , S. F . Developmental biology / Scott F . Gilbert . 10t h edn, (Sinauer Associates, 2014). ↵ Brownfield , D. G. et al. Alveolar cell fate selection and lifelong maintenance of AT2 cells by FGF signaling . Nat Commun 13 , 7137 ( 2022 ). doi: 10.1038/s41467-022-34059-1 OpenUrl CrossRef PubMed ↵ Ellis , H. M. & Horvitz , H. R . Genetic control of programmed cell death in the nematode C. elegans . Cell 44 , 817 – 829 ( 1986 ). doi: 10.1016/0092-8674(86)90004-8 OpenUrl CrossRef PubMed Web of Science ↵ Zou , H. & Niswander , L . Requirement for BMP signaling in interdigital apoptosis and scale formation . Science 272 , 738 – 741 ( 1996 ). doi: 10.1126/science.272.5262.738 OpenUrl Abstract / FREE Full Text ↵ Ricard , N. , Bailly , S. , Guignabert , C. & Simons , M . The quiescent endothelium: signalling pathways regulating organ-specific endothelial normalcy . Nat Rev Cardiol 18 , 565 – 580 ( 2021 ). doi: 10.1038/s41569-021-00517-4 OpenUrl CrossRef PubMed ↵ Wang , Y. et al. Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis . Nature 465 , 483 – 486 ( 2010 ). doi: 10.1038/nature09002 OpenUrl CrossRef PubMed Web of Science ↵ Beyer , S. , Kelly , R. G. & Miquerol , L . Inducible Cx40-Cre expression in the cardiac conduction system and arterial endothelial cells . Genesis 49 , 83 – 91 ( 2011 ). doi: 10.1002/dvg.20687 OpenUrl CrossRef PubMed Web of Science ↵ Hitz , B. C. et al. The ENCODE Uniform Analysis Pipelines . bioRxiv ( 2023 ). doi: 10.1101/2023.04.04.535623 OpenUrl Abstract / FREE Full Text ↵ Van den Berge , K., et al. Trajectory-based differential expression analysis for single-cell sequencing data . Nat Commun 11 , 1201 ( 2020 ). doi: 10.1038/s41467-020-14766-3 OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted May 07, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following An embryonic artery-forming niche reactivates in pulmonary arterial hypertension Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share An embryonic artery-forming niche reactivates in pulmonary arterial hypertension Wen Tian , Timothy Ting-Hsuan Wu , Shenbiao Gu , Jason L. Chang , Cerianne Huang , Ryan Vinh , Adam M. Andruska , Kyle K. Song , Dongeon Kim , Yu Zhu , Seunghee Lee , Junliang Pan , Peter N. Kao , Tushar Desai , Lawrence S. Prince , Lindsay D. Butcher , Xinguo Jiang , Marlene Rabinovitch , Kristy Red-Horse , Mark R. Nicolls bioRxiv 2025.05.02.651303; doi: https://doi.org/10.1101/2025.05.02.651303 Share This Article: Copy Citation Tools An embryonic artery-forming niche reactivates in pulmonary arterial hypertension Wen Tian , Timothy Ting-Hsuan Wu , Shenbiao Gu , Jason L. Chang , Cerianne Huang , Ryan Vinh , Adam M. Andruska , Kyle K. Song , Dongeon Kim , Yu Zhu , Seunghee Lee , Junliang Pan , Peter N. Kao , Tushar Desai , Lawrence S. Prince , Lindsay D. Butcher , Xinguo Jiang , Marlene Rabinovitch , Kristy Red-Horse , Mark R. Nicolls bioRxiv 2025.05.02.651303; doi: https://doi.org/10.1101/2025.05.02.651303 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-15T06:18:04.506796+00:00