The effect of Entamoeba histolytica Lectin Antigen and MicroRNA-643 on the development of microsatellite instability (MSI) in Colorectal Adenocarcinoma

The effect of Entamoeba histolytica Lectin Antigen and MicroRNA-643 on the development of microsatellite instability (MSI) in Colorectal Adenocarcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The effect of Entamoeba histolytica Lectin Antigen and MicroRNA-643 on the development of microsatellite instability (MSI) in Colorectal Adenocarcinoma Leila Haghighi, Abdolhossein Dalimi, Majid Pirestani, Fatemeh Ghaffarifar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4239958/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Globally, Entamoeba histolytica remains a leading cause of death. The impact of protozoa as environmental factors in microsatellite instability (MSI) remains largely unexplored, as are miRNAs as potential biomarkers for amoeba and in the context of colorectal disease. In this study, we investigated the relationship between the antigenic structure of the Eh -lectin and the altered expression of miRNA-643 and XIAP, a gene involved in apoptosis inhibition. The study aimed to detect E. histolytica , miRNA-643, XIAP, and MSI in 150 colorectal cancer biopsy samples. To achieve this, a multi-faceted approach employing immunohistochemistry (IHC), Multiplex PCR, RT-qPCR, and Real-Time PCR were utilized. For enhanced MSI diagnosis precision, PCR-Multiplex was performed concurrently with IHC. Among the 150 colorectal cancer biopsy samples analyzed, 39 (28 MSI-H and 11 MSI-L) exhibited microsatellite instability (MSI), while the remaining 111 were MSI-negative. Notably, co-occurrence of MSI and E. histolytica antigen was observed in 11 samples. These samples (positive for both MSI and E. histolytica antigen) showed an increased expression of miRNA-643, contrasting with XIAP expression. The concurrence of microsatellite instability (MSI) with E. histolytica antigen positivity and elevated miRNA-643 expression, contrasted with diminished XIAP inhibitor gene levels, in colorectal adenocarcinoma biopsy samples, strongly supports the hypothesis that this protozoan parasite plays a role in MSI development, through its potential involvement in apoptosis. Entamoeba histolytica miRNA-643 MSI microsatellite instability XIAP immunohistochemistry (IHC) PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Despite long-standing research on Entamoeba histolytica infection, gaps remain in understanding its natural history (Zhang et al. 2019 ). While most infected individuals are asymptomatic carriers (colonizing the large intestine), the host defense mechanisms preventing invasive disease remain unclear. A fresh review could spark renewed interest and address this critical knowledge gap (Nair and Variyam 2014 ). Estimates suggest a staggering 480 million infections worldwide, with 36 million experiencing debilitating colitis or extra-intestinal abscesses (Shirley et al. 2018 ). The prevalence of E. histolytica and E. dispar in Iran ranges from 2–30%, likely due to the diverse weather and conditions in different regions (Haque et al. 2003 ). Lectin, an adherence factor for E. histolytica, serves as an indicator for differentiating this parasite from its subgroups by facilitating attachment to intestinal cells. Gal-lectin, a galactose/N-acetylgalactosamine-inhibit able lectin, is crucial for colonizing mucin, binding to host cells, and contributing to disease pathogenesis (Begum et al. 2015 ). Most intestinal cells possess MUC-2, which bind with high affinity to the Gal-lectin carbohydrate recognition domain (CRD Hgl). The heavy and light chains of Gal-lectin are linked by a disulfide bond on a lipid raft base, activating β2 and β7 integrin, key intracellular signal transmitters in E. histolytica (Vines et al. 1998 ). Therefore, Gal-lectin not only identifies and binds to the mucus and mucin of the colon's mucosa and submucosa but also renders E. histolytica resistant to the complement system, making it multifunctional (Petri et al. 2002 ). Interestingly, higher cholesterol levels have been shown to enhance the adhesion of E. histolytica to galactose on the host cell surface (Welter et al. 2011 ). In E. histolytica , the voracious protozoan responsible for human amoebiasis, phagocytosis is a key factor in its virulence (Avalos-Padilla et al. 2018 ). It has the inherent capacity to ingest other cells through phagocytosis and trogocytosis, a processes crucial for both reproduction and pathogenicity (Watanabe et al. 2020 ). The activation of cytolytic and proteolytic enzymes leads to cleaving caspases, ultimately leading to cell death – apoptosis (Ralston and Petri 2011 ). However, the role of host non-coding RNAs like microRNAs in this precise regulation remains enigmatic. These small, single-stranded RNA molecules guide post-transcriptional gene silencing, influencing mRNA degradation or translation inhibition and play a role in various infectious diseases (Di Leva et al. 2014 ). Recent studies have identified additional structural sequences crucial for efficient miRNA production. These include the length of the UGU motif in the apical loop, a GHG motif in the stalk, and a UG and CNNC motif in the basal region of the pri-miRNA (Connerty et al. 2015 ). RNA-binding proteins play essential roles as regulators of miRNA biogenesis and activity, with RNA-RNA and protein-RNA interactions being vital for post-transcriptional regulation during normal development. However, these interactions must be deregulated in diseases (van Kouwenhove et al. 2011 ). MicroRNAs (miRNAs) exhibit aberrant expression in nearly all types of cancer, including gastrointestinal cancers. Various digestive cancers, such as those of the esophagus, stomach, liver, pancreas, colon, and rectum, can be distinguished based on their miRNA expression profiles (Tang et al. 2016 ). MicroRNAs are being investigated as potential cancer biomarkers due to their extracellular stability and their locations within cancer-associated genomic regions (Alamoudi et al. 2017 ). Apoptosis can be linked to colon cancer development by altering the chromosomal structure and destabilizing terminal microsatellites, a state known as MSI (microsatellite instability) (Peltomäki 2001 ; Grillo et al. 2022 ). Apoptosis-induced mutations in nucleic acid repair genes and mismatches in the DNA mismatch repair system contribute to chromosomal instability, leading to MSI. According to reports, 15% of hereditary colorectal cancers are MSI positive. Five indices: NR27, BAT-26, BAT-25, NR21& NR24, are used to evaluate microsatellite stability. Based on the level of instability, MSI is classified into high (H-MSI), stable (MSS), and low (L-MSI) groups (Cai et al. 2020 ). H-MSI accounts for over 90% of these mutations (Nojadeh et al. 2018 ). Building on findings that E. histolytica induces cell apoptosis in colon cancer cell lines via increased miRNA-643 expression (López-Rosas et al. 2018 ), it should be noted that there has been no clinical research on tumoral adenocarcinoma cells to investigate the expression level of miRNA-643, particularly regarding the incidence of MSI and its relationship with the antigenic manifestation of E. histolytica lectin and the anti-apoptotic gene XLAP. This study aims to achieve two key objectives: (1) Identify the presence of a specific E. histolytica surface protein (e.g., Gal-lectin) on the surface of colorectal adenocarcinoma tumor cells and (2) investigate the potential association between miRNA-643 expression and microsatellite instability (MSI) in patients with this disease. By analyzing this association through correlation analysis and functional assays, this study seeks to unravel potential diagnostic, prognostic, or therapeutic implications, ultimately contributing to more effective treatment strategies for colorectal cancer. 2. Materials and Methods 2.1. Sample Collection To investigate E. histolytica antigen and microsatellite instability (MSI) in 150 colorectal adenocarcinoma biopsy samples, 3–5 µm sections were prepared on Poly-L-lysine-coated slides from paraffin blocks for immunohistochemical staining. Additionally, DNA was extracted for MSI detection using Multiplex PCR. For miRNA assessment by RT-qPCR and Real-Time PCR, 5 micro tubes, each containing 3 sections of 15 µm, were collected from separate samples. 2.2. Ethical Review The Ethical Committee of Tarbiat Modares University (Tehran, Iran), approved this study with Code No.: IR.MODARES.REC.1402.004. Informed written consent was obtained from all patients for the inclusion of their colorectal biopsy samples in the study. 2.3. DNA extraction : Micro tubes collected after deparaffinization with xylene were used for the extraction of genomic DNA from colorectal biopsy specimens with the GeneAll® Exgene™ FFPE Tissue DNA kit (South Korea) according to the manufacturer's instructions. 2.4. Multiplex PCR : Multiplex PCR was performed using various markers and specific primers listed in Table 1 . Reaction mixtures were prepared in 25 µL volumes, containing 5.5 µL of Taq Master Mix, 10 pmol of each primer (1 µM for both forward and reverse), 4 µL of template DNA, and nuclease-free water to adjust to the final volume. The PCR protocol included an initial denaturation at 95°C for 5 minutes, followed by 40 cycles of: denaturation at 95°C for 40 seconds, annealing at 54°C for 33 seconds, and extension at 72°C for 1 minute. A final extension was performed at 72°C for 30 minutes. Amplified products were then visualized by electrophoresis on a 2% agarose gel containing red gel dye. Table 1 Primers sequences and amplicon size of PCR program for MSI detection Marker Primer sequences(5' to3') Amplicon size (bp) Gene BAT-25 F: TACCAGGTGGCAAAGGGCA R: TCTGCATTTTAACTATGGCTC 153 c-Kit BAT-26 F: CTGCGGTAATCAAGTTTTTTAG R: AACCATTCAACATTTTTAACCC 183 HMSH2 NR-27 F: AACCATGCTTGCAAACCACT R: CGATAATACTAGCAATGACC 87 Inhibitor of apoptosis protein-1 NR-21 F: GAGTCGCTGGCACAGTTCTA R: CTGGTCACTCGCGTTTACAA 109 SLC7A8 NR-24 F: GCTGAATTTTACCTCCTGAC R:ATTGTGCCATTGCATTCCAA 131 Zinc finger 2 2.5. Immunohistochemical staining : To investigate E. histolytica lectin and microsatellite instability (MSI), immunohistochemical staining was performed on tissue sections. Following deparaffinization, dehydration, and peroxidase inhibition with 3% hydrogen peroxide in methanol, antigen retrieval was achieved in citrate buffer (pH 6) at 121°C for 15 minutes under 15 psi pressure in an autoclave. After autoclaving and cooling, the slides were placed in PBS buffer. After cooling, the slides were incubated with an anti-Gal-lectin monoclonal antibody (HK-9 strain) from GeneTex to detect the specific E. histolytica lectin, followed by a blocking protein step. To investigate MSI, antibodies against PMS2, MSH6, MSH2, and MLH1 from Master Company (Masterdiagnostica, ready to use) were subsequently applied. Incubation with specific antibodies lasted 1.5 hours, followed by a master secondary antibody. Diaminobenzene (DAB) substrate and Mayer's hematoxylin were employed for detection and analysis of the antibody reactions, with hematoxylin providing counterstaining. 2.6. Detecting miRNA-643 and XIAP in Biopsy Samples : RNA was extracted from deparaffinized colorectal biopsy samples using the QIAGEN® kit. Subsequently, cDNA was synthesized with primers designed by Bon Yakhte Company (mir-643-F: GAACTTGTATGGTATCTCAGGT and RNU6-F: AAGGATGACACGCAAATTC) using a temperature program of 37°C for 10 minutes, 55°C for 60 minutes, and 70°C for 10 minutes. To assess the expression levels of miRNA-643 and XIAP, an anti-apoptotic gene, qRT-PCR was conducted using SYBR-Green on an ABI7500 system (Applied Bio systems, USA). Three replicates of each experiment were performed. Real-time reactions followed a temperature program of 95°C for 2 minutes, then 40 cycles of 95°C for 5 seconds, and 60°C for 30 seconds. The relative expression of miRNAs was quantified using the comparative Ct method (2^−ΔΔCT) and the Delta-Delta-Ct (ddCt) Algorithm, with GAPDH serving as an internal control for data normalization (Table 2 ). Table 2 sequence of miRNA-643, XIAP, GAPDH primer Marker Primers Sequence(5'to3') has-46 F: has-46 R: GTG CTC GTC TCG GCA GCA CAT ATA C AAA AAT ATG GAA CGC TTC ACG AAT TTG has-XIAP F: has-XIAP R: TTC ACT TGA CGA GTG TCT GGT TGT CCT TGA AAC TGA ACC CCA has-GAPDH F: has-GAPDH R: TTG ACC TCA ACT ACA TGG TTT ACA GCT CCT GGA AGA TGG TGA TG has-miRNA 643 F: has-miRNA 643 R: GCA GAC TTG TAT GCT AGC TCA GTC CAG TTT TTT TTT TTT TTT CTA CCT 2.7. Statistical Analysis Data were presented as Mean ± SD and analyzed using SPSS version 23.0 software. A P-value of less than 0.05 was considered statistically significant. The associations between miR-643 expression levels and the parameters of colorectal cancer (CRC) patients were evaluated using the Pearson χ2 test. The kappa test was utilized to determine the concordance between the expression level of miR-643 and MSI status. The differences in miR-643 levels between MSI-positive and E. histolytica-positive cases were assessed using the McNemar test, with P < 0.05 indicating statistical significance. 3. Results 3.1. General results Of the 150 colorectal adenocarcinoma samples examined, 19 cases tested positive for the E. histolytica lectin light chain antigen by immunohistochemistry. Meanwhile, 39 cases were positive for MSI using PCR (Fig. 1 ), and 37 cases with IHC (Fig. 2 ). The degree of concordance between PCR and IHC methods in detecting MSI positivity was 95%. Out of a total of 39 MSI + cases, 28 cases had more than 2 positive indices, placing them in the MSI-H group, and 11 cases had a positive index, indicating MSI-L, which signifies a higher percentage of MSI-H (71.7%) in MSI-positive samples (Table 3 ). Table 3 Comparison of MSI-H and MSI-L percentages in 39 MSI + cases MSI High N (%) MSI Low N (%) Chi-square Statistics P-value MSI+ (N Total = 39) 28 (0.72) 11 (0.28) 7.41 0.009 Table 4 The relationship between Adenocarcinoma, E. histolytica- lectin and MSI . No. MSI+ No. (%) MSI- No. (%) Sig P-value E. histolytica ( Eh-L )+ 19 11 (58%) 8 (42%) < 0.05 E. histolytica ( Eh-L )- 131 28 (21.37%) 103 (78.62%) < 0.009 Adenocarcinoma 150 39 (26%) 111 (74%) < 0.001 Out of 39 MSI + cases, 11 cases were positive for E. histolytica light chain antigen. Out of 131 cases of MSI-, 8 cases were confirmed by light chain antigen of this protozoan. The difference in E. histolytica positivity between the MSI + and MSI − groups was not statistically significant based on Fisher's exact test (P > 0.05). However, a significant difference was observed when comparing E. histolytica negative samples with positive and negative MSI status (P < 0.009). Additionally, a significant difference was noted in the concurrent examination of MSI and E. histolytica (P < 0.05). Out of the 39 MSI-positive samples, MSI + was observed in 3 samples, and there was a significant difference between these two groups (P < 0.05). The results obtained from the measurement of miRNA-643 expression levels indicated that the samples could be divided into four groups as follows: The first group: MSI positive but E. histolytica antigen negative. The second group: MSI negative but E. histolytica lectin antigen positive. The third group: Both E. histolytica lectin antigen and MSI positive and the fourth group: Compared the expression of miRNA-643 and the anti-apoptotic gene XIAP, where E. histolytica antigen was positive (Table 5 ). 3.2. The expression results of miRNA-643 and XIAP gene : According to Table 5 , the first group exhibited a threefold increase in XIAP gene expression compared to miRNA-643, and the second group showed a fourfold increase in anti-apoptotic gene expression. The third group revealed a threefold increase in miRNA-643 expression compared to the anti-apoptotic gene. In the fourth group, related to E. histolytica positive antigen samples and their relationship with miRNA-643, the co-expression of miRNA-643 and XIAP was indicated, which was not statistically significant with a p-value > 0.5. All groups were measured based on the GAPDH gene with an expression level of 1. The expression results of miRNA-643 and XIAP gene, according to Table 5 , showed increased expression of XIAP compared to miRNA-643 in the first group. In the second group, both genes had increased expression, but the increase in the expression of the anti-apoptotic gene XIAP was observed much more. In the third group, where all the indicators measured in the research showed an increase in the expression of miRNA-643. However, in the fourth group, as in the second group, an increase in the expression of XIAP was observed, and was considered insignificant in terms of p-value > 0.05. Table 5 miRNA-643 and XIAP expression results in the four investigated groups mir643 XIAP Expression P value Regulated Expression P value Regulated Group 1 0.146 0.001 DOWN 3.769 0.088 UP Group 2 3.9 0.014 UP 12.036 0.005 UP Group 3 1.437 0.033 UP 0.425 0.019 DOWN Group 4 0.555 0.595 UP 0.342 0.653 UP Group 1: MSI positive, E .histolytica negative, group 2: MSI negative, E.histolytica positive, Group 3: MSI and E.histolytica positive, Group 4: Relationship of miRNA643 with E.histolytica positive. The first group exhibited a threefold increase in XIAP gene expression relative to miRNA-643, and the second group exhibited a fourfold increase in anti-apoptotic gene expression. The third group exhibited a threefold increase in the expression of miRNA-643 compared to the anti-apoptotic gene. In the fourth group, related to E. histolytica positive antigen samples and their association with miRNA-643, the co-expression of miRNA-643 and XIAP was observed, but it was not statistically significant with a p-value > 0.5. The samples positive for MSI and E. histolytica lectin antigen, demonstrated an increase in miRNA-643 expression compared to the XIAP anti-apoptotic gene, based on the 2^−∆∆CT results from data analysis (P < 0.019). 4. Discussion Entamoeba histolytica is known to induce host cell apoptosis, and studies are investigating the ability of Gal/GalNAc lectin to trigger apoptosis, the role of amoeba pore in activating host caspases, and the potential of amoebic proteases to directly activate effector caspases upon entering the host cell cytoplasm (Huston et al. 2003 ). Colorectal cancer is among the most prevalent cancers in Iran, ranking third among cancers (Azadeh et al. 2008). The significance of MSI as a diagnostic biomarker has gained attention for improving treatment for patients with colorectal cancer, with about 15% of colorectal cancers being MSI-positive (Wei et al. 2011 ). However, environmental and acquired factors influencing MSI development have not been thoroughly studied. Conversely, studies have demonstrated the association of certain bacteria, such as Fusobacterium nucleatum and Epstein-Barr virus, with colon cancer tissue and their correlation with MSI at the tumor site (Mjelle et al. 2019 ). Thus, in addition to molecular methods, immunohistochemical techniques have been employed due to advancements in antigen detection in tissue sections (Ruan et al. 2020 ). Immunohistochemistry, a fundamental technique used for diagnostic and research purposes in many laboratories, plays a crucial role in tumor immunophenotyping and the evaluation of tissue-specific genes, which is important for tumor classification at various diagnostic stages (Geramizadeh et al. 2021 ; Haghighi et al. 2022 ) used this method to identify the specific antigen of this protozoan in colorectal lesion biopsy samples, finding lectin antigen presence on the tumor cell surface in 8 MSI-positive samples. The absence of E. histolytica DNA in adenocarcinoma biopsy samples by the PCR technique suggested that patients with adenocarcinoma were not concurrently infected with this protozoan (Haghighi et al. 2022 ). Nevertheless, the detection of this protozoan's antigen on the surface of colorectal tumor cells remained an open question and required additional verification (Rebersek 2021 ). Changes in the intestinal microbiome are also linked to colorectal cancer, potentially enhancing the invasion of intestinal parasitic diseases. The invasive process of E. histolytica trophozoites induces significant changes in the host's genetic programs, largely described by the phenomenon of protozoan trogocytosis (Ralston et al. 2014 ). Moreover, the involvement of microRNAs in the apoptosis of colorectal tumor cells has been explored, with various identification methods employed (Bartel 2004 ). The biogenesis of miRNAs starts in the cell nucleus, where they are transcribed from specific genes by RNA polymerase II or III as primary transcripts (pri-mRNA). MiRNAs can act on their target genes in two main ways: if the miRNA binds to an mRNA with a high-affinity complementary transcript, it leads to mRNA degradation; if the miRNA binds incompletely, it results in the repression of mRNA translation (Hata and Lieberman 2015 ). In recent years, miRNAs have been recognized as potential diagnostic and prognostic biomarkers, modulators of chemo resistance, and a new therapeutic option (Qureshi and Sacan 2013 ). The tumor-suppressive potential of miR-643 has garnered attention, with studies showing that miR-643 can inhibit cell proliferation, invasion, and metastasis by downregulating RAF1 (rapidly accelerated fibro sarcoma) expression in lung cancer cells and increasing radiation sensitivity during radiotherapy (Tian et al. 2023 ). Additionally, miRNA-643 has been shown to decrease cell proliferation mediated by TPC-1 (Two pore segment channel 1) and increase the expression of the KI67 antigen and apoptosis-related proteins such as Bax and caspase-3 in papillary thyroid carcinoma cells (Yin and Shao 2020 ). On the other hand, cells have genes that inhibit cell death or apoptosis; one of these genes, the XIAP, is coded by the XIAP gene and prevents cell death by inhibiting caspases, which is vital to cells. It also increases significantly in cancer cells (Latour and Aguilar 2015 ). The mutation disorder in this gene is the cause of various diseases, as well as Crohn’s disease (Peng et al. 2023 ). One study indicated that miRNA-643, which was upregulated in SW-480 tumor cells in contact with E. histolytica trophozoites, could counteract the XIAP apoptosis inhibitor gene. However, the function and mechanism of miR-643 in colorectal cancer remain under-researched, with studies indicating that miR-643 inhibits cell viability and promotes apoptosis in gastric cancer (Wu et al. 2021 ). This study's analysis of colon adenocarcinoma biopsy cells, particularly those positive for MSI and E. histolytica antigen, revealed a threefold increase in miRNA-643 expression, echoing findings from SW480 cell line cultures (Xie et al. 2020 ). Since PCR results negated active amoebiasis infection, and immunohistochemistry and Western blotting indicated the presence of E. histolytica lectin light chain on the surface of tumor cells, two hypotheses emerged: firstly, that patients may have had a prior infection with this protozoan, leaving the lectin antigenic index in the cells, and secondly, that tumor cells might mimic antigens similar to E. histolytica , which could serve as a treatment marker for colorectal adenocarcinoma using recombinant protozoan lectin. The observed increase in miRNA-643 expression in adenocarcinoma cells suggests its role as an apoptosis-inducing factor in these patients, warranting further investigation. 5. Conclusion Current treatment guidelines for cancers recommend targeted approaches based on clinical trial outcomes. The findings of this study indicate that MSI-positive samples, which also tested positive for E. histolytica lectin light chain antigen and showed higher expression of miRNA-643, reinforce the role of this protozoan in MSI development, suggesting its potential as an auxiliary biomarker for identifying mutations such as NRAS, BRAF, and KRAS in colorectal adenocarcinoma patients. Moreover, the study suggests the potential application of the protozoan's lectin antigenic index as a platform for enhancing drug delivery to tumor cells and inducing apoptosis. This proposition underscores the need for additional research in this specific area to explore its practical implications and therapeutic benefits. Our study's broader significance lies in identifying E. histolytica as a potential colorectal cancer biomarker linked to specific mutations, offering new avenues for understanding cancer development. It introduces an innovative approach for refined diagnostics and treatments. While promising, further validation and clinical studies are essential to confirm E. histolytica lectin's utility as a reliable biomarker. Continued investigation will solidify these findings and pave the way for personalized cancer therapies and diagnostics. Declarations Consent to publish Yes . Funding source This research was financially supported by Tarbiat Modares University, Tehran, Iran. Grant No. MED33164270 . Data availability All data generated or analyzed during this study are included in this published article. The raw data are available from the corresponding author upon reasonable request . Credit authorship contribution statement L . H . : Writing – review & editing, Writing – original draft, Software, Methodology, Investigation, Formal analysis, Data curation. A . D . : Writing – review & editing, Visualization, Supervision, Project administration, Funding acquisition, Conceptualization. M . P . : Writing – original draft, Validation, Software, Formal analysis. F . Gh . : Writing – original draft, Visualization, Validation, Methodology. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper . Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper . Medical Ethics Certificate : This study received approval from the ethics committee of Tarbiat Modares University, bearing the code number: IR.MODARES.REC.1402.004 . Acknowledgments : The authors of this article would like to thank all the staff of the Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, as well as the colleagues of the Stem Cell Center of Tabriz University, for their assistance . References Alamoudi AA, Alnoury A, Gad H (2017) miRNA in tumour metabolism and why could it be the preferred pathway for energy reprograming. Brief Funct Genomics 17:157–169. 10.1093/bfgp/elx023 Avalos-Padilla Y, Knorr RL, Javier-Reyna R et al (2018) The Conserved ESCRT-III Machinery Participates in the Phagocytosis of Entamoeba histolytica . Front Cell Infect Microbiol 8:53. 10.3389/fcimb.2018.00053 Bartel DP (2004) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 116:281–297 Begum S, Quach J, Chadee K (2015) Immune Evasion Mechanisms of Entamoeba histolytica Cai L, Sun Y, Wang K et al (2020) The Better Survival of MSI Subtype Is Associated With the Oxidative Stress Related Pathways in Gastric Cancer. Front Oncol 10:1269. 10.3389/fonc.2020.01269 Connerty P, Ahadi A, Hutvagner G (2015) RNA Binding Proteins in the miRNA Pathway. Int J Mol Sci 17. 10.3390/ijms17010031 Di Leva G, Garofalo M, Croce CM (2014) MicroRNAs in cancer. Annu Rev Pathol 9:287–314. 10.1146/annurev-pathol-012513-104715 Geramizadeh B, Bozorg-Ghalati F, Jafari F et al (2021) Microsatellite Instability and Colorectal Cancer, Immunohistochemical and Molecular Evaluation by Using DNA Sequencing: A Single Center Experience. Iran J Pathol 16:325–331. 10.30699/ijp.2021.131467.2462 Grillo F, Campora M, Carlin L et al (2022) Stranger things in the gut: uncommon items in gastrointestinal specimens. Virchows Arch 480:231–245. 10.1007/s00428-021-03188-1 Haghighi L, Razmjou E, Rafiei-Sefiddashti R et al (2022) Entamoeba histolytica and Probable Effect on Production Microsatellite Instability in Colorectal Cancer. Curr Microbiol 79:111. 10.1007/s00284-022-02782-z Haque R, Huston CD, Hughes M et al (2003) Amebiasis. N Engl J Med 348:1565–1573. 10.1056/NEJMra022710 Hata A, Lieberman J (2015) Dysregulation of microRNA biogenesis and gene silencing in cancer. Sci Signal 8:re3. 10.1126/scisignal.2005825 Huston CD, Boettner DR, Miller-Sims V, Petri WA Jr. (2003) Apoptotic killing and phagocytosis of host cells by the parasite Entamoeba histolytica . Infect Immun 71:964–972. 10.1128/iai.71.2.964-972.2003 Latour S, Aguilar C (2015) XIAP deficiency syndrome in humans. Semin Cell Dev Biol 39:115–123. https://doi.org/10.1016/j.semcdb.2015.01.015 López-Rosas I, López-Camarillo C, Salinas-Vera YM et al (2018) Entamoeba histolytica Up-Regulates MicroRNA-643 to Promote Apoptosis by Targeting XIAP in Human Epithelial Colon Cells. Front Cell Infect Microbiol 8:437. 10.3389/fcimb.2018.00437 Mjelle R, Sjursen W, Thommesen L et al (2019) Small RNA expression from viruses, bacteria and human miRNAs in colon cancer tissue and its association with microsatellite instability and tumor location. BMC Cancer 19:161. 10.1186/s12885-019-5330-0 Nair GV, Variyam EP (2014) Noninvasive intestinal amebiasis: Entamoeba histolytica colonization without invasion. Curr Opin Infect Dis 27:465–469. 10.1097/qco.0000000000000095 Nojadeh JN, Behrouz Sharif S, Sakhinia E (2018) Microsatellite instability in colorectal cancer. Excli j 17:159–168. 10.17179/excli2017-948 Peltomäki P (2001) Deficient DNA mismatch repair: a common etiologic factor for colon cancer. Hum Mol Genet 10:735–740. 10.1093/hmg/10.7.735 Peng C, Jiang Y, Ou X et al (2023) Novel XIAP mutation with early-onset Crohn’s disease complicated with acute heart failure: a case report. BMC Cardiovasc Disord 23:368. 10.1186/s12872-023-03386-6 Petri JWA, Haque R, Mann BJ (2002) The bittersweet interface of parasite and host: lectin-carbohydrate interactions during human invasion by the parasite Entamoeba histolytica . Annu Rev Microbiol 56:39–64. 10.1146/annurev.micro.56.012302.160959 Qureshi R, Sacan A (2013) A novel method for the normalization of microRNA RT-PCR data. BMC Med Genomics 6:S14. 10.1186/1755-8794-6-S1-S14 Ralston KS, Petri JWA (2011) Tissue destruction and invasion by Entamoeba histolytica . Trends Parasitol 27:254–263. 10.1016/j.pt.2011.02.006 Ralston KS, Solga MD, Mackey-Lawrence NM et al (2014) Trogocytosis by Entamoeba histolytica contributes to cell killing and tissue invasion. Nature 508:526–530. 10.1038/nature13242 Rebersek M (2021) Gut microbiome and its role in colorectal cancer. BMC Cancer 21:1325. 10.1186/s12885-021-09054-2 Ruan H, Leibowitz BJ, Zhang L, Yu J (2020) Immunogenic cell death in colon cancer prevention and therapy. Mol Carcinog 59:783–793. https://doi.org/10.1002/mc.23183 Shirley DAT, Farr L, Watanabe K, Moonah S (2018) A review of the global burden, new diagnostics, and current Therapeutics for amebiasis. Open Forum Infect Dis 5:ofy161. 10.1093/ofid/ofy161 Tang S, Wu WK, Li X et al (2016) Stratification of Digestive Cancers with Different Pathological Features and Survival Outcomes by MicroRNA Expression. Sci Rep 6:24466. 10.1038/srep24466 Tian H, Ding K, Wang Z et al (2023) miR-643 suppresses cell invasion and radioresistant of lung cancer through RAF1. Precis Med Sci 12:113–120. https://doi.org/10.1002/prm2.12102 van Kouwenhove M, Kedde M, Agami R (2011) MicroRNA regulation by RNA-binding proteins and its implications for cancer. Nat Rev Cancer 11:644–656. 10.1038/nrc3107 Vines RR, Ramakrishnan G, Rogers JB et al (1998) Regulation of adherence and virulence by the Entamoeba histolytica lectin cytoplasmic domain, which contains a beta2 integrin motif. Mol Biol Cell 9:2069–2079. 10.1091/mbc.9.8.2069 Watanabe N, Nakada-Tsukui K, Nozaki T (2020) Two isotypes of phosphatidylinositol 3-phosphate-binding sorting nexins play distinct roles in trogocytosis in Entamoeba histolytica . Cell Microbiol 22:e13144. 10.1111/cmi.13144 Wei W, Liu F, Liu L et al (2011) Distinct mutations in MLH1 and MSH2 genes in hereditary non-polyposis colorectal cancer (HNPCC) families from China. BMB Rep 44:317–322. 10.5483/BMBRep.2011.44.5.317 Welter BH, Goldston AM, Temesvari LA (2011) Localisation to lipid rafts correlates with increased function of the Gal/GalNAc lectin in the human protozoan parasite, Entamoeba histolytica . Int J Parasitol 41:1409–1419. 10.1016/j.ijpara.2011.10.003 Wu Y, Ye H, Peng B et al (2021) MiR-643 Functions as a Potential Tumor Suppressor in Gastric Cancer by Inhibiting Cell Proliferation and Invasion via Targeting TXNDC9. Ann Clin Lab Sci 51:494–502 Xie YH, Chen YX, Fang JY (2020) Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Target Ther 5:22. 10.1038/s41392-020-0116-z Yin H, Shao J (2020) MicroRNA-643 promotes proliferation and inhibits apoptosis of papillary thyroid carcinoma by down-regulating the cytochrome P450 family member 11B1. Transl Cancer Res 9:1465–1475. 10.21037/tcr.2020.01.43 Zhang Y, Niu Q, Fan W et al (2019) Oral microbiota and gastrointestinal cancer. Onco Targets Ther 12:4721–4728. 10.2147/ott.S194153 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4239958","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":289343615,"identity":"6380b534-d720-44c4-8c48-113fd2d7c672","order_by":0,"name":"Leila Haghighi","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Leila","middleName":"","lastName":"Haghighi","suffix":""},{"id":289343616,"identity":"49861a2f-1dcb-4dcb-899a-ad31551da59d","order_by":1,"name":"Abdolhossein Dalimi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYDCCA8wNBxgMGBj4gWwJuGgCXi2MEC2SDaRoAdMGB5C14AN8xw82HrpRwCBvfO3wwRs/99jYM7AffsDwcA9uLZJnEhsO5xgwGG67nZZs2fMsLbGBJ82AIeEZbi0GByBaGLfdzjGT4DlwGOiLHKBfDuDRcv4hWIv95tk5ZpJ/Dvy3Z+B/Q0DLDYgtiRukc8ykeQ4AQ0OCgC2SNyC2JM8A+sVa5kByYpvEM4MD+LTwnU8+/DnnD4Nt/+zkgzffHLCz5+dPfvjwBx4tUPAfwWQDYsIaRsEoGAWjYBTgBQDVSlhLcB8whAAAAABJRU5ErkJggg==","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":true,"prefix":"","firstName":"Abdolhossein","middleName":"","lastName":"Dalimi","suffix":""},{"id":289343618,"identity":"39248d57-f5a2-4bf0-bae0-21348f40eb97","order_by":2,"name":"Majid Pirestani","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Majid","middleName":"","lastName":"Pirestani","suffix":""},{"id":289343619,"identity":"8dfac4cd-b815-4a2b-b4ac-b6cccd3a12e2","order_by":3,"name":"Fatemeh Ghaffarifar","email":"","orcid":"","institution":"Tarbiat Modares University","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Ghaffarifar","suffix":""}],"badges":[],"createdAt":"2024-04-09 06:09:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4239958/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4239958/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54592301,"identity":"0ee5dfd8-db8a-49e8-93a2-d432bf5b28fb","added_by":"auto","created_at":"2024-04-12 17:39:20","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":244307,"visible":true,"origin":"","legend":"\u003cp\u003eMSI electrophoresis gel: with two positive indicators (H-MSI). Well number 1: NR-27 negative, number 2: NR-24 negative, number 3: NR-21 negative, number 4: BAT-25 positive, 5: BAT-26 positive, number 6: negative control number 7: blank, number 8: marker size\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4239958/v1/43b6205358dc69f37b606764.jpeg"},{"id":54592302,"identity":"7c812b1b-a5ee-4666-9b7a-971b7a5337ec","added_by":"auto","created_at":"2024-04-12 17:39:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":786754,"visible":true,"origin":"","legend":"\u003cp\u003eImmunohistochemical staining pictures related to microsatellite instability are presented as follows: A\u0026amp;B depict positive staining for MLH1 and MSH2 mutations, while C\u0026amp;D showcase negative staining for mutations of MSH6 and PMS2. It is worth mentioning that in the analysis of immunohistochemical slides of microsatellite samples, the color ability of tumoral cell nuclei with chromogen indicates the absence of mutation in the investigated marker and is considered negative from the point of view of the specific antibody (Arrows). E: Negative and F: Positive cytoplasmic staining image (40x) for \u003cem\u003eE. histolytica\u003c/em\u003e lectin light chain antigen\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4239958/v1/0db80ea2f9c32e83d42bc6c5.png"},{"id":54592305,"identity":"9181c919-cb7f-4dcb-b623-8c7572deb5c6","added_by":"auto","created_at":"2024-04-12 17:39:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":16703,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of \u003cem\u003eE. histolytica positive\u003c/em\u003e percentage in MSI positive and MSI negative group.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4239958/v1/31bedcfa710772407f119d7d.png"},{"id":54592303,"identity":"d017695d-b1a6-466d-a98a-5f7f44723bad","added_by":"auto","created_at":"2024-04-12 17:39:21","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":124526,"visible":true,"origin":"","legend":"\u003cp\u003eA) The 2^−∆∆CT values related to the XIAP anti-apoptotic gene in four groups were as follows: Group 1 - MSI negative\u003cem\u003e, E. histolytica\u003c/em\u003e negative; Group 2 - MSI positive, \u003cem\u003eE. histolytica\u003c/em\u003e negative; Group 3 - MSI positive and \u003cem\u003eE. histolytica\u003c/em\u003e positive; Group 4 - \u003cem\u003eE. histolytica\u003c/em\u003e positive and related to the expression of miRNA643 and XIAP gene\u003c/p\u003e\n\u003cp\u003eB) The results for the miRNA-643 gene in these groups showed that Group 3 exhibited a threefold increase in miRNA-643 expression compared to the anti-apoptotic gene.\u003c/p\u003e","description":"","filename":"floatimage33.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4239958/v1/eb31462094ad9959340b891c.jpeg"},{"id":54597412,"identity":"53287fd5-cadb-4d01-a5fb-7238c240abac","added_by":"auto","created_at":"2024-04-12 19:16:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1453985,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4239958/v1/db467fc7-b73f-45c3-a08e-2b04c6ca37c2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The effect of Entamoeba histolytica Lectin Antigen and MicroRNA-643 on the development of microsatellite instability (MSI) in Colorectal Adenocarcinoma","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDespite long-standing research on \u003cem\u003eEntamoeba histolytica\u003c/em\u003e infection, gaps remain in understanding its natural history (Zhang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). While most infected individuals are asymptomatic carriers (colonizing the large intestine), the host defense mechanisms preventing invasive disease remain unclear. A fresh review could spark renewed interest and address this critical knowledge gap (Nair and Variyam \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Estimates suggest a staggering 480\u0026nbsp;million infections worldwide, with 36\u0026nbsp;million experiencing debilitating colitis or extra-intestinal abscesses (Shirley et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe prevalence of \u003cem\u003eE. histolytica\u003c/em\u003e and \u003cem\u003eE. dispar\u003c/em\u003e in Iran ranges from 2\u0026ndash;30%, likely due to the diverse weather and conditions in different regions (Haque et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Lectin, an adherence factor for E. histolytica, serves as an indicator for differentiating this parasite from its subgroups by facilitating attachment to intestinal cells. Gal-lectin, a galactose/N-acetylgalactosamine-inhibit able lectin, is crucial for colonizing mucin, binding to host cells, and contributing to disease pathogenesis (Begum et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Most intestinal cells possess MUC-2, which bind with high affinity to the Gal-lectin carbohydrate recognition domain (CRD Hgl). The heavy and light chains of Gal-lectin are linked by a disulfide bond on a lipid raft base, activating β2 and β7 integrin, key intracellular signal transmitters in \u003cem\u003eE. histolytica\u003c/em\u003e (Vines et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Therefore, Gal-lectin not only identifies and binds to the mucus and mucin of the colon's mucosa and submucosa but also renders \u003cem\u003eE. histolytica\u003c/em\u003e resistant to the complement system, making it multifunctional (Petri et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Interestingly, higher cholesterol levels have been shown to enhance the adhesion of \u003cem\u003eE. histolytica\u003c/em\u003e to galactose on the host cell surface (Welter et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eE. histolytica\u003c/em\u003e, the voracious protozoan responsible for human amoebiasis, phagocytosis is a key factor in its virulence (Avalos-Padilla et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It has the inherent capacity to ingest other cells through phagocytosis and trogocytosis, a processes crucial for both reproduction and pathogenicity (Watanabe et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The activation of cytolytic and proteolytic enzymes leads to cleaving caspases, ultimately leading to cell death \u0026ndash; apoptosis (Ralston and Petri \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, the role of host non-coding RNAs like microRNAs in this precise regulation remains enigmatic. These small, single-stranded RNA molecules guide post-transcriptional gene silencing, influencing mRNA degradation or translation inhibition and play a role in various infectious diseases (Di Leva et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Recent studies have identified additional structural sequences crucial for efficient miRNA production. These include the length of the UGU motif in the apical loop, a GHG motif in the stalk, and a UG and CNNC motif in the basal region of the pri-miRNA (Connerty et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). RNA-binding proteins play essential roles as regulators of miRNA biogenesis and activity, with RNA-RNA and protein-RNA interactions being vital for post-transcriptional regulation during normal development. However, these interactions must be deregulated in diseases (van Kouwenhove et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). MicroRNAs (miRNAs) exhibit aberrant expression in nearly all types of cancer, including gastrointestinal cancers. Various digestive cancers, such as those of the esophagus, stomach, liver, pancreas, colon, and rectum, can be distinguished based on their miRNA expression profiles (Tang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). MicroRNAs are being investigated as potential cancer biomarkers due to their extracellular stability and their locations within cancer-associated genomic regions (Alamoudi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Apoptosis can be linked to colon cancer development by altering the chromosomal structure and destabilizing terminal microsatellites, a state known as MSI (microsatellite instability) (Peltom\u0026auml;ki \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Grillo et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Apoptosis-induced mutations in nucleic acid repair genes and mismatches in the DNA mismatch repair system contribute to chromosomal instability, leading to MSI. According to reports, 15% of hereditary colorectal cancers are MSI positive. Five indices: NR27, BAT-26, BAT-25, NR21\u0026amp; NR24, are used to evaluate microsatellite stability. Based on the level of instability, MSI is classified into high (H-MSI), stable (MSS), and low (L-MSI) groups (Cai et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). H-MSI accounts for over 90% of these mutations (Nojadeh et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBuilding on findings that \u003cem\u003eE. histolytica\u003c/em\u003e induces cell apoptosis in colon cancer cell lines via increased miRNA-643 expression (L\u0026oacute;pez-Rosas et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), it should be noted that there has been no clinical research on tumoral adenocarcinoma cells to investigate the expression level of miRNA-643, particularly regarding the incidence of MSI and its relationship with the antigenic manifestation of \u003cem\u003eE. histolytica\u003c/em\u003e lectin and the anti-apoptotic gene XLAP. This study aims to achieve two key objectives: (1) Identify the presence of a specific \u003cem\u003eE. histolytica\u003c/em\u003e surface protein (e.g., Gal-lectin) on the surface of colorectal adenocarcinoma tumor cells and (2) investigate the potential association between miRNA-643 expression and microsatellite instability (MSI) in patients with this disease.\u003c/p\u003e \u003cp\u003eBy analyzing this association through correlation analysis and functional assays, this study seeks to unravel potential diagnostic, prognostic, or therapeutic implications, ultimately contributing to more effective treatment strategies for colorectal cancer.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Sample Collection\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo investigate \u003cem\u003eE. histolytica\u003c/em\u003e antigen and microsatellite instability (MSI) in 150 colorectal adenocarcinoma biopsy samples, 3\u0026ndash;5 \u0026micro;m sections were prepared on Poly-L-lysine-coated slides from paraffin blocks for immunohistochemical staining. Additionally, DNA was extracted for MSI detection using Multiplex PCR. For miRNA assessment by RT-qPCR and Real-Time PCR, 5 micro tubes, each containing 3 sections of 15 \u0026micro;m, were collected from separate samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Ethical Review\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe Ethical Committee of Tarbiat Modares University (Tehran, Iran), approved this study with Code No.: IR.MODARES.REC.1402.004. Informed written consent was obtained from all patients for the inclusion of their colorectal biopsy samples in the study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. DNA extraction\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eMicro tubes collected after deparaffinization with xylene were used for the extraction of genomic DNA from colorectal biopsy specimens with the GeneAll\u0026reg; Exgene\u0026trade; FFPE Tissue DNA kit (South Korea) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Multiplex PCR\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eMultiplex PCR was performed using various markers and specific primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Reaction mixtures were prepared in 25 \u0026micro;L volumes, containing 5.5 \u0026micro;L of Taq Master Mix, 10 pmol of each primer (1 \u0026micro;M for both forward and reverse), 4 \u0026micro;L of template DNA, and nuclease-free water to adjust to the final volume. The PCR protocol included an initial denaturation at 95\u0026deg;C for 5 minutes, followed by 40 cycles of: denaturation at 95\u0026deg;C for 40 seconds, annealing at 54\u0026deg;C for 33 seconds, and extension at 72\u0026deg;C for 1 minute. A final extension was performed at 72\u0026deg;C for 30 minutes. Amplified products were then visualized by electrophoresis on a 2% agarose gel containing red gel dye.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers sequences and amplicon size of PCR program for MSI detection\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences(5' to3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAT-25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TACCAGGTGGCAAAGGGCA\u003c/p\u003e \u003cp\u003eR: TCTGCATTTTAACTATGGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ec-Kit\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAT-26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTGCGGTAATCAAGTTTTTTAG\u003c/p\u003e \u003cp\u003eR: AACCATTCAACATTTTTAACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e183\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHMSH2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNR-27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACCATGCTTGCAAACCACT\u003c/p\u003e \u003cp\u003eR: CGATAATACTAGCAATGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eInhibitor of apoptosis protein-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNR-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAGTCGCTGGCACAGTTCTA\u003c/p\u003e \u003cp\u003eR: CTGGTCACTCGCGTTTACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e109\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSLC7A8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNR-24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTGAATTTTACCTCCTGAC\u003c/p\u003e \u003cp\u003eR:ATTGTGCCATTGCATTCCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e131\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eZinc finger 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Immunohistochemical staining\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eTo investigate \u003cem\u003eE. histolytica\u003c/em\u003e lectin and microsatellite instability (MSI), immunohistochemical staining was performed on tissue sections. Following deparaffinization, dehydration, and peroxidase inhibition with 3% hydrogen peroxide in methanol, antigen retrieval was achieved in citrate buffer (pH 6) at 121\u0026deg;C for 15 minutes under 15 psi pressure in an autoclave. After autoclaving and cooling, the slides were placed in PBS buffer.\u003c/p\u003e \u003cp\u003eAfter cooling, the slides were incubated with an anti-Gal-lectin monoclonal antibody (HK-9 strain) from GeneTex to detect the specific \u003cem\u003eE. histolytica\u003c/em\u003e lectin, followed by a blocking protein step. To investigate MSI, antibodies against PMS2, MSH6, MSH2, and MLH1 from Master Company (Masterdiagnostica, ready to use) were subsequently applied. Incubation with specific antibodies lasted 1.5 hours, followed by a master secondary antibody. Diaminobenzene (DAB) substrate and Mayer's hematoxylin were employed for detection and analysis of the antibody reactions, with hematoxylin providing counterstaining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Detecting miRNA-643 and XIAP in Biopsy Samples\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eRNA was extracted from deparaffinized colorectal biopsy samples using the QIAGEN\u0026reg; kit. Subsequently, cDNA was synthesized with primers designed by Bon Yakhte Company (mir-643-F: GAACTTGTATGGTATCTCAGGT and RNU6-F: AAGGATGACACGCAAATTC) using a temperature program of 37\u0026deg;C for 10 minutes, 55\u0026deg;C for 60 minutes, and 70\u0026deg;C for 10 minutes.\u003c/p\u003e \u003cp\u003eTo assess the expression levels of miRNA-643 and XIAP, an anti-apoptotic gene, qRT-PCR was conducted using SYBR-Green on an ABI7500 system (Applied Bio systems, USA). Three replicates of each experiment were performed. Real-time reactions followed a temperature program of 95\u0026deg;C for 2 minutes, then 40 cycles of 95\u0026deg;C for 5 seconds, and 60\u0026deg;C for 30 seconds.\u003c/p\u003e \u003cp\u003eThe relative expression of miRNAs was quantified using the comparative Ct method (2^\u0026minus;ΔΔCT) and the Delta-Delta-Ct (ddCt) Algorithm, with GAPDH serving as an internal control for data normalization (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003esequence of miRNA-643, XIAP, GAPDH primer\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMarker\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers Sequence(5'to3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehas-46 F:\u003c/p\u003e \u003cp\u003ehas-46 R:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTG CTC GTC TCG GCA GCA CAT ATA C\u003c/p\u003e \u003cp\u003eAAA AAT ATG GAA CGC TTC ACG AAT TTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehas-XIAP F:\u003c/p\u003e \u003cp\u003ehas-XIAP R:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTC ACT TGA CGA GTG TCT GGT\u003c/p\u003e \u003cp\u003eTGT CCT TGA AAC TGA ACC CCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehas-GAPDH F:\u003c/p\u003e \u003cp\u003ehas-GAPDH R:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTG ACC TCA ACT ACA TGG TTT ACA\u003c/p\u003e \u003cp\u003eGCT CCT GGA AGA TGG TGA TG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehas-miRNA 643 F:\u003c/p\u003e \u003cp\u003ehas-miRNA 643 R:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCA GAC TTG TAT GCT AGC TCA\u003c/p\u003e \u003cp\u003eGTC CAG TTT TTT TTT TTT TTT CTA CCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Statistical Analysis\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eData were presented as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and analyzed using SPSS version 23.0 software. A P-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003cp\u003eThe associations between miR-643 expression levels and the parameters of colorectal cancer (CRC) patients were evaluated using the Pearson χ2 test. The kappa test was utilized to determine the concordance between the expression level of miR-643 and MSI status. The differences in miR-643 levels between MSI-positive and E. histolytica-positive cases were assessed using the McNemar test, with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicating statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":" \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1. General results\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eOf the 150 colorectal adenocarcinoma samples examined, 19 cases tested positive for the \u003cem\u003eE. histolytica\u003c/em\u003e lectin light chain antigen by immunohistochemistry. Meanwhile, 39 cases were positive for MSI using PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and 37 cases with IHC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The degree of concordance between PCR and IHC methods in detecting MSI positivity was 95%.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOut of a total of 39 MSI\u0026thinsp;+\u0026thinsp;cases, 28 cases had more than 2 positive indices, placing them in the MSI-H group, and 11 cases had a positive index, indicating MSI-L, which signifies a higher percentage of MSI-H (71.7%) in MSI-positive samples (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of MSI-H and MSI-L percentages in 39 MSI\u0026thinsp;+\u0026thinsp;cases\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMSI High\u003c/p\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMSI Low\u003c/p\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChi-square\u003c/p\u003e \u003cp\u003eStatistics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMSI+ (N Total\u0026thinsp;=\u0026thinsp;39)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e28 (0.72)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11 (0.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe relationship between Adenocarcinoma, \u003cem\u003eE. histolytica- lectin and MSI\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMSI+\u003c/p\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMSI-\u003c/p\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSig\u003c/p\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. histolytica\u003c/em\u003e(\u003cem\u003eEh-L\u003c/em\u003e)+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11 (58%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8 (42%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. histolytica\u003c/em\u003e(\u003cem\u003eEh-L\u003c/em\u003e)-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e131\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 (21.37%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103 (78.62%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdenocarcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39 (26%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e111 (74%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eOut of 39 MSI\u0026thinsp;+\u0026thinsp;cases, 11 cases were positive for \u003cem\u003eE. histolytica\u003c/em\u003e light chain antigen. Out of 131 cases of MSI-, 8 cases were confirmed by light chain antigen of this protozoan.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe difference in \u003cem\u003eE. histolytica\u003c/em\u003e positivity between the MSI\u0026thinsp;+\u0026thinsp;and MSI\u0026thinsp;\u0026minus;\u0026thinsp;groups was not statistically significant based on Fisher's exact test (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, a significant difference was observed when comparing \u003cem\u003eE. histolytica\u003c/em\u003e negative samples with positive and negative MSI status (P\u0026thinsp;\u0026lt;\u0026thinsp;0.009). Additionally, a significant difference was noted in the concurrent examination of MSI and \u003cem\u003eE. histolytica\u003c/em\u003e (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Out of the 39 MSI-positive samples, MSI\u0026thinsp;+\u0026thinsp;was observed in 3 samples, and there was a significant difference between these two groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eThe results obtained from the measurement of miRNA-643 expression levels indicated that the samples could be divided into four groups as follows: The first group: MSI positive but \u003cem\u003eE. histolytica\u003c/em\u003e antigen negative. The second group: MSI negative but \u003cem\u003eE. histolytica\u003c/em\u003e lectin antigen positive. The third group: Both \u003cem\u003eE. histolytica\u003c/em\u003e lectin antigen and MSI positive and the fourth group: Compared the expression of miRNA-643 and the anti-apoptotic gene XIAP, where \u003cem\u003eE. histolytica\u003c/em\u003e antigen was positive (Table \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. The expression results of miRNA-643 and XIAP gene\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eAccording to Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the first group exhibited a threefold increase in XIAP gene expression compared to miRNA-643, and the second group showed a fourfold increase in anti-apoptotic gene expression. The third group revealed a threefold increase in miRNA-643 expression compared to the anti-apoptotic gene. In the fourth group, related to \u003cem\u003eE. histolytica\u003c/em\u003e positive antigen samples and their relationship with miRNA-643, the co-expression of miRNA-643 and XIAP was indicated, which was not statistically significant with a p-value\u0026thinsp;\u0026gt;\u0026thinsp;0.5. All groups were measured based on the GAPDH gene with an expression level of 1.\u003c/p\u003e \u003cp\u003eThe expression results of miRNA-643 and XIAP gene, according to Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, showed increased expression of XIAP compared to miRNA-643 in the first group. In the second group, both genes had increased expression, but the increase in the expression of the anti-apoptotic gene XIAP was observed much more. In the third group, where all the indicators measured in the research showed an increase in the expression of miRNA-643. However, in the fourth group, as in the second group, an increase in the expression of XIAP was observed, and was considered insignificant in terms of p-value\u0026thinsp;\u0026gt;\u0026thinsp;0.05.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003emiRNA-643 and XIAP expression results in the four investigated groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003emir643\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eXIAP\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eExpression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegulated\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eExpression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRegulated\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDOWN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.769\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.088\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.014\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.036\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.437\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.033\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.425\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDOWN\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.555\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.595\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.342\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eUP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eGroup 1: MSI positive, \u003cem\u003eE .histolytica\u003c/em\u003e negative, group 2: MSI negative, \u003cem\u003eE.histolytica\u003c/em\u003e positive, Group 3: MSI and \u003cem\u003eE.histolytica\u003c/em\u003e positive, Group 4: Relationship of miRNA643 with \u003cem\u003eE.histolytica\u003c/em\u003e positive.\u003c/p\u003e \u003cp\u003eThe first group exhibited a threefold increase in XIAP gene expression relative to miRNA-643, and the second group exhibited a fourfold increase in anti-apoptotic gene expression. The third group exhibited a threefold increase in the expression of miRNA-643 compared to the anti-apoptotic gene. In the fourth group, related to \u003cem\u003eE. histolytica\u003c/em\u003e positive antigen samples and their association with miRNA-643, the co-expression of miRNA-643 and XIAP was observed, but it was not statistically significant with a p-value\u0026thinsp;\u0026gt;\u0026thinsp;0.5.\u003c/p\u003e \u003cp\u003eThe samples positive for MSI and \u003cem\u003eE. histolytica\u003c/em\u003e lectin antigen, demonstrated an increase in miRNA-643 expression compared to the XIAP anti-apoptotic gene, based on the 2^\u0026minus;∆∆CT results from data analysis (P\u0026thinsp;\u0026lt;\u0026thinsp;0.019).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":" \u003cp\u003e \u003cem\u003eEntamoeba histolytica\u003c/em\u003e is known to induce host cell apoptosis, and studies are investigating the ability of Gal/GalNAc lectin to trigger apoptosis, the role of amoeba pore in activating host caspases, and the potential of amoebic proteases to directly activate effector caspases upon entering the host cell cytoplasm (Huston et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Colorectal cancer is among the most prevalent cancers in Iran, ranking third among cancers (Azadeh et al. 2008). The significance of MSI as a diagnostic biomarker has gained attention for improving treatment for patients with colorectal cancer, with about 15% of colorectal cancers being MSI-positive (Wei et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, environmental and acquired factors influencing MSI development have not been thoroughly studied. Conversely, studies have demonstrated the association of certain bacteria, such as \u003cem\u003eFusobacterium nucleatum\u003c/em\u003e and \u003cem\u003eEpstein-Barr\u003c/em\u003e virus, with colon cancer tissue and their correlation with MSI at the tumor site (Mjelle et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThus, in addition to molecular methods, immunohistochemical techniques have been employed due to advancements in antigen detection in tissue sections (Ruan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eImmunohistochemistry, a fundamental technique used for diagnostic and research purposes in many laboratories, plays a crucial role in tumor immunophenotyping and the evaluation of tissue-specific genes, which is important for tumor classification at various diagnostic stages (Geramizadeh et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Haghighi et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) used this method to identify the specific antigen of this protozoan in colorectal lesion biopsy samples, finding lectin antigen presence on the tumor cell surface in 8 MSI-positive samples. The absence of \u003cem\u003eE. histolytica\u003c/em\u003e DNA in adenocarcinoma biopsy samples by the PCR technique suggested that patients with adenocarcinoma were not concurrently infected with this protozoan (Haghighi et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Nevertheless, the detection of this protozoan's antigen on the surface of colorectal tumor cells remained an open question and required additional verification (Rebersek \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChanges in the intestinal microbiome are also linked to colorectal cancer, potentially enhancing the invasion of intestinal parasitic diseases. The invasive process of \u003cem\u003eE. histolytica\u003c/em\u003e trophozoites induces significant changes in the host's genetic programs, largely described by the phenomenon of protozoan trogocytosis (Ralston et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMoreover, the involvement of microRNAs in the apoptosis of colorectal tumor cells has been explored, with various identification methods employed (Bartel \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The biogenesis of miRNAs starts in the cell nucleus, where they are transcribed from specific genes by RNA polymerase II or III as primary transcripts (pri-mRNA). MiRNAs can act on their target genes in two main ways: if the miRNA binds to an mRNA with a high-affinity complementary transcript, it leads to mRNA degradation; if the miRNA binds incompletely, it results in the repression of mRNA translation (Hata and Lieberman \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn recent years, miRNAs have been recognized as potential diagnostic and prognostic biomarkers, modulators of chemo resistance, and a new therapeutic option (Qureshi and Sacan \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The tumor-suppressive potential of miR-643 has garnered attention, with studies showing that miR-643 can inhibit cell proliferation, invasion, and metastasis by downregulating RAF1 (rapidly accelerated fibro sarcoma) expression in lung cancer cells and increasing radiation sensitivity during radiotherapy (Tian et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, miRNA-643 has been shown to decrease cell proliferation mediated by TPC-1 (Two pore segment channel 1) and increase the expression of the KI67 antigen and apoptosis-related proteins such as Bax and caspase-3 in papillary thyroid carcinoma cells (Yin and Shao \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOn the other hand, cells have genes that inhibit cell death or apoptosis; one of these genes, the XIAP, is coded by the XIAP gene and prevents cell death by inhibiting caspases, which is vital to cells. It also increases significantly in cancer cells (Latour and Aguilar \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The mutation disorder in this gene is the cause of various diseases, as well as Crohn\u0026rsquo;s disease (Peng et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne study indicated that miRNA-643, which was upregulated in SW-480 tumor cells in contact with \u003cem\u003eE. histolytica\u003c/em\u003e trophozoites, could counteract the XIAP apoptosis inhibitor gene. However, the function and mechanism of miR-643 in colorectal cancer remain under-researched, with studies indicating that miR-643 inhibits cell viability and promotes apoptosis in gastric cancer (Wu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This study's analysis of colon adenocarcinoma biopsy cells, particularly those positive for MSI and \u003cem\u003eE. histolytica\u003c/em\u003e antigen, revealed a threefold increase in miRNA-643 expression, echoing findings from SW480 cell line cultures (Xie et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSince PCR results negated active amoebiasis infection, and immunohistochemistry and Western blotting indicated the presence of \u003cem\u003eE. histolytica\u003c/em\u003e lectin light chain on the surface of tumor cells, two hypotheses emerged: firstly, that patients may have had a prior infection with this protozoan, leaving the lectin antigenic index in the cells, and secondly, that tumor cells might mimic antigens similar to \u003cem\u003eE. histolytica\u003c/em\u003e, which could serve as a treatment marker for colorectal adenocarcinoma using recombinant protozoan lectin. The observed increase in miRNA-643 expression in adenocarcinoma cells suggests its role as an apoptosis-inducing factor in these patients, warranting further investigation.\u003c/p\u003e"},{"header":"5. Conclusion","content":" \u003cp\u003eCurrent treatment guidelines for cancers recommend targeted approaches based on clinical trial outcomes. The findings of this study indicate that MSI-positive samples, which also tested positive for \u003cem\u003eE. histolytica\u003c/em\u003e lectin light chain antigen and showed higher expression of miRNA-643, reinforce the role of this protozoan in MSI development, suggesting its potential as an auxiliary biomarker for identifying mutations such as NRAS, BRAF, and KRAS in colorectal adenocarcinoma patients. Moreover, the study suggests the potential application of the protozoan's lectin antigenic index as a platform for enhancing drug delivery to tumor cells and inducing apoptosis. This proposition underscores the need for additional research in this specific area to explore its practical implications and therapeutic benefits.\u003c/p\u003e \u003cp\u003eOur study's broader significance lies in identifying \u003cem\u003eE. histolytica\u003c/em\u003e as a potential colorectal cancer biomarker linked to specific mutations, offering new avenues for understanding cancer development. It introduces an innovative approach for refined diagnostics and treatments.\u003c/p\u003e \u003cp\u003eWhile promising, further validation and clinical studies are essential to confirm \u003cem\u003eE. histolytica\u003c/em\u003e lectin's utility as a reliable biomarker. Continued investigation will solidify these findings and pave the way for personalized cancer therapies and diagnostics.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConsent to publish\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYes\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding source\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was financially supported by Tarbiat Modares University, Tehran, Iran. Grant No. MED33164270\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article. The raw data are available from the corresponding author upon reasonable request\u003cspan dir=\"RTL\"\u003e.\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCredit authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eL\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003eH\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/strong\u003e: Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Software, Methodology, Investigation, Formal analysis, Data curation. \u003cstrong\u003eA\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003eD\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/strong\u003e: Writing \u0026ndash; review \u0026amp; editing, Visualization, Supervision, Project administration, Funding acquisition, Conceptualization. \u003cstrong\u003eM\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003eP\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e:\u003c/strong\u003e Writing \u0026ndash; original draft, Validation, Software, Formal analysis. \u003cstrong\u003eF\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003eGh\u003c/strong\u003e\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e: Writing \u0026ndash; original draft, Visualization, Validation, Methodology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Declaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper\u003cspan dir=\"RTL\"\u003e.\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMedical Ethics Certificate\u003c/strong\u003e\u003cspan dir=\"RTL\"\u003e:\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eThis study received approval from the ethics committee of Tarbiat Modares University, bearing the code number: IR.MODARES.REC.1402.004\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003cspan dir=\"RTL\"\u003e:\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eThe authors of this article would like to thank all the staff of the Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, as well as the colleagues of the Stem Cell Center of Tabriz University, for their assistance\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlamoudi AA, Alnoury A, Gad H (2017) miRNA in tumour metabolism and why could it be the preferred pathway for energy reprograming. Brief Funct Genomics 17:157\u0026ndash;169. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bfgp/elx023\u003c/span\u003e\u003cspan address=\"10.1093/bfgp/elx023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvalos-Padilla Y, Knorr RL, Javier-Reyna R et al (2018) The Conserved ESCRT-III Machinery Participates in the Phagocytosis of \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Front Cell Infect Microbiol 8:53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2018.00053\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2018.00053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartel DP (2004) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 116:281\u0026ndash;297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBegum S, Quach J, Chadee K (2015) Immune Evasion Mechanisms of \u003cem\u003eEntamoeba histolytica\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai L, Sun Y, Wang K et al (2020) The Better Survival of MSI Subtype Is Associated With the Oxidative Stress Related Pathways in Gastric Cancer. Front Oncol 10:1269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2020.01269\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2020.01269\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConnerty P, Ahadi A, Hutvagner G (2015) RNA Binding Proteins in the miRNA Pathway. Int J Mol Sci 17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms17010031\u003c/span\u003e\u003cspan address=\"10.3390/ijms17010031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Leva G, Garofalo M, Croce CM (2014) MicroRNAs in cancer. Annu Rev Pathol 9:287\u0026ndash;314. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-pathol-012513-104715\u003c/span\u003e\u003cspan address=\"10.1146/annurev-pathol-012513-104715\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeramizadeh B, Bozorg-Ghalati F, Jafari F et al (2021) Microsatellite Instability and Colorectal Cancer, Immunohistochemical and Molecular Evaluation by Using DNA Sequencing: A Single Center Experience. Iran J Pathol 16:325\u0026ndash;331. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.30699/ijp.2021.131467.2462\u003c/span\u003e\u003cspan address=\"10.30699/ijp.2021.131467.2462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrillo F, Campora M, Carlin L et al (2022) Stranger things in the gut: uncommon items in gastrointestinal specimens. Virchows Arch 480:231\u0026ndash;245. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00428-021-03188-1\u003c/span\u003e\u003cspan address=\"10.1007/s00428-021-03188-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaghighi L, Razmjou E, Rafiei-Sefiddashti R et al (2022) \u003cem\u003eEntamoeba histolytica\u003c/em\u003e and Probable Effect on Production Microsatellite Instability in Colorectal Cancer. Curr Microbiol 79:111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00284-022-02782-z\u003c/span\u003e\u003cspan address=\"10.1007/s00284-022-02782-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaque R, Huston CD, Hughes M et al (2003) Amebiasis. N Engl J Med 348:1565\u0026ndash;1573. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMra022710\u003c/span\u003e\u003cspan address=\"10.1056/NEJMra022710\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHata A, Lieberman J (2015) Dysregulation of microRNA biogenesis and gene silencing in cancer. Sci Signal 8:re3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/scisignal.2005825\u003c/span\u003e\u003cspan address=\"10.1126/scisignal.2005825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuston CD, Boettner DR, Miller-Sims V, Petri WA Jr. (2003) Apoptotic killing and phagocytosis of host cells by the parasite \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Infect Immun 71:964\u0026ndash;972. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/iai.71.2.964-972.2003\u003c/span\u003e\u003cspan address=\"10.1128/iai.71.2.964-972.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLatour S, Aguilar C (2015) XIAP deficiency syndrome in humans. Semin Cell Dev Biol 39:115\u0026ndash;123. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.semcdb.2015.01.015\u003c/span\u003e\u003cspan address=\"10.1016/j.semcdb.2015.01.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026oacute;pez-Rosas I, L\u0026oacute;pez-Camarillo C, Salinas-Vera YM et al (2018) \u003cem\u003eEntamoeba histolytica\u003c/em\u003e Up-Regulates MicroRNA-643 to Promote Apoptosis by Targeting XIAP in Human Epithelial Colon Cells. Front Cell Infect Microbiol 8:437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2018.00437\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2018.00437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMjelle R, Sjursen W, Thommesen L et al (2019) Small RNA expression from viruses, bacteria and human miRNAs in colon cancer tissue and its association with microsatellite instability and tumor location. BMC Cancer 19:161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12885-019-5330-0\u003c/span\u003e\u003cspan address=\"10.1186/s12885-019-5330-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNair GV, Variyam EP (2014) Noninvasive intestinal amebiasis: \u003cem\u003eEntamoeba histolytica\u003c/em\u003e colonization without invasion. Curr Opin Infect Dis 27:465\u0026ndash;469. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/qco.0000000000000095\u003c/span\u003e\u003cspan address=\"10.1097/qco.0000000000000095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNojadeh JN, Behrouz Sharif S, Sakhinia E (2018) Microsatellite instability in colorectal cancer. Excli j 17:159\u0026ndash;168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17179/excli2017-948\u003c/span\u003e\u003cspan address=\"10.17179/excli2017-948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeltom\u0026auml;ki P (2001) Deficient DNA mismatch repair: a common etiologic factor for colon cancer. Hum Mol Genet 10:735\u0026ndash;740. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/10.7.735\u003c/span\u003e\u003cspan address=\"10.1093/hmg/10.7.735\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng C, Jiang Y, Ou X et al (2023) Novel XIAP mutation with early-onset Crohn\u0026rsquo;s disease complicated with acute heart failure: a case report. BMC Cardiovasc Disord 23:368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12872-023-03386-6\u003c/span\u003e\u003cspan address=\"10.1186/s12872-023-03386-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetri JWA, Haque R, Mann BJ (2002) The bittersweet interface of parasite and host: lectin-carbohydrate interactions during human invasion by the parasite \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Annu Rev Microbiol 56:39\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.micro.56.012302.160959\u003c/span\u003e\u003cspan address=\"10.1146/annurev.micro.56.012302.160959\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQureshi R, Sacan A (2013) A novel method for the normalization of microRNA RT-PCR data. BMC Med Genomics 6:S14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1755-8794-6-S1-S14\u003c/span\u003e\u003cspan address=\"10.1186/1755-8794-6-S1-S14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRalston KS, Petri JWA (2011) Tissue destruction and invasion by \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Trends Parasitol 27:254\u0026ndash;263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pt.2011.02.006\u003c/span\u003e\u003cspan address=\"10.1016/j.pt.2011.02.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRalston KS, Solga MD, Mackey-Lawrence NM et al (2014) Trogocytosis by \u003cem\u003eEntamoeba histolytica\u003c/em\u003e contributes to cell killing and tissue invasion. Nature 508:526\u0026ndash;530. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature13242\u003c/span\u003e\u003cspan address=\"10.1038/nature13242\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRebersek M (2021) Gut microbiome and its role in colorectal cancer. BMC Cancer 21:1325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12885-021-09054-2\u003c/span\u003e\u003cspan address=\"10.1186/s12885-021-09054-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuan H, Leibowitz BJ, Zhang L, Yu J (2020) Immunogenic cell death in colon cancer prevention and therapy. Mol Carcinog 59:783\u0026ndash;793. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/mc.23183\u003c/span\u003e\u003cspan address=\"10.1002/mc.23183\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShirley DAT, Farr L, Watanabe K, Moonah S (2018) A review of the global burden, new diagnostics, and current Therapeutics for amebiasis. Open Forum Infect Dis 5:ofy161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ofid/ofy161\u003c/span\u003e\u003cspan address=\"10.1093/ofid/ofy161\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang S, Wu WK, Li X et al (2016) Stratification of Digestive Cancers with Different Pathological Features and Survival Outcomes by MicroRNA Expression. Sci Rep 6:24466. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep24466\u003c/span\u003e\u003cspan address=\"10.1038/srep24466\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian H, Ding K, Wang Z et al (2023) miR-643 suppresses cell invasion and radioresistant of lung cancer through RAF1. Precis Med Sci 12:113\u0026ndash;120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/prm2.12102\u003c/span\u003e\u003cspan address=\"10.1002/prm2.12102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Kouwenhove M, Kedde M, Agami R (2011) MicroRNA regulation by RNA-binding proteins and its implications for cancer. Nat Rev Cancer 11:644\u0026ndash;656. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrc3107\u003c/span\u003e\u003cspan address=\"10.1038/nrc3107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVines RR, Ramakrishnan G, Rogers JB et al (1998) Regulation of adherence and virulence by the \u003cem\u003eEntamoeba histolytica\u003c/em\u003e lectin cytoplasmic domain, which contains a beta2 integrin motif. Mol Biol Cell 9:2069\u0026ndash;2079. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/mbc.9.8.2069\u003c/span\u003e\u003cspan address=\"10.1091/mbc.9.8.2069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe N, Nakada-Tsukui K, Nozaki T (2020) Two isotypes of phosphatidylinositol 3-phosphate-binding sorting nexins play distinct roles in trogocytosis in \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Cell Microbiol 22:e13144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cmi.13144\u003c/span\u003e\u003cspan address=\"10.1111/cmi.13144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei W, Liu F, Liu L et al (2011) Distinct mutations in MLH1 and MSH2 genes in hereditary non-polyposis colorectal cancer (HNPCC) families from China. BMB Rep 44:317\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5483/BMBRep.2011.44.5.317\u003c/span\u003e\u003cspan address=\"10.5483/BMBRep.2011.44.5.317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWelter BH, Goldston AM, Temesvari LA (2011) Localisation to lipid rafts correlates with increased function of the Gal/GalNAc lectin in the human protozoan parasite, \u003cem\u003eEntamoeba histolytica\u003c/em\u003e. Int J Parasitol 41:1409\u0026ndash;1419. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijpara.2011.10.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpara.2011.10.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Y, Ye H, Peng B et al (2021) MiR-643 Functions as a Potential Tumor Suppressor in Gastric Cancer by Inhibiting Cell Proliferation and Invasion via Targeting TXNDC9. Ann Clin Lab Sci 51:494\u0026ndash;502\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie YH, Chen YX, Fang JY (2020) Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Target Ther 5:22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-020-0116-z\u003c/span\u003e\u003cspan address=\"10.1038/s41392-020-0116-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin H, Shao J (2020) MicroRNA-643 promotes proliferation and inhibits apoptosis of papillary thyroid carcinoma by down-regulating the cytochrome P450 family member 11B1. Transl Cancer Res 9:1465\u0026ndash;1475. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21037/tcr.2020.01.43\u003c/span\u003e\u003cspan address=\"10.21037/tcr.2020.01.43\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Niu Q, Fan W et al (2019) Oral microbiota and gastrointestinal cancer. Onco Targets Ther 12:4721\u0026ndash;4728. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/ott.S194153\u003c/span\u003e\u003cspan address=\"10.2147/ott.S194153\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Entamoeba histolytica, miRNA-643, MSI, microsatellite instability, XIAP, immunohistochemistry (IHC), PCR","lastPublishedDoi":"10.21203/rs.3.rs-4239958/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4239958/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlobally, \u003cem\u003eEntamoeba histolytica\u003c/em\u003e remains a leading cause of death. The impact of protozoa as environmental factors in microsatellite instability (MSI) remains largely unexplored, as are miRNAs as potential biomarkers for amoeba and in the context of colorectal disease. In this study, we investigated the relationship between the antigenic structure of the \u003cem\u003eEh\u003c/em\u003e-lectin and the altered expression of miRNA-643 and XIAP, a gene involved in apoptosis inhibition.\u003c/p\u003e \u003cp\u003eThe study aimed to detect \u003cem\u003eE. histolytica\u003c/em\u003e, miRNA-643, XIAP, and MSI in 150 colorectal cancer biopsy samples. To achieve this, a multi-faceted approach employing immunohistochemistry (IHC), Multiplex PCR, RT-qPCR, and Real-Time PCR were utilized. For enhanced MSI diagnosis precision, PCR-Multiplex was performed concurrently with IHC.\u003c/p\u003e \u003cp\u003eAmong the 150 colorectal cancer biopsy samples analyzed, 39 (28 MSI-H and 11 MSI-L) exhibited microsatellite instability (MSI), while the remaining 111 were MSI-negative. Notably, co-occurrence of MSI and \u003cem\u003eE. histolytica\u003c/em\u003e antigen was observed in 11 samples. These samples (positive for both MSI and \u003cem\u003eE. histolytica\u003c/em\u003e antigen) showed an increased expression of miRNA-643, contrasting with XIAP expression.\u003c/p\u003e \u003cp\u003eThe concurrence of microsatellite instability (MSI) with \u003cem\u003eE. histolytica\u003c/em\u003e antigen positivity and elevated miRNA-643 expression, contrasted with diminished XIAP inhibitor gene levels, in colorectal adenocarcinoma biopsy samples, strongly supports the hypothesis that this protozoan parasite plays a role in MSI development, through its potential involvement in apoptosis.\u003c/p\u003e","manuscriptTitle":"The effect of Entamoeba histolytica Lectin Antigen and MicroRNA-643 on the development of microsatellite instability (MSI) in Colorectal Adenocarcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-12 17:39:15","doi":"10.21203/rs.3.rs-4239958/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"35e2c83c-e27f-41c3-a304-31c264759586","owner":[],"postedDate":"April 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-12T19:15:21+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-12 17:39:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4239958","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4239958","identity":"rs-4239958","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}