Tamoxifen Modulates Spinal Cord Injury Repair via Ccl2/ccr2 Axis and Its Mechanisms

Tamoxifen Modulates Spinal Cord Injury Repair via Ccl2/ccr2 Axis and Its Mechanisms | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tamoxifen Modulates Spinal Cord Injury Repair via Ccl2/ccr2 Axis and Its Mechanisms Xiangzi Wang, Yuqi Lin, Xiao Liang, Wuhua Pang, Yuhan Liu, Ziqi Wang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7278511/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background: Spinal cord injury (SCI) represents a profoundly serious neurological disorder characterized by limited self-repair capabilities and accompanied by secondary inflammatory damage, rendering its treatment a pressing challenge in the field of medical science research. The estrogen receptor modulator Tamoxifen (TAM), owing to its neuroprotective and anti-inflammatory properties, is emerging as a potential option for the treatment of neural injury repair. Preliminary bioinformatics screening has revealed a significant increase in the expression of C-C motif chemokine ligand 2 (CCL2) and chemokine receptor 2 (CCR2) during the acute phase of SCI. TAM may exert therapeutic effects on SCI by inhibiting the activity of the CCL2/CCR2 axis, thereby influencing downstream pathways. Objective: This study aims to address the critical issue of secondary inflammatory damage hindering neural regeneration and repair following SCI. By investigating the regulatory effects of TAM on the CCL2/CCR2 axis and its downstream pathways, we seek to elucidate its molecular mechanisms and provide novel strategies for pharmacological intervention in secondary injuries associated with SCI. Methods: Utilizing bioinformatics techniques, we identified differentially expressed genes post-SCI and analyzed signaling pathways related to the CCL2/CCR2 axis. We assessed the expression levels of this axis following SCI and employed behavioral assays, RT-PCR, ELISA, and Western blotting to validate the effects of TAM administration on the CCL2/CCR2 axis, its downstream pathways, and molecular mechanisms in both LPS-induced microglial inflammation models and complete transection models of SCI. Furthermore, we utilized the CCR2 antagonist INCB3344 and the PPAR-γ antagonist GW9662 to further validate the relationships within these pathways. Results: TAM significantly reduced the expression of the CCL2/CCR2 axis in both in vitro and in vivo models following injury. By modulating this axis, TAM decreased NF-κB pathway expression and inhibited the secretion of inflammatory factors, facilitating the transition of microglia from a pro-inflammatory to an anti-inflammatory phenotype while activating the PPAR-γ pathway. Additionally, the activation of PPAR-γ reciprocally inhibited the expression of the CCL2/CCR2 axis. Conclusion: TAM may significantly alleviate secondary inflammatory responses following SCI through its modulation of the CCL2/CCR2 signaling pathway, exhibiting anti-apoptotic and anti-inflammatory effects. The findings of this study provide a theoretical foundation and experimental basis for the clinical application of TAM in SCI treatment research. Spinal cord injury Tamoxifen CCL2/CCR2 PPAR-γ Microglia polarization Inflammation Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Spinal cord injury (SCI) causes irreversible damage to the central nervous system (CNS), profoundly impacting patients' physical and emotional well-being[ 1 , 2 ]. Treating SCI is particularly challenging due to the CNS's limited regenerative capacity and the secondary inflammatory responses that exacerbate both physical and emotional suffering, placing a substantial burden on patients' families and society[ 3 , 4 ]. In the acute phase, primary injuries include significant physical trauma, disruption of the blood-spinal cord barrier (BSCB), and immediate immune cell activation. Secondary lesions manifest as neuronal death, glial scar formation, immune cell infiltration, demyelination, and reduced neurotransmission[ 5 ]. Two primary therapeutic approaches for SCI are pharmacotherapy and surgery[ 6 , 7 ]. Surgical intervention focuses on alleviating spinal cord compression, minimizing further damage, and repairing nerve tissues. Additionally, pharmacological strategies aim to mitigate secondary injury during the acute phase by reducing neuronal damage and inflammatory responses mediated by chemokines. Recent studies have shown that microglia, macrophages, neutrophils, etc. are activated by C-C chemotactic factor ligand 2 (CCL2)/ chemotactic factor C-C receptor 2 (CCR2) axis, leading to the release of numerous chemokines and inflammatory factors, which trigger an inflammatory cascade within 3 to 7 days post-injury [ 8 , 9 ]. The available data indicate a significant relationship between the CCL2/CCR2 axis and the inflammatory response, glial scar formation, microglia activation and neuronal death following SCI. Chemokines, such as CCL2, are the major components secreted by astrocytes and microglia post-SCI[ 10 – 12 ], which is involved in recruiting monocytes, T lymphocytes, and natural killer cells to inflammatory sites via interaction with CCR2, thereby exacerbating neuropathology[ 13 – 19 ]. Studies have shown that promoting the polarization of microglia from an M1 pro-inflammatory phenotype to an M2 anti-inflammatory phenotype can reduce inflammation, promote tissue repair and regeneration, and restore neural function[ 20 ]. Utilizing GeneMANIA ( https://genemania.org ) to investigate gene interactions, Brennan et al. identified CCL2 as a crucial SCI- and microglia-dependent node located at the network's periphery [ 21 ]. It has also been revealed that CCL2/CCR2 influences SCI recovery in animal models by modulating inflammation and apoptotic pathways[ 11 , 22 ]. Consequently, the CCL2/CCR2 pathway affects SCI regeneration and repair by suppressing microglial and astrocytic activation, promoting microglial anti-inflammatory polarization, and diminishing the inflammatory response[ 23 ]. Nuclear receptors are a class of ligand-dependent transcription factors that, upon activation, influence the expression of genes regulating crucial physiological processes. Among these receptors, peroxisome proliferator-activated receptor-gamma (PPAR-γ) is considered a vital link between lipid metabolism, metabolic diseases, and innate immunity[ 24 ]. Studies have shown that PPAR-γ agonists possess anti-inflammatory properties and can inhibit neuronal apoptosis[ 25 ]. In the models of SCI, PPAR-γ has demonstrated significant neuroprotective and anti-apoptotic effects[ 26 – 28 ]. Moreover, accumulating research underscores the pivotal role of PPAR-γ in suppressing chemokines[ 29 ]. Zhang et al. demonstrated that the PPAR-γ agonist amorfruitins alleviate neuropathic pain in CCI rats via downregulating proinflammatory cytokines and CCL2/CCR2 axis[ 30 ]. Mei et al. demonstrated that naringin can significantly lower the expression of CCL2 and other inflammatory factors after SCI by increasing the expression of PPAR-г protein. Concurrently, there was an increase in the expression of genes linked to microglia M2 polarization in spinal cord tissue[ 31 ]. Recent studies indicate that TAM can suppress CCR2 gene expression post-SCI. Synthesized in 1966, TAM is a selective estrogen receptor modulator (SERM) with a biochemical structure akin to estradiol[ 32 ]. Through various mechanisms, TAM provides neuroprotection by permeating the blood-brain barrier (BBB). These mechanisms encompass reducing inflammatory damage, promoting sensory cortex regeneration, and exerting antioxidant and anti-apoptotic effects in models of penetrating brain injury, middle cerebral artery occlusion (MCAo), and SCI[ 33 – 35 ]. Research has demonstrated that administering TAM within 24 hours or immediately following SCI in female mice can significantly enhances motor function recovery and mitigates secondary inflammatory injury[ 36 ]. Transcriptome analysis of spinal cord tissues collected 24 hours after TAM injection, administered 30 minutes post-injury, demonstrated that TAM downregulates CCR2 gene expression in SCI/TAM- versus SCI/TAM + groups[ 37 ]. Prior studies suggest that TAM may expedite recovery following spinal cord injury by modulating CCR2 gene expression, thereby influencing associated inflammatory pathways. Based on these findings, the present study adopts the following design: 1) Examination of differential gene expression post-SCI and analysis of gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enriched with CCL2 and CCR2. 2) Evaluation of motor and autonomic function (including bladder control) and histological assessments to gauge recovery in TAM-treated SCI rats. 3) Investigate the impact of TAM on microglial polarization post-SCI. 4) Explore TAM's anti-apoptotic and anti-inflammatory effects and the associated pathways post-SCI. This study further explores potential targets and pathways linked to TAM’s effects in SCI, including microglial activation and its associated mechanisms (As shown in Fig. 1 ). This approach provides a novel therapeutic strategy for SCI, highlighting the potential role of TAM as a neuroprotective agent and its broader implications for treating neurological disorders. Materials and Method Experimental Animals and Cells For this investigation, ninety adult male Sprague Dawley (SD) rats were chosen. They weighed between 220g and 250g at 6–8 weeks of age. Beijing Weitonglihua Laboratory Animal Technology Co., LTD. (License number: SCXK (Beijing) 2021-0011) is the supplier of all animals. For two weeks, the rats were housed in a specific pathogen-free (SPF) facility, maintained at a temperature of 23°C ± 2°C and a humidity level of 50% ± 5%. They were exposed to a 12-hour light/dark cycle each day and provided with ample food, fresh water, and comfortable living conditions. The Tianjin Armed Police Special Medical Center's Experimental Animal Ethics Committee approved all animal experiments (AG-PJHC-002-01.0 (AF)-001), which were carried out in compliance with the Ministry of Science and Technology's (2006) Guiding Principles for the Management and Use of Experimental Animals and Guiding Opinions on the Treatment of Experimental Animals. The BV2 microglial cell line (CL-0493) was obtained from Wuhan Puno Life Technology Co., Ltd. Bioinformatics Analysis Gene expression datasets GSE42828 and GSE5296 relevant to spinal cord injury (SCI) were downloaded from the Gene Expression Omnibus (GEO) database on the NCBI website. These datasets encompass transcriptomic data matrices from the SHAM group and various time points following SCI, with a particular focus on day three post-surgery. After normalizing the raw data using the limma package in R (version ≥ 4.0), differential gene analysis was performed with selection criteria of p < 0.05 and (|logFC|) ≥ 1. The Venny 2.1 tool was employed to conduct intersection analysis of the upregulated genes from both datasets, resulting in a Venn diagram. Co-expressed genes were imported into the STRING platform (v11.5, confidence threshold ≥ 0.7) to construct a protein-protein interaction (PPI) network, predicting the interactions among these co-expressed genes. Interaction data were then exported to Cytoscape software (v3.9.1) for visualization. Furthermore, the maximal clique centrality (MCC) algorithm from the Cytoscape plugin cytoHubba was utilized to identify the top ten genes based on MCC ranking as key genes. The DAVID database (v6.8) was employed for Gene Ontology (GO) and KEGG pathway enrichment analyses of these key genes, with parameters set at p < 0.05. Experimental Procedure and Grouping In the cellular experiment, the cells were divided into three groups: the control group, the LPS group (stimulated with 1 μg/mL LPS for 24 hours), and the TAM treatment group following LPS induction, referred to as the TAM group. The TAM group was further categorized into three concentrations. After a 24-hour induction in the LPS group, TAM was administered for an additional 24 hours at concentrations of 7.5, 5, and 2.5 μM. Initially, RT-PCR technology was employed to conduct preliminary verification of the expression levels of the CCL2/CCR2 axis, microglial polarization markers (CD32, iNOS, and Arg-1), NF-κB, inflammatory factors (IL-6, IL-1β, and TNF-α), and PPAR-γ. The expression levels of inflammatory factors, CCL2, and nitric oxide (NO) in the cell supernatant were measured using a kit. The optimal dosage concentration was selected, and immunofluorescence techniques were applied to assess the expression of the CCL2/CCR2 axis, microglial polarization markers, NF-κB, PPAR-γ, and Bcl2/Bax/Caspase-3 at the protein level. In the animal experiment, after rearing SD rats for one week, they were randomly divided into four groups: the sham surgery group (SHAM) (n=6), the TAM group (n=6), the SCI group (n=6), and the SCI+TAM group (n=6). Based on previous studies [63, 115] and the conversion of dosages for cells and rats, the concentration of TAM was selected as 5 mg/kg. Thirty minutes after the SCI modeling, the suspension was administered via intraperitoneal injection to the rats for three consecutive days. To evaluate the impact of TAM on the recovery of motor function in SCI rats, a series of experiments were conducted. Assessments including BBB scoring, recovery of urinary function, and changes in body weight were performed on days 1, 3, 7, 14, 21, 28, 35, and 42 post-surgery. On day 42, footprint analysis, as well as collection of spinal cord and bladder tissues, were conducted. Furthermore, using RT-PCR technology, the expression of the CCL2/CCR2 axis, microglial polarization markers (CD32, iNOS, and Arg-1), NF-κB, inflammatory factors (IL-6, IL-1β, and TNF-α), and PPAR-γ in spinal cord tissue was preliminarily validated. The expression levels of inflammatory factors and CCL2 in serum were assessed using ELISA kits. Additionally, Western blotting was employed to measure the protein levels of the CCL2/CCR2 axis, microglial polarization markers, NF-κB, and PPAR-γ. Model Establishment In vitro model establishment: Initially, BV2 cells were cultured in high-glucose DMEM supplemented with 10% fetal bovine serum until they reached 80%-90% confluence. Subsequently, the cells were seeded into a multi-well plate or culture dish. After cell adhesion, they were stimulated with 1 μg/mL LPS to simulate a neuroinflammatory environment for a duration of 24 hours. Microscopic observation revealed a transformation in cell morphology from a resting "dendritic" form to an "amoeboid" shape (characterized by cell body enlargement and retraction of processes), accompanied by pronounced nucleolar changes and an increase in cytoplasmic granules. Concurrently, there was a significant upregulation of inflammatory factors, including the secretion of pro-inflammatory mediators such as TNF-α, IL-6, IL-1β, and NO, as assessed by ELISA. In vivo model establishment: Following systemic inhalation anesthesia with isoflurane, rats were secured in a prone position on the operating table. The location of the T10 vertebra was confirmed, and a preparation area was established within a 5 cm range above and below it. Using the most prominent T2 spinous process between the scapulae as a reference point, the T10 spinous process was accurately localized, and local disinfection was performed with iodine solution. A midline incision was made at the center of the T10 spinous process, extending 3 cm longitudinally along the spinous midline. Blunt dissection of the bilateral paravertebral muscles was performed, with hemostatic clamps used to retract the soft tissue. The subcutaneous fascia and muscle layers were dissected layer by layer to fully expose the spinous structure. Subsequently, residual muscle fibers at the T10 segment were meticulously trimmed, and a miniature burr was employed to precisely remove the T10 spinous process, thereby completely exposing the target lamina. Next, scissors were used to cut open the lamina, revealing the dura mater. Centered on T10 and using the midline blood vessels as a reference line, ophthalmic scissors were utilized to transect the spinal cord vertically for hemostatic compression. The successful establishment of the model was indicated by the immediate emergence of the tail-flick reflex following spinal cord transection, along with observable retraction-like movements of the body. Upon awakening from anesthesia, the experimental rats could only support and move using their forelimbs, while their hind limbs exhibited complete paralysis, and tail movement function was lost, accompanied by sphincter dysfunction (manifesting as urinary retention and defecation difficulties). These symptoms confirmed the successful establishment of a complete spinal cord transection injury model. Post-modeling, rats were housed individually to prevent mutual biting injuries and received daily antibiotic injections for five consecutive days. Additionally, postoperative abdominal massages were administered three times daily to assist in bladder compression and facilitate urination until spontaneous urination was restored. Behavioral Examination Two researchers did the behavioral tests on their own; they were not informed about the experimental group assignment. After an injury, the Basso Beattie Bresnahan (BBB) examination, urine recovery, and footprint test were assessed 7, 14, 21, 28, and 35 days later. The footprint test was carried out 35 days later. A typical technique for assessing neurological function, the BBB examination was put out by Ohio University researchers in 1995. The BBB scoring system is a popular tool for assessing the motor skills of models with spinal cord injuries because it more accurately captures the increase in behavioral function. Rats' hindlimb movement was categorized into 22 levels by the BBB score, which also included nearly all of the behavioral alterations that occurred during the hindlimb's recovery following SCI. Mice trained to run on a paper-covered track measuring one meter in length and ten centimeters in width were given blue ink on their front PAWS and red ink on their back PAWS for the footprint test. Analysis is done on the step length and step breadth. Cell culture A typical microglia cell line in neuroscience research is BV2, which is produced from mice. In vitro models of neurodegenerative disorders and related cellular conditions and processes, including neuroinflammation and SCI[38, 39], can be studied using this immortal cell line. In order to imitate inflammation following spinal cord injury, microglia BV2 were induced in vitro using LPS (1 ug/mL) in this experiment. BV2 cells were cultured at 37ºC with 5% CO 2 in Dulbecco’s modified Eagle’s medium (DMEM) with high glucose (Gibco TM , Waltham, MA, USA) supplemented with 1% penicillin/streptomycin (biosharp, China) and 10% FBS (Vivacell, China). To simulate the inflammatory response, cells were exposed to LPS (1 ug/mL) for 24 h. Co-treatment with TAM (MCE, HY-13757A, USA). Cell Viability Cell counting kit-8 (CCK-8, Sparkjade, China) was used to evaluate cell viability according to the instructions. 3000 cells per well were plated in 96-well plates and allowed to grow for 24 h. After treating cells with different concentrations of TAM for 24 h and 48 h, 100 μL of medium containing 10 μL of CCK-8 solution was applied. After that, the plates were incubated at 37 ºC for 0.5 h. The optical density at 450 nm was measured. Histological Staining Rats with SCI were given anesthesia for 42 days using an isoflurane inhalation machine, and their hearts were perfused with phosphate buffer saline (PBS) and 4% paraformaldehyde (PFA). Remove the spine, bite the vertebrae, and align the location of the injury, which is 1 cm above and below and 3 cm overall. 10% formalin was used to preserve fresh spinal cord tissue. Rat liver, spleen, lung, kidney, and heart were all removed at the same time and preserved in 10% formalin for later histological staining. Sectioning came after a 48-hour fixation with 10% formalin. Paraffin embedding came next. two times, for five to ten minutes each, dewaxing in xylene. Rehydrating series ethanol (100%, 95%, 85%, and 75%) took three minutes for each gradient. Soak for two minutes in distilled water. Elisa Rat IL-6, TNF-α, IL-1β and CCL2 Enzyme-Linked Immunosorbent Assay (ELISA) kits (Proteintech, USA) were used to explore the effect of TAM on changes in inflammatory cytokines. Animal samples: After SCI, the rats were anesthetized 3 days after intraperitoneal injection of TAM. Following abdominal aortic blood collection, the upper serum samples were obtained by centrifugation. Cell sample: LPS or TAM was used to stimulate for 24 hours, and then the supernatant was collected for ELISA assay. Immunofluorescence The 14 mm climbing plate was filled with drops of the cell suspension using a 24-well plate, and roughly 30,000 cells were inoculated in each well. Following the growth of cell adhesion, the cells were exposed to either LPS or TAM (5 μM) for 24 h. Following this, the supernatant was extracted and PBS washed three times. It was fixed for 20 minutes with 4% paraformaldehyde, and then for another 20 minutes, it was exposed to 0.5% Triton X-100 to expose antigens and remove lipids and certain proteins. The 0.5% Triton X-100 treatment was not applied to the membrane proteins. After that, use 10% BSA to block the cells at room temperature for 30 minutes. Then, the slides were incubated at 4 ºC overnight with rabbit anti-MCP-1/CCL2 (26161-1-AP, Proteintech, 1:100), rabbit anti-CCR2 (ab273050, abcam, 1:250), rabbit anti-iNOS recombinant(80517-1-RR, Proteintech, 1:500), rabbit anti-CD32(15625-1-AP, Proteintech, 1:500), rabbit anti-Arginae-1(16001-1-AP, Proteintech, 1:500), rabbit anti-PPAR-γ(16643-1-AP, Proteintech, 1:500) antibodies. After washing with PBS for 3 times, the sections were incubated with secondary antibodies Goat Anti-Rabbit IgG (H+L) FITC-conjugated (S0008, Proteintech, 1:1000) for 1 h at room temperature in the dark. After washing with PBS for 3 times, dye with DAPI for 3-5 minutes. Western blot The rats were anesthetized 3 days after tamoxifen administration for SCI, followed by cardiac perfusion with PBS and 4% PFA. The spinal cord was lysed for 30 min in strong RIPA buffer (Solarbio, Beijing, China) containing protease inhibitors and phosphatase inhibitors (100:1:1, Solarbio, Beijing, China). The cells were inoculated into 6-well plates and stimulated with either LPS or tamoxifen for 24 hours. The cells were lysed for 20 min in strong RIPA buffer (Solarbio, Beijing, China) containing protease inhibitors and phosphatase inhibitors (100:1:1, Solarbio, Beijing, China). The protein was denatured by adding 5× sample buffer to the supernatant after centrifugation and letting it sit at room temperature for an hour. After that, the proteins were separated using SDS pages and moved to membranes made of cellulose nitrate (Millipore, USA). After blocking with 5% skim milk for 90 min, the membranes were submerged in the primary antibody and placed overnight on a shaker inside a 4°C refrigerator. The primary antibodies included rabbit anti-MCP-1/CCL2 (26161-1-AP, Proteintech, 1:1000), rabbit anti-CCR2 (ab273050, abcam, 1:1000), rabbit anti-iNOS recombinant(80517-1-RR, Proteintech, 1:2500), rabbit anti-CD32(15625-1-AP, Proteintech, 1:2500), rabbit anti-Arginae-1(16001-1-AP, Proteintech, 1:2500), rabbit anti-PPAR-г (16643-1-AP, Proteintech, 1:5000), rabbit anti-GAPDH(10494-1-AP, Proteintech, 1:25000), rabbit anti-rabbit ATP1A1(14418-1-AP, Proteintech, 1:10000) antibodies. After washing with PBS for 3 times, the sections were incubated with secondary antibodies Goat Anti-Rabbit IgG (H+L) HRP (S0001, Affinity, 1:5000). Quantitative Real-Time PCR Quantitative real-time PCR (RT-PCR) was used to determine the expression of target gene. SPARKeasy Improved Tissue/Cell RNA kit (AC0202, Sparkjade, Shandong, China) was used to extract RNA. The Leica ultramicro protein nucleic acid analyzer was used to measure the RNA concentration. One-Step gDNA Removal kit (AT341, TRAN, Beijing, China) for reverse transcription of RNA was used, and a 20 uL system was set up. Following preparation, the reverse transcription system was vortexized for a brief moment on the vortex instrument, gently mixed, and then incubated for 15 minutes at 42°C. It was then heated for 5 seconds at 85°C in the thermal circulation instrument. With three pore types for each gene and control pore types devoid of primers and samples, the genes to be evaluated were organized from low to high average temperature. Primers and TransStart Tip Green qPCR SuperMix kit were used to analysis the expression of gene. Expression levels were calculated according to the 2 - ΔΔCt method. The primers are listed in Table 1. Antagonist INCB3344 To investigate whether TAM influences the expression of CCR2, thereby affecting the relationship between NF-κB, PPAR-γ, Bcl2/Bax/Caspase-3, and microglial polarization, we employed the CCR2 antagonist INCB3344 (MedChemExpress) for validation. In the immunofluorescence and RT-PCR experiments, cells were divided into four groups: control group (BV2 cells), LPS group (stimulated with 1 μg/mL LPS for 24 hours), TAM (stimulated with LPS for 24 hours and treated with TAM for 24 hours), and TAM + INCB3344 (stimulated with LPS for 24 hours and treated with 10 nM INCB3344 for 24 hours). Antagonist GW9662 To further investigate the relationship between CCL2/CCR2 and PPAR-γ, we validated the expression of CCL2 and CCR2 using the specific PPAR-γ antagonist GW9662 (MedChemExpress). In the in vivo model, the experiment was divided into four groups: the sham surgery group, the spinal cord injury (SCI) group, the TAM group, and the GW9662 group. The control groups (SHAM and SCI) did not receive TAM; the TAM group received intraperitoneal injections of TAM (5 mg/kg) following SCI; while the GW9662 group received both TAM (5 mg/kg) and the PPAR-γ inhibitor GW9662 (1 mg/kg) post-SCI. In the in vitro model, the experiment was similarly categorized into four groups: the control group (BV2 cells), the LPS group (stimulated with 1 μg/mL LPS for 24 hours), the TAM group (subjected to 1 μg/mL LPS stimulation for 24 hours followed by intervention with 5 μM TAM for an additional 24 hours), and the GW9662 group (receiving 5 μM TAM and 10 μM GW9662 for 24 hours after 24 hours of LPS stimulation). Statistical Analysis With GraphPad Prism 9.0.0, all statistical analyses were performed. Fluorescence intensity and band density were analyzed by Image J. The results are shown as the mean ± SD from a minimum of three separate tests conducted in duplicate. The student's t test was employed to compare the information. The means of various groups were compared using One-way ANOVA, and the mRNAs were correlated using Pearson's test. p <0.05 was chosen as the statistical significance value. Table. 1 Statistical table of all primers needed in RT-PCR experiments. Primers 5’ to 3’ iNOS-F GCTCTAGTGAAGCAAAGCCC iNOS-R TGGTGAAGAGTGTCATGCAA Arginase1-F CTGAGCTTTGATGTCGACGG Arginase1-R TCCTCTGCTGTCTTCCCAAG CD32a-F CGGGGTCTGTTTCTTTTCGG CD32a-R TCTCCCTCTCTCCTCTCCCT PPAR-F GATGTCTTGACTCATGGGTGT PPAR-R CAGCATGGAATAGGGGTTTGC IL-1β-F CGACAAAATACCTGTGGCCT IL-1β-R TTCTTTGGGTATTGCTTGGG IL-6-F GAAACCGCTATGAAGTTCCTCTCTG IL-6-R TGTTGGGAGTGGTATCCTCTGTGA TNF-α-F CATCTTCTCAAAATTCGAGTGACAA TNF-α-R TGGGAGTAGACAAGGTACAACCC CCL2-F TCGGAGTTTGGGTTTGCTTG CCL2-R CAATCAATGCCCCAGTCACC Results Bioinformatics analysis of gene expression in the acute phase of SCI To deeply excavate the key genes involved in acute phase of SCI, the GSE42828 dataset and the GSE5296 dataset were used for analysis via R language. These studies represent a comprehensive database of temporal changes in gene expression that underlie the secondary injury response that occurs in a mouse model of SCI. In the comparison of the transcriptomes of the Sham group and the third day after SCI (standard: abs(log 2 FC) >1, p -value <0.05), we found that 83 genes were upregulated in dataset GSE42828(Fig. 2B) and 321 genes were upregulated in dataset GSE5296 (Fig. 2A) after SCI. A total of 58 co-expressed genes were screened out from these differentially-expressed genes (Fig.2C), and protein-protein interaction network analysis was subsequently applied through website String and software Cytoscape (Fig. 2D). CCL2 had the greatest degree value among the differential genes when they were sequenced based on degree (Fig. 2E). The maximum clique centrality (MCC) value was determined using the software cytoHubba in Cytoscape, and the top ten genes with the MCC value were chosen to be hub genes (Fig. 2F). Furthermore, 10 hub genes were subjected to GO and KEGG analyses through website Enrichr. The signaling chemokine-mediated signaling pathway that were most relevant (Fig. 2G). The findings demonstrated that CCL2 (Fig.2D, E) was markedly elevated during the acute stage of SCI and that it influenced SCI by controlling glial cell migration and apoptosis through binding to its receptor, CCR2 (Fig.2H). Simultaneously, data from the KEGG database indicates that CCL2/CCR2 may also have an impact on pathways leading to nitric oxide and reactive oxygen species generation, which in turn may influence inflammation and neural defense. TAM administration Promotes Motor Functional Recovery After SCI In order to evaluate the effect of TAM administration on SCI rats, we conducted a series of behavioral tests to evaluate the effect of TAM, such as motor function recovery, urination function recovery, weight change. The experimental workflow is depicted in Fig. 3A. Both SCI and TAM groups exhibited initial weight loss post-SCI (Fig. 3B), but TAM-treated rats demonstrated significant weight recovery by week 2, matching normal group growth rates. BBB scoring indicated superior motor recovery in the TAM group versus controls at day 14 and 21, with significant divergence from W3-6 (TAM:12.33 vs SCI:8.33 at D42; p<0.05; Fig. 3C). Footprint analysis (Fig. 3D) revealed SCI rats displayed toe dragging and shortened stride lengths, while TAM group restored plantar contact and toe angles. TAM intervention improved urinary function, showing reduced bladder volume (Fig. 3E), decreased bladder perimeter (Fig. 3F), and accelerated micturition recovery (14d vs 20d; p <0.05; Fig. 3G). HE staining at D42 demonstrated TAM reduced lesion cavitation versus SCI (Fig. 3H-I), attenuated dense glial scarring/inflammation, and enhanced neuronal survival (Fig. 3J), suggesting neuroprotection, glial recruitment, and axonal regeneration for improved histopathological recovery TAM can Reduce the Expression of CCL2 and CCR2 in vivo and in vitro Models An SCI transversal model was established to investigate the differential expression of CCL2/CCR2 in the acute and subacute stages of SCI (Fig. 4A). The results showed that CCL2 protein expression increased after SCI, peaked 1 day after injury, and then decreased. (Fig. 4B-D). At the same time, the expression of CCR2 protein also showed an increasing trend after SCI, lagging behind that of CCL2, and significantly increased from the first day, and reached a high level on the third day. Next, we verified the regulatory effect of TAM on CCL2 and CCR2 in vivo and in vitro models. To select the appropriate concentration of TAM, CCK8 kit was used (Fig. 4E). PCR results showed that the mRNA expression of CCL2/CCR2 was decreased with TAM concentrations of 7.5, 5 and 2.5 μM (Fig. 4F-G). ELISA kit was used to detect CCL2 in the supernatant of cells, and it was found that TAM administration could reduce the content of CCL2 in the supernatant, of which 7.5uM and 5uM were the most effective (Fig. 4H). The immunofluorescence experiment was performed by implementing TAM at a concentration of 5 μM. The results of immunofluorescence experiment showed that TAM could decrease the expression level of CCL2/CCR2 protein (Fig. 4 I-L). Further in vivo investigations in rat models (Fig. 4 M) demonstrated significantly reduced CCL2/CCR2 mRNA levels in the TAM+SCI group versus SCI group via RT-PCR, while no changes were observed between sham and TAM-only groups, confirming TAM’s specificity to SCI conditions (Fig. 4 N-O). ELISA further validated TAM-mediated reduction of serum CCL2 post-SCI (Fig. 3-6P). WB analysis revealed TAM effectively suppressed SCI-induced upregulation of CCL2/CCR2 protein expression, even reducing levels below pre-SCI baselines (Fig. 4 Q-S). TAM Administration Decreased the expression of Inflammatory Factors through NF-κB Pathway in vivo and in vitro Models In the in vitro model, the expression levels of inflammatory factors (such as TNF-α, IL-1β, and IL-6) in the cell supernatant were assessed using an ELISA kit. Following LPS induction, there was a significant increase in the expression levels of inflammatory factors (Fig. 5 A-C). The expression of inflammatory factors was further validated at the mRNA level using RT-PCR (Fig. 5 D-F). Given that nitric oxide (NO) promotes inflammatory responses and factor generation, we subsequently measured the NO content in the cell supernatant. The experimental results indicated that NO levels significantly increased following LPS induction in the cell model, while TAM treatment notably reduced NO levels (Fig. 5 G-I). To further investigate the impact of TAM on the NF-κB pathway, we first validated the mRNA expression levels of NF-κB in the in vitro model using RT-PCR. The inhibitory effect of TAM on NF-κB exhibited a concentration-dependent enhancement. We selected 5 μM for subsequent experiments; both the CCR2 antagonist and the TAM treatment group demonstrated inhibitory effects on NF-κB expression at the mRNA level (Fig. 5K). Immunofluorescence confirmed these findings at the protein level (Fig. 5L), with Fig. 5M presenting the statistical results for fluorescence intensity. Next, we validated the experimental results from the in vitro model in an in vivo SCI model. The expression levels of inflammatory factors in serum were measured using an ELISA kit three days post-SCI treatment. Compared to the sham-operated group, the SCI group exhibited a significant increase in serum inflammatory factors, while a downward trend was observed in pro-inflammatory factors IL-6, IL-1β, and TNF-α in the SCI+TAM group, with statistical significance (Fig. 5N-P). PCR results further indicated that TAM treatment could downregulate the expression of inflammatory factors at the mRNA level in both in vivo and in vitro models (Fig. 5Q-S). Next, we will examine the expression of NF-κB protein in the in vivo model following TAM treatment. The PCR results indicate that the NF-κB pathway is activated in the animal model after SCI, whereas administration of TAM suppresses the expression of this pathway (Fig. 5T). At the protein level, the inhibitory effect of TAM on NF-κB protein is relatively modest (Fig. 5U-V). TAM Administration can Regulate Microglial Polarization in vivo and in vitro Models In vitro models: RT-PCR was used to detect mRNA expression levels of CD32, iNOS, and Arg-1. LPS-induced inflammatory groups showed upregulated iNOS and CD32 mRNA expression compared to the normal group, while TAM administration downregulated their expression. LPS-induced groups exhibited reduced Arg-1 mRNA expression, which was upregulated by TAM (Fig. 6A-C). A concentration of 5 μM was selected for subsequent experiments. At the mRNA level, the CCR2 antagonist INCB3344 also promoted microglial polarization from M1 to M2 phenotypes (Fig. 6D-F). At the protein level, LPS induction significantly enhanced M1 polarization, with increased iNOS fluorescence intensity in the cytoplasm (Fig. 6G-H) and elevated CD32 fluorescence intensity compared to controls. TAM intervention reversed microglial polarization from M1 to M2: iNOS fluorescence intensity decreased, CD32 membrane fluorescence intensity diminished (Fig. 6I-J), and Arg-1 fluorescence intensity increased post-TAM (Fig. 6K-L), with uniform green fluorescence signals indicating M2 reparative phenotype activation. In vivo animal models: SCI groups showed elevated iNOS and CD32 mRNA expression compared to sham groups, which was reduced by TAM intervention. Arg-1 mRNA expression in SCI groups showed no significant difference from sham groups but was significantly upregulated post-TAM. TAM alone had no effect on CD32, iNOS, or Arg-1 expression (Fig. 6M-O). WB results demonstrated that TAM significantly regulated microglial polarization. Compared to SCI groups, the SCI+TAM group exhibited markedly reduced M1 markers (iNOS and CD32 protein levels): by day 3 post-injury, iNOS and CD32 expression decreased, indicating suppression of pro-inflammatory phenotype activation. Concurrently, M2 marker Arg-1 expression showed time-dependent upregulation in the TAM group, surpassing SCI group levels by day 3 post-injury, suggesting microglial shift toward an anti-inflammatory/reparative phenotype (Fig. 6P-S). TAM activates PPAR-γ expression in both in vivo and in vitro models In the in vitro cell model, PPAR-γ expression was first assessed at the mRNA level. Results revealed that LPS induction suppressed PPAR-γ expression, whereas TAM administration activated PPAR-γ expression (Fig. 7A). Similarly, treatment with INCB3344, a CCR2 antagonist, also activated PPAR-γ expression by antagonizing CCR2 (Fig. 7B). Immunofluorescence analysis at the protein level (Fig. 7C-D) further validated these findings: LPS treatment significantly reduced PPAR-γ fluorescence intensity, while both TAM and INCB3344 administration restored PPAR-γ activation, as indicated by enhanced green fluorescence signals. In vivo animal experiments confirmed these results through PCR and WB analyses at both mRNA and protein levels. Following SCI, PPAR-γ expression was inhibited, but TAM treatment effectively restored its expression (Fig. 7E-G). TAM activates the expression of the Bcl-2/Bax/Caspase-3 axis in in vitro models RT-PCR was employed at the mRNA level to assess the expression of the Bcl-2/Bax/Caspase-3 axis. The results demonstrated that LPS induction downregulated Bcl-2 expression and upregulated Bax and Caspase-3 protein expression. Treatment with TAM and INCB3344 increased Bcl-2 expression and reduced Bax and Caspase-3 expression following LPS induction (Fig. A-C). Immunofluorescence results at the protein level corroborated these findings: LPS induction decreased Bcl-2 expression and weakened green fluorescence intensity, while both TAM and INCB3344 administration upregulated Bcl-2 expression (Fig. D-E). Concurrently, LPS induction elevated Bax and Caspase-3 protein expression, which was attenuated by TAM and INCB3344 treatment, as evidenced by reduced green fluorescence intensity (Fig. F-I). PPAR-γ Activation Suppresses CCL2/CCR2 Expression Following SCI To further explore the relationship between CCL2/CCR2 and PPAR-γ, we detected the expression of CCL2/CCR2 in vivo and vitro model. To verify whether TAM relieve neuropathic pain by activating PPAR-γ, GW9662(PPAR-γ antagonist) was co-administrated with TAM. TAM was not injected into the SHAM group and SCI group. TAM was injected into the experimental group, and TAM and PPAR-γ inhibitor GW9662 (1 mg/kg) were injected into the GW9662 group after SCI. As shown in Figure 8A, PCR results showed that GW9662 could effectively inhibit the activation of the PPAR-г pathway. As shown in Fig 8B-E, the expression levels of CCL2 and CCR2 in GW9662 group were increased in both in vivo and in vitro models. These results indicated that TAM affected the expression of CCL2/CCR2 through PPAR-γ. Meanwhile, immunofluorescence results showed that TAM could decrease the expression of CCL2 and CCR2, while GW9662 could increase the expression of CCL2 and CCR2 by inhibiting the expression of PPAR-γ (Fig. 8F-I). In animal model, WB results showed that TAM administration could inhibit the expression of CCL2 and CCR2 after SCI, while GW9662 could reverse the effect of TAM on SCI rats by inhibiting the expression of PPAR-γ (Fig. 8J-L). In summary, the results showed that inhibition of PPAR-γ pathway expression reversed the decreased expression of CCL2 and CCR2 in SCI rats induced by TAM administration. The expression of CCL2 and CCR2 is related to the PPAR-γ pathway. Discussion Previous studies have demonstrated that TAM, a drug approved by the FDA, promotes the recovery of motor neurons, myelin protection, axonal preservation, and neuronal survival, thereby exerting neuroprotective effects[ 34 , 36 , 40 ]. Our research reveals that TAM primarily exerts its neuroprotective effects through chemokine and receptor-related pathways, which mediate anti-apoptotic and anti-inflammatory responses, ultimately enhancing the recovery of motor and neurological functions following SCI (As shown in Fig. 9 ). A prospective therapeutic approach for treating inflammation and secondary injury should focus on the CCL2/CCR2 axis[ 13 , 41 ]. This study integrates two datasets, GSE42828 (rat SCI model) and GSE5296 (mouse spinal cord injury model), to identify 58 co-expressed genes. This research explores the pathological significance of these key genes during the acute phase of SCI. The elevated expression of these genes plays a crucial biological role in the regulation of the inflammatory microenvironment, neuronal repair, and secondary injury associated with SCI. Their functions can be categorized as follows: pro-inflammatory response and immune cell recruitment, macrophage/microglial polarization and phagocytic regulation, and lipid metabolism alongside inflammation resolution. In terms of pro-inflammatory response and immune cell recruitment, the heightened expression of CCL2 and CCR2 drives the migration of monocytes and macrophages to the site of injury, exacerbating the inflammatory response. During the early phase of SCI, CCL2 activates the NF-κB pathway to promote M1 macrophage polarization, leading to the release of pro-inflammatory factors such as TNF-α and IL-1β, which intensify neuronal apoptosis. Additionally, CCL3 (MIP-1α) works in conjunction with CCL2 to enhance the infiltration of neutrophils and T cells, thereby broadening the area of inflammatory damage. CCR1 mediates the signaling of chemokines (such as CCL3), facilitating microglial activation. FCGR1A (CD64), functioning as a high-affinity IgG receptor, amplifies antibody-dependent phagocytosis, potentially worsening inflammation-related oxidative stress. According to previous transcriptomic results, it has been established that TAM can effectively reduce the expression of CCR2 before and after SCI[ 37 , 42 ]. Building upon prior research, we selected a concentration of 5 mg/kg TAM for administration[ 33 , 43 ]. A male rat SCI transection model was established, and TAM treatment was administered during the acute phase. The results of this study demonstrate that CCL2 protein expression rapidly increases after SCI, peaking on day 1, and gradually declines thereafter. During the acute phase of SCI, tissue cells such as neurons and glial cells at the injury site rapidly secrete CCL2 in response to traumatic stimulation. As a critical chemokine, CCL2 recruits peripheral monocytes, macrophages, and other immune cells to migrate to the injury site, initiating local immune-inflammatory responses. The sharp early increase in CCL2 expression may help clear necrotic debris and pathogens from damaged tissues, providing temporary protective effects. However, excessive immune-inflammatory responses may exacerbate neuronal damage. The gradual decline in CCL2 expression over time likely reflects a self-regulatory feedback mechanism to mitigate neurotoxic effects of prolonged inflammation. CCR2, the specific receptor for CCL2, exhibited delayed upregulation compared to CCL2. WB and PCR analyses confirmed that TAM administration during the acute phase significantly reduced CCL2 and CCR2 expression in both in vivo and in vitro models, providing critical insights into its neuroprotective mechanisms. Notably, this study is the first to reveal TAM’s dual regulatory effect on CCR2 in SCI models: it suppresses both ligand (CCL2) expression and directly inhibits receptor (CCR2) protein levels, synergistically blocking CCL2/CCR2-mediated inflammatory cascades. SCI activates the NF-κB signaling pathway, triggering production of inflammatory factors such as IL-1β, IL-6, and TNF-α, which exacerbate inflammation and neuronal apoptosis. Suppressing NF-κB is thus a key therapeutic target for mitigating secondary inflammation post-SCI. TAM was shown to inhibit NF-κB pathway activity by downregulating CCR2, significantly reducing NF-κB expression and associated inflammatory cytokines (IL-1β, IL-6, TNF-α) post-treatment. Microglial activation plays a pivotal role in post-SCI inflammation, shifting from anti-inflammatory (M2) to pro-inflammatory (M1) phenotypes, releasing pro-inflammatory factors that worsen neural damage[ 43 ]. TAM modulated microglial polarization via the CCL2/CCR2 axis, promoting a shift from M1 to M2 phenotypes. Specifically, TAM reduced pro-inflammatory markers (iNOS, CD32) and increased anti-inflammatory markers (Arg-1). Concurrently, TAM exerted neuroprotective and anti-inflammatory effects by activating PPAR-γ, which was significantly upregulated in both in vivo and in vitro models. Further experiments revealed that TAM’s inhibition of the CCL2/CCR2 axis was closely linked to PPAR-γ activation. Co-treatment with the PPAR-γ antagonist GW9662 partially reversed TAM’s suppression of CCL2/CCR2 expression, confirming this mechanism. Additionally, TAM regulated Bcl-2 family protein expression by enhancing anti-apoptotic Bcl-2 and reducing pro-apoptotic Bax and Caspase-3 levels, thereby inhibiting apoptosis. Post-SCI, pro-apoptotic protein expression surged, driving cell death. TAM counteracted this by elevating Bcl-2/Bax ratios and suppressing Caspase-3 activity, as validated by immunofluorescence and molecular assays. This study has the following limitations: First, the molecular mechanisms by which TAM regulates SCI treatment remain incompletely understood. It is unclear whether TAM influences the CCL2/CCR2 axis through additional pathways beyond PPAR-γ activation, and the specific molecular mechanisms underlying TAM’s modulation of microglial activation states also require further elucidation. Deeper exploration of these mechanisms could optimize TAM-based therapeutic strategies. Second, in animal experiments, the SCI model utilized male SD rats, leaving the potential effects of estrogen on TAM treatment in females unaddressed. Additionally, the complete transection model fails to replicate clinically common incomplete injuries. Moreover, the manual surgical transection method used for modeling may introduce variability in injury severity across subjects. Finally, in cell experiments, only the BV2 microglial inflammation model was employed to simulate SCI in vitro. However, the spinal cord is a complex tissue environment involving other glial cells and neurons, which cannot be fully recapitulated in this simplified system. Conclusion In conclusion, this study employed a complete transection SCI rat model and an LPS-induced BV2 cell inflammation model to assess the effects of TAM on motor and neurological functional recovery in SCI rats through multiple approaches, combined with bioinformatics analysis to elucidate the underlying mechanisms. Experimental results revealed significant differences in CCL2/CCR2 expression before and after SCI, with TAM effectively reducing their expression. During the acute phase of SCI, TAM activated PPAR-γ, suppressed CCL2/CCR2 expression, inhibited NF-κB pathway activity, and reduced inflammatory cytokine production. Additionally, TAM modulated microglial activation states by shifting them from pro-inflammatory to anti-inflammatory phenotypes and influenced the Bcl-2/BAX/Caspase-3 signaling pathway to inhibit apoptosis. In summary, TAM intervention in the CCL2/CCR2 signaling pathway alleviated secondary inflammation post-SCI, demonstrating anti-apoptotic and anti-inflammatory effects, thereby providing a theoretical foundation for its application in SCI treatment. Declarations Conficts of interest: The authors declare no conflicts of interest. Animal Ethics All animal experiments were approved by the Experimental Animal Ethics Committee of Tianjin Armed Police Specialized Medical Center (Number: Animal 2024-0024), and followed the guidelines for the management and use of experimental animals and the guidelines for the handling of experimental animals issued by the Ministry of Science and Technology (2006). Funding General Program of National Natural Science Foundation of China, No. 82272255; Key Program of the National Natural Science Foundation of China, No. 11932013; Independent Innovation Science Fund, No. KYZZZCX2405; Tianjin Education Commission scientific research project, No. 2022YGYB07. Author Contribution 1. Experimental Design & Conceptualization•Xiangzi Wang designed the experimental framework, established methodology, and defined research objectives for investigating TAM's therapeutic mechanisms in SCI.2. Investigation & Data Acquisition•Xiangzi Wang, Yuqi Lin, Xiao LiangConducted key experiments including: oEstablishment of rat SCI transection modelsoLPS-induced BV2 microglial activation assaysoIntraperitoneal TAM administration and dosage optimizationoBehavioral assessments (BBB scoring, footprint tests, bladder function recovery)oMolecular biology techniques (Western blot, ELISA, RT-PCR, immunofluorescence)3. Data Analysis & Interpretation•Xiangzi Wang & Wuhua Pang & Yuhan LiuPerformed:oBioinformatics analysis of GSE42828/GSE5296 datasetsoStatistical processing using GraphPad Prism 9.0.0oImage quantification (fluorescence intensity, band density via ImageJ)oFunctional enrichment analysis (GO/KEGG pathways)Key visualizations:4. Visualization & Figure Preparation•Xiangzi WangCreated and integrated all figures illustrating experimental results and mechanisms, including: oProtein interaction networksoIn vivo/in vitro validation dataoPathway schematics5. Manuscript Development•Xiangzi Wang & Ziqi WangCo-wrote the manuscript with responsibilities: oDrafted results, methodology, and discussion sectionsoSynthesized data into cohesive narrativeoRevised text for scientific accuracy and clarity6. Supervision & Funding Acquisition•Xuyi Chen & Bin LiuProvided: oTechnical guidance on SCI modeling and molecular assaysoCritical review of experimental designoFunding support (National Natural Science Foundation grants)oOversight for ethical compliance and study validation7. Manuscript Validation•All AuthorsConducted final: oData verificationoIntellectual content reviewoApproval of the published version References Eli, I., Lerner, D. P. & Ghogawala, Z. (2021) Acute Traumatic Spinal Cord Injury, Neurologic Clinics. 39 , 471-488. Hu, Y., Li, L., Hong, B., Xie, Y., Li, T., Feng, C., Yang, F., Wang, Y., Zhang, J., Yu, Y. & Fan, X. (2023) Epidemiological features of traumatic spinal cord injury in China: A systematic review and meta-analysis, FRONTIERS IN NEUROLOGY. 14 . Azarhomayoun, A., Aghasi, M., Mousavi, N., Shokraneh, F., Vaccaro, A. R., Haj Mirzaian, A., Derakhshan, P. & Rahimi-Movaghar, V. (2018) Mortality Rate and Predicting Factors of Traumatic Thoracolumbar Spinal Cord Injury; A Systematic Review and Meta-Analysis, Bulletin of emergency and trauma. 6 , 181-194. Pickelsimer, E., Shiroma, E. J. & Wilson, D. A. (2010) Statewide Investigation of Medically Attended Adverse Health Conditions of Persons With Spinal Cord Injury, JOURNAL OF SPINAL CORD MEDICINE. 33 , 221-231. Rust, R. & Kaiser, J. (2017) Insights into the Dual Role of Inflammation after Spinal Cord Injury, The Journal of neuroscience : the official journal of the Society for Neuroscience. 37 , 4658-4660. Liu, X., Zhang, Y., Wang, Y. & Qian, T. (2021) Inflammatory Response to Spinal Cord Injury and Its Treatment, World Neurosurg. 155 , 19-31. Harvey, L. A. (2016) Physiotherapy rehabilitation for people with spinal cord injuries, Journal of Physiotherapy. 62 , 4-11. Milich, L. M., Ryan, C. B. & Lee, J. K. (2019) Correction to: The origin, fate, and contribution of macrophages to spinal cord injury pathology, Acta Neuropathologica. 137 , 799-800. Devanney, N. A., Stewart, A. N. & Gensel, J. C. (2020) Microglia and macrophage metabolism in CNS injury and disease: The role of immunometabolism in neurodegeneration and neurotrauma, Experimental Neurology. 329 , 113310. Dansereau, M. A., Midavaine, É., Bégin-Lavallée, V., Belkouch, M., Beaudet, N., Longpré, J. M., Mélik-Parsadaniantz, S. & Sarret, P. (2021) Mechanistic insights into the role of the chemokine CCL2/CCR2 axis in dorsal root ganglia to peripheral inflammation and pain hypersensitivity, J Neuroinflammation. 18 , 79. Wang, X., Niu, X., Wang, Y., Liu, Y., Yang, C., Chen, X. & Qi, Z. (2024) C-C motif chemokine ligand 2/C-C motif chemokine receptor 2 pathway as a therapeutic target and regulatory mechanism for spinal cord injury, Neural regeneration research . Wang, X., Niu, X., Wang, Y., Liu, Y., Yang, C., Chen, X. & Qi, Z. (2025) C-C motif chemokine ligand 2/C-C motif chemokine receptor 2 pathway as a therapeutic target and regulatory mechanism for spinal cord injury, NEURAL REGENERATION RESEARCH. 20 , 2231-2244. Zhang, H., Hu, Y.-M., Wang, Y.-J., Zhou, Y., Zhu, Z.-J., Chen, M.-H., Wang, Y.-J., Xu, H. & Wang, Y.-H. (2023) Macrophage migration inhibitory factor facilitates astrocytic production of the CCL2 chemokine following spinal cord injury, Neural regeneration research. 18 , 1802-1808. Rong, Y., Ji, C., Wang, Z., Ge, X., Wang, J., Ye, W., Tang, P., Jiang, D., Fan, J., Yin, G., Liu, W. & Cai, W. (2021) Small extracellular vesicles encapsulating CCL2 from activated astrocytes induce microglial activation and neuronal apoptosis after traumatic spinal cord injury (vol 18, 196, 2021), JOURNAL OF NEUROINFLAMMATION. 18 . Shechter, R., Miller, O., Yovel, G., Rosenzweig, N., London, A., Ruckh, J., Kim, K.-W., Klein, E., Kalchenko, V., Bendel, P., Lira, Sergio A., Jung, S. & Schwartz, M. (2013) Recruitment of Beneficial M2 Macrophages to Injured Spinal Cord Is Orchestrated by Remote Brain Choroid Plexus, Immunity. 38 , 555-569. Rogic, A., Pant, I., Grumolato, L., Fernandez-Rodriguez, R., Edwards, A., Das, S., Sun, A., Yao, S., Qiao, R., Jaffer, S., Sachidanandam, R., Akturk, G., Karlic, R., Skobe, M. & Aaronson, S. A. (2021) High endogenous CCL2 expression promotes the aggressive phenotype of human inflammatory breast cancer, NATURE COMMUNICATIONS. 12 . Kierdorf, K., Erny, D., Goldmann, T., Sander, V., Schulz, C., Perdiguero, E. G., Wieghofer, P., Heinrich, A., Riemke, P., Hölscher, C., Müller, D. N., Luckow, B., Brocker, T., Debowski, K., Fritz, G., Opdenakker, G., Diefenbach, A., Biber, K., Heikenwalder, M., Geissmann, F., Rosenbauer, F. & Prinz, M. (2013) Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways, Nature neuroscience. 16 , 273-80. Ginhoux, F., Greter, M., Leboeuf, M., Nandi, S., See, P., Gokhan, S., Mehler, M. F., Conway, S. J., Ng, L. G., Stanley, E. R., Samokhvalov, I. M. & Merad, M. (2010) Fate mapping analysis reveals that adult microglia derive from primitive macrophages, Science (New York, NY). 330 , 841-5. Dong, Y., Dong, Y., Zhu, C., Yang, L., Wang, H., Li, J., Zheng, Z., Zhao, H., Xie, W., Chen, M., Jie, Z., Li, J., Zang, Y. & Shi, J. (2024) Targeting CCL2-CCR2 signaling pathway alleviates macrophage dysfunction in COPD via PI3K-AKT axis, Cell Commun Signal. 22 , 364. Shi Xu, L. R., Zhang Bing, Chen Qi, Zuo Hua. (2023) Effect of inflammatory reaction mediated by microglia polarization in spinal cord injury, Chinese Journal of Tissue Engineering Research. 27 , 121-129. Brennan, F. H., Li, Y., Wang, C., Ma, A., Guo, Q., Li, Y., Pukos, N., Campbell, W. A., Witcher, K. G., Guan, Z., Kigerl, K. A., Hall, J. C. E., Godbout, J. P., Fischer, A. J., McTigue, D. M., He, Z., Ma, Q. & Popovich, P. G. (2022) Microglia coordinate cellular interactions during spinal cord repair in mice, NATURE COMMUNICATIONS. 13 . Fang, S., Tang, H., Li, M.-Z., Chu, J.-J., Yin, Z.-S. & Jia, Q.-Y. (2023) Identification of the CCL2 PI3K/Akt axis involved in autophagy and apoptosis after spinal cord injury, Metabolic Brain Disease. 38 , 1335-1349. Xu, J., Dong, H., Qian, Q., Zhang, X., Wang, Y., Jin, W. & Qian, Y. (2017) Astrocyte-derived CCL2 participates in surgery-induced cognitive dysfunction and neuroinflammation via evoking microglia activation, BEHAVIOURAL BRAIN RESEARCH. 332 , 145-153. Paterniti, I., Impellizzeri, D., Crupi, R., Morabito, R., Campolo, M., Esposito, E. & Cuzzocrea, S. (2013) Molecular evidence for the involvement of PPAR-δ and PPAR-γ in anti-inflammatory and neuroprotective activities of palmitoylethanolamide after spinal cord trauma, JOURNAL OF NEUROINFLAMMATION. 10 . McTigue, D. M. (2008) Potential Therapeutic Targets for PPARγ after Spinal Cord Injury, PPAR Research. 2008 , 517162. Krishna, S., Cheng, B., Sharma, D. R., Yadav, S., Stempinski, E. S., Mamtani, S., Shah, E., Deo, A., Acherjee, T., Thomas, T., Zhang, X., Zhang, J., Iacobas, D. A. & Ballabh, P. (2021) PPAR-γ activation enhances myelination and neurological recovery in premature rabbits with intraventricular hemorrhage . 118 , e2103084118. Li, X., Guo, Q., Ye, Z., Wang, E., Zou, W., Sun, Z., He, Z., Zhong, T., Weng, Y. & Pan, Y. (2021) PPAR γ Prevents Neuropathic Pain by Down-Regulating CX3CR1 and Attenuating M1 Activation of Microglia in the Spinal Cord of Rats Using a Sciatic Chronic Constriction Injury Model, Frontiers in neuroscience. 15 , 620525. Zhang, H., Gong, M. & Luo, X. (2020) Methoxytetrahydro-2H-pyran-2-yl)methyl benzoate inhibits spinal cord injury in the rat model via PPAR-γ/PI3K/p-Akt activation, Environmental toxicology. 35 , 714-721. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J. & Glass, C. K. (1998) The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation, Nature. 391 , 79-82. Gao, P., Wang, J., Su, Z., Li, F. & Zhang, X. (2021) Amorfrutins Relieve Neuropathic Pain through the PPARγ/CCL2 Axis in CCI Rats, PPAR Research. 2021 , 8894752. Li, B. & Mei, X.-F. (2023) Naringin may promote functional recovery following spinal cord injury by modulating microglial polarization through the PPAR-γ/NF-κB signaling pathway, BRAIN RESEARCH. 1821 . Lu, Y. & Liu, W. (2020) Selective Estrogen Receptor Degraders (SERDs): A Promising Strategy for Estrogen Receptor Positive Endocrine-Resistant Breast Cancer, JOURNAL OF MEDICINAL CHEMISTRY. 63 , 15094-15114. Colon, J. M., Gonzalez, P. A., Cajigas, A., Maldonado, W. I., Torrado, A. I., Sandago, J. M., Salgado, I. K. & Miranda, J. D. (2018) Continuous tamoxifen delivery improves locomotor recovery 6 h after spinal cord injury by neuronal and glial mechanisms in male rats, EXPERIMENTAL NEUROLOGY. 299 , 109-121. Colón, J. M. & Miranda, J. D. (2016) Tamoxifen: an FDA approved drug with neuroprotective effects for spinal cord injury recovery, Neural Regeneration Research. 11 , 1208-1211. de la Torre Valdovinos, B., Duenas Jimenez, J. M., Estrada, I. J., Banuelos Pineda, J., Franco Rodriguez, N. E., Lopez Ruiz, J. R., Osuna Carrasco, L. P., Candanedo Arellano, A. & Duenas Jimenez, S. H. (2016) Tamoxifen Promotes Axonal Preservation and Gait Locomotion Recovery after Spinal Cord Injury in Cats, Journal of veterinary medicine. 2016 , 9561968-9561968. Colon, J. M., Torrado, A. I., Cajigas, A., Santiago, J. M., Salgado, I. K., Arroyo, Y. & Miranda, J. D. (2016) Tamoxifen Administration Immediately or 24 Hours after Spinal Cord Injury Improves Locomotor Recovery and Reduces Secondary Damage in Female Rats, JOURNAL OF NEUROTRAUMA. 33 , 1696-1708. Cabrera-Aldana, E. E., Balderas-Martinez, Y. I., Velázquez-Cruz, R., Tovar-y-Romo, L. B., Sevilla-Montoya, R., Martínez-Cruz, A., Martinez-Cordero, C., Valdes-Flores, M., Santamaria-Olmedo, M., Hidalgo-Bravo, A. & Guízar-Sahagún, G. (2023) Administration of Tamoxifen Can Regulate Changes in Gene Expression during the Acute Phase of Traumatic Spinal Cord Injury in Current Issues in Molecular Biology pp. 7476-7491 Ma, H., Wang, C., Han, L., Kong, F., Liu, Z., Zhang, B., Chu, W., Wang, H., Wang, L., Li, Q., Peng, W., Yang, H., Han, C. & Lu, X. (2023) Tofacitinib Promotes Functional Recovery after Spinal Cord Injury by Regulating Microglial Polarization via JAK/STAT Signaling Pathway, International journal of biological sciences. 19 , 4865-4882. Wang, R., Wu, X., Tian, Z., Hu, T., Cai, C., Wu, G., Jiang, G. B. & Liu, B. (2023) Sustained release of hydrogen sulfide from anisotropic ferrofluid hydrogel for the repair of spinal cord injury, Bioactive materials. 23 , 118-128. Salgado, I. K., Torrado, A. I., Santiago, J. M. & Miranda, J. D. (2015) Tamoxifen and Src kinase inhibitors as neuroprotective/neuroregenerative drugs after spinal cord injury, NEURAL REGENERATION RESEARCH. 10 , 385-390. Gu, C., Geng, X., Wu, Y., Dai, Y., Zeng, J., Wang, Z., Fang, H., Sun, Y. & Chen, X. (2024) Engineered Macrophage Membrane-Coated Nanoparticles with Enhanced CCR2 Expression Promote Spinal Cord Injury Repair by Suppressing Neuroinflammation and Neuronal death, SMALL. 20 . Wei., H. (2016) Neuroprotective effect of tamoxifen in a model rat with aucte spinal cord injury, Chinese Journal of Tissue Engineering Research. 20 , 7710-7716. Crisci, I., Bonzano, S., Nicolas, Z., Dallorto, E., Peretto, P., Krezel, W. & De Marchis, S. (2024) Tamoxifen exerts direct and microglia-mediated effects preventing neuroinflammatory changes in the adult mouse hippocampal neurogenic niche, GLIA. 72 , 1273-1289. Additional Declarations No competing interests reported. Supplementary Files ThefullimagesofWB.pptx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Oct, 2025 Reviews received at journal 09 Oct, 2025 Reviews received at journal 08 Oct, 2025 Reviewers agreed at journal 18 Sep, 2025 Reviewers agreed at journal 17 Sep, 2025 Reviewers invited by journal 17 Sep, 2025 Editor assigned by journal 03 Sep, 2025 Submission checks completed at journal 19 Aug, 2025 First submitted to journal 02 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7278511","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":517670393,"identity":"36050c63-9ad5-4150-8fdd-1495858e6a51","order_by":0,"name":"Xiangzi Wang","email":"","orcid":"","institution":"State Key Laboratory of Medicinal Chemical Biology, College of Pharmacy, Nankai University,","correspondingAuthor":false,"prefix":"","firstName":"Xiangzi","middleName":"","lastName":"Wang","suffix":""},{"id":517670394,"identity":"d36a7d26-3b66-4113-a387-4de12f0d2174","order_by":1,"name":"Yuqi Lin","email":"","orcid":"","institution":"Graduate School of Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuqi","middleName":"","lastName":"Lin","suffix":""},{"id":517670395,"identity":"aec99cdc-e395-41c3-b5e1-9837cba5dbb9","order_by":2,"name":"Xiao Liang","email":"","orcid":"","institution":"State Key Laboratory of Medicinal Chemical Biology, College of Pharmacy, Nankai University,","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Liang","suffix":""},{"id":517670396,"identity":"09ae95d8-74c3-409c-893a-c100b63a9c59","order_by":3,"name":"Wuhua Pang","email":"","orcid":"","institution":"Graduate School of Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wuhua","middleName":"","lastName":"Pang","suffix":""},{"id":517670397,"identity":"aa5bdf44-3b12-4164-96de-5a2c22b1b76b","order_by":4,"name":"Yuhan Liu","email":"","orcid":"","institution":"Graduate School of Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuhan","middleName":"","lastName":"Liu","suffix":""},{"id":517670398,"identity":"dba839cc-2574-463d-90d6-ac85225b21c2","order_by":5,"name":"Ziqi Wang","email":"","orcid":"","institution":"Characteristic Medical Center of People’s Armed Police Forces","correspondingAuthor":false,"prefix":"","firstName":"Ziqi","middleName":"","lastName":"Wang","suffix":""},{"id":517670399,"identity":"e3f002a6-7402-4b74-827d-f1bc5bc5a2eb","order_by":6,"name":"Bin Liu","email":"","orcid":"","institution":"Central Laboratory, the Second Hospital of Hebei Medical University,","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Liu","suffix":""},{"id":517670400,"identity":"436c77f8-8ea7-47ea-8194-e5f4aa7cf7a0","order_by":7,"name":"Xuyi Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYDACCQjFw8be//HBBwMbOeK18PEcMDacUZBmTLQWBjmJBDNpng+HEwnq4J/dfOwxb9thGTaJhDRpGwPmBAb2w0c34LXkzrF0w5lth3nYeB4cts4xYMtj4ElLu4FPi4FEjpnER5AW9sTG2zkGPMUMEjxmBLTkf5NIBGlhSGaQtjCQSGwgrCWHDWILRxqTNIOBAWEtEjfSzCRnnEsH+uUMs2GPQYIxGyG/8M9IfibNU2ZtL9/ew/jgx5//cvzsh4/h1QIFzQgmGxHKQaCOSHWjYBSMglEwIgEApwFCvmowQmQAAAAASUVORK5CYII=","orcid":"","institution":"Characteristic Medical Center of People’s Armed Police Forces","correspondingAuthor":true,"prefix":"","firstName":"Xuyi","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-08-02 13:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7278511/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7278511/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92276713,"identity":"9c16dd97-59b8-4cfd-8b7a-82e879c38e24","added_by":"auto","created_at":"2025-09-26 15:31:12","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7893236,"visible":true,"origin":"","legend":"","description":"","filename":"MainDocument1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/714b82902d78a809fbdeefa6.docx"},{"id":92276724,"identity":"2aeb8290-1ac5-4e40-bbda-fd524e75bbc2","added_by":"auto","created_at":"2025-09-26 15:31:15","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6005176,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1AI.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/e33dd9db17dede8817a0cafd.tif"},{"id":92276720,"identity":"a8314fbc-415d-4fc3-85ec-d3ab19d9d025","added_by":"auto","created_at":"2025-09-26 15:31:14","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2834680,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3AI.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/df0977b6317b2354019872fe.jpg"},{"id":92276825,"identity":"dfd047a1-0e36-4532-9564-8e33977db8cf","added_by":"auto","created_at":"2025-09-26 15:31:39","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8923052,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/17378533a9ac7c47f44c0a2d.tif"},{"id":92276824,"identity":"5ed9b8bc-8fc3-4faf-9f21-001a432912d3","added_by":"auto","created_at":"2025-09-26 15:31:38","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19196712,"visible":true,"origin":"","legend":"","description":"","filename":"Fig62.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/ccd26e4de2a654d9aadb29ab.tif"},{"id":92276810,"identity":"1fd0a69b-1afa-480a-994b-41e764371022","added_by":"auto","created_at":"2025-09-26 15:31:30","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10428540,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/3b06ac8929c0b600221e4f6b.tif"},{"id":92276559,"identity":"d654a460-6ae5-4e6a-be70-bdf484220b77","added_by":"auto","created_at":"2025-09-26 15:30:58","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15230728,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/8f543e1510e35441cb12da76.tif"},{"id":92277418,"identity":"60812008-12ec-4453-800b-20a4fb994798","added_by":"auto","created_at":"2025-09-26 15:39:09","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":740369,"visible":true,"origin":"","legend":"","description":"","filename":"MechanismofTAMtreatment.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/041d3df72b4192f8a763df0a.png"},{"id":92276776,"identity":"aa6222ad-32cd-4c06-bd6f-75a498c375cc","added_by":"auto","created_at":"2025-09-26 15:31:29","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11463,"visible":true,"origin":"","legend":"","description":"","filename":"438f041ff7d2403fbbceb6472951d77a.json","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/10f095adb5c7a5b0cc37806f.json"},{"id":92276503,"identity":"faa2e858-1347-42e1-bb2b-d7452aa92c8c","added_by":"auto","created_at":"2025-09-26 15:30:54","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14489,"visible":true,"origin":"","legend":"","description":"","filename":"AnimalEthicsdeclaration.docx","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/0db882925c1c275587410a97.docx"},{"id":92276738,"identity":"49dfa2d5-76b4-4ac8-87ee-c58dec8dd06b","added_by":"auto","created_at":"2025-09-26 15:31:17","extension":"pptx","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7289271,"visible":true,"origin":"","legend":"","description":"","filename":"ThefullimagesofWB.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/22e8ae1dd490931f9d7fb47b.pptx"},{"id":92276714,"identity":"cf5e602f-acd3-474f-ad45-a04261d7ec49","added_by":"auto","created_at":"2025-09-26 15:31:12","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156624,"visible":true,"origin":"","legend":"","description":"","filename":"438f041ff7d2403fbbceb6472951d77a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/389406cdf7a61ae452b49950.xml"},{"id":92276816,"identity":"cb45f2b4-b428-4ff6-a5e4-856a2b6ef0d7","added_by":"auto","created_at":"2025-09-26 15:31:36","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6005176,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1AI.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/f434cf721e5a602f69634340.tif"},{"id":92276708,"identity":"ae27c2e2-6829-40c3-998d-80d87c8f08e3","added_by":"auto","created_at":"2025-09-26 15:31:10","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2834680,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3AI.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/a4158df59389aa38bebba312.jpg"},{"id":92276711,"identity":"dc35157e-e35a-4a4e-b0ed-08b38f0aee6e","added_by":"auto","created_at":"2025-09-26 15:31:11","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8923052,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/acb0e54af3b8cda78eb21d70.tif"},{"id":92276564,"identity":"445c3ac5-73e0-4956-be1a-8fcb261c9c37","added_by":"auto","created_at":"2025-09-26 15:31:00","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19196712,"visible":true,"origin":"","legend":"","description":"","filename":"Fig62.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/d12fe959000ac96229918abe.tif"},{"id":92276822,"identity":"3475060d-0ffa-4b3e-bf54-49a75bb7dd26","added_by":"auto","created_at":"2025-09-26 15:31:38","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10428540,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/dc4a6e2313945b6926a2551d.tif"},{"id":92276556,"identity":"5b3350ad-b382-4480-bd3f-d5c008730ae0","added_by":"auto","created_at":"2025-09-26 15:30:57","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15230728,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/1d9dadafbe0bec2924a12367.tif"},{"id":92277432,"identity":"913b0184-5b18-4896-8e45-8b6a9bddc5b8","added_by":"auto","created_at":"2025-09-26 15:39:14","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":740369,"visible":true,"origin":"","legend":"","description":"","filename":"MechanismofTAMtreatment.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/cb83b354c7fd3d4b4d8a028e.png"},{"id":92276549,"identity":"35d8eb46-7e00-4547-beea-5b08a57ec96a","added_by":"auto","created_at":"2025-09-26 15:30:55","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":167248,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/0a5240dcbc74cfda3c4b732f.jpeg"},{"id":92277426,"identity":"7a746eb3-03a7-4c43-b95a-1326945fbb46","added_by":"auto","created_at":"2025-09-26 15:39:10","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":142180,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/6741a14643068314dd96bfe1.png"},{"id":92276745,"identity":"e8dc6dc2-0157-40eb-927e-e262700ba9c8","added_by":"auto","created_at":"2025-09-26 15:31:20","extension":"jpeg","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":760478,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/1035e6716b92e43833353b17.jpeg"},{"id":92276811,"identity":"c5583f5b-01bd-4e44-b6df-5e32db2106c3","added_by":"auto","created_at":"2025-09-26 15:31:31","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1678556,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/dc68065c3331cdc9b90f8171.jpeg"},{"id":92276725,"identity":"24704cd0-8241-44d1-a5da-8ef86f8841a5","added_by":"auto","created_at":"2025-09-26 15:31:15","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":519750,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/7e50683b45124dc887425bef.jpeg"},{"id":92276554,"identity":"671b19ac-1241-46bc-8902-888871d67218","added_by":"auto","created_at":"2025-09-26 15:30:56","extension":"jpeg","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":860318,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/20208133030b054d05f14191.jpeg"},{"id":92276717,"identity":"afd1809c-03db-496e-8e9c-480533274462","added_by":"auto","created_at":"2025-09-26 15:31:13","extension":"jpeg","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1853202,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/33082e5e149d6e684cdeb87a.jpeg"},{"id":92276719,"identity":"8dace2bf-c7b2-4881-9e4a-d5d0f6075c12","added_by":"auto","created_at":"2025-09-26 15:31:14","extension":"jpeg","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1047486,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/330e0df941448ad4e780dcf2.jpeg"},{"id":92276775,"identity":"ddbb410f-b390-4d0c-a860-6af383743a36","added_by":"auto","created_at":"2025-09-26 15:31:29","extension":"jpeg","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":428168,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/a55cdda03c9645772109ed4a.jpeg"},{"id":92276823,"identity":"c0610db7-0474-4002-97a4-d1b66465fb35","added_by":"auto","created_at":"2025-09-26 15:31:38","extension":"jpeg","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":324715,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/a75e59476833856ec16eb64e.jpeg"},{"id":92276597,"identity":"434044b7-3ce6-4e96-a731-fd7f3972004c","added_by":"auto","created_at":"2025-09-26 15:31:06","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2736940,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1AI.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/f8dc258cc018a5a875942acf.png"},{"id":92276706,"identity":"eb46d9aa-6681-44bf-bec3-c0f4e39b79d4","added_by":"auto","created_at":"2025-09-26 15:31:10","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":316767,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3AI.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/cfe231a65f35eb75614f94a4.png"},{"id":92276707,"identity":"76fce152-8d9b-4902-bee7-85b6dac5dfab","added_by":"auto","created_at":"2025-09-26 15:31:10","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3352192,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/792a9ca6aec5209c95fa822a.png"},{"id":92276562,"identity":"e8460338-7876-4f4f-afc1-e4d6bea1d785","added_by":"auto","created_at":"2025-09-26 15:30:59","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8428496,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig62.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/03ed8d6748008bf29360fc76.png"},{"id":92276817,"identity":"7c54cfc8-0138-4646-8fca-04827e9e34d1","added_by":"auto","created_at":"2025-09-26 15:31:36","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4398900,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/6805ce5254167f3fea69199a.png"},{"id":92276746,"identity":"4e6de1da-0723-4fa5-84c0-3e5dac3e70db","added_by":"auto","created_at":"2025-09-26 15:31:20","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6312821,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/c3200b93b0c226a6a456544a.png"},{"id":92276703,"identity":"e739aa15-784a-4953-9062-53daa3177653","added_by":"auto","created_at":"2025-09-26 15:31:09","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111522,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineMechanismofTAMtreatment.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/e0dc4ebcdb5b44622e8c412a.png"},{"id":92276751,"identity":"696ecb37-68b8-4cdd-92f9-074018aa6928","added_by":"auto","created_at":"2025-09-26 15:31:25","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31572,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/a01958dc4ad34a26c1d42bdb.png"},{"id":92276594,"identity":"eb2c190c-23e2-497a-ab03-fdcc035e501d","added_by":"auto","created_at":"2025-09-26 15:31:05","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34942,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/0074e5568e916fffffaba574.png"},{"id":92276601,"identity":"2544764e-7f9f-4c62-9751-bebeda358b0c","added_by":"auto","created_at":"2025-09-26 15:31:09","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124396,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/abb58b874fcab43b487489d2.png"},{"id":92276741,"identity":"4c4c9a83-4677-4bd3-b5b5-97e0f47fa44e","added_by":"auto","created_at":"2025-09-26 15:31:18","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":230310,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/0bd46c5e97453452c029f130.png"},{"id":92276705,"identity":"c8a5ea49-4e5b-415f-87a4-8f34140bde64","added_by":"auto","created_at":"2025-09-26 15:31:10","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134264,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/73a6838fb38508dde09a38b8.png"},{"id":92276722,"identity":"d7c260bd-fca7-418d-8f11-66810f2d6fad","added_by":"auto","created_at":"2025-09-26 15:31:15","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102117,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/d21b8b2b4ff2ae67667173fc.png"},{"id":92276702,"identity":"a917d4fd-d8af-4750-a800-5ce1523d5c7f","added_by":"auto","created_at":"2025-09-26 15:31:09","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":196476,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/738146303afa3c85187f81fb.png"},{"id":92276723,"identity":"32c548c1-ff8a-42e2-8bdf-1e1ba925e955","added_by":"auto","created_at":"2025-09-26 15:31:15","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100542,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/1014289d51f5a463b23b9fcd.png"},{"id":92276792,"identity":"f8af2e11-ace2-4ae9-9aa4-4b3c09b8e72c","added_by":"auto","created_at":"2025-09-26 15:31:29","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138659,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/e2579ad29adc16e0da445646.png"},{"id":92276774,"identity":"460720b2-cb60-4079-8130-b18fa12a868f","added_by":"auto","created_at":"2025-09-26 15:31:28","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97101,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/e8d7adfd1a29741fc8f09041.png"},{"id":92276742,"identity":"a9774ffb-1b67-43ae-8466-00cf9688157f","added_by":"auto","created_at":"2025-09-26 15:31:18","extension":"xml","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":152164,"visible":true,"origin":"","legend":"","description":"","filename":"438f041ff7d2403fbbceb6472951d77a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/743e03b0e554299dc06dd0df.xml"},{"id":92276827,"identity":"f0e2337f-7c5d-4077-8f94-90d1ddd10d14","added_by":"auto","created_at":"2025-09-26 15:31:39","extension":"html","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":164645,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/cf4e7eb8a97c50c75bfcae13.html"},{"id":92276777,"identity":"e671bbeb-35ae-49da-8da9-e68a8b101d36","added_by":"auto","created_at":"2025-09-26 15:31:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":188592,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental Design\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/b4731ba4ffc11877a23626dd.png"},{"id":92276595,"identity":"395331d9-9f5d-42f6-bef5-047da81b45ec","added_by":"auto","created_at":"2025-09-26 15:31:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1268513,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBioinformatics analysis of differential gene expression after SCI.\u003c/strong\u003e A. Volcano Plot: Transcriptomic sequencing results before and after SCI were compared with the SHAM surgery group in the GSE5296 database (criteria: abs(log2FC) \u0026gt;1,\u003cem\u003e p\u003c/em\u003e\u0026lt;0.05). B. Volcano Plot: Transcriptomic sequencing results before and after SCI were compared with the SHAM surgery group in the GSE42828 database (criteria: abs(log2FC) \u0026gt;1, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05). C. Venn Diagram: A total of 58 commonly upregulated genes were identified in both GSE42828 and GSE5296 datasets. D. Protein-protein interaction (PPI) network of the 58 differentially expressed genes post-SCI was constructed using the STRING database. E. Protein-Protein Interaction Network. F. Core gene PPI network, filtered based on MCC values using Cytoscape software. G. GO functional enrichment analysis was performed on the 10 core genes commonly differentially expressed post-SCI. H. Histogram of GO functional enrichment analysis results for CCL2 and CCR2 genes.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/f5f5c6203779faf0ec424f65.png"},{"id":92276560,"identity":"9c03073e-706d-496f-a274-8c2028713a86","added_by":"auto","created_at":"2025-09-26 15:30:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2864645,"visible":true,"origin":"","legend":"\u003cp\u003eTAM can improve motor function and behavior in SCI rats A. Experimental protocol. B. Trends in body weight changes among the SHAM, SCI, and SCI+TAM groups. C. BBB scores for the SHAM, SCI, and SCI+TAM groups. D. The forelimbs of the rats were stained with blue ink, while the hindlimbs were marked with red ink. Footprint analysis was conducted on the SCI and SCI+TAM groups on day 42. E. A comparison of bladder size among the SHAM, SCI, and SCI+TAM groups on day 42. F. Statistical analysis of bladder tissue circumference in the SHAM, SCI, and SCI+TAM groups. G. Recovery of urinary function in the SCI and SCI+TAM groups.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/ac90b69481d24462e06fc952.png"},{"id":92276596,"identity":"74255a09-833c-48bd-8f27-c36d7d39b959","added_by":"auto","created_at":"2025-09-26 15:31:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":542765,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential expression of CCL2/CCR2 after SCI and expression of CCL2/CCR2 after TAM administration. \u003c/strong\u003eA. Experimental Protocol. B. Western Blot analysis was performed to assess the expression levels of CCL2 and CCR2 proteins on days 1, 3, 7, and 14 post-SCI. C-D. Quantitative analysis of CCL2 and CCR2 protein levels (n=3 per group). E. CCK-8 assay results (n=5 per group). F-G. RT-PCR analysis of CCL2/CCR2 mRNA expression levels in the control, LPS, and treatment groups (n=3 per group). H. CCL2 expression levels in cell supernatants were measured using a CCL2 ELISA kit. I and K. Representative fluorescence images of CCL2 and CCR2 in the control, LPS, and LPS+TAM groups. J and L. Quantitative analysis of CCL2 and CCR2 fluorescence intensity (n=3 per group). M. Experimental protocol. N-O. RT-PCR analysis of CCL2/CCR2 mRNA expression levels in spinal cord tissues from SHAM, TAM, SCI, and SCI+TAM groups (n=3 per group). P. ELISA assay measuring CCL2 expression levels in serum samples from SHAM, TAM, SCI, and SCI+TAM groups (n=3 per group). Q. Representative Western blot results of CCL2 and CCR2 in spinal cord tissues from the SHAM, SCI, and SCI+TAM groups on day 3 post-SCI. R-S. Quantitative analysis of CCL2 and CCR2 protein levels (n=3 per group).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/c38feab9dcf1fd65ea6333b8.png"},{"id":92276550,"identity":"e01c18ac-58ca-4d5e-9095-c38e4104ddf9","added_by":"auto","created_at":"2025-09-26 15:30:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1374979,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression level of inflammatory factors in in vitro and in vivo models and the expression level of inflammatory pathway NF-κB in vitro models.\u003c/strong\u003e A-C. ELISA kit was used to detect the expression of TNF-α, IL-1β and IL-6 in cellular supernatant after TAM administration (n=3 per group). D-F. RT-PCR was used to detect the mRNA expression of TNF-α, IL-1β and IL-6 in BV2 cells after TAM administration compared with M0 group and LPS group (n = 3 per group). G-I. NO kit was used to detect the content of NO in the cell supernatant after 24 h, 36 h and 48 h of TAM administration (n=5 per group). J. RT-PCR was used to detect the mRNA expression of NF-κB in M0, LPS, 7.5, 5 and 2.5 μM groups (n=3 per groups). K. RT-PCR was used to detect the mRNA expression of NF-κB in M0, LPS, LPS+TAM and LPS+INCB3344 groups (n=3 per groups). L. Representative fluorescence images of NF-κB from M0, LPS, LPS+TAM and LPS+INCB3344 groups. M. Analysis of NF-κB fluorescence intensity as shown in L (n = 3 per group). N-P. ELISA kit was used to detect the expression of TNF-α, IL-1β and IL-6 in serum of SCI rats after TAM administration (n = 3 per group). Q-S. RT-PCR was used to detect the mRNA expression of TNF-α, IL-1β and IL-6 in the spinal cord of rats after TAM administration compared with SCI group and SHAM group (n = 3 per group). T. RT-PCR was used to detect the mRNA expression of NF-κB in the spinal cord of rats. U. Representative Western blots of NF-κB in the spinal cord at 3 days after SCI. V. Analysis of NF-κB protein levels as shown in U (n = 3 per group).\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/91449fb86afd0184973c3010.png"},{"id":92276600,"identity":"eb5be4ed-40f7-4058-a9fd-42b19b4066bc","added_by":"auto","created_at":"2025-09-26 15:31:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3002034,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of M1 and M2 microglia markers in in vitro and in vivo models. A-C. RT-PCR was used to detect the mRNA expression of iNOS, CD32 and Arg-1 in BV2 cells after TAM administration compared with M0 group and LPS group (n = 3 per group). D-F. RT-PCR was used to detect the mRNA expression of iNOS, CD32 and Arg-1 in M0, LPS, LPS+TAM and LPS+INCB3344 groups(n = 3 per group). G.I and K. Representative fluorescence images of iNOS, CD32 and Arg-1from M0, LPS, LPS+TAM and LPS+INCB3344 groups. H, J and L. Analysis of iNOS, CD32 and Arg-1fluorescence intensity (n = 3 per group). M-O. RT-PCR was used to detect the mRNA expression of iNOS, CD32 and Arg-1 in the spinal cord of rats after TAM administration compared with SCI group and SHAM group (n = 3 per group). P. Representative Western blots of iNOS, CD32 and Arg-1 in the spinal cord at 3 days after SCI. Q-S. Analysis of the expression iNOS, CD32 and Arg-1 protein levels as shown in M (n = 3 per group).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/42f9e46dac92366ad226d8b8.png"},{"id":92276548,"identity":"b2999e17-728e-424c-9427-500d0365b092","added_by":"auto","created_at":"2025-09-26 15:30:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1650994,"visible":true,"origin":"","legend":"\u003cp\u003eRegulation of PPAR-γ pathway after TAM administration in vivo and in vitro models. A. RT-PCR was used to detect the mRNA expression of PPAR-γ in M0, LPS, 7.5, 5 and 2.5 μM groups (n=3 per groups). B. RT-PCR was used to detect the mRNA expression of PPAR-γ in M0, LPS, LPS+TAM and LPS+INCB3344 groups (n=3 per groups). C. Analysis of PPAR-γ fluorescence intensity as shown in D (n = 3 per group). D. Representative fluorescence images of PPAR-γ from M0, LPS, LPS+TAM and LPS+INCB3344 groups. E. RT-PCR was used to detect the mRNA expression of PPAR-γ in SHAM, TAM, SCI and SCI+TAM groups (n=3 per groups). F. Representative Western blots of PPAR-γ in the spinal cord at 3 days after SCI and TAM administration. G. Analysis of the expression PPAR-γ protein levels as shown in F (n = 3 per group).\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/b4c879946f0d12ea00d39484.png"},{"id":92276602,"identity":"b157962e-db58-455f-b32c-7605a44be2f7","added_by":"auto","created_at":"2025-09-26 15:31:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":454712,"visible":true,"origin":"","legend":"\u003cp\u003eTAM-mediated anti-apoptosis via Bcl-2/BAX/Caspase-3 in vitro. A-C. RT-PCR was used to detect the mRNA expression of Bcl-2, Bax and Caspase-3 in M0, LPS, LPS+TAM and LPS+INCB3344 groups (n=3 per groups). D.F and H. Representative fluorescence images of Bcl2, Bax and Cas-3 from M0, LPS and LPS+TAM and LPS+INCB3344 groups. E.G and I. Analysis of Bcl2, BAX and Cas-3 fluorescence intensity as shown in D.F and H (n = 3 per group).\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/3c90f9c968ad0519f49736c5.png"},{"id":92276744,"identity":"4b4ddca8-3d40-4f60-8559-549b6afd728a","added_by":"auto","created_at":"2025-09-26 15:31:19","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":350551,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. 8\u003c/strong\u003e Expression of CCL2/CCR2 and polarization of microglia in vitro and in vivo models after use of PPAR-г antagonists. A-C. RT-PCR was used to detect the mRNA expression of CCL2, CCR2 and PPAR-г in BV2 cells after TAM and GW9662 administration compared with M0 group and LPS group (n = 3 per group). D-E. RT-PCR was used to detect the mRNA expression of CCL2, CCR2 in the spinal cord of rats after TAM and GW9662 administration compared with SCI group and SHAM group (n = 3 per group). F, H. Representative fluorescence images of CCL2 and CCR2 from M0, LPS, LPS+TAM groups and LPS+TAM+GW9662 group. G, I. Analysis of CCL2 and CCR2 fluorescence intensity as shown in F, H (n = 3 per group). J. Representative WB of CCL2 and CCR2 in the spinal cord of SCI rats at 3 days after TAM and GW9662 administration. K-L. Analysis of the expression CCL2 and CCR2 protein levels as shown in J (n = 3 per group).\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/13866d434465a12b2db8585e.png"},{"id":92276715,"identity":"e88b112c-9036-4553-b7ba-511ddd7a8e5b","added_by":"auto","created_at":"2025-09-26 15:31:12","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":142180,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. 9\u003c/strong\u003e Mechanism of TAM treatment and repair of SCI.\u003c/p\u003e","description":"","filename":"image10.png","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/bce88ef7aae2470a775c8566.png"},{"id":92277862,"identity":"eeb3741e-8c08-4139-b6e7-61fb227cc85b","added_by":"auto","created_at":"2025-09-26 15:43:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12005938,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/798d82bd-5bc7-416d-868d-ac6b4158ec56.pdf"},{"id":92276712,"identity":"efc1560c-d87d-4b2f-b747-336fb9f05e1f","added_by":"auto","created_at":"2025-09-26 15:31:11","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7289271,"visible":true,"origin":"","legend":"","description":"","filename":"ThefullimagesofWB.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7278511/v1/1c647bb0fd77fd7ebbb870a1.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eTamoxifen Modulates Spinal Cord Injury Repair via Ccl2/ccr2 Axis and Its Mechanisms\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSpinal cord injury (SCI) causes irreversible damage to the central nervous system (CNS), profoundly impacting patients' physical and emotional well-being[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Treating SCI is particularly challenging due to the CNS's limited regenerative capacity and the secondary inflammatory responses that exacerbate both physical and emotional suffering, placing a substantial burden on patients' families and society[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In the acute phase, primary injuries include significant physical trauma, disruption of the blood-spinal cord barrier (BSCB), and immediate immune cell activation. Secondary lesions manifest as neuronal death, glial scar formation, immune cell infiltration, demyelination, and reduced neurotransmission[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Two primary therapeutic approaches for SCI are pharmacotherapy and surgery[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Surgical intervention focuses on alleviating spinal cord compression, minimizing further damage, and repairing nerve tissues. Additionally, pharmacological strategies aim to mitigate secondary injury during the acute phase by reducing neuronal damage and inflammatory responses mediated by chemokines. Recent studies have shown that microglia, macrophages, neutrophils, etc. are activated by C-C chemotactic factor ligand 2 (CCL2)/ chemotactic factor C-C receptor 2 (CCR2) axis, leading to the release of numerous chemokines and inflammatory factors, which trigger an inflammatory cascade within 3 to 7 days post-injury [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe available data indicate a significant relationship between the CCL2/CCR2 axis and the inflammatory response, glial scar formation, microglia activation and neuronal death following SCI. Chemokines, such as CCL2, are the major components secreted by astrocytes and microglia post-SCI[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which is involved in recruiting monocytes, T lymphocytes, and natural killer cells to inflammatory sites via interaction with CCR2, thereby exacerbating neuropathology[\u003cspan additionalcitationids=\"CR14 CR15 CR16 CR17 CR18\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Studies have shown that promoting the polarization of microglia from an M1 pro-inflammatory phenotype to an M2 anti-inflammatory phenotype can reduce inflammation, promote tissue repair and regeneration, and restore neural function[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Utilizing GeneMANIA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://genemania.org\u003c/span\u003e\u003cspan address=\"https://genemania.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to investigate gene interactions, Brennan et al. identified CCL2 as a crucial SCI- and microglia-dependent node located at the network's periphery [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. It has also been revealed that CCL2/CCR2 influences SCI recovery in animal models by modulating inflammation and apoptotic pathways[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Consequently, the CCL2/CCR2 pathway affects SCI regeneration and repair by suppressing microglial and astrocytic activation, promoting microglial anti-inflammatory polarization, and diminishing the inflammatory response[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNuclear receptors are a class of ligand-dependent transcription factors that, upon activation, influence the expression of genes regulating crucial physiological processes. Among these receptors, peroxisome proliferator-activated receptor-gamma (PPAR-γ) is considered a vital link between lipid metabolism, metabolic diseases, and innate immunity[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Studies have shown that PPAR-γ agonists possess anti-inflammatory properties and can inhibit neuronal apoptosis[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the models of SCI, PPAR-γ has demonstrated significant neuroprotective and anti-apoptotic effects[\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Moreover, accumulating research underscores the pivotal role of PPAR-γ in suppressing chemokines[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Zhang et al. demonstrated that the PPAR-γ agonist amorfruitins alleviate neuropathic pain in CCI rats via downregulating proinflammatory cytokines and CCL2/CCR2 axis[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Mei et al. demonstrated that naringin can significantly lower the expression of CCL2 and other inflammatory factors after SCI by increasing the expression of PPAR-г protein. Concurrently, there was an increase in the expression of genes linked to microglia M2 polarization in spinal cord tissue[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRecent studies indicate that TAM can suppress CCR2 gene expression post-SCI. Synthesized in 1966, TAM is a selective estrogen receptor modulator (SERM) with a biochemical structure akin to estradiol[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Through various mechanisms, TAM provides neuroprotection by permeating the blood-brain barrier (BBB). These mechanisms encompass reducing inflammatory damage, promoting sensory cortex regeneration, and exerting antioxidant and anti-apoptotic effects in models of penetrating brain injury, middle cerebral artery occlusion (MCAo), and SCI[\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Research has demonstrated that administering TAM within 24 hours or immediately following SCI in female mice can significantly enhances motor function recovery and mitigates secondary inflammatory injury[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Transcriptome analysis of spinal cord tissues collected 24 hours after TAM injection, administered 30 minutes post-injury, demonstrated that TAM downregulates CCR2 gene expression in SCI/TAM- versus SCI/TAM\u0026thinsp;+\u0026thinsp;groups[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Prior studies suggest that TAM may expedite recovery following spinal cord injury by modulating CCR2 gene expression, thereby influencing associated inflammatory pathways.\u003c/p\u003e\u003cp\u003eBased on these findings, the present study adopts the following design: 1) Examination of differential gene expression post-SCI and analysis of gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enriched with CCL2 and CCR2. 2) Evaluation of motor and autonomic function (including bladder control) and histological assessments to gauge recovery in TAM-treated SCI rats. 3) Investigate the impact of TAM on microglial polarization post-SCI. 4) Explore TAM's anti-apoptotic and anti-inflammatory effects and the associated pathways post-SCI. This study further explores potential targets and pathways linked to TAM\u0026rsquo;s effects in SCI, including microglial activation and its associated mechanisms (As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This approach provides a novel therapeutic strategy for SCI, highlighting the potential role of TAM as a neuroprotective agent and its broader implications for treating neurological disorders.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Materials and Method","content":"\u003cp\u003e\u003cstrong\u003eExperimental Animals and Cells \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor this investigation, ninety adult male Sprague Dawley (SD) rats were chosen. They weighed between 220g and 250g at 6\u0026ndash;8 weeks of age. Beijing Weitonglihua Laboratory Animal Technology Co., LTD. (License number: SCXK (Beijing) 2021-0011) is the supplier of all animals. For two weeks, the rats were housed in a specific pathogen-free (SPF) facility, maintained at a temperature of 23\u0026deg;C \u0026plusmn; 2\u0026deg;C and a humidity level of 50% \u0026plusmn; 5%. They were exposed to a 12-hour light/dark cycle each day and provided with ample food, fresh water, and comfortable living conditions. The Tianjin Armed Police Special Medical Center\u0026apos;s Experimental Animal Ethics Committee approved all animal experiments (AG-PJHC-002-01.0 (AF)-001), which were carried out in compliance with the Ministry of Science and Technology\u0026apos;s (2006) Guiding Principles for the Management and Use of Experimental Animals and Guiding Opinions on the Treatment of Experimental Animals. The BV2 microglial cell line (CL-0493) was obtained from Wuhan Puno Life Technology Co., Ltd.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatics Analysis \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene expression datasets GSE42828 and GSE5296 relevant to spinal cord injury (SCI) were downloaded from the Gene Expression Omnibus (GEO) database on the NCBI website. These datasets encompass transcriptomic data matrices from the SHAM group and various time points following SCI, with a particular focus on day three post-surgery. After normalizing the raw data using the limma package in R (version \u0026ge; 4.0), differential gene analysis was performed with selection criteria of \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and (|logFC|) \u0026ge; 1. The Venny 2.1 tool was employed to conduct intersection analysis of the upregulated genes from both datasets, resulting in a Venn diagram. Co-expressed genes were imported into the STRING platform (v11.5, confidence threshold \u0026ge; 0.7) to construct a protein-protein interaction (PPI) network, predicting the interactions among these co-expressed genes. Interaction data were then exported to Cytoscape software (v3.9.1) for visualization. Furthermore, the maximal clique centrality (MCC) algorithm from the Cytoscape plugin cytoHubba was utilized to identify the top ten genes based on MCC ranking as key genes. The DAVID database (v6.8) was employed for Gene Ontology (GO) and KEGG pathway enrichment analyses of these key genes, with parameters set at \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental Procedure and Grouping \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the cellular experiment, the cells were divided into three groups: the control group, the LPS group (stimulated with 1 \u0026mu;g/mL LPS for 24 hours), and the TAM treatment group following LPS induction, referred to as the TAM group. The TAM group was further categorized into three concentrations. After a 24-hour induction in the LPS group, TAM was administered for an additional 24 hours at concentrations of 7.5, 5, and 2.5 \u0026mu;M. Initially, RT-PCR technology was employed to conduct preliminary verification of the expression levels of the CCL2/CCR2 axis, microglial polarization markers (CD32, iNOS, and Arg-1), NF-\u0026kappa;B, inflammatory factors (IL-6, IL-1\u0026beta;, and TNF-\u0026alpha;), and PPAR-\u0026gamma;. The expression levels of inflammatory factors, CCL2, and nitric oxide (NO) in the cell supernatant were measured using a kit. The optimal dosage concentration was selected, and immunofluorescence techniques were applied to assess the expression of the CCL2/CCR2 axis, microglial polarization markers, NF-\u0026kappa;B, PPAR-\u0026gamma;, and Bcl2/Bax/Caspase-3 at the protein level.\u003c/p\u003e\n\u003cp\u003eIn the animal experiment, after rearing SD rats for one week, they were randomly divided into four groups: the sham surgery group (SHAM) (n=6), the TAM group (n=6), the SCI group (n=6), and the SCI+TAM group (n=6). Based on previous studies [63, 115] and the conversion of dosages for cells and rats, the concentration of TAM was selected as 5 mg/kg. Thirty minutes after the SCI modeling, the suspension was administered via intraperitoneal injection to the rats for three consecutive days. To evaluate the impact of TAM on the recovery of motor function in SCI rats, a series of experiments were conducted. Assessments including BBB scoring, recovery of urinary function, and changes in body weight were performed on days 1, 3, 7, 14, 21, 28, 35, and 42 post-surgery. On day 42, footprint analysis, as well as collection of spinal cord and bladder tissues, were conducted. Furthermore, using RT-PCR technology, the expression of the CCL2/CCR2 axis, microglial polarization markers (CD32, iNOS, and Arg-1), NF-\u0026kappa;B, inflammatory factors (IL-6, IL-1\u0026beta;, and TNF-\u0026alpha;), and PPAR-\u0026gamma; in spinal cord tissue was preliminarily validated. The expression levels of inflammatory factors and CCL2 in serum were assessed using ELISA kits. Additionally, Western blotting was employed to measure the protein levels of the CCL2/CCR2 axis, microglial polarization markers, NF-\u0026kappa;B, and PPAR-\u0026gamma;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eModel Establishment \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn vitro model establishment: Initially, BV2 cells were cultured in high-glucose DMEM supplemented with 10% fetal bovine serum until they reached 80%-90% confluence. Subsequently, the cells were seeded into a multi-well plate or culture dish. After cell adhesion, they were stimulated with 1 \u0026mu;g/mL LPS to simulate a neuroinflammatory environment for a duration of 24 hours. Microscopic observation revealed a transformation in cell morphology from a resting \u0026quot;dendritic\u0026quot; form to an \u0026quot;amoeboid\u0026quot; shape (characterized by cell body enlargement and retraction of processes), accompanied by pronounced nucleolar changes and an increase in cytoplasmic granules. Concurrently, there was a significant upregulation of inflammatory factors, including the secretion of pro-inflammatory mediators such as TNF-\u0026alpha;, IL-6, IL-1\u0026beta;, and NO, as assessed by ELISA.\u003c/p\u003e\n\u003cp\u003eIn vivo model establishment: Following systemic inhalation anesthesia with isoflurane, rats were secured in a prone position on the operating table. The location of the T10 vertebra was confirmed, and a preparation area was established within a 5 cm range above and below it. Using the most prominent T2 spinous process between the scapulae as a reference point, the T10 spinous process was accurately localized, and local disinfection was performed with iodine solution. A midline incision was made at the center of the T10 spinous process, extending 3 cm longitudinally along the spinous midline. Blunt dissection of the bilateral paravertebral muscles was performed, with hemostatic clamps used to retract the soft tissue. The subcutaneous fascia and muscle layers were dissected layer by layer to fully expose the spinous structure. Subsequently, residual muscle fibers at the T10 segment were meticulously trimmed, and a miniature burr was employed to precisely remove the T10 spinous process, thereby completely exposing the target lamina. Next, scissors were used to cut open the lamina, revealing the dura mater. Centered on T10 and using the midline blood vessels as a reference line, ophthalmic scissors were utilized to transect the spinal cord vertically for hemostatic compression. The successful establishment of the model was indicated by the immediate emergence of the tail-flick reflex following spinal cord transection, along with observable retraction-like movements of the body. Upon awakening from anesthesia, the experimental rats could only support and move using their forelimbs, while their hind limbs exhibited complete paralysis, and tail movement function was lost, accompanied by sphincter dysfunction (manifesting as urinary retention and defecation difficulties). These symptoms confirmed the successful establishment of a complete spinal cord transection injury model. Post-modeling, rats were housed individually to prevent mutual biting injuries and received daily antibiotic injections for five consecutive days. Additionally, postoperative abdominal massages were administered three times daily to assist in bladder compression and facilitate urination until spontaneous urination was restored.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBehavioral Examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo researchers did the behavioral tests on their own; they were not informed about the experimental group assignment. After an injury, the Basso Beattie Bresnahan (BBB) examination, urine recovery, and footprint test were assessed 7, 14, 21, 28, and 35 days later. The footprint test was carried out 35 days later.\u003cbr\u003e\u0026nbsp; \u0026nbsp;A typical technique for assessing neurological function, the BBB examination was put out by Ohio University researchers in 1995. The BBB scoring system is a popular tool for assessing the motor skills of models with spinal cord injuries because it more accurately captures the increase in behavioral function. Rats\u0026apos; hindlimb movement was categorized into 22 levels by the BBB score, which also included nearly all of the behavioral alterations that occurred during the hindlimb\u0026apos;s recovery following SCI.\u003c/p\u003e\n\u003cp\u003eMice trained to run on a paper-covered track measuring one meter in length and ten centimeters in width were given blue ink on their front PAWS and red ink on their back PAWS for the footprint test. Analysis is done on the step length and step breadth.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA typical microglia cell line in neuroscience research is BV2, which is produced from mice. In vitro models of neurodegenerative disorders and related cellular conditions and processes, including neuroinflammation and SCI[38, 39], can be studied using this immortal cell line. In order to imitate inflammation following spinal cord injury, microglia BV2 were induced in vitro using LPS (1 ug/mL) in this experiment. BV2 cells were cultured at 37\u0026ordm;C with 5% CO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003ein Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) with high glucose (Gibco\u003csup\u003eTM\u003c/sup\u003e, Waltham, MA, USA) supplemented with 1% penicillin/streptomycin (biosharp, China) and 10% FBS (Vivacell, China). To simulate the inflammatory response, cells were exposed to LPS (1 ug/mL) for 24 h. Co-treatment with TAM (MCE, HY-13757A, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Viability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell counting kit-8 (CCK-8, Sparkjade, China) was used to evaluate cell viability according to the instructions. 3000 cells per well were plated in 96-well plates and allowed to grow for 24 h. After treating cells with different concentrations of TAM for 24 h and 48 h, 100 \u0026mu;L of medium containing 10 \u0026mu;L of CCK-8 solution was applied. After that, the plates were incubated at 37 \u0026ordm;C for 0.5 h. The optical density at 450 nm was measured.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRats with SCI were given anesthesia for 42 days using an isoflurane inhalation machine, and their hearts were perfused with phosphate buffer saline (PBS) and 4% paraformaldehyde (PFA). Remove the spine, bite the vertebrae, and align the location of the injury, which is 1 cm above and below and 3 cm overall. 10% formalin was used to preserve fresh spinal cord tissue. Rat liver, spleen, lung, kidney, and heart were all removed at the same time and preserved in 10% formalin for later histological staining. Sectioning came after a 48-hour fixation with 10% formalin. Paraffin embedding came next. two times, for five to ten minutes each, dewaxing in xylene. Rehydrating series ethanol (100%, 95%, 85%, and 75%) took three minutes for each gradient. Soak for two minutes in distilled water.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElisa\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRat IL-6, TNF-\u0026alpha;, IL-1\u0026beta; and CCL2 Enzyme-Linked Immunosorbent Assay (ELISA) kits (Proteintech, USA) were used to explore the effect of TAM on changes in inflammatory cytokines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnimal samples: After SCI, the rats were anesthetized 3 days after intraperitoneal injection of TAM. Following abdominal aortic blood collection, the upper serum samples were obtained by centrifugation.\u003c/p\u003e\n\u003cp\u003eCell sample: LPS or TAM was used to stimulate for 24 hours, and then the supernatant was collected for ELISA assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 14 mm climbing plate was filled with drops of the cell suspension using a 24-well plate, and roughly 30,000 cells were inoculated in each well. Following the growth of cell adhesion, the cells were exposed to either LPS or TAM (5 \u0026mu;M) for 24 h. Following this, the supernatant was extracted and PBS washed three times. It was fixed for 20 minutes with 4% paraformaldehyde, and then for another 20 minutes, it was exposed to 0.5% Triton X-100 to expose antigens and remove lipids and certain proteins. The 0.5% Triton X-100 treatment was not applied to the membrane proteins. After that, use 10% BSA to block the cells at room temperature for 30 minutes. Then, the slides were incubated at 4 \u0026ordm;C overnight with rabbit anti-MCP-1/CCL2 (26161-1-AP, Proteintech, 1:100), rabbit anti-CCR2 (ab273050, abcam, 1:250), rabbit anti-iNOS recombinant(80517-1-RR, Proteintech, 1:500), rabbit anti-CD32(15625-1-AP, Proteintech, 1:500), rabbit anti-Arginae-1(16001-1-AP, Proteintech, 1:500), rabbit anti-PPAR-\u0026gamma;(16643-1-AP, Proteintech, 1:500) antibodies. After washing with PBS for 3 times, the sections were incubated with secondary antibodies Goat Anti-Rabbit IgG (H+L) FITC-conjugated (S0008, Proteintech, 1:1000) for 1 h at room temperature in the dark. After washing with PBS for 3 times, dye with DAPI for 3-5 minutes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe rats were anesthetized 3 days after tamoxifen administration for SCI, followed by cardiac perfusion with PBS and 4% PFA. The spinal cord was lysed for 30 min in strong RIPA buffer (Solarbio, Beijing, China) containing protease inhibitors and phosphatase inhibitors (100:1:1, Solarbio, Beijing, China). The cells were inoculated into 6-well plates and stimulated with either LPS or tamoxifen for 24 hours. The cells were lysed for 20 min in strong RIPA buffer (Solarbio, Beijing, China) containing protease inhibitors and phosphatase inhibitors (100:1:1, Solarbio, Beijing, China). The protein was denatured by adding 5\u0026times; sample buffer to the supernatant after centrifugation and letting it sit at room temperature for an hour. After that, the proteins were separated using SDS pages and moved to membranes made of cellulose nitrate (Millipore, USA). After blocking with 5% skim milk for 90 min, the membranes were submerged in the primary antibody and placed overnight on a shaker inside a 4\u0026deg;C refrigerator. The primary antibodies included rabbit anti-MCP-1/CCL2 (26161-1-AP, Proteintech, 1:1000), rabbit anti-CCR2 (ab273050, abcam, 1:1000), rabbit anti-iNOS recombinant(80517-1-RR, Proteintech, 1:2500), rabbit anti-CD32(15625-1-AP, Proteintech, 1:2500), rabbit anti-Arginae-1(16001-1-AP, Proteintech, 1:2500), rabbit anti-PPAR-г (16643-1-AP, Proteintech, 1:5000), rabbit anti-GAPDH(10494-1-AP, Proteintech, 1:25000), rabbit anti-rabbit ATP1A1(14418-1-AP, Proteintech, 1:10000) antibodies. After washing with PBS for 3 times, the sections were incubated with secondary antibodies Goat Anti-Rabbit IgG (H+L) HRP (S0001, Affinity, 1:5000).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuantitative real-time PCR (RT-PCR) was used to determine the expression of target gene. SPARKeasy Improved Tissue/Cell RNA kit (AC0202, Sparkjade, Shandong, China) was used to extract RNA. The Leica ultramicro protein nucleic acid analyzer was used to measure the RNA concentration. One-Step gDNA Removal kit (AT341, TRAN, Beijing, China) for reverse transcription of RNA was used, and a 20 uL system was set up. Following preparation, the reverse transcription system was vortexized for a brief moment on the vortex instrument, gently mixed, and then incubated for 15 minutes at 42\u0026deg;C. It was then heated for 5 seconds at 85\u0026deg;C in the thermal circulation instrument. With three pore types for each gene and control pore types devoid of primers and samples, the genes to be evaluated were organized from low to high average temperature. Primers and TransStart Tip Green qPCR SuperMix kit were used to analysis the expression of gene. Expression levels were calculated according to the 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. The primers are listed in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntagonist INCB3344\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate whether TAM influences the expression of CCR2, thereby affecting the relationship between NF-\u0026kappa;B, PPAR-\u0026gamma;, Bcl2/Bax/Caspase-3, and microglial polarization, we employed the CCR2 antagonist INCB3344 (MedChemExpress) for validation. In the immunofluorescence and RT-PCR experiments, cells were divided into four groups: control group (BV2 cells), LPS group (stimulated with 1 \u0026mu;g/mL LPS for 24 hours), TAM (stimulated with LPS for 24 hours and treated with TAM for 24 hours), and TAM + INCB3344 (stimulated with LPS for 24 hours and treated with 10 nM INCB3344 for 24 hours).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntagonist GW9662\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the relationship between CCL2/CCR2 and PPAR-\u0026gamma;, we validated the expression of CCL2 and CCR2 using the specific PPAR-\u0026gamma; antagonist GW9662 (MedChemExpress). In the in vivo model, the experiment was divided into four groups: the sham surgery group, the spinal cord injury (SCI) group, the TAM group, and the GW9662 group. The control groups (SHAM and SCI) did not receive TAM; the TAM group received intraperitoneal injections of TAM (5 mg/kg) following SCI; while the GW9662 group received both TAM (5 mg/kg) and the PPAR-\u0026gamma; inhibitor GW9662 (1 mg/kg) post-SCI. In the in vitro model, the experiment was similarly categorized into four groups: the control group (BV2 cells), the LPS group (stimulated with 1 \u0026mu;g/mL LPS for 24 hours), the TAM group (subjected to 1 \u0026mu;g/mL LPS stimulation for 24 hours followed by intervention with 5 \u0026mu;M TAM for an additional 24 hours), and the GW9662 group (receiving 5 \u0026mu;M TAM and 10 \u0026mu;M GW9662 for 24 hours after 24 hours of LPS stimulation).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWith GraphPad Prism 9.0.0, all statistical analyses were performed. Fluorescence intensity and band density were analyzed by Image J. The results are shown as the mean \u0026plusmn; SD from a minimum of three separate tests conducted in duplicate. The student\u0026apos;s t test was employed to compare the information. The means of various groups were compared using One-way ANOVA, and the mRNAs were correlated using Pearson\u0026apos;s test. \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 was chosen as the statistical significance value.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eTable. 1\u003c/strong\u003e Statistical table of all primers needed in RT-PCR experiments.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u0026rsquo; to 3\u0026rsquo;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eiNOS-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eGCTCTAGTGAAGCAAAGCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eiNOS-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTGGTGAAGAGTGTCATGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eArginase1-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCTGAGCTTTGATGTCGACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eArginase1-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTCCTCTGCTGTCTTCCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eCD32a-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCGGGGTCTGTTTCTTTTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eCD32a-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTCTCCCTCTCTCCTCTCCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003ePPAR-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eGATGTCTTGACTCATGGGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003ePPAR-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCAGCATGGAATAGGGGTTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eIL-1\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCGACAAAATACCTGTGGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eIL-1\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTTCTTTGGGTATTGCTTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eIL-6-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eGAAACCGCTATGAAGTTCCTCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eIL-6-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTGTTGGGAGTGGTATCCTCTGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCATCTTCTCAAAATTCGAGTGACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTGGGAGTAGACAAGGTACAACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eCCL2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eTCGGAGTTTGGGTTTGCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eCCL2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eCAATCAATGCCCCAGTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Results","content":"\u003ch2\u003eBioinformatics analysis of gene expression in the acute phase of SCI\u003c/h2\u003e\n\u003cp\u003eTo deeply excavate the key genes involved in acute phase of SCI, the GSE42828 dataset and the GSE5296 dataset were used for analysis via R language. These studies represent a comprehensive database of temporal changes in gene expression that underlie the secondary injury response that occurs in a mouse model of SCI. In the comparison of the transcriptomes of the Sham group and the third day after SCI (standard: abs(log\u003csub\u003e2\u003c/sub\u003eFC) \u0026gt;1, \u003cem\u003ep\u003c/em\u003e-value \u0026lt;0.05), we found that 83 genes were upregulated in dataset GSE42828(Fig. 2B) and 321 genes were upregulated in dataset GSE5296 (Fig. 2A) after SCI. A total of 58 co-expressed genes were screened out from these differentially-expressed genes (Fig.2C), and protein-protein interaction network analysis was subsequently applied through website String and software Cytoscape (Fig. 2D). CCL2 had the greatest degree value among the differential genes when they were sequenced based on degree (Fig. 2E). The maximum clique centrality (MCC) value was determined using the software cytoHubba in Cytoscape, and the top ten genes with the MCC value were chosen to be hub genes (Fig. 2F). Furthermore, 10 hub genes were subjected to GO and KEGG analyses through website Enrichr. The signaling chemokine-mediated signaling pathway that were most relevant (Fig. 2G). The findings demonstrated that CCL2 (Fig.2D, E) was markedly elevated during the acute stage of SCI and that it influenced SCI by controlling glial cell migration and apoptosis through binding to its receptor, CCR2 (Fig.2H). Simultaneously, data from the KEGG database indicates that CCL2/CCR2 may also have an impact on pathways leading to nitric oxide and reactive oxygen species generation, which in turn may influence inflammation and neural defense.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eTAM administration Promotes Motor Functional Recovery After SCI\u003c/h2\u003e\n\u003cp\u003eIn order to evaluate the effect of TAM administration on SCI rats, we conducted a series of behavioral tests to evaluate the effect of TAM, such as motor function recovery, urination function recovery, weight change. The experimental workflow is depicted in Fig. 3A. Both SCI and TAM groups exhibited initial weight loss post-SCI (Fig. 3B), but TAM-treated rats demonstrated significant weight recovery by week 2, matching normal group growth rates. BBB scoring indicated superior motor recovery in the TAM group versus controls at day 14 and 21, with significant divergence from W3-6 (TAM:12.33 vs SCI:8.33 at D42; p\u0026lt;0.05; Fig. 3C). Footprint analysis (Fig. 3D) revealed SCI rats displayed toe dragging and shortened stride lengths, while TAM group restored plantar contact and toe angles. TAM intervention improved urinary function, showing reduced bladder volume (Fig. 3E), decreased bladder perimeter (Fig. 3F), and accelerated micturition recovery (14d vs 20d; \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; Fig. 3G). HE staining at D42 demonstrated TAM reduced lesion cavitation versus SCI (Fig. 3H-I), attenuated dense glial scarring/inflammation, and enhanced neuronal survival (Fig. 3J), suggesting neuroprotection, glial recruitment, and axonal regeneration for improved histopathological recovery\u003c/p\u003e\n\u003ch2\u003eTAM can Reduce the Expression of CCL2 and CCR2 in vivo and in vitro Models\u003c/h2\u003e\n\u003cp\u003eAn SCI transversal model was established to investigate the differential expression of CCL2/CCR2 in the acute and subacute stages of SCI (Fig. 4A). The results showed that CCL2 protein expression increased after SCI, peaked 1 day after injury, and then decreased. (Fig. 4B-D). At the same time, the expression of CCR2 protein also showed an increasing trend after SCI, lagging behind that of CCL2, and significantly increased from the first day, and reached a high level on the third day. Next, we verified the regulatory effect of TAM on CCL2 and CCR2 in vivo and in vitro models. To select the appropriate concentration of TAM, CCK8 kit was used (Fig. 4E). PCR results showed that the mRNA expression of CCL2/CCR2 was decreased with TAM concentrations of 7.5, 5 and 2.5 \u0026mu;M (Fig. 4F-G). ELISA kit was used to detect CCL2 in the supernatant of cells, and it was found that TAM administration could reduce the content of CCL2 in the supernatant, of which 7.5uM and 5uM were the most effective (Fig. 4H). The immunofluorescence experiment was performed by implementing TAM at a concentration of 5 \u0026mu;M. The results of immunofluorescence experiment showed that TAM could decrease the expression level of CCL2/CCR2 protein (Fig. 4 I-L). Further in vivo investigations in rat models (Fig. 4 M) demonstrated significantly reduced CCL2/CCR2 mRNA levels in the TAM+SCI group versus SCI group via RT-PCR, while no changes were observed between sham and TAM-only groups, confirming TAM\u0026rsquo;s specificity to SCI conditions (Fig. 4 N-O). ELISA further validated TAM-mediated reduction of serum CCL2 post-SCI (Fig. 3-6P). WB analysis revealed TAM effectively suppressed SCI-induced upregulation of CCL2/CCR2 protein expression, even reducing levels below pre-SCI baselines (Fig. 4 Q-S).\u003c/p\u003e\n\u003ch2\u003eTAM Administration Decreased the expression of Inflammatory Factors through NF-\u0026kappa;B Pathway in vivo and in vitro Models\u003c/h2\u003e\n\u003cp\u003eIn the in vitro model, the expression levels of inflammatory factors (such as TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6) in the cell supernatant were assessed using an ELISA kit. Following LPS induction, there was a significant increase in the expression levels of inflammatory factors (Fig. 5 A-C). The expression of inflammatory factors was further validated at the mRNA level using RT-PCR (Fig. 5 D-F). Given that nitric oxide (NO) promotes inflammatory responses and factor generation, we subsequently measured the NO content in the cell supernatant. The experimental results indicated that NO levels significantly increased following LPS induction in the cell model, while TAM treatment notably reduced NO levels (Fig. 5 G-I). To further investigate the impact of TAM on the NF-\u0026kappa;B pathway, we first validated the mRNA expression levels of NF-\u0026kappa;B in the in vitro model using RT-PCR. The inhibitory effect of TAM on NF-\u0026kappa;B exhibited a concentration-dependent enhancement. We selected 5 \u0026mu;M for subsequent experiments; both the CCR2 antagonist and the TAM treatment group demonstrated inhibitory effects on NF-\u0026kappa;B expression at the mRNA level (Fig. 5K). Immunofluorescence confirmed these findings at the protein level (Fig. 5L), with Fig. 5M presenting the statistical results for fluorescence intensity.\u003c/p\u003e\n\u003cp\u003eNext, we validated the experimental results from the in vitro model in an in vivo SCI model. The expression levels of inflammatory factors in serum were measured using an ELISA kit three days post-SCI treatment. Compared to the sham-operated group, the SCI group exhibited a significant increase in serum inflammatory factors, while a downward trend was observed in pro-inflammatory factors IL-6, IL-1\u0026beta;, and TNF-\u0026alpha; in the SCI+TAM group, with statistical significance (Fig. 5N-P). PCR results further indicated that TAM treatment could downregulate the expression of inflammatory factors at the mRNA level in both in vivo and in vitro models (Fig. 5Q-S). Next, we will examine the expression of NF-\u0026kappa;B protein in the in vivo model following TAM treatment. The PCR results indicate that the NF-\u0026kappa;B pathway is activated in the animal model after SCI, whereas administration of TAM suppresses the expression of this pathway (Fig. 5T). At the protein level, the inhibitory effect of TAM on NF-\u0026kappa;B protein is relatively modest (Fig. 5U-V).\u003c/p\u003e\n\u003ch2\u003eTAM Administration can Regulate Microglial Polarization in vivo and in vitro Models\u003c/h2\u003e\n\u003cp\u003eIn vitro models: RT-PCR was used to detect mRNA expression levels of CD32, iNOS, and Arg-1. LPS-induced inflammatory groups showed upregulated iNOS and CD32 mRNA expression compared to the normal group, while TAM administration downregulated their expression. LPS-induced groups exhibited reduced Arg-1 mRNA expression, which was upregulated by TAM (Fig. 6A-C). A concentration of 5 \u0026mu;M was selected for subsequent experiments. At the mRNA level, the CCR2 antagonist INCB3344 also promoted microglial polarization from M1 to M2 phenotypes (Fig. 6D-F). At the protein level, LPS induction significantly enhanced M1 polarization, with increased iNOS fluorescence intensity in the cytoplasm (Fig. 6G-H) and elevated CD32 fluorescence intensity compared to controls. TAM intervention reversed microglial polarization from M1 to M2: iNOS fluorescence intensity decreased, CD32 membrane fluorescence intensity diminished (Fig. 6I-J), and Arg-1 fluorescence intensity increased post-TAM (Fig. 6K-L), with uniform green fluorescence signals indicating M2 reparative phenotype activation.\u003c/p\u003e\n\u003cp\u003eIn vivo animal models: SCI groups showed elevated iNOS and CD32 mRNA expression compared to sham groups, which was reduced by TAM intervention. Arg-1 mRNA expression in SCI groups showed no significant difference from sham groups but was significantly upregulated post-TAM. TAM alone had no effect on CD32, iNOS, or Arg-1 expression (Fig. 6M-O). WB results demonstrated that TAM significantly regulated microglial polarization. Compared to SCI groups, the SCI+TAM group exhibited markedly reduced M1 markers (iNOS and CD32 protein levels): by day 3 post-injury, iNOS and CD32 expression decreased, indicating suppression of pro-inflammatory phenotype activation. Concurrently, M2 marker Arg-1 expression showed time-dependent upregulation in the TAM group, surpassing SCI group levels by day 3 post-injury, suggesting microglial shift toward an anti-inflammatory/reparative phenotype (Fig. 6P-S).\u003c/p\u003e\n\u003ch2\u003eTAM activates PPAR-\u0026gamma; expression in both in vivo and in vitro models\u003c/h2\u003e\n\u003cp\u003eIn the in vitro cell model, PPAR-\u0026gamma; expression was first assessed at the mRNA level. Results revealed that LPS induction suppressed PPAR-\u0026gamma; expression, whereas TAM administration activated PPAR-\u0026gamma; expression (Fig. 7A). Similarly, treatment with INCB3344, a CCR2 antagonist, also activated PPAR-\u0026gamma; expression by antagonizing CCR2 (Fig. 7B). Immunofluorescence analysis at the protein level (Fig. 7C-D) further validated these findings: LPS treatment significantly reduced PPAR-\u0026gamma; fluorescence intensity, while both TAM and INCB3344 administration restored PPAR-\u0026gamma; activation, as indicated by enhanced green fluorescence signals. In vivo animal experiments confirmed these results through PCR and WB analyses at both mRNA and protein levels. Following SCI, PPAR-\u0026gamma; expression was inhibited, but TAM treatment effectively restored its expression (Fig. 7E-G).\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eTAM activates the expression of the Bcl-2/Bax/Caspase-3 axis in in vitro models\u003c/h2\u003e\n\u003cp\u003eRT-PCR was employed at the mRNA level to assess the expression of the Bcl-2/Bax/Caspase-3 axis. The results demonstrated that LPS induction downregulated Bcl-2 expression and upregulated Bax and Caspase-3 protein expression. Treatment with TAM and INCB3344 increased Bcl-2 expression and reduced Bax and Caspase-3 expression following LPS induction (Fig. A-C). Immunofluorescence results at the protein level corroborated these findings: LPS induction decreased Bcl-2 expression and weakened green fluorescence intensity, while both TAM and INCB3344 administration upregulated Bcl-2 expression (Fig. D-E). Concurrently, LPS induction elevated Bax and Caspase-3 protein expression, which was attenuated by TAM and INCB3344 treatment, as evidenced by reduced green fluorescence intensity (Fig. F-I).\u003c/p\u003e\n\u003ch2\u003ePPAR-\u0026gamma; Activation Suppresses CCL2/CCR2 Expression Following SCI\u003c/h2\u003e\n\u003cp\u003eTo further explore the relationship between CCL2/CCR2 and PPAR-\u0026gamma;, we detected the expression of CCL2/CCR2 in vivo and vitro model. To verify whether TAM relieve neuropathic pain by activating PPAR-\u0026gamma;, GW9662(PPAR-\u0026gamma; antagonist) was co-administrated with TAM. TAM was not injected into the SHAM group and SCI group. TAM was injected into the experimental group, and TAM and PPAR-\u0026gamma; inhibitor GW9662 (1 mg/kg) were injected into the GW9662 group after SCI. As shown in Figure 8A, PCR results showed that GW9662 could effectively inhibit the activation of the PPAR-г pathway. As shown in Fig 8B-E, the expression levels of CCL2 and CCR2 in GW9662 group were increased in both in vivo and in vitro models. These results indicated that TAM affected the expression of CCL2/CCR2 through PPAR-\u0026gamma;. Meanwhile, immunofluorescence results showed that TAM could decrease the expression of CCL2 and CCR2, while GW9662 could increase the expression of CCL2 and CCR2 by inhibiting the expression of PPAR-\u0026gamma; (Fig. 8F-I). In animal model, WB results showed that TAM administration could inhibit the expression of CCL2 and CCR2 after SCI, while GW9662 could reverse the effect of TAM on SCI rats by inhibiting the expression of PPAR-\u0026gamma; (Fig. 8J-L). In summary, the results showed that inhibition of PPAR-\u0026gamma; pathway expression reversed the decreased expression of CCL2 and CCR2 in SCI rats induced by TAM administration. The expression of CCL2 and CCR2 is related to the PPAR-\u0026gamma; pathway.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePrevious studies have demonstrated that TAM, a drug approved by the FDA, promotes the recovery of motor neurons, myelin protection, axonal preservation, and neuronal survival, thereby exerting neuroprotective effects[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Our research reveals that TAM primarily exerts its neuroprotective effects through chemokine and receptor-related pathways, which mediate anti-apoptotic and anti-inflammatory responses, ultimately enhancing the recovery of motor and neurological functions following SCI (As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eA prospective therapeutic approach for treating inflammation and secondary injury should focus on the CCL2/CCR2 axis[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. This study integrates two datasets, GSE42828 (rat SCI model) and GSE5296 (mouse spinal cord injury model), to identify 58 co-expressed genes. This research explores the pathological significance of these key genes during the acute phase of SCI. The elevated expression of these genes plays a crucial biological role in the regulation of the inflammatory microenvironment, neuronal repair, and secondary injury associated with SCI. Their functions can be categorized as follows: pro-inflammatory response and immune cell recruitment, macrophage/microglial polarization and phagocytic regulation, and lipid metabolism alongside inflammation resolution. In terms of pro-inflammatory response and immune cell recruitment, the heightened expression of CCL2 and CCR2 drives the migration of monocytes and macrophages to the site of injury, exacerbating the inflammatory response. During the early phase of SCI, CCL2 activates the NF-κB pathway to promote M1 macrophage polarization, leading to the release of pro-inflammatory factors such as TNF-α and IL-1β, which intensify neuronal apoptosis. Additionally, CCL3 (MIP-1α) works in conjunction with CCL2 to enhance the infiltration of neutrophils and T cells, thereby broadening the area of inflammatory damage. CCR1 mediates the signaling of chemokines (such as CCL3), facilitating microglial activation. FCGR1A (CD64), functioning as a high-affinity IgG receptor, amplifies antibody-dependent phagocytosis, potentially worsening inflammation-related oxidative stress.\u003c/p\u003e\u003cp\u003eAccording to previous transcriptomic results, it has been established that TAM can effectively reduce the expression of CCR2 before and after SCI[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Building upon prior research, we selected a concentration of 5 mg/kg TAM for administration[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. A male rat SCI transection model was established, and TAM treatment was administered during the acute phase. The results of this study demonstrate that CCL2 protein expression rapidly increases after SCI, peaking on day 1, and gradually declines thereafter. During the acute phase of SCI, tissue cells such as neurons and glial cells at the injury site rapidly secrete CCL2 in response to traumatic stimulation. As a critical chemokine, CCL2 recruits peripheral monocytes, macrophages, and other immune cells to migrate to the injury site, initiating local immune-inflammatory responses. The sharp early increase in CCL2 expression may help clear necrotic debris and pathogens from damaged tissues, providing temporary protective effects. However, excessive immune-inflammatory responses may exacerbate neuronal damage. The gradual decline in CCL2 expression over time likely reflects a self-regulatory feedback mechanism to mitigate neurotoxic effects of prolonged inflammation. CCR2, the specific receptor for CCL2, exhibited delayed upregulation compared to CCL2.\u003c/p\u003e\u003cp\u003eWB and PCR analyses confirmed that TAM administration during the acute phase significantly reduced CCL2 and CCR2 expression in both in vivo and in vitro models, providing critical insights into its neuroprotective mechanisms. Notably, this study is the first to reveal TAM\u0026rsquo;s dual regulatory effect on CCR2 in SCI models: it suppresses both ligand (CCL2) expression and directly inhibits receptor (CCR2) protein levels, synergistically blocking CCL2/CCR2-mediated inflammatory cascades.\u003c/p\u003e\u003cp\u003eSCI activates the NF-κB signaling pathway, triggering production of inflammatory factors such as IL-1β, IL-6, and TNF-α, which exacerbate inflammation and neuronal apoptosis. Suppressing NF-κB is thus a key therapeutic target for mitigating secondary inflammation post-SCI. TAM was shown to inhibit NF-κB pathway activity by downregulating CCR2, significantly reducing NF-κB expression and associated inflammatory cytokines (IL-1β, IL-6, TNF-α) post-treatment.\u003c/p\u003e\u003cp\u003eMicroglial activation plays a pivotal role in post-SCI inflammation, shifting from anti-inflammatory (M2) to pro-inflammatory (M1) phenotypes, releasing pro-inflammatory factors that worsen neural damage[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. TAM modulated microglial polarization via the CCL2/CCR2 axis, promoting a shift from M1 to M2 phenotypes. Specifically, TAM reduced pro-inflammatory markers (iNOS, CD32) and increased anti-inflammatory markers (Arg-1).\u003c/p\u003e\u003cp\u003eConcurrently, TAM exerted neuroprotective and anti-inflammatory effects by activating PPAR-γ, which was significantly upregulated in both in vivo and in vitro models. Further experiments revealed that TAM\u0026rsquo;s inhibition of the CCL2/CCR2 axis was closely linked to PPAR-γ activation. Co-treatment with the PPAR-γ antagonist GW9662 partially reversed TAM\u0026rsquo;s suppression of CCL2/CCR2 expression, confirming this mechanism.\u003c/p\u003e\u003cp\u003eAdditionally, TAM regulated Bcl-2 family protein expression by enhancing anti-apoptotic Bcl-2 and reducing pro-apoptotic Bax and Caspase-3 levels, thereby inhibiting apoptosis. Post-SCI, pro-apoptotic protein expression surged, driving cell death. TAM counteracted this by elevating Bcl-2/Bax ratios and suppressing Caspase-3 activity, as validated by immunofluorescence and molecular assays.\u003c/p\u003e\u003cp\u003eThis study has the following limitations: First, the molecular mechanisms by which TAM regulates SCI treatment remain incompletely understood. It is unclear whether TAM influences the CCL2/CCR2 axis through additional pathways beyond PPAR-γ activation, and the specific molecular mechanisms underlying TAM\u0026rsquo;s modulation of microglial activation states also require further elucidation. Deeper exploration of these mechanisms could optimize TAM-based therapeutic strategies. Second, in animal experiments, the SCI model utilized male SD rats, leaving the potential effects of estrogen on TAM treatment in females unaddressed. Additionally, the complete transection model fails to replicate clinically common incomplete injuries. Moreover, the manual surgical transection method used for modeling may introduce variability in injury severity across subjects. Finally, in cell experiments, only the BV2 microglial inflammation model was employed to simulate SCI in vitro. However, the spinal cord is a complex tissue environment involving other glial cells and neurons, which cannot be fully recapitulated in this simplified system.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study employed a complete transection SCI rat model and an LPS-induced BV2 cell inflammation model to assess the effects of TAM on motor and neurological functional recovery in SCI rats through multiple approaches, combined with bioinformatics analysis to elucidate the underlying mechanisms. Experimental results revealed significant differences in CCL2/CCR2 expression before and after SCI, with TAM effectively reducing their expression. During the acute phase of SCI, TAM activated PPAR-γ, suppressed CCL2/CCR2 expression, inhibited NF-κB pathway activity, and reduced inflammatory cytokine production. Additionally, TAM modulated microglial activation states by shifting them from pro-inflammatory to anti-inflammatory phenotypes and influenced the Bcl-2/BAX/Caspase-3 signaling pathway to inhibit apoptosis. In summary, TAM intervention in the CCL2/CCR2 signaling pathway alleviated secondary inflammation post-SCI, demonstrating anti-apoptotic and anti-inflammatory effects, thereby providing a theoretical foundation for its application in SCI treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConficts of interest:\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003ch2\u003eAnimal Ethics\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were approved by the Experimental Animal Ethics Committee of Tianjin Armed Police Specialized Medical Center (Number: Animal 2024-0024), and followed the guidelines for the management and use of experimental animals and the guidelines for the handling of experimental animals issued by the Ministry of Science and Technology (2006).\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eGeneral Program of National Natural Science Foundation of China, No. 82272255; Key Program of the National Natural Science Foundation of China, No. 11932013; Independent Innovation Science Fund, No. KYZZZCX2405; Tianjin Education Commission scientific research project, No. 2022YGYB07.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003e1. Experimental Design \u0026amp; Conceptualization\u0026bull;Xiangzi Wang designed the experimental framework, established methodology, and defined research objectives for investigating TAM\u0026apos;s therapeutic mechanisms in SCI.2. Investigation \u0026amp; Data Acquisition\u0026bull;Xiangzi Wang, Yuqi Lin, Xiao LiangConducted key experiments including: oEstablishment of rat SCI transection modelsoLPS-induced BV2 microglial activation assaysoIntraperitoneal TAM administration and dosage optimizationoBehavioral assessments (BBB scoring, footprint tests, bladder function recovery)oMolecular biology techniques (Western blot, ELISA, RT-PCR, immunofluorescence)3. Data Analysis \u0026amp; Interpretation\u0026bull;Xiangzi Wang \u0026amp; Wuhua Pang \u0026amp; Yuhan LiuPerformed:oBioinformatics analysis of GSE42828/GSE5296 datasetsoStatistical processing using GraphPad Prism 9.0.0oImage quantification (fluorescence intensity, band density via ImageJ)oFunctional enrichment analysis (GO/KEGG pathways)Key visualizations:4. Visualization \u0026amp; Figure Preparation\u0026bull;Xiangzi WangCreated and integrated all figures illustrating experimental results and mechanisms, including: oProtein interaction networksoIn vivo/in vitro validation dataoPathway schematics5. Manuscript Development\u0026bull;Xiangzi Wang \u0026amp; Ziqi WangCo-wrote the manuscript with responsibilities: oDrafted results, methodology, and discussion sectionsoSynthesized data into cohesive narrativeoRevised text for scientific accuracy and clarity6. Supervision \u0026amp; Funding Acquisition\u0026bull;Xuyi Chen \u0026amp; Bin LiuProvided: oTechnical guidance on SCI modeling and molecular assaysoCritical review of experimental designoFunding support (National Natural Science Foundation grants)oOversight for ethical compliance and study validation7. Manuscript Validation\u0026bull;All AuthorsConducted final: oData verificationoIntellectual content reviewoApproval of the published version\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eEli, I., Lerner, D. P. \u0026amp; Ghogawala, Z. (2021) Acute Traumatic Spinal Cord Injury, \u003cem\u003eNeurologic Clinics. \u003c/em\u003e\u003cstrong\u003e39\u003c/strong\u003e, 471-488.\u003c/li\u003e\n\u003cli\u003eHu, Y., Li, L., Hong, B., Xie, Y., Li, T., Feng, C., Yang, F., Wang, Y., Zhang, J., Yu, Y. \u0026amp; Fan, X. (2023) Epidemiological features of traumatic spinal cord injury in China: A systematic review and meta-analysis, \u003cem\u003eFRONTIERS IN NEUROLOGY. \u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eAzarhomayoun, A., Aghasi, M., Mousavi, N., Shokraneh, F., Vaccaro, A. R., Haj Mirzaian, A., Derakhshan, P. \u0026amp; Rahimi-Movaghar, V. (2018) Mortality Rate and Predicting Factors of Traumatic Thoracolumbar Spinal Cord Injury; A Systematic Review and Meta-Analysis, \u003cem\u003eBulletin of emergency and trauma. \u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 181-194.\u003c/li\u003e\n\u003cli\u003ePickelsimer, E., Shiroma, E. J. \u0026amp; Wilson, D. A. (2010) Statewide Investigation of Medically Attended Adverse Health Conditions of Persons With Spinal Cord Injury, \u003cem\u003eJOURNAL OF SPINAL CORD MEDICINE. \u003c/em\u003e\u003cstrong\u003e33\u003c/strong\u003e, 221-231.\u003c/li\u003e\n\u003cli\u003eRust, R. \u0026amp; Kaiser, J. (2017) Insights into the Dual Role of Inflammation after Spinal Cord Injury, \u003cem\u003eThe Journal of neuroscience : the official journal of the Society for Neuroscience. \u003c/em\u003e\u003cstrong\u003e37\u003c/strong\u003e, 4658-4660.\u003c/li\u003e\n\u003cli\u003eLiu, X., Zhang, Y., Wang, Y. \u0026amp; Qian, T. (2021) Inflammatory Response to Spinal Cord Injury and Its Treatment, \u003cem\u003eWorld Neurosurg. \u003c/em\u003e\u003cstrong\u003e155\u003c/strong\u003e, 19-31.\u003c/li\u003e\n\u003cli\u003eHarvey, L. A. (2016) Physiotherapy rehabilitation for people with spinal cord injuries, \u003cem\u003eJournal of Physiotherapy. \u003c/em\u003e\u003cstrong\u003e62\u003c/strong\u003e, 4-11.\u003c/li\u003e\n\u003cli\u003eMilich, L. M., Ryan, C. B. \u0026amp; Lee, J. K. (2019) Correction to: The origin, fate, and contribution of macrophages to spinal cord injury pathology, \u003cem\u003eActa Neuropathologica. \u003c/em\u003e\u003cstrong\u003e137\u003c/strong\u003e, 799-800.\u003c/li\u003e\n\u003cli\u003eDevanney, N. A., Stewart, A. N. \u0026amp; Gensel, J. C. (2020) Microglia and macrophage metabolism in CNS injury and disease: The role of immunometabolism in neurodegeneration and neurotrauma, \u003cem\u003eExperimental Neurology. \u003c/em\u003e\u003cstrong\u003e329\u003c/strong\u003e, 113310.\u003c/li\u003e\n\u003cli\u003eDansereau, M. A., Midavaine, \u0026Eacute;., B\u0026eacute;gin-Lavall\u0026eacute;e, V., Belkouch, M., Beaudet, N., Longpr\u0026eacute;, J. M., M\u0026eacute;lik-Parsadaniantz, S. \u0026amp; Sarret, P. (2021) Mechanistic insights into the role of the chemokine CCL2/CCR2 axis in dorsal root ganglia to peripheral inflammation and pain hypersensitivity, \u003cem\u003eJ Neuroinflammation. \u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 79.\u003c/li\u003e\n\u003cli\u003eWang, X., Niu, X., Wang, Y., Liu, Y., Yang, C., Chen, X. \u0026amp; Qi, Z. (2024) C-C motif chemokine ligand 2/C-C motif chemokine receptor 2 pathway as a therapeutic target and regulatory mechanism for spinal cord injury, \u003cem\u003eNeural regeneration research\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eWang, X., Niu, X., Wang, Y., Liu, Y., Yang, C., Chen, X. \u0026amp; Qi, Z. (2025) C-C motif chemokine ligand 2/C-C motif chemokine receptor 2 pathway as a therapeutic target and regulatory mechanism for spinal cord injury, \u003cem\u003eNEURAL REGENERATION RESEARCH. \u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 2231-2244.\u003c/li\u003e\n\u003cli\u003eZhang, H., Hu, Y.-M., Wang, Y.-J., Zhou, Y., Zhu, Z.-J., Chen, M.-H., Wang, Y.-J., Xu, H. \u0026amp; Wang, Y.-H. (2023) Macrophage migration inhibitory factor facilitates astrocytic production of the CCL2 chemokine following spinal cord injury, \u003cem\u003eNeural regeneration research. \u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e, 1802-1808.\u003c/li\u003e\n\u003cli\u003eRong, Y., Ji, C., Wang, Z., Ge, X., Wang, J., Ye, W., Tang, P., Jiang, D., Fan, J., Yin, G., Liu, W. \u0026amp; Cai, W. (2021) Small extracellular vesicles encapsulating CCL2 from activated astrocytes induce microglial activation and neuronal apoptosis after traumatic spinal cord injury (vol 18, 196, 2021), \u003cem\u003eJOURNAL OF NEUROINFLAMMATION. \u003c/em\u003e\u003cstrong\u003e18\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eShechter, R., Miller, O., Yovel, G., Rosenzweig, N., London, A., Ruckh, J., Kim, K.-W., Klein, E., Kalchenko, V., Bendel, P., Lira, Sergio A., Jung, S. \u0026amp; Schwartz, M. (2013) Recruitment of Beneficial M2 Macrophages to Injured Spinal Cord Is Orchestrated by Remote Brain Choroid Plexus, \u003cem\u003eImmunity. \u003c/em\u003e\u003cstrong\u003e38\u003c/strong\u003e, 555-569.\u003c/li\u003e\n\u003cli\u003eRogic, A., Pant, I., Grumolato, L., Fernandez-Rodriguez, R., Edwards, A., Das, S., Sun, A., Yao, S., Qiao, R., Jaffer, S., Sachidanandam, R., Akturk, G., Karlic, R., Skobe, M. \u0026amp; Aaronson, S. A. (2021) High endogenous CCL2 expression promotes the aggressive phenotype of human inflammatory breast cancer, \u003cem\u003eNATURE COMMUNICATIONS. \u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eKierdorf, K., Erny, D., Goldmann, T., Sander, V., Schulz, C., Perdiguero, E. G., Wieghofer, P., Heinrich, A., Riemke, P., H\u0026ouml;lscher, C., M\u0026uuml;ller, D. N., Luckow, B., Brocker, T., Debowski, K., Fritz, G., Opdenakker, G., Diefenbach, A., Biber, K., Heikenwalder, M., Geissmann, F., Rosenbauer, F. \u0026amp; Prinz, M. (2013) Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways, \u003cem\u003eNature neuroscience. \u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e, 273-80.\u003c/li\u003e\n\u003cli\u003eGinhoux, F., Greter, M., Leboeuf, M., Nandi, S., See, P., Gokhan, S., Mehler, M. F., Conway, S. J., Ng, L. G., Stanley, E. R., Samokhvalov, I. M. \u0026amp; Merad, M. (2010) Fate mapping analysis reveals that adult microglia derive from primitive macrophages, \u003cem\u003eScience (New York, NY). \u003c/em\u003e\u003cstrong\u003e330\u003c/strong\u003e, 841-5.\u003c/li\u003e\n\u003cli\u003eDong, Y., Dong, Y., Zhu, C., Yang, L., Wang, H., Li, J., Zheng, Z., Zhao, H., Xie, W., Chen, M., Jie, Z., Li, J., Zang, Y. \u0026amp; Shi, J. (2024) Targeting CCL2-CCR2 signaling pathway alleviates macrophage dysfunction in COPD via PI3K-AKT axis, \u003cem\u003eCell Commun Signal. \u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 364.\u003c/li\u003e\n\u003cli\u003eShi Xu, L. R., Zhang Bing, Chen Qi, Zuo Hua. (2023) Effect of inflammatory reaction mediated by microglia polarization in spinal cord injury, \u003cem\u003eChinese Journal of Tissue Engineering Research. \u003c/em\u003e\u003cstrong\u003e27\u003c/strong\u003e, 121-129.\u003c/li\u003e\n\u003cli\u003eBrennan, F. H., Li, Y., Wang, C., Ma, A., Guo, Q., Li, Y., Pukos, N., Campbell, W. A., Witcher, K. G., Guan, Z., Kigerl, K. A., Hall, J. C. E., Godbout, J. P., Fischer, A. J., McTigue, D. M., He, Z., Ma, Q. \u0026amp; Popovich, P. G. (2022) Microglia coordinate cellular interactions during spinal cord repair in mice, \u003cem\u003eNATURE COMMUNICATIONS. \u003c/em\u003e\u003cstrong\u003e13\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eFang, S., Tang, H., Li, M.-Z., Chu, J.-J., Yin, Z.-S. \u0026amp; Jia, Q.-Y. (2023) Identification of the CCL2 PI3K/Akt axis involved in autophagy and apoptosis after spinal cord injury, \u003cem\u003eMetabolic Brain Disease. \u003c/em\u003e\u003cstrong\u003e38\u003c/strong\u003e, 1335-1349.\u003c/li\u003e\n\u003cli\u003eXu, J., Dong, H., Qian, Q., Zhang, X., Wang, Y., Jin, W. \u0026amp; Qian, Y. (2017) Astrocyte-derived CCL2 participates in surgery-induced cognitive dysfunction and neuroinflammation via evoking microglia activation, \u003cem\u003eBEHAVIOURAL BRAIN RESEARCH. \u003c/em\u003e\u003cstrong\u003e332\u003c/strong\u003e, 145-153.\u003c/li\u003e\n\u003cli\u003ePaterniti, I., Impellizzeri, D., Crupi, R., Morabito, R., Campolo, M., Esposito, E. \u0026amp; Cuzzocrea, S. (2013) Molecular evidence for the involvement of PPAR-\u0026delta; and PPAR-\u0026gamma; in anti-inflammatory and neuroprotective activities of palmitoylethanolamide after spinal cord trauma, \u003cem\u003eJOURNAL OF NEUROINFLAMMATION. \u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eMcTigue, D. M. (2008) Potential Therapeutic Targets for PPAR\u0026gamma; after Spinal Cord Injury, \u003cem\u003ePPAR Research. \u003c/em\u003e\u003cstrong\u003e2008\u003c/strong\u003e, 517162.\u003c/li\u003e\n\u003cli\u003eKrishna, S., Cheng, B., Sharma, D. R., Yadav, S., Stempinski, E. S., Mamtani, S., Shah, E., Deo, A., Acherjee, T., Thomas, T., Zhang, X., Zhang, J., Iacobas, D. A. \u0026amp; Ballabh, P. (2021) PPAR-\u0026gamma; activation enhances myelination and neurological recovery in premature rabbits with intraventricular hemorrhage\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003e118\u003c/strong\u003e, e2103084118.\u003c/li\u003e\n\u003cli\u003eLi, X., Guo, Q., Ye, Z., Wang, E., Zou, W., Sun, Z., He, Z., Zhong, T., Weng, Y. \u0026amp; Pan, Y. (2021) PPAR \u0026gamma; Prevents Neuropathic Pain by Down-Regulating CX3CR1 and Attenuating M1 Activation of Microglia in the Spinal Cord of Rats Using a Sciatic Chronic Constriction Injury Model, \u003cem\u003eFrontiers in neuroscience. \u003c/em\u003e\u003cstrong\u003e15\u003c/strong\u003e, 620525.\u003c/li\u003e\n\u003cli\u003eZhang, H., Gong, M. \u0026amp; Luo, X. (2020) Methoxytetrahydro-2H-pyran-2-yl)methyl benzoate inhibits spinal cord injury in the rat model via PPAR-\u0026gamma;/PI3K/p-Akt activation, \u003cem\u003eEnvironmental toxicology. \u003c/em\u003e\u003cstrong\u003e35\u003c/strong\u003e, 714-721.\u003c/li\u003e\n\u003cli\u003eRicote, M., Li, A. C., Willson, T. M., Kelly, C. J. \u0026amp; Glass, C. K. (1998) The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation, \u003cem\u003eNature. \u003c/em\u003e\u003cstrong\u003e391\u003c/strong\u003e, 79-82.\u003c/li\u003e\n\u003cli\u003eGao, P., Wang, J., Su, Z., Li, F. \u0026amp; Zhang, X. (2021) Amorfrutins Relieve Neuropathic Pain through the PPAR\u0026gamma;/CCL2 Axis in CCI Rats, \u003cem\u003ePPAR Research. \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, 8894752.\u003c/li\u003e\n\u003cli\u003eLi, B. \u0026amp; Mei, X.-F. (2023) Naringin may promote functional recovery following spinal cord injury by modulating microglial polarization through the PPAR-\u0026gamma;/NF-\u0026kappa;B signaling pathway, \u003cem\u003eBRAIN RESEARCH. \u003c/em\u003e\u003cstrong\u003e1821\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLu, Y. \u0026amp; Liu, W. (2020) Selective Estrogen Receptor Degraders (SERDs): A Promising Strategy for Estrogen Receptor Positive Endocrine-Resistant Breast Cancer, \u003cem\u003eJOURNAL OF MEDICINAL CHEMISTRY. \u003c/em\u003e\u003cstrong\u003e63\u003c/strong\u003e, 15094-15114.\u003c/li\u003e\n\u003cli\u003eColon, J. M., Gonzalez, P. A., Cajigas, A., Maldonado, W. I., Torrado, A. I., Sandago, J. M., Salgado, I. K. \u0026amp; Miranda, J. D. (2018) Continuous tamoxifen delivery improves locomotor recovery 6 h after spinal cord injury by neuronal and glial mechanisms in male rats, \u003cem\u003eEXPERIMENTAL NEUROLOGY. \u003c/em\u003e\u003cstrong\u003e299\u003c/strong\u003e, 109-121.\u003c/li\u003e\n\u003cli\u003eCol\u0026oacute;n, J. M. \u0026amp; Miranda, J. D. (2016) Tamoxifen: an FDA approved drug with neuroprotective effects for spinal cord injury recovery, \u003cem\u003eNeural Regeneration Research. \u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 1208-1211.\u003c/li\u003e\n\u003cli\u003ede la Torre Valdovinos, B., Duenas Jimenez, J. M., Estrada, I. J., Banuelos Pineda, J., Franco Rodriguez, N. E., Lopez Ruiz, J. R., Osuna Carrasco, L. P., Candanedo Arellano, A. \u0026amp; Duenas Jimenez, S. H. (2016) Tamoxifen Promotes Axonal Preservation and Gait Locomotion Recovery after Spinal Cord Injury in Cats, \u003cem\u003eJournal of veterinary medicine. \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, 9561968-9561968.\u003c/li\u003e\n\u003cli\u003eColon, J. M., Torrado, A. I., Cajigas, A., Santiago, J. M., Salgado, I. K., Arroyo, Y. \u0026amp; Miranda, J. D. (2016) Tamoxifen Administration Immediately or 24 Hours after Spinal Cord Injury Improves Locomotor Recovery and Reduces Secondary Damage in Female Rats, \u003cem\u003eJOURNAL OF NEUROTRAUMA. \u003c/em\u003e\u003cstrong\u003e33\u003c/strong\u003e, 1696-1708.\u003c/li\u003e\n\u003cli\u003eCabrera-Aldana, E. E., Balderas-Martinez, Y. I., Vel\u0026aacute;zquez-Cruz, R., Tovar-y-Romo, L. B., Sevilla-Montoya, R., Mart\u0026iacute;nez-Cruz, A., Martinez-Cordero, C., Valdes-Flores, M., Santamaria-Olmedo, M., Hidalgo-Bravo, A. \u0026amp; Gu\u0026iacute;zar-Sahag\u0026uacute;n, G. (2023) Administration of Tamoxifen Can Regulate Changes in Gene Expression during the Acute Phase of Traumatic Spinal Cord Injury in \u003cem\u003eCurrent Issues in Molecular Biology \u003c/em\u003e pp. 7476-7491\u003c/li\u003e\n\u003cli\u003eMa, H., Wang, C., Han, L., Kong, F., Liu, Z., Zhang, B., Chu, W., Wang, H., Wang, L., Li, Q., Peng, W., Yang, H., Han, C. \u0026amp; Lu, X. (2023) Tofacitinib Promotes Functional Recovery after Spinal Cord Injury by Regulating Microglial Polarization via JAK/STAT Signaling Pathway, \u003cem\u003eInternational journal of biological sciences. \u003c/em\u003e\u003cstrong\u003e19\u003c/strong\u003e, 4865-4882.\u003c/li\u003e\n\u003cli\u003eWang, R., Wu, X., Tian, Z., Hu, T., Cai, C., Wu, G., Jiang, G. B. \u0026amp; Liu, B. (2023) Sustained release of hydrogen sulfide from anisotropic ferrofluid hydrogel for the repair of spinal cord injury, \u003cem\u003eBioactive materials. \u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 118-128.\u003c/li\u003e\n\u003cli\u003eSalgado, I. K., Torrado, A. I., Santiago, J. M. \u0026amp; Miranda, J. D. (2015) Tamoxifen and Src kinase inhibitors as neuroprotective/neuroregenerative drugs after spinal cord injury, \u003cem\u003eNEURAL REGENERATION RESEARCH. \u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, 385-390.\u003c/li\u003e\n\u003cli\u003eGu, C., Geng, X., Wu, Y., Dai, Y., Zeng, J., Wang, Z., Fang, H., Sun, Y. \u0026amp; Chen, X. (2024) Engineered Macrophage Membrane-Coated Nanoparticles with Enhanced CCR2 Expression Promote Spinal Cord Injury Repair by Suppressing Neuroinflammation and Neuronal death, \u003cem\u003eSMALL. \u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWei., H. (2016) Neuroprotective effect of tamoxifen in a model rat with aucte spinal cord injury, \u003cem\u003eChinese Journal of Tissue Engineering Research. \u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 7710-7716.\u003c/li\u003e\n\u003cli\u003eCrisci, I., Bonzano, S., Nicolas, Z., Dallorto, E., Peretto, P., Krezel, W. \u0026amp; De Marchis, S. (2024) Tamoxifen exerts direct and microglia-mediated effects preventing neuroinflammatory changes in the adult mouse hippocampal neurogenic niche, \u003cem\u003eGLIA. \u003c/em\u003e\u003cstrong\u003e72\u003c/strong\u003e, 1273-1289.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroimmune-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnip","sideBox":"Learn more about [Journal of Neuroimmune Pharmacology](http://link.springer.com/journal/11481)","snPcode":"11481","submissionUrl":"https://submission.nature.com/new-submission/11481/3","title":"Journal of Neuroimmune Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Spinal cord injury, Tamoxifen, CCL2/CCR2, PPAR-γ, Microglia polarization, Inflammation, Apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-7278511/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7278511/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003eSpinal cord injury (SCI) represents a profoundly serious neurological disorder characterized by limited self-repair capabilities and accompanied by secondary inflammatory damage, rendering its treatment a pressing challenge in the field of medical science research. The estrogen receptor modulator Tamoxifen (TAM), owing to its neuroprotective and anti-inflammatory properties, is emerging as a potential option for the treatment of neural injury repair. Preliminary bioinformatics screening has revealed a significant increase in the expression of C-C motif chemokine ligand 2 (CCL2) and chemokine receptor 2 (CCR2) during the acute phase of SCI. TAM may exert therapeutic effects on SCI by inhibiting the activity of the CCL2/CCR2 axis, thereby influencing downstream pathways.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective: \u003c/strong\u003eThis study aims to address the critical issue of secondary inflammatory damage hindering neural regeneration and repair following SCI. By investigating the regulatory effects of TAM on the CCL2/CCR2 axis and its downstream pathways, we seek to elucidate its molecular mechanisms and provide novel strategies for pharmacological intervention in secondary injuries associated with SCI.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eUtilizing bioinformatics techniques, we identified differentially expressed genes post-SCI and analyzed signaling pathways related to the CCL2/CCR2 axis. We assessed the expression levels of this axis following SCI and employed behavioral assays, RT-PCR, ELISA, and Western blotting to validate the effects of TAM administration on the CCL2/CCR2 axis, its downstream pathways, and molecular mechanisms in both LPS-induced microglial inflammation models and complete transection models of SCI. Furthermore, we utilized the CCR2 antagonist INCB3344 and the PPAR-γ antagonist GW9662 to further validate the relationships within these pathways.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eTAM significantly reduced the expression of the CCL2/CCR2 axis in both in vitro and in vivo models following injury. By modulating this axis, TAM decreased NF-κB pathway expression and inhibited the secretion of inflammatory factors, facilitating the transition of microglia from a pro-inflammatory to an anti-inflammatory phenotype while activating the PPAR-γ pathway. Additionally, the activation of PPAR-γ reciprocally inhibited the expression of the CCL2/CCR2 axis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eTAM may significantly alleviate secondary inflammatory responses following SCI through its modulation of the CCL2/CCR2 signaling pathway, exhibiting anti-apoptotic and anti-inflammatory effects. The findings of this study provide a theoretical foundation and experimental basis for the clinical application of TAM in SCI treatment research.\u003c/p\u003e","manuscriptTitle":"Tamoxifen Modulates Spinal Cord Injury Repair via Ccl2/ccr2 Axis and Its Mechanisms","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-26 15:26:31","doi":"10.21203/rs.3.rs-7278511/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-10T13:38:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-09T11:18:32+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-09T01:43:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"150468271502457234434479854073758910250","date":"2025-09-18T09:16:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"52916027973856428873591456519735135553","date":"2025-09-17T20:23:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-17T11:58:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-03T18:28:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-20T01:46:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroimmune Pharmacology","date":"2025-08-02T13:08:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroimmune-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnip","sideBox":"Learn more about [Journal of Neuroimmune Pharmacology](http://link.springer.com/journal/11481)","snPcode":"11481","submissionUrl":"https://submission.nature.com/new-submission/11481/3","title":"Journal of Neuroimmune Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"1e63b2fc-0ce1-47b0-85f0-54c1e8e9b92b","owner":[],"postedDate":"September 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-14T20:38:16+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-26 15:26:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7278511","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7278511","identity":"rs-7278511","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}