Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage

preprint OA: closed CC-BY-4.0

Abstract

microRNA (miRNA) regulation is crucial to achieve precise spatio-temporal expression patterns of their target genes. This makes it crucial to determine the levels of cleavage of a particular target mRNA in different tissues and under different conditions. We developed a quantitative PCR method “quantitative Amplification of Cleaved Ends (qACE)” to assay levels of specific cleavage products in order to determine the extent of miRNA-directed target cleavage of a specific target gene. qACE uses cDNA generated from adapter-ligated RNA molecules and relies on a carefully designed fusion primer that spans the adapter-cleaved RNA junction in qPCR to specifically amplify and quantify cleaved products. The levels of full-length transcripts can also be assayed in the same cDNA preparation using primers that span across the miRNA cleavage site. We used qACE to demonstrate that soybean roots over-expressing miR164 had increased levels of target cleavage and that miRNA deficient Arabidopsis thaliana hen1-1 mutants had reduced levels of target cleavage. We used qACE to discover that differential cleavage by miR164 in nodule vs. adjacent root tissue contributed to nodule-specific expression of NAC1 transcription factors in soybean. These experiments show that qACE can be used to discover and demonstrate tissue-specific cleavage by miRNAs to achieve specific spatio-temporal expression of target genes in plants.
Full text 159,993 characters · extracted from preprint-html · click to expand
Quantitative Amplification of Cleaved Ends (qACE)... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/3-240" }, "headline": "Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage", "datePublished": "2014-10-09T15:06:06", "dateModified": "2015-07-01T12:34:57", "author": [ { "@type": "Person", "name": "Suresh Damodaran" }, { "@type": "Person", "name": "Sajag Adhikari" }, { "@type": "Person", "name": "Marie Turner" }, { "@type": "Person", "name": "Senthil Subramanian" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "microRNA (miRNA) regulation is crucial to achieve precise spatio-temporal expression patterns of their target genes. This makes it crucial to determine the levels of cleavage of a particular target mRNA in different tissues and under different conditions. We developed a quantitative PCR method “quantitative Amplification of Cleaved Ends (qACE)” to assay levels of specific cleavage products in order to determine the extent of miRNA-directed target cleavage of a specific target gene. qACE uses cDNA generated from adapter-ligated RNA molecules and relies on a carefully designed fusion primer that spans the adapter-cleaved RNA junction in qPCR to specifically amplify and quantify cleaved products. The levels of full-length transcripts can also be assayed in the same cDNA preparation using primers that span across the miRNA cleavage site. We used qACE to demonstrate that soybean roots over-expressing miR164 had increased levels of target cleavage and that miRNA deficient Arabidopsis thaliana hen1-1 mutants had reduced levels of target cleavage. We used qACE to discover that differential cleavage by miR164 in nodule vs. adjacent root tissue contributed to nodule-specific expression of NAC1 transcription factors in soybean. These experiments show that qACE can be used to discover and demonstrate tissue-specific cleavage by miRNAs to achieve specific spatio-temporal expression of target genes in plants." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/3-240", "name": "Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed..." } } ] } Home Browse Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Damodaran S, Adhikari S, Turner M and Subramanian S. Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.12688/f1000research.5266.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Method Article Revised Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] Suresh Damodaran 1 , Sajag Adhikari 1 , Marie Turner 1,2 , Senthil Subramanian 1 Suresh Damodaran 1 , Sajag Adhikari 1 , Marie Turner 1,2 , Senthil Subramanian 1 PUBLISHED 01 Jul 2015 Author details Author details 1 Department of Plant Science, South Dakota State University, Brookings, SD, 57007, USA 2 Vegenov BBV, Pol de Leon, 29250, France OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract microRNA (miRNA) regulation is crucial to achieve precise spatio-temporal expression patterns of their target genes. This makes it crucial to determine the levels of cleavage of a particular target mRNA in different tissues and under different conditions. We developed a quantitative PCR method “quantitative Amplification of Cleaved Ends (qACE)” to assay levels of specific cleavage products in order to determine the extent of miRNA-directed target cleavage of a specific target gene. qACE uses cDNA generated from adapter-ligated RNA molecules and relies on a carefully designed fusion primer that spans the adapter-cleaved RNA junction in qPCR to specifically amplify and quantify cleaved products. The levels of full-length transcripts can also be assayed in the same cDNA preparation using primers that span across the miRNA cleavage site. We used qACE to demonstrate that soybean roots over-expressing miR164 had increased levels of target cleavage and that miRNA deficient Arabidopsis thaliana hen1-1 mutants had reduced levels of target cleavage. We used qACE to discover that differential cleavage by miR164 in nodule vs. adjacent root tissue contributed to nodule-specific expression of NAC1 transcription factors in soybean. These experiments show that qACE can be used to discover and demonstrate tissue-specific cleavage by miRNAs to achieve specific spatio-temporal expression of target genes in plants. READ ALL READ LESS Keywords microRNA, degradome, PARE, mRNA cleavage, Glycine max, Arabidopsis thaliana, qPCR, qACE Corresponding Author(s) Senthil Subramanian ( [email protected] ) Close Corresponding author: Senthil Subramanian Competing interests: No competing interests were disclosed. Grant information: Research in the authors’ laboratory is supported by funds (awarded to S.S) from USDA-AFRI (2010-65116 20514), NSF-PGRP (IOS-1350189), South Dakota Soybean Research and Promotion Council and South Dakota State University and Agricultural Experiment station. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2015 Damodaran S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). How to cite: Damodaran S, Adhikari S, Turner M and Subramanian S. Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.12688/f1000research.5266.2 ) First published: 09 Oct 2014, 3 :240 ( https://doi.org/10.12688/f1000research.5266.1 ) Latest published: 01 Jul 2015, 3 :240 ( https://doi.org/10.12688/f1000research.5266.2 ) Revised Amendments from Version 1 Two of the reviewers pointed out the need for independent validation of change in levels of cleavage assayed by qACE. In response to these comments, we used published Northern blot data to quantify band intensities of full length and cleaved AtNAC1. In agreement with our results in soybean, miR164 over-expressing Arabidopsis seedlings had increased ratio of cleaved products while mir164 mutants of Arabidopsis had a reduced ratio of cleaved products. We have also modified generalized statements in our conclusions about “differential cleavage” and reorganized the manuscript in order to introduce qACE primer design, ratio of cleaved transcripts (RCT), and assumptions about stability of cleaved transcripts along with the results. We have specifically reiterated that qACE can only be used to assay previously validated targets where the cleavage site is known. Two of the reviewers pointed out the need for independent validation of change in levels of cleavage assayed by qACE. In response to these comments, we used published Northern blot data to quantify band intensities of full length and cleaved AtNAC1. In agreement with our results in soybean, miR164 over-expressing Arabidopsis seedlings had increased ratio of cleaved products while mir164 mutants of Arabidopsis had a reduced ratio of cleaved products. We have also modified generalized statements in our conclusions about “differential cleavage” and reorganized the manuscript in order to introduce qACE primer design, ratio of cleaved transcripts (RCT), and assumptions about stability of cleaved transcripts along with the results. We have specifically reiterated that qACE can only be used to assay previously validated targets where the cleavage site is known. To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table. READ REVIEWER RESPONSES Introduction miRNAs are short 21-22nt RNA molecules that regulate the expression of cognate target genes primarily through post-transcriptional mechanisms 1 . The majority of plant miRNAs fine-tune target gene expression through precise mRNA cleavage to achieve proper spatio-temporal expression patterns during plant development as well as in response to environmental changes 2 – 4 . Adaxial localization of transcripts encoding a set of HD-ZIP III transcription factors by miR166 in leaves 5 , 6 is an excellent example. The expression of miR166 is restricted to abaxial layers in contrast to its target genes 7 . Mutations in miRNA recognition sites of HD-ZIP III genes (conferring resistance against miR166-mediated decay) resulted in ectopic expression of these genes in abaxial cell layers leading to adaxialized leaves 8 . Polarized expression of miR166 and its target HD-ZIP IIIs is conserved in other plant species as well, e.g. maize 7 , and soybean 9 . Another example is the nodule-meristem specific expression of MtHAP2-1 (alpha subunit of a CCAAT-binding NFY), which is spatially restricted by miR169, which is expressed in the infection zone adjacent to the meristem. Expression of a miRNA resistant MtHAP2-1 under the control of its native promoter led to significantly reduced nodule growth suggesting that spatially restricted expression of MtHAP2-1 is crucial for proper nodule development 10 . Similarly, miR399 plays an important role during inorganic phosphate (Pi) starvation by down regulating PHO2/UBC24 (a gene encoding a putative ubiquitin conjugating enzyme) mRNA 11 , 12 . PHO2 maintains proper levels of phosphate transporter activities 12 and its down regulation increases phosphate acquisition. These examples demonstrate that mere transcriptional regulation is not sufficient to achieve proper spatial and temporal expression of target genes and miRNA regulation is crucial for additional fine-tuning of gene expression. Identification, validation and quantification of the extent of regulation of specific target genes by miRNA is crucial for proper understanding of miRNA-mediated gene regulation. Bioinformatics-based prediction of miRNA targets was developed based on the extent of base-pairing between miRNAs and their targets 13 and subsequently improved based on base-pairing in specific “seed” regions as well as the cleavage site 11 , 14 . A defining feature of miRNA-guided regulation in plants is that cleavage takes place precisely between 10 th and 11 th nucleotide from the 5’end of miRNA in the complementary region of the target transcript. A modified RNA Ligase Mediated-5’Rapid Amplification of cDNA Ends (RLM-5’RACE) method is being used to validate cleavage by miRNAs by mapping the site of cleavage 15 . In this technique an RNA oligo of known sequence is ligated to the mRNA molecules that had an uncapped 5’end arising due to RNase cleavage. OligodT-primed cDNA molecules from adapter ligated RNA is then used to amplify specific target RNA molecules (using a forward primer from the adapter and gene-specific reverse primer). Subsequent sequencing of these amplicons can precisely map the cleavage site. This technique serves as an excellent qualitative method to validate miRNA-mediated cleavage of targets. However, this method cannot quantify the extent of miRNA cleavage i.e. increased cleavage in specific tissue types and/or specific developmental stages/time points. In addition, among the multiple targets of a particular miRNA, some are cleaved more efficiently than the others for example, miR393 mediated reduction in the flag22 elicited wild type seedlings, showed reduction of TIR1, AFB2, AFB3 but not AFB1 16 . Recently, high throughput sequencing-enabled methods were developed for genome-wide validation (and identification) of miRNA targets (“degradome” or PARE (Parallel Analysis of RNA Ends)) 17 , 18 . Briefly, an RNA adaptor with a MmeI recognition site is ligated to the cleaved ends of polyA RNA molecules. Ligated molecules are reverse-transcribed, amplified linearly and digested with MmeI (which cleaves ~20 nucleotides (nt) away from the recognition site) yielding short DNA molecules corresponding to the junction of the RNA adapter and miRNA-cleavage end. A dsDNA oligo adapter is subsequently ligated to the MmeI end and these molecules are linearly amplified, and sequenced using high throughput methods. This results in ~20 nt cleavage signatures that can be used to map miRNA-directed cleavage sites (e.g. CleaveLand bioinformatics pipeline (Addo-Quaye et al. 2009). Normalized abundance of cleavage signatures from specific target genes can be used to quantify miRNA-directed cleavage. However, miRNA binding sites of target genes are highly conserved. Therefore, these short signature sequences generated by degradome/PARE analyses might be shared by more than one gene making it impossible to distinguish cleavage levels of specific target transcripts. For example, at least two targets of miR319 share the same cleavage signature in Arabidopsis ( Table S1 ). Other examples include targets of miR161 and miR172. This is especially significant in species with extensive genome duplications (e.g. soybean) and polyploidy species (e.g. wheat) that have a number of paralogs with high sequence identity. For instance, in soybean five auxin response factor (ARF) genes targeted by miR160 shared the same cleavage signature in the degradome library and RLM-5’RACE had to be used to confirm cleavage of individual target genes 19 . In addition, degradome/PARE analysis is a global analysis method and does not allow determining cleavage levels of a small set of miRNA targets ( Table S1 ). A semi-quantitative method to assay miRNA-directed cleavage was reported by Schwab et al. (2005) 14 . However, the method was not widely used subsequently perhaps due to the lack of validation under different conditions and/or its semi-quantitative nature. We enhanced this method through the use of qPCR and named it “quantitative Amplification of Cleaved Ends” (qACE), and evaluated its ability to assay the extent of miRNA-directed cleavage of specific target genes. qACE allows quantification of specific target mRNA molecules resulting from miRNA-directed cleavage in different tissue-types and/or under different experimental conditions. We demonstrate the applicability of this method to (i) assay increased cleavage of targets in miRNA over-expressing plants, (ii) assay reduced cleavage of targets in miRNA-deficient plants, and (iii) to identify a key role for miR164 in conferring nodule-enriched expression of two of its target genes. Materials and methods Plant material Arabidopsis thaliana wild type Ler and hen1-1 mutant seeds (obtained from ABRC, Columbus, OH: Stock#CS6583) were surface-sterilized and grown in Sunshine mix #1 (Tessman Company, Sioux Falls, SD) under 16h light at 25°C. Leaf, stem and flower tissues were harvested at the same developmental stages, immediately frozen in liquid N 2 and stored at -70°C. Soybean seeds Glycine max cv. Williams-82, the genotype used for genome sequencing project 20 were surface-sterilized 21 and germinated in 4” pots filled with a mixture of vermiculite: perlite (Hummert International, MO) in the ratio of 1:3 and watered with nitrogen free plant nutrient solution 22 . The plants were grown in a controlled environment vertical growth chamber (Conviron Growth chamber, Manitoba, Canada). Growth conditions used were: 16h light and 8h dark and 50% relative humidity with a day and night temperature of 25°C and 20°C respectively. For nodulation assays 5 days old germinated plants were inoculated with Bradyrhizobium japonicum (USDA110) grown in Vincent’s rich medium prepared and supplemented with Chloramphenicol (antibiotic selection marker) at 30°C 23 . The plants were inoculated with B. japonicum at a concentration of OD 600 =0.08 and 14 days post inoculation mature nodules and the root segment adjacent to the nodule were harvested separately. Over expression of gma-miR164a To over-express miR164, the precursor of gma-miR164 (miRBaseID MI0007209) was PCR amplified using G. max genomic DNA as template. The PCR product was initially cloned in to an entry vector PCR8/GW/TOPO (Invitrogen, Carlsbad, CA) and subsequently in to the binary vector pCAMGFP-CsVMV: GW 24 using a Gateway LR clonase (Invitrogen, Carlsbad, CA) reaction. The vector was transformed in to Agrobacterium rhizogenes K599 cells, using electroporation and composite plant transformation was performed as described 25 . Transgenic GFP roots were collected on dry-ice and stored at -70°C until RNA isolation and cDNA synthesis. RNA isolation and cDNA synthesis Total RNA was isolated from the different tissues using TRI reagent (Product#T9424, Sigma Aldrich, St. Louis, MO) as described previously 21 . The RNA was quantified using Nanodrop spectrophotometer (ND1000, Thermo Scientific, Wilmington, DE) and RNA integrity was verified using agarose gel electrophoresis. Adapter ligated cDNA was prepared using GeneRacer kit (Product#L1502-01, Invitrogen, Carlsbad, CA) as per the manufacturer’s instructions except that calf intestinal phosphatase treatment to remove 5’ phosphate and 5’ Cap removal using tobacco acid pyrophosphatase steps were omitted. For Arabidopsis gene expression analysis 2µg of total RNA each of leaf, stem, and flower was pooled together and subject to adapter-ligated cDNA synthesis. For gene expression analysis in soybean nodules and adjacent root tissues, 7µg of total RNA was used in adapter-ligated cDNA synthesis. For miRNA stem-loop cDNA synthesis, 1µg of total RNA was used and a multiplexed cDNA was performed for all miRNAs examined using M-MuLV reverse transcriptase 26 , 27 . miR1515 & U6 was used as normalization/house-keeping control for miRNAs 28 . qPCR and qACE assays qPCR assays were performed in MX3000P thermocycler (Stratagene/Agilent technologies, Santa Clara, CA) using SYBR Advantage qPCR premix (Product#639676, Clontech, Mountain View, CA). The data was analyzed using the MxPro software. Relative expression values for full length transcripts were performed using the dCt method 29 using Actin for soybean and U6 for Arabidopsis as normalization control. Relative levels of cleaved transcripts (described as RCT in text) were calculated using the dCt method comparing the Ct values of full-length vs. cleaved transcripts in the same sample. For statistical analyses, we calculated the range of possible expression values in each sample based on the deviation between Ct values of replicates. Error bars indicate this range in each sample. Results Principle of qACE qACE is an extension of the modified RLM-5’RACE method 15 , 30 used to qualitatively validate target cleavage and the subsequent semi-quantitative method 14 used to examine the levels of cleavage remnants. An RNA adapter is ligated to cleaved 5’-ends of polyA or total RNA preparations (“adapter-ligated RNA”). The adapter gets ligated to any available 5’-phosphate of ribose molecule of RNA arising due to miRNA-directed cleavage or other means (e.g. mRNA degradation), but not to full-length mRNAs, because of the 5-methyl Guanosine/CAP. Oligo-dT primed cDNAs generated from adapter-ligated RNA are subject to real-time PCR where a primer that spans the adapter junction is used as a forward primer (subsequently referred to as qACE forward primer) and a gene-specific reverse primer ( Figure 1 ). Figure 1. Quantitative Amplification of cDNA Ends (qACE). Total RNA containing full length transcripts with 7-methyl Guanosine/CAP and cleaved transcripts arising due to miRNA activity is used as starting material. An RNA oligo adapter of known sequence is ligated to the cleaved transcripts (with a 5’-Phosphate group) giving rise to adapter ligated mRNA. Oligo dT-primed cDNA is used to assay the levels of full length mRNA (qPCR) and cleaved transcripts (qACE). The qPCR forward and reverse primers (qPCR-F & qPCR-R) were designed across the miRNA binding site whereas the qACE forward primer (qACE-F) is designed complementary to adapter sequence but with six nucleotides at the 3’end specific to the sequence at 5’end of cleaved transcript, and a gene specific reverse primer (qACE-R). The forward primer had to be designed such that it does not amplify full-length cDNA molecules or bind non-specifically to other adapter-ligated molecules. We achieved this by careful design such that this primer corresponds to the adapter-cleavage product junction with 6 nucleotides at the 3’end of the primer corresponding to the nucleotides downstream of the cleavage site in the target gene. A shorter design (a 4nt sequence for example), had an increased probability of non-specific binding. On the other hand, longer than 6nt design had a higher thermodynamic stability making it possible to bind to full-length cDNA molecules (depending on the GC content). In addition, for target genes with identical miRNA cleavage signatures (and therefore identical qACE forward primers), specificity was achieved by carefully designing gene-specific reverse primers. We expected that the qACE forward primer combined with a gene-specific reverse primer would help specifically amplify ligation products where the adapter is ligated to the predicted/validated cleavage site. Therefore, a qPCR assay using these primers will specifically quantify cleaved mRNAs resulting from miRNA-directed cleavage. We also expected that the qACE forward primer will not amplify full-length cDNA molecules and neither would it efficiently amplify ligation products where the cleaved end does not correspond to the miRNA-directed cleavage site ( Figure S4a1 ). Finally, we also expected that the use of a gene-specific reverse primer would amplify linearly and help distinguish different targets of the same miRNA even if the miRNA-binding sites are identical/highly conserved ( Figure S4a – Figure S4d ). In addition, the same cDNA preparation can be used to quantify full-length molecules of target mRNA as well as using appropriate primers that span across the miRNA binding site (subsequently referred to as full-length qPCR primers). Ratio of cleaved transcripts vs. full-length transcripts will serve as a quantitative indicator of the extent of miRNA-directed cleavage of the target mRNA. The level of cleaved target transcripts also depends on the levels of transcriptional activity of the target gene. Therefore, comparing absolute levels of cleaved transcripts (or levels normalized to house-keeping genes) between two conditions or tissue types might not reveal differences in miRNA regulation. We decided to normalize the levels of cleaved transcripts to full-length transcripts using the dCt method to obtain the ratio of cleaved transcripts (RCT). The formula for calculating RCT is, 2 (C t(Full length)- C t(cleaved transcript) ) , where C t stands for threshold cycle. It should be noted that qACE relies on prior knowledge about the validity of the cleavage site e.g. obtained through 5’-RACE or degradome/PARE analyses. It cannot be used to validate a predicted cleavage site. In addition, one has to assume that the stability of cleavage products are identical among multiple target genes that are compared. However, such an assumption has to be made even for alternate methods such as degradome/PARE analysis. qACE demonstrates increased GmNAC1b transcript cleavage in soybean roots over-expressing miR164 To obtain proof of concept for the method, we examined the abundance of cleavage remnants in miR164 over-expressing soybean roots. We isolated total RNA from vector control and miR164 over-expressing roots and examined mature miR164 levels by stem-loop qPCR. We observed an 6-fold increase in miR164 over-expressing roots compared to control roots as expected ( Figure 2a ) 31 . We also examined the expression of GmNAC1b, a 5’-RACE-validated target of miR164 in soybean ( Figure S1 ). GmNAC1b is a close ortholog of AtNAC1 ( Figure S2 ). A potential cleavage product of AtNAC1 accumulates in the roots of Arabidopsis plants over-expressing miR164 33 . To quantify the levels of GmNAC1b, we generated oligo-dT-primed cDNA and performed qPCR assays using primers designed across the miR164 binding site of GmNAC1b. Results from qPCR assays indicated that there was a 4.2-fold reduction in the levels of full-length GmNAC1b transcripts in miR164 over-expressing roots compared to control roots ( Figure 2b ). These results indicated that indeed over-expression of miR164 resulted in a reduction in full-length transcripts of its target. Figure 2. Increased cleavage of GmNAC1b transcripts by over expression of miR164 in soybean roots. ( a ) The relative expression level of miR164 (normalized to that of miR1515) in control soybean roots and those over-expressing miR164 (miR164ox) determined using stem-loop qPCR. ( b ) The relative expression levels of full-length GmNAC1b (normalized to that of GmActin) in control and miR164ox roots assayed using qPCR. The data shown in ( a ) and ( b ) are average of three replicate assays and error bars indicate the range of possible values based on deviation between Ct values of replicate assays. ( c ) The Ratio of Cleaved Transcripts (RCT) over full-length transcripts of GmNAC1b in control and miR164ox roots assayed using qACE. The data shown are average of three replicate assays and error bars indicate the range of possible values based on deviation between Ct values of three replicate assays. Next, we used qACE to detect and quantify target cleavage in these roots. We designed qACE primers for GmNAC1b as outlined in Figure 1 . First we examined if the qACE primer pair does not amplify full-length molecules of GmNAC1b using the above cDNA from total RNA without any adapter ligation. qPCR assays detected no amplification ( Figure S4a1 ) indicating that indeed qACE primers did not amplify/detect full-length GmNAC1b molecules. Next, we prepared adapter-ligated cDNA by ligating a known RNA adapter (see methods) to total RNA and reverse-transcribing these molecules using an oligo-dT primer. We used this cDNA to assay full length and cleaved molecules of GmNAC1b using the appropriate primer pairs ( Figure 1 ) and calculated RCT values for each NAC1b in control and miR164 over-expressing roots. There was an 11.6-fold increase in the ratio of cleaved GmNAC1b transcripts in miR164 over-expressing roots compared to the control roots ( Figure 2c ) indicating that indeed miR164 over-expressing roots had increased cleavage of GmNAC1b. This experiment demonstrated that qACE could detect and provide a quantitative indicator of the levels of target cleavage. qACE demonstrates reduced target cleavage in miRNA-deficient Arabidopsis hen1-1 mutant plants Next, we examined the levels of target cleavage in Arabidopsis wild-type ( Ler ) and miRNA-deficient hen1-1 mutant plants. It was previously demonstrated using Northern blots that hen1-1 mutants accumulated less amounts of miRNAs and that there was an increase in the levels of miRNA targets in these plants 34 . We used stem-loop qPCR to determine the levels of three different conserved miRNAs: ath-miR160, ath-miR164 and ath-miR159 in Arabidopsis Ler and hen1-1 plants 27 . As reported earlier, a clear reduction in the levels of mature miR160, miR164 and miR159 was observed in hen1-1 plants in comparison to Ler (control) ( Figure 3a ). However, it should be noted that the levels of reduction were not uniform for all three miRNAs; fold change of -3.2, -21, and -18 respectively. Figure 3. Reduced cleavage of target transcripts in miRNA-deficient Arabidopsis hen1-1 mutants. ( a ) Expression of ath-miR160, ath-miR164 and ath-miR159 in wild-type Ler and hen1-1 tissues assayed by stem-loop qPCR. The expression levels of the miRNAs were normalized to U6. The data shown are average and error bars indicate the range of possible values based on deviation between Ct values of three replicate assays. ( b ) Levels of full-length target transcripts (AtARF17 target of miR160, AtNAC1 & AtCUC2 target of miR164 and AtMYB65 target of miR159) in Ler and hen1-1 tissues analyzed using qPCR. Gene expression levels were normalized to U6 and further confirmed using two additional housekeeping genes, AtEF-α and AtGAPDH (data not shown). The data shown are average and error bars indicate the range of possible values based on deviation between Ct values of two replicate assays. ( c ) The Ratio of Cleaved Transcripts (RCT) over full-length transcripts of AtARF17, AtNAC1, AtCUC2, AtMYB65 in Ler and hen1-1 tissues assayed by qACE. Data shown are average and error bars indicate the range of possible values based on deviation between Ct values of two replicate assays. Next, we used qPCR and qACE respectively to determine the levels of full length and cleaved transcripts of selected targets of the above miRNAs. AtARF17 is an auxin response factor post-transcriptionally regulated by ath-miR160 32 . As reported previously, we also observed an increase in the expression of AtARF17 in hen1-1 plants (~1.4-fold increase; Figure 3b ). Similarly, AtNAC1 and AtCUC2, targets of ath-miR164 showed ~3.5 fold increase in gene expression levels in hen1-1 compared to Ler ( Figure 3b ). AtMYB65, known to be regulated by ath-miR159 had a 4.6-fold increase in transcript levels in hen1-1 compared to Ler ( Figure 3b ). qACE assays indicated a significant reduction in the abundance of miRNA-directed cleavage products for all these target genes in hen1-1 . For example, the levels of cleaved AtARF17 levels were lower in hen1-1 plants resulting in a ~3.5-fold reduction in RCT ( Figure 3c ). Similarly, AtNAC1 had a 6.3-fold reduction in RCT in hen1-1 compared to Ler . AtCUC2 another target of miR164 had only a 2.5-fold decrease in RCT in hen1-1 vs. Ler . Note that both AtNAC1 and AtCUC2 had a 3.5-fold increase in the levels of full-length transcripts ( hen1-1 vs. Ler ) but the reduction in RCTs was very different. This data indicated that the extent of gene expression regulated by miR164 is perhaps different between these two targets. Possible reasons include differences in cleavage efficiency as well as differences in the extent of overlap in tissue domains where the miRNA and the targets are expressed. qACE helped identify this difference where as simple comparison of full-length transcript levels by qPCR would not have identified it. Finally, AtMYB65 showed a ~3.5-fold reduction in RCT in hen1-1 vs. Ler ( Figure 3c ). As a comparison, we determined the ratio of cleaved vs. full length target transcripts using previously published northern blot data using Arabidopsis plants with increased or decreased levels of miR164 33 . We performed image analysis to obtain band intensities of full length and cleaved products and calculated the ratio of cleaved transcripts to full length. In Arabidopsis plants over-expressing miR164 in a chemically inducible manner, a 48 hour induction led to a 1.5 fold increase in RCT in one of the transgenic lines ( Table S2 ). In the other transgenic line, the cleaved product was below the limit of detection at this time point and hence RCT could not be calculated. Nevertheless, increased RCT in miR164 over-expressing plants was consistent with results from our soybean miR164 over-expression experiments ( Figure 2 ). Similarly, in mir164 mutant lines, we observed a significant decrease in RCT ( Table S3 ) consistent with results from our hen1-1 experiments ( Figure 3 ). Evidence from these experiments clearly demonstrated the ability of qACE to provide a quantitative indicator of miRNA-directed cleavage of targets resulting from changes in cognate miRNA levels. Nodule specific expression of NAC1 transcription factors in soybean Having demonstrated the ability of qACE to detect and quantify cleavage of specific miRNA targets, we used the technique to examine the role of miRNAs in governing nodule-specific/enriched gene expression in soybean. We compiled a total of 326 miRNA genes classified in to 134 families from soybean and predicted a total of 596 genes targeted by these miRNAs in soybean 35 . Among these, a set of miRNA-target pairs had inverse expression pattern between mature symbiotic nodules (MN) and adjacent root tissues (ABMN; data not shown). We identified two NAC transcription factors, GmNAC1a and GmNAC1b (5’-RACE validated targets of miR164) that were expressed in a nodule-enriched manner. While GmNAC1a had ~6.3-fold higher expression in MN vs. ABMN tissues, GmNAC1b had a 3.2-fold higher expression ( Figure 4a ). Interestingly, miR164 had a nodule-excluded expression pattern i.e. ~40-fold lower expression in MN vs. ABMN ( Figure 4b ). Figure 4. Nodule-enriched gene expression directed by miRNA activity in soybean. ( a ) Levels of full-length GmNAC1a & b transcript levels in mature nodules (MN) and adjacent root tissues (ABMN) assayed by qPCR and expression levels were normalized to GmActin. Data shown are average and error bars indicate the range of possible values based on deviation between Ct values of two replicate assays. ( b ) Level of gma-miR164 in MN and ABMN tissues assayed by stem-loop qPCR. miRNA expression levels were normalized to that of miR1515. Data shown are average and error bars indicate the range of possible values based on deviation between Ct values of three replicate assays. ( c ) The Ratio of Cleaved Transcripts (RCT) over full-length transcripts of GmNAC1a & b assayed by qACE. Data shown are average from two biological replicates and error bars indicate ± SD. Based on such inverse expression of these miRNA-target pairs we hypothesized that nodule-specific expression of these target genes might be at least in part regulated by nodule-excluded expression of miR164. In other words, miR164 might actively cleave these target genes in adjacent root tissues to restrict their expression to the nodules. Such a mechanism combined with transcriptional regulation can be used to generate expression gradients as observed between miR166 and its HD-ZIP III proteins during xylem development 36 . However, mere inverse expression of miRNAs and their targets is not conclusive evidence for our hypothesis. If indeed, these target genes were preferentially cleaved in ABMN tissues to ensure MN-specific expression, we would expect to observe a larger proportion of cleaved transcripts in ABMN tissues vs. MN tissues. We used qACE to determine the cleavage levels of GmNAC1a and GmNAC1b in ABMN and MN tissues and calculated RCT values. It is worth noting that these targets share the same cleavage signature in degradome/PARE analyses ( Table S1 ). We designed gene specific reverse primers that distinguished these genes ( Table S4 and Figure S3a & b ). Both GmNAC1a and GmNAC1b had increased cleavage in ABMN tissues compared to MN tissues. Interestingly, consistent with the higher enrichment of GmNAC1a in MN tissues, this gene had a higher cleavage in ABMN tissues (~23.5-fold higher than MN tissues). GmNAC1b also had higher cleavage in ABMN tissues (~15.8-fold higher than MN tissues; Figure 4c ). Increased cleavage of GmNAC1a in ABMN compared to GmNAC1b was consistent with increased enrichment of full length GmNAC1a transcripts in MN compared to that of GmNAC1b. qACE assays strongly support the hypothesis that increased cleavage of targets in ABMN tissues by miR164 contributes at least in part to determine their nodule-enriched expression. The high sequence identity between the transcripts of GmNAC1a and b (~92%) precluded the use of Northern to perform such comparisons between these genes. In summary, we have demonstrated that qACE can detect and quantify miRNA-directed cleavage of specific target genes using miRNA over-expression and miRNA-deficient tissues. We successfully used the technique to identify differential cleavage of specific target genes between nodule and adjacent root tissues revealing an additional miRNA-directed mechanism that results in nodule-specific/enriched gene expression. Dataset 1. Raw data qACE to assay miRNA-directed target cleavage. Dataset 1 . Raw Ct values corresponding to Figure 2 . Dataset 2 . Raw Ct values corresponding to Figure 3 . Dataset 3 . Raw Ct values corresponding to Figure 4 . Discussion qACE provides a quantitative indicator of miRNA-directed cleavage of specific target genes by assaying the levels of cleavage remnants. A number of studies have shown reduced levels of target transcripts as an indirect evidence of miRNA-directed cleavage 36 , 37 . Northern hybridization has also been used to estimate miRNA-directed cleavage. For example, a putative cleavage product of NAC1 resulting from miR164 activity was detected using a 3’-specific probe in Arabidopsis 33 . More recently, degradome/PARE analysis has enabled quantification of global miRNA cleavage 17 , 18 . However, this method cannot distinguish target transcripts that share the same cleavage signature (see Introduction ). qACE, an enhancement to the semi-quantitative method developed by Schwab et al. 2005 14 , enables quantification of miRNA-directed cleavage of a smaller set of target genes and also can differentiate closely related genes. During the preparation of this manuscript a near identical method was used by Li et al. (2014) 38 to distinguish efficiencies of miR159-directed cleavage of different MYB33 targets with specific mismatches. This study validated the usefulness of the qACE method. We have performed proof of concept and control experiments (e.g. demonstrating lack of amplification using qACE primers in non-adapter ligated cDNA preparations) to demonstrate the method’s utility. We have demonstrated this using GmNAC1a and GmNAC1b which share a similar cleavage signature ( Table S1 ). Our results show that using qPCR (to assay reduction in full-length transcripts) and qACE (to assay the levels of cleaved transcripts) on the same cDNA preparation, one can estimate specific levels of cleavage for each target gene. For example, we demonstrate that both NAC1 and CUC2 had similar levels of increase in hen1-1 , but different levels of reduction in miR164-directed cleavage. A potential limitation of qACE is the level of target gene expression and thus the detectable level of cleavage products. Among the different genes we tested, RCTs ranged from 0.0033 (GmNAC1b Figure 2c ) to 0.2 (AtNAC1; Figure 3c ). As one can imagine, for very poorly expressed genes with a low levels of miRNA cleavage, it can be technically challenging to reliably detect cleavage products. We used linearity and efficiency assays to determine valid range of Ct values that are reliable for each gene of interest (See below). Alternate solutions to this deficiency include the use of xrn4 mutants as done previously 18 or the use of linear pre-amplification of the adapter-ligated RNA molecules by incorporating a T7 promoter in the adapter. However, this will amplify only cleaved products and not full-length transcripts. In addition, specific miRNAs also induce generation of secondary sRNAs from the cleaved product making them unavailable for quantification. Another limitation of qACE is its inability to distinguish cleavage products with closely spaced cleavage sites. For example, G. max has twenty miR166 genes that are predicted to target all twelve GmHD-ZIP III genes. We have identified two major cleavage products from several of these genes where the position of cleavage site differs by two nucleotides. Based on the known miR166 variants in soybean, we hypothesized that these two cleavage products arose from the activities of miR166a and miR166h respectively ( Figure 5 ). We attempted to distinguish these cleavage products by qACE. Unfortunately qACE failed to differentiate the cleaved molecules arising due to gma-miR166h owing to loop formation in template which enables amplification of the qACE primer pairs designed to detect cleavage levels arising due to miR166a. Despite these minor limitations, we have demonstrated that qACE is a very useful method that can provide a quantitative indicator of the cleavage levels of specific miRNA target genes. Figure 5. Cleavage products with closely spaced cleavage sites and difficulty in detection using qACE. The images depict binding of the qACE forward primer (qACE-F) to cleavage products resulting from miR166h and miR166a guided cleavage of GmHD-ZIP III transcripts. The primer-template combination in the top panel resulted in no amplification underscoring the specificity of the primer. However, the primer-template combination shown in the bottom panel resulted in non-specific amplification. We hypothesize that the 6nt binding stretch at the 3’end was the reason for such non-specific amplification. The oligo adapter ligated to the cleaved end is indicated in bold letters and as grey bar. qACE being a qPCR-based method, specificity and linearity of primers used are key factors to be considered 39 . For linearity assays for qACE primers, one has to use adapter-ligated cDNA. Due to the lower abundance of cleavage products, we made cDNA preparations from 5–7µg of DNase treated total RNA. To efficiently utilize these cDNA preparations for qACE assays, we used PCR amplified cDNA for linearity assays. We amplified a small amount of adapter-ligated cDNA using 5’adapter as forward primer and 3’PolydT adapter as reverse primer in a 25 cycle PCR. We reasoned that dilutions of this PCR product can be used to check the linearity of the qACE primer pairs, but cannot be used for qACE assays (due to non-linear amplification). This enabled the use of adapter-ligated cDNA primarily for qACE assays and increased the overall efficiency of the method in terms of amount of RNA requirement. Data availability F1000Research : Dataset 1. Raw data qACE to assay miRNA-directed target cleavage, 10.5256/f1000research.5266.d36383 40 Author contributions SS conceived the study, guided data analysis, and wrote the manuscript. SD, SA and MT performed the experiments. SD and SA analyzed the data and co-wrote the manuscript. Competing interests No competing interests were disclosed. Grant information Research in the authors’ laboratory is supported by funds (awarded to S.S) from USDA-AFRI (2010-65116-20514), NSF-PGRP (IOS-1350189), South Dakota Soybean Research and Promotion Council and South Dakota State University and Agricultural Experiment station. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Acknowledgements The use of equipment at the SDSU-Functional Genomics Core Facility supported in part by NSF/EPSCoR Grant No. 0091948, the State of South Dakota is acknowledged. Supplementary information Figure S1. Validation of gma-miR164a guided cleavage of GmNAC1b using RLM 5’-RACE. The arrow indicates the cleavage site in the miR164a binding site of GmNAC1b. The numbers within parenthesis indicate the frequency of miRNA cleaved product of the total number of sequences analyzed. Figure S2. Phylogenetic tree of NAC1 transcription factor peptide sequence of AtNAC1 (At1g56010), NAC1 orthologs in Glycine max, Medicago truncatula, Poplar trichocharpa, Vitis vinifera, Brachypodium distachyon were identified using BLASTP tool in Phytozome ( www.phytozome.net ). The amino acid sequences were aligned using global alignment in MEGA 5. The aligned sequences were used for constructing a phylogenetic tree using the rooted neighborhood joining method. The numbers in the branches indicate the distance and arrows shows the GmNAC1b presence in AtNAC1 clade. Figure S3. Dissociation curves of qACE amplicons ( a ) GmNAC1a and ( b ) GmNAC1b. The melting temperatures (Tm) are different for GmNAC1a and GmNAC1b underscoring the specificity of the gene specific reverse primer although the qACE-F primer is common for both. The data is the average of two replicate assays. Figure S4a. Amplification plots of GmNAC1b in ( a1 ) control and ( a2 ) miR164ox (miR164 over expression) amplification plots showing linear amplification of full length (red squares) and cleaved cDNA (blue circles) by GmNAC1b qPCR-F & R and qACE-F & R primers respectively determined by SYBR fluorescence. ( a1 ) Amplification plot showing no amplification of full length cDNA by GmNAC1b qACE-F & R primers determined by SYBR fluorescence (yellow lines). The data shown are normalized fluorescence from three replicate assays. Figure S4b. Amplification plots of AtNAC1 & AtCUC2 in ( b1 & b3 ) Ler and ( b2 & b4 ) hen1-1 Arabidopsis mutant. Amplification plot showing linear amplification of full length (blue circles) and cleaved cDNA (red squares) by qPCR-F & R and qACE-F & R primers respectively for AtNAC1 ( b1 & b2 ), AtCUC2 ( b3 & b4 ) determined by SYBR fluorescence. The data shown are normalized fluorescence from two replicate assays. Figure S4c. Amplification plots of AtARF17 & AtMYB65 in ( c1 & c3 ) Ler and ( c2 & c4 ) hen1-1 Arabidopsis mutant. Amplification plot showing linear amplification of full length (blue circles) and cleaved cDNA (red squares) by qPCR-F & R and qACE-F & R primers respectively for AtARF17 ( c1 & c2 ), AtMYB65 ( c3 & c4 ) determined by SYBR fluorescence. The data shown are normalized fluorescence from two replicate assays. Figure S4d. Amplification plots of GmNAC1a & b in ( d1 & d3 ) MN ( d2 & d4 ) ABMN tissues of soybean. Amplification plot showing linear amplification of full length (blue circles) and cleaved cDNA (red squares) by qPCR-F & R and qACE-F & R primers respectively for GmNAC1a ( d1 & d2 ), GmNAC1b ( d3 & d4 ) determined by SYBR fluorescence. The data shown are normalized fluorescence from two replicate assays. Table S1. Examples of miRNA targets with identical cleavage signatures in degradome/PARE libraries. Species miRNA family analyzed Targets sharing identical cleavage signature with at least one other target of its cognate miRNA Percentage of targets with shared cleavage signatures with at least one other target of the cognate miRNA Soybean miR160 Glyma10g35480.1 a 41.7%(5/12) Glyma11g20490.1 a Glyma12g08110.1 a Glyma13g20370.1 b Glyma10g06080.1 b miR164 Glyma04g33270.1 a 85.7%(6/7) Glyma05g00930.1 a Glyma06g21020.1 a Glyma17g10970.1 a Glyma08g18470.1 b Glyma15g40510.1 b miR166 Glyma04g09000.1 b 100%(12/12) Glyma05g30000.1 a Glyma06g09100.1 b Glyma07g01940.1 b Glyma07g01950.1 b Glyma08g13110.1 a Glyma08g21610.1 b Glyma08g21620.1 b Glyma09g02750.1 a Glyma11g20520.1 c Glyma12g08080.1 c Glyma15g13640.1 b miR169 Glyma09g07960.1 a 40%(2/5) Glyma15g18970.1 a miR159 Glyma04g15150.1 a 40%(2/5) Glyma06g47000.1 a Arabidopsis miR319a AT2G45950.1 a 16.7%(2/12) AT3G61415.1 a miR172d AT3G23810.1 a 25%(2/8) AT4G13940.1 a The data was obtained for Arabidopsis (German et al. , 2009) & Soybean (Shamimuzzaman and Vodkin 2012). Targets of a particular miRNA family with identical cleavage signatures are denoted by the same letter label (a, b, or c). Table S2. Quantification of Northern blot bands ( Figure 4c , Guo et al., 2005). Lane 1 Lane 2 Lane 3 0hr 24hr 48hr Band intensity NAC1-Full length 17102.98 8605.187 8547.208 NAC1-Cleaved 1067.113 456.062 760.749 Ratio(RCT) 0.06239 0.05300 0.08901 Ratio of cleaved transcripts to full length in Arabidopsis plants over-expressing miR164 in response to an exogenous inducer. Previously published Northern data ( Figure 4c in 33 ) was analyzed by quantifying the integrated band intensity using ImageJ ( http://rsbweb.nih.gov/ij/ ). The full length and cleaved transcripts are labeled NAC1 and NAC1 3’ respectively in the original figure. Table S3. Quantification of Northern blot bands ( Figure 5c , Guo et al., 2005). Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Col-0 miR164b-1 miR164a-1 miR164a-2 miR164a-3 Band intensity NAC1-Full length 9452.238 16113.794 13025.652 17353.48 12895.51 NAC1-Cleaved 1223.376 218.092 185.435 908.234 235.263 Ratio(RCT) 0.1294 0.01353 0.01423 0.05233 0.01824 Ratio of cleaved transcripts to full length in wild-type and mir164 mutant Arabidopsis seedlings. Previously published Northern data ( Figure 5c in 33 ) was analyzed by quantifying the integrated band intensity using ImageJ ( http://rsbweb.nih.gov/ij/ ). The full length and cleaved transcripts are labeled NAC1 and NAC1 3’ respectively in the original figure. Table S4. Sequences of PCR primers used in this study. Gene Forward primer Reverse primer Arabidopsis qPCR Primers ATGAPDH(At1g13440) TTGGTGACAACAGGTCAAGCA AAACTTGTCGCTCAATGCAATC AtEF1α(At5g60390) TGAGCACGCTCTTCTTGCTTTCA GGTGGTGGCATCCATCTTGTTACA Universal U6 GGAACGATACAGAGAAGATTAGCA GTGCAGGGTCCGAGGT (qPCR-universal miRNA-R) ATNAC1(At1g56010) GACCAAGAACCCTCTTCTTATCTCAG GACTGAGTTGGTTAGGTTCGAGT ATCUC2(At5g53950) CCTACGACAGCCGTAGCACC TGAGTTAACGTCTAAGCCCAAGGC ATARF17(At1g77850) GATCCAAGTCCTTCTATGTTCTCGTA CCCAAATCAGGAAGCGGACTT ATMYB65(At3g11440) ACGTATGGCATGCATCCTACTTC GTGGAGGTGACGGAGTCGT Arabidopsis qACE primers AtNAC1 ACATGGACTGAAGGAGTAGAAATGCTTC GACTGAGTTGGTTAGGTTCGAGT AtCUC2 ACATGGACTGAAGGAGTAGAAATGTTTC TGAGTTAACGTCTAAGCCCAAGGC AtARF17 ACATGGACTGAAGGAGTAGAAAGAGCCA CCCAAATCAGGAAGCGGACTT AtMYB65 ACATGGACTGAAGGAGTAGAAATCATTC GTGGAGGTGACGGAGTCGT Soybean qPCR and cloning primers GmACTIN(Glyma02g10170) CCGGTCGTGACCTCACTGATTTCTTG CATCAGGCAACTCGTAGCTCTTCTCG GmNAC1a(Glyma08g18470) CGGGATCTTCAACTCTTCCTGCG GAGGGAACTTAGGCTCCATAGTGGT GmNAC1b(Glyma15g40510) CTGCTATGAGGACACAGGATCTTCAT AAATTTGGTGCTCCTCCATATGCAT Gma-miR164a AGCTTAAGGTGCATGCAACG GCTGGACACAATTGGTTAGGAG Soybean qACE primers GmNAC1a(Glyma08g18470) ACATGGACTGAAGGAGTAGAAATGCTTC GAGGGAACTTAGGCTCCATAGTGGT GmNAC1b(Glyma15g40510) AAATTTGGTGCTCCTCCATATGCAT GmHD-ZIPIII-166a ACATGGACTGAAGGAGTAGAAACCTGGT GmHD-ZIPIII-166h ACATGGACTGAAGGAGTAGAAATGGTCC miRNA cDNA synthesis primer AtmiR159a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC AtmiR159b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGAGC AtmiR159c GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGAGC miR164 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGCACG GmmIR1515 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGATC U6 GTGCAGGGTCCGAGGTTTTGGACCATTTCTCGAT miR160 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAT miRNA qPCR primer qPCR-atmiR159-F TCGCTTTTGGATTGAAGGGA GTGCAGGGTCCGAGGT (qPCR-universal miRNA-R) qPCR-MIR164-F TGGAGAAGCAGGGCACGTGCA qPCR-miR1515-F TCGCTTCATTTTGCGTGCAAT qPCR-miR160-F TGCCTGGCTCCCTGTATGCCA Faculty Opinions recommended References 1. Reinhart BJ, Weinstein EG, Rhoades MW, et al. : MicroRNAs in plants. Genes Dev. 2002; 16 (13): 1616–26. PubMed Abstract | Publisher Full Text | Free Full Text 2. Jover-Gil S, Candela H, Ponce MR: Plant microRNAs and development. Int J Dev Biol. 2005; 49 (5–6): 733–44. PubMed Abstract | Publisher Full Text 3. Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAs and their regulatory roles in plants. Annu Rev Plant Biol. 2006; 57 : 19–53. PubMed Abstract | Publisher Full Text 4. Chen X: Small RNAs and their roles in plant development. Annu Rev Cell Dev Biol. 2009; 25 : 21–44. PubMed Abstract | Publisher Full Text 5. Emery JF, Floyd SK, Alvarez J, et al. : Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr Biol. 2003; 13 (20): 1768–74. PubMed Abstract | Publisher Full Text 6. Prigge MJ, Otsuga D, Alonso JM, et al. : Class III homeodomain-leucine zipper gene family members have overlapping, antagonistic, and distinct roles in Arabidopsis development. Plant Cell. 2005; 17 (1): 61–76. PubMed Abstract | Publisher Full Text | Free Full Text 7. Juarez MT, Kui JS, Thomas J, et al. : microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature. 2004; 428 (6978): 84–8. PubMed Abstract | Publisher Full Text 8. Mallory AC, Reinhart BJ, Jones-Rhoades MW, et al. : MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5’ region. EMBO J. 2004; 23 (16): 3356–64. PubMed Abstract | Publisher Full Text | Free Full Text 9. Wong CE, Zhao YT, Wang XJ, et al. : MicroRNAs in the shoot apical meristem of soybean. J Exp Bot. 2011; 62 (8): 2495–506. PubMed Abstract | Publisher Full Text 10. Combier JP, Frugier F, de Billy F, et al. : MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula . Gene Dev. 2006; 20 (22): 3084–8. PubMed Abstract | Publisher Full Text | Free Full Text 11. Allen E, Xie Z, Gustafson AM, et al. : microRNA-directed phasing during trans -acting siRNA biogenesis in plants. Cell. 2005; 121 (2): 207–21. PubMed Abstract | Publisher Full Text 12. Kuo HF, Chiou TJ: The role of microRNAs in phosphorus deficiency signaling. Plant Physiol. 2011; 156 (3): 1016–24. PubMed Abstract | Publisher Full Text | Free Full Text 13. Rhoades MW, Reinhart BJ, Lim LP, et al. : Prediction of plant microRNA targets. Cell. 2002; 110 (4): 513–20. PubMed Abstract | Publisher Full Text 14. Schwab R, Palatnik JF, Riester M, et al. : Specific effects of microRNAs on the plant transcriptome. Dev Cell. 2005; 8 (4): 517–27. PubMed Abstract | Publisher Full Text 15. Llave C, Xie Z, Kasschau KD, et al. : Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science. 2002; 297 (5589): 2053–6. PubMed Abstract | Publisher Full Text 16. Navarro L, Dunoyer P, Jay F, et al. : A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science. 2006; 312 (5772): 436–9. PubMed Abstract | Publisher Full Text 17. Addo-Quaye C, Miller W, Axtell MJ: CleaveLand: a pipeline for using degradome data to find cleaved small RNA targets. Bioinformatics. 2009; 25 (1): 130–1. PubMed Abstract | Publisher Full Text | Free Full Text 18. German MA, Pillay M, Jeong DH, et al. : Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends. Nat Biotechnol. 2008; 26 (8): 941–6. PubMed Abstract | Publisher Full Text 19. Shamimuzzaman M, Vodkin L: Identification of soybean seed developmental stage-specific and tissue-specific miRNA targets by degradome sequencing. BMC Genomics. 2012; 13 : 310. PubMed Abstract | Publisher Full Text | Free Full Text 20. Schmutz J, Cannon SB, Schlueter J, et al. : Genome sequence of the palaeopolyploid soybean. Nature. 2010; 463 (7278): 178–83. PubMed Abstract | Publisher Full Text 21. Subramanian S, Fu Y, Sunkar R, et al. : Novel and nodulation-regulated microRNAs in soybean roots. BMC Genomics. 2008; 9 : 160. PubMed Abstract | Publisher Full Text | Free Full Text 22. Lullien V, Barker DG, de Lajudie P, et al. : Plant gene expression in effective and ineffective root nodules of alfalfa ( Medicago sativa ). Plant Mol Biol. 1987; 9 (5): 469–78. PubMed Abstract | Publisher Full Text 23. Vincent JM: A manual for the practical study of root nodule bacteria. IBP handbook Blackwell Scientific Publications, Oxford, United Kingdom. 1970; (15). Reference Source 24. Graham TL, Graham MY, Subramanian S, et al. : RNAi silencing of genes for elicitation or biosynthesis of 5-deoxyisoflavonoids suppresses race-specific resistance and hypersensitive cell death in Phytophthora sojae infected tissues. Plant Physiol. 2007; 144 (2): 728–40. PubMed Abstract | Publisher Full Text | Free Full Text 25. Collier R, Fuchs B, Walter N, et al. : Ex vitro composite plants: an inexpensive, rapid method for root biology. Plant J. 2005; 43 (3): 449–57. PubMed Abstract | Publisher Full Text 26. Turner M, Adhikari S, Subramanian S: Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs. Plant Signal Behav. 2013; 8 (8): e24918. PubMed Abstract | Publisher Full Text | Free Full Text 27. Varkonyi-Gasic E, Hellens RP: Quantitative stem-loop RT-PCR for detection of microRNAs. Methods Mol Biol. 2011; 744 : 145–57. PubMed Abstract | Publisher Full Text 28. Adhikari S, Turner M, Subramanian S: Hairpin priming is better suited than in vitro polyadenylation to generate cDNA for plant miRNA qPCR. Mol Plant. 2013; 6 (1): 229–31. PubMed Abstract | Publisher Full Text 29. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25 (4): 402–8. PubMed Abstract | Publisher Full Text 30. Rapid amplification of 5’ complementary DNA ends (5’ RACE). Nat Methods. 2005; 2 (8): 629–30. PubMed Abstract | Publisher Full Text 31. Mao G, Turner M, Yu O, et al. : miR393 and miR164 influence indeterminate but not determinate nodule development. Plant Signaling Behav. 2013; 8 (10). PubMed Abstract | Publisher Full Text 32. Wang JW, Wang LJ, Mao YB, et al. : Control of root cap formation by microRNA-targeted auxin response factors in Arabidopsis. Plant Cell. 2005; 17 (8): 2204–16. PubMed Abstract | Publisher Full Text | Free Full Text 33. Guo HS, Xie Q, Fei JF, et al. : MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell. 2005; 17 (5): 1376–86. PubMed Abstract | Publisher Full Text | Free Full Text 34. Park W, Li J, Song R, et al. : CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana . Curr Biol. 2002; 12 (17): 1484–95. PubMed Abstract | Publisher Full Text 35. Turner M, Yu O, Subramanian S: Genome organization and characteristics of soybean microRNAs. BMC Genomics. 2012; 13 : 169. PubMed Abstract | Publisher Full Text | Free Full Text 36. Carlsbecker A, Lee JY, Roberts CJ, et al. : Cell signalling by microRNA165/6 directs gene dose-dependent root cell fate. Nature. 2010; 465 (7296): 316–21. PubMed Abstract | Publisher Full Text | Free Full Text 37. Liu PP, Montgomery TA, Fahlgren N, et al. : Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J. 2007; 52 (1): 133–46. PubMed Abstract | Publisher Full Text 38. Li J, Reichel M, Millar AA: Determinants beyond both complementarity and cleavage govern microR159 efficacy in Arabidopsis . PLoS Genet. 2014; 10 (3): e1004232. PubMed Abstract | Publisher Full Text | Free Full Text 39. Udvardi MK, Czechowski T, Scheible WR: Eleven golden rules of quantitative RT-PCR. Plant Cell. 2008; 20 (7): 1736–7. PubMed Abstract | Publisher Full Text | Free Full Text 40. Damodaran S, Adhikari S, Turner M, et al. : Raw data qACE to assay miRNA-directed target cleavage. F1000Research. 2014. Data Source Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 09 Oct 2014 ADD YOUR COMMENT Comment Author details Author details 1 Department of Plant Science, South Dakota State University, Brookings, SD, 57007, USA 2 Vegenov BBV, Pol de Leon, 29250, France Competing interests No competing interests were disclosed. Grant information Research in the authors’ laboratory is supported by funds (awarded to S.S) from USDA-AFRI (2010-65116 20514), NSF-PGRP (IOS-1350189), South Dakota Soybean Research and Promotion Council and South Dakota State University and Agricultural Experiment station. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 01 Jul 2015, 3:240 https://doi.org/10.12688/f1000research.5266.2 version 1 Published: 09 Oct 2014, 3:240 https://doi.org/10.12688/f1000research.5266.1 Copyright © 2015 Damodaran S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Damodaran S, Adhikari S, Turner M and Subramanian S. Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.12688/f1000research.5266.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 01 Jul 2015 Revised Views 0 Cite How to cite this report: Schwab R. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r9272 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-9272 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 17 Aug 2015 Rebecca Schwab , Center for Plant Molecular Biology, University of Tübingen, Tübingen, Germany Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.7228.r9272 The newly added tables S2 and S3, which contain quantifications of Northern blot bands published in a different paper, are not sufficient to prove the validity of qACE - of accurately measuring changes in miRNA-cleaved mRNAs when using qACE. A ... Continue reading READ ALL The newly added tables S2 and S3, which contain quantifications of Northern blot bands published in a different paper, are not sufficient to prove the validity of qACE - of accurately measuring changes in miRNA-cleaved mRNAs when using qACE. A direct comparison is needed from the same starting material (RNA or tissue). Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Schwab R. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r9272 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-9272 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Masson P. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r8361 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-8361 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 06 Jul 2015 Patrick Masson , Department of Genetics, University of Wisconsin-Madison, Madison, WI, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.7228.r8361 The changes made to this manuscript improve its quality. However, the experiment added to independently validate the ability of qACE to quantitatively assess the levels of target cleavage by miRNA is not appropriate, involving a published experiment that analyzed distinct ... Continue reading READ ALL The changes made to this manuscript improve its quality. However, the experiment added to independently validate the ability of qACE to quantitatively assess the levels of target cleavage by miRNA is not appropriate, involving a published experiment that analyzed distinct plant materials relative to this qACE analysis (Arabidopsis vs soybean). A true validation experiment should involve an alternative method such as Northern blot analysis to analyze the relative abundance of full length RNA and cleavage products within the same RNA preparations that were used to obtain the qACE data reported here. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Masson P. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r8361 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-8361 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 09 Oct 2014 Views 0 Cite How to cite this report: Millar AA. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8620 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8620 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 12 May 2015 Anthony A. Millar , Plant Science Division, Research School of Biology, Australian National University, Canberra, ACT, Australia Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.5613.r8620 Here, the authors describe an assay that quantifies miRNA-guided cleavage products. Then, by comparing to the mRNA levels of the corresponding non-cleaved target transcripts, a ratio is obtained that estimates the proportion of transcript present in the cell has been ... Continue reading READ ALL Here, the authors describe an assay that quantifies miRNA-guided cleavage products. Then, by comparing to the mRNA levels of the corresponding non-cleaved target transcripts, a ratio is obtained that estimates the proportion of transcript present in the cell has been cleaved by the miRNA. They tested this in an overexpression line, a miRNA-deficient mutant, and in an example where an endogenous miRNA is expressed in a tissue specific manner. The discussion nicely points out the advantages and limitations of the approach. Although the assay represents a relatively straight forward modification of a widely used protocol, modifying it into a quantitative-PCR protocol may enable a number of interesting questions to be addressed. For example, it may give an insight into the efficiency of miRNA-mediated regulation, where it could determine if all equally predicted targets are cleaved as efficiently as one another. Minor comments The authors state in the abstract that qACE can “determine the extent of miRNA regulation for a specific target gene”. This method only measures transcript cleavage, but nothing can be inferred about any translational inhibition mechanism, which there is now very strong evidence that many (possibly most) miRNA-target interactions have a translational repression component to it. Maybe this should be mentioned somewhere in the manuscript as it has basically been ignored, and so this method can only measure the efficiency of cleavage but not the “extent of miRNA regulation”. Also in abstract the term “differential cleavage by miR164” makes it sound like the miRNA is cleaving differently in the different tissues, this may turn out to be the case in some examples, but here isn’t more likely due to the fact that miR164 is differentially expressed, having a higher abundance in root tissues compared to nodules? I would be careful with the use of that term. In the discussion; “we demonstrate that both NAC1 and CUC2 had similar levels of increase in hen1-1 , but different levels of reduction in miR164-directed cleavage.” Maybe the authors should be more careful with their claims, as qPCR measurements can vary, and the number of biological reps were not indicated, they did mention “replicate assays” but this seems something different, so how repeatable was this difference? Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Millar AA. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8620 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8620 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Masson P. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8479 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8479 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 27 Apr 2015 Patrick Masson , Department of Genetics, University of Wisconsin-Madison, Madison, WI, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.5613.r8479 This paper describes a method that allows quantification of miRNA-directed cleavage of specific target RNAs in plant tissues. Method validation includes an analysis of target cleavage in miRNA over-expressing tissues and in miRNA-deficient samples ( hen1 mutant). Usefulness of the approach ... Continue reading READ ALL This paper describes a method that allows quantification of miRNA-directed cleavage of specific target RNAs in plant tissues. Method validation includes an analysis of target cleavage in miRNA over-expressing tissues and in miRNA-deficient samples ( hen1 mutant). Usefulness of the approach is illustrated by the identification of a role for miRNA-directed cleavage in the modulation of nodule-specific GmNAC1 -isoform expression in Glycine max . This quantitative protocol may reveal itself as very useful in experiments aimed at characterizing the role played by miRNAs in the regulation of target gene expression in plants and their contribution to growth, development and response to the environment. However, under its current form, this manuscript suffers from a lack of independent validation of its quantitative output. Such validation should involve a different approach aimed at quantifying the relative levels of miRNA, full-length and cleaved target transcripts in wild type, overexpressing and miRNA-deficient mutants. For instance, a Northern blot analysis of wild-type, miR164-over-expressing and hen1 plant tissues could be carried out to evaluate relative levels of miR164 as well as full-length AtNAC1 and its miR164-induced cleavage product, and the results compared to those obtained through the qRT-PCR and qAce approaches described in this manuscript. Indeed, we know from the publication by Guo et al. (2005) (referenced in this manuscript) that these various RNAs can be identified and quantified by Northern blot analysis Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Masson P. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8479 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8479 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Schwab R. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r6570 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-6570 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 19 Nov 2014 Rebecca Schwab , Center for Plant Molecular Biology, University of Tübingen, Tübingen, Germany Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.5613.r6570 Technical comments: The ‘proof’ that the method can reliably quantify miRNA target cleavage products is based on inferences from previous reports - that increased cleavage is expected when the corresponding miRNA is over-expressed, and that reduced cleavage is to be seen ... Continue reading READ ALL Technical comments: The ‘proof’ that the method can reliably quantify miRNA target cleavage products is based on inferences from previous reports - that increased cleavage is expected when the corresponding miRNA is over-expressed, and that reduced cleavage is to be seen in miRNA biosynthetic mutants such as hen1 . An adequate validation should however include an independent methodology, such as regular northern blots for miRNA targets. This is easily done when choosing targets that are reasonably stable. Quantification of the resulting bands (full length and cleaved) will serve as an independent proof of concept. It would be helpful to add a couple of words during the results section about the design of qACE primers and to what extent they require optimisation (overlap adapter/target). Sort of a guideline. Also, the RCT value should be explained a bit better during the results section. Stability of miRNA target cleavage products is an issue - sometimes they are easily detected, sometimes they are not. This is mentioned in the discussion, but should come up before as it is a major point of consideration for the design of the experiments. Materials and Methods: What tissues were used for RT experiments? Which primers were used to over-express miR164 in soybean? Other: I somewhat disagree with the statement ‘…quantification of the extent of regulation of specific target genes by miRNA is crucial for proper understanding of their biological roles.’ To investigate the biological roles of miRNAs, quantifying (and spatially/temporally visualising) target protein levels is very important. Quantifying the extent of miRNA-directed cleavage contributing to target protein levels are however very interesting for mechanistic studies of miRNA-mediated gene regulation. Sentences are sometimes phrased very generally. Since miRNA-directed cleavage is not a main issue in animals, ‘plants’ can come up already in the beginning of sentences. Competing Interests: No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Schwab R. Reviewer Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r6570 ) The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-6570 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 09 Oct 2014 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 01 Jul 15 read read Version 1 09 Oct 14 read read read Rebecca Schwab , University of Tübingen, Tübingen, Germany Patrick Masson , University of Wisconsin-Madison, Madison, USA Anthony A. Millar , Australian National University, Canberra, Australia Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Schwab R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 17 Aug 2015 | for Version 2 Rebecca Schwab , Center for Plant Molecular Biology, University of Tübingen, Tübingen, Germany 0 Views copyright © 2015 Schwab R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The newly added tables S2 and S3, which contain quantifications of Northern blot bands published in a different paper, are not sufficient to prove the validity of qACE - of accurately measuring changes in miRNA-cleaved mRNAs when using qACE. A direct comparison is needed from the same starting material (RNA or tissue). Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Schwab R. Peer Review Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r9272) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-9272 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Masson P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 06 Jul 2015 | for Version 2 Patrick Masson , Department of Genetics, University of Wisconsin-Madison, Madison, WI, USA 0 Views copyright © 2015 Masson P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The changes made to this manuscript improve its quality. However, the experiment added to independently validate the ability of qACE to quantitatively assess the levels of target cleavage by miRNA is not appropriate, involving a published experiment that analyzed distinct plant materials relative to this qACE analysis (Arabidopsis vs soybean). A true validation experiment should involve an alternative method such as Northern blot analysis to analyze the relative abundance of full length RNA and cleavage products within the same RNA preparations that were used to obtain the qACE data reported here. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Masson P. Peer Review Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.7228.r8361) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-240/v2#referee-response-8361 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Millar A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 12 May 2015 | for Version 1 Anthony A. Millar , Plant Science Division, Research School of Biology, Australian National University, Canberra, ACT, Australia 0 Views copyright © 2015 Millar A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Here, the authors describe an assay that quantifies miRNA-guided cleavage products. Then, by comparing to the mRNA levels of the corresponding non-cleaved target transcripts, a ratio is obtained that estimates the proportion of transcript present in the cell has been cleaved by the miRNA. They tested this in an overexpression line, a miRNA-deficient mutant, and in an example where an endogenous miRNA is expressed in a tissue specific manner. The discussion nicely points out the advantages and limitations of the approach. Although the assay represents a relatively straight forward modification of a widely used protocol, modifying it into a quantitative-PCR protocol may enable a number of interesting questions to be addressed. For example, it may give an insight into the efficiency of miRNA-mediated regulation, where it could determine if all equally predicted targets are cleaved as efficiently as one another. Minor comments The authors state in the abstract that qACE can “determine the extent of miRNA regulation for a specific target gene”. This method only measures transcript cleavage, but nothing can be inferred about any translational inhibition mechanism, which there is now very strong evidence that many (possibly most) miRNA-target interactions have a translational repression component to it. Maybe this should be mentioned somewhere in the manuscript as it has basically been ignored, and so this method can only measure the efficiency of cleavage but not the “extent of miRNA regulation”. Also in abstract the term “differential cleavage by miR164” makes it sound like the miRNA is cleaving differently in the different tissues, this may turn out to be the case in some examples, but here isn’t more likely due to the fact that miR164 is differentially expressed, having a higher abundance in root tissues compared to nodules? I would be careful with the use of that term. In the discussion; “we demonstrate that both NAC1 and CUC2 had similar levels of increase in hen1-1 , but different levels of reduction in miR164-directed cleavage.” Maybe the authors should be more careful with their claims, as qPCR measurements can vary, and the number of biological reps were not indicated, they did mention “replicate assays” but this seems something different, so how repeatable was this difference? Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Millar AA. Peer Review Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8620) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8620 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2015 Masson P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 27 Apr 2015 | for Version 1 Patrick Masson , Department of Genetics, University of Wisconsin-Madison, Madison, WI, USA 0 Views copyright © 2015 Masson P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This paper describes a method that allows quantification of miRNA-directed cleavage of specific target RNAs in plant tissues. Method validation includes an analysis of target cleavage in miRNA over-expressing tissues and in miRNA-deficient samples ( hen1 mutant). Usefulness of the approach is illustrated by the identification of a role for miRNA-directed cleavage in the modulation of nodule-specific GmNAC1 -isoform expression in Glycine max . This quantitative protocol may reveal itself as very useful in experiments aimed at characterizing the role played by miRNAs in the regulation of target gene expression in plants and their contribution to growth, development and response to the environment. However, under its current form, this manuscript suffers from a lack of independent validation of its quantitative output. Such validation should involve a different approach aimed at quantifying the relative levels of miRNA, full-length and cleaved target transcripts in wild type, overexpressing and miRNA-deficient mutants. For instance, a Northern blot analysis of wild-type, miR164-over-expressing and hen1 plant tissues could be carried out to evaluate relative levels of miR164 as well as full-length AtNAC1 and its miR164-induced cleavage product, and the results compared to those obtained through the qRT-PCR and qAce approaches described in this manuscript. Indeed, we know from the publication by Guo et al. (2005) (referenced in this manuscript) that these various RNAs can be identified and quantified by Northern blot analysis Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Masson P. Peer Review Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r8479) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-8479 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2014 Schwab R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 19 Nov 2014 | for Version 1 Rebecca Schwab , Center for Plant Molecular Biology, University of Tübingen, Tübingen, Germany 0 Views copyright © 2014 Schwab R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Technical comments: The ‘proof’ that the method can reliably quantify miRNA target cleavage products is based on inferences from previous reports - that increased cleavage is expected when the corresponding miRNA is over-expressed, and that reduced cleavage is to be seen in miRNA biosynthetic mutants such as hen1 . An adequate validation should however include an independent methodology, such as regular northern blots for miRNA targets. This is easily done when choosing targets that are reasonably stable. Quantification of the resulting bands (full length and cleaved) will serve as an independent proof of concept. It would be helpful to add a couple of words during the results section about the design of qACE primers and to what extent they require optimisation (overlap adapter/target). Sort of a guideline. Also, the RCT value should be explained a bit better during the results section. Stability of miRNA target cleavage products is an issue - sometimes they are easily detected, sometimes they are not. This is mentioned in the discussion, but should come up before as it is a major point of consideration for the design of the experiments. Materials and Methods: What tissues were used for RT experiments? Which primers were used to over-express miR164 in soybean? Other: I somewhat disagree with the statement ‘…quantification of the extent of regulation of specific target genes by miRNA is crucial for proper understanding of their biological roles.’ To investigate the biological roles of miRNAs, quantifying (and spatially/temporally visualising) target protein levels is very important. Quantifying the extent of miRNA-directed cleavage contributing to target protein levels are however very interesting for mechanistic studies of miRNA-mediated gene regulation. Sentences are sometimes phrased very generally. Since miRNA-directed cleavage is not a main issue in animals, ‘plants’ can come up already in the beginning of sentences. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Schwab R. Peer Review Report For: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage [version 2; peer review: 3 approved with reservations] . F1000Research 2015, 3 :240 ( https://doi.org/10.5256/f1000research.5613.r6570) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/3-240/v1#referee-response-6570 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Click here to access the data. The problem Spreadsheet data files may not format correctly if your computer is using different default delimiters (symbols used to separate values into separate cells) - a spreadsheet created in one region is sometimes misinterpreted by computers in other regions. You can change the regional settings on your computer so that the spreadsheet can be interpreted correctly. How to fix it Save downloaded CSV file Open spreadsheet program (e.g. Excel) Click the ‘Data’ tab at the top Click the ‘From text’ icon (top left) Browse for downloaded CSV file, click ‘Import’ Ensure ‘Delimited’ radio button is selected, click ‘Next’ Check one of the appropriate delimiter checkboxes (you can visualize the formatting by looking at the data preview below these options) Click ‘Finish’ Downloaded data do not display as expected? Download the data Dataset citation: Damodaran S, Adhikari S, Turner M and Subramanian S. Dataset 1 in: Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed target cleavage. F1000Research 2015, 3 :240 (https://doi.org/10.5256/f1000research.5266.d36383) Close Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Quantitative Amplification of Cleaved Ends...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/3-240/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/3-240/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/3-240/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Damodaran S et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/3-240/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/3-240", templates : { twitter : "Quantitative Amplification of Cleaved Ends (qACE) to assay miRNA-directed.... Damodaran S et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/3-240/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/5266/7228") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "7228"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "7556": 0, "7501": 0, "8078": 0, "7502": 0, "8079": 0, "7503": 0, "8144": 0, "8145": 0, "8146": 0, "8147": 0, "8148": 0, "7702": 0, "7703": 0, "7704": 0, "7705": 0, "8479": 19, "6880": 0, "8161": 0, "6881": 0, "8162": 0, "8360": 0, "8361": 23, "6569": 0, "8362": 0, "6570": 56, "8363": 0, "6380": 0, "8620": 24, "8173": 0, "6381": 0, "6382": 0, "6383": 0, "6384": 0, "7281": 0, "6643": 0, "6644": 0, "6645": 0, "6646": 0, "9271": 0, "9272": 16, "9273": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "3a3e6d14-e54f-4757-8efd-7701fdf715bf"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0