Improvement of antagonistic activity against Streptococcus agalactiae using recombinant Bacillus subtilis expressing L-gulonolactone oxidase: its effects on growth performance, immune response, and antioxidant activity in Nile tilapia, Oreochromis niloticus

Improvement of antagonistic activity against Streptococcus agalactiae using recombinant Bacillus subtilis expressing L-gulonolactone oxidase: its effects on growth performance, immune response, and antioxidant activity in Nile tilapia, Oreochromis niloticus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improvement of antagonistic activity against Streptococcus agalactiae using recombinant Bacillus subtilis expressing L-gulonolactone oxidase: its effects on growth performance, immune response, and antioxidant activity in Nile tilapia, Oreochromis niloticus Jirawadee Kaewda, Surintorn Boonanuntanasarn, Pimpisut Manassila, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3997297/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Due to the lack of the L-gulonolactone oxidase ( GULO ) enzyme, Nile tilapia is unable to synthesize vitamin C and thus requires an adequate level of exogenous vitamin C in its diet. In our previous study, we isolated the probiotic Bacillus subtilis from the intestine of Nile tilapia. Our findings revealed its antagonistic activity against major pathogenic bacteria in Nile tilapia, as well as its ability to enhance the immune responses of the fish. In addition, B. subtilis is an ideal bacterial factory to produce heterologous proteins. Therefore, this study aimed to construct a recombinant probiotic B. subtilis expressing GULO and investigated its effects as a dietary supplement in Nile tilapia. The fish were divided into four groups: those fed with a basal diet (CON), a basal diet + vitamin C (VC), a basal diet + wild-type B. subtilis (BS), and a basal diet + recombinant B. subtilis (BS + GULO). At day 90 of the feeding trial, significant enhancements in growth performance, immune response, and antioxidant capacity were observed in fish fed with BS + GULO. The HPLC analysis and qRT-PCR revealed a significant increase in serum ascorbic acid and GULO mRNA levels in the intestine of the BS + GULO group, respectively. In the challenge test, a time-course experiment demonstrated a significant increase in the expression of pro-inflammatory genes and immune response against S. agalactiae in the BS + GULO group, indicating an improvement in antagonistic activity compared to the wild-type B. subtilis . L-gulonolactone oxidase Bacillus subtilis antagonistic activity Nile tilapia Streptococcus agalactiae Antioxidant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Over the past decades, the production of Nile tilapia has steadily shifted towards intensive culture systems. However, the advancement of intensive culture has led to the deterioration of water quality, which facilitates the proliferation of pathogens in aquatic environments. In such situations, coupled with the impact of climate change, fish are more susceptible to stress, leading to impaired growth performance and a weakened immune system. To address this issue, fish farmers have prioritized fish health maintenance through the implementation of effective management practices, supplying high-quality nutritional feed, and administering immunostimulants. Among the immunostimulant agents, probiotics B. subtilis and vitamin C have become a field of interest for researchers to apply in intensive culture systems. The probiotic B. subtilis is considered one of the most commonly used dietary supplements in various fish species, owing to its ability to exert numerous positive effects on the gut microbiota, growth performance, disease resistance, health status of aquatic animals, and water quality [ 1 – 3 ]. In addition, it is generally recognized as safe (GRAS) and well-known as an ideal bacterial factory for producing heterologous proteins [ 4 – 5 ]. In modern fish farming, vitamin C has emerged as a crucial exogenous micronutrient element and immunostimulant supplemented in aquafeed. This is due to the frequent inadequacy of its natural quantities to sustain normal body functions in fish, particularly under high stocking density conditions. Since vitamin C's pivotal function as an enzyme cofactor, it has a crucial part in facilitating many physiological processes that involve biosynthesis, protein metabolism [ 6 ], iron metabolism [ 7 ], lipid metabolism [ 8 ], immune response [ 9 ], stress [ 10 ], and physiological antioxidant activity [ 11 – 12 ]. In fish, vitamin C deficiency results in various adverse consequences, including impaired growth performance and survival rate, increased susceptibility to stress, depressed immune status, reduced reproductive performance, skeletal alterations, impaired collagen formation, slow wound healing, and anemia [ 13 – 16 ]. On the other hand, the adequate intake of vitamin C has been widely shown to have beneficial effects on the growth and health of fish. For example, dietary supplementation with the optimal level of vitamin C markedly improved growth performance [ 16 – 18 ], as well as serum antioxidant activities [ 16 ]. It also enhanced several immune responses, including phagocytic activity, phagocytic index, alternative complement activity, and lysozyme activity [ 17 , 19 , 20 ]. In addition, dietary vitamin C increment has also been proven to enhance the proliferation of spermatogonia, and hematocrit value in Japanese eel broodstock ( Anguilla japonica ) [ 21 ]. In aquaculture conditions, vitamin C is naturally derived from plants found in aquatic environments. However, in intensive commercial operations, natural plant-based food sources are usually inadequate to meet the demand for fish. Moreover, more advanced teleosts, including Nile tilapia, are incapable of synthesizing vitamin C de novo due to a lack/mutation of the L-gulonolactone oxidase ( GULO ) which is an enzyme necessary for the last step of ascorbic acid biosynthesis [ 22 ]. In contrast, amphibians, reptiles, certain mammals, birds, chickens, primitive lobe-finned fish, certain cartilaginous fish species, and almost all plants possess the ability to synthesize vitamin C due to the presence of the functional GULO gene [ 23 – 25 ]. For this reason, more advanced teleost species must obtain vitamin C through dietary supplementation to ensure their optimum growth and health, especially in intensive culture conditions where limited natural foods are available [ 26 ]. Unfortunately, the stability of vitamin C as a dietary component often makes it inadequate at useful levels for aquatic animals due to its rapid oxidation. The loss of vitamin C is accelerated in inappropriate environmental conditions during the commercial manufacturing process of aquafeed, storage, handling, and feeding conditions. The rate of loss depends on various factors, including temperature, oxygen, UV irradiation, light, pH levels, and the presence of transition metal ions [ 27 – 28 ]. To overcome these roadblocks, various approaches have emerged to ensure that animals receive a sufficient amount of vitamin C and to enhance the stability and bioavailability of vitamin C. It includes the shielding of vitamin C through encapsulation [ 29 ], the development of chemical vitamin C derivatives [ 30 ], genomic integration of L-gulonolactone oxidase [ 24 , 31 ], utilization of exogenous 2-keto-L-gulonic acid supplementation [ 32 ], and so on. In this study, we aimed to construct a recombinant probiotic B. subtilis expressing GULO from the red junglefowl ( G. gallus ) to reestablish the ascorbic acid pathway in Nile tilapia and evaluate its potential as a dietary supplement for Nile tilapia. Since the ascorbate biosynthesis pathway, starting with D-glucose-1-phosphate as the initial precursor and progressing until L-gulonate, is conserved in all animal species [ 33 ], it may be possible to reestablish this pathway by integrating the GULO gene into probiotic B. subtilis using recombinant probiotic technology. In addition, our previous study revealed the beneficial effects of B. subtilis isolated from the intestine of Nile tilapia, including, antagonistic activity, bile salts and pH tolerance, protease-producing capacity, antibiotic susceptibility, and pathogenicity tests [ 34 ]. Therefore, the application of recombinant probiotic B. subtilis expressing GULO may provide a possible alternative option to achieve the combined effect of probiotic B. subtilis and vitamin C supplementation. Materials and Methods Construction of recombinant probiotic B. subtilis expressing GULO Primer design, RNA isolation, and cDNA synthesis Specific primers were deliberately designed to amplify the full-length GULO cDNA of G. gallus (accession no. XM_015285218) published on the GenBank database ( http://www.ncbi.nlm.nih.gov ). The forward primer (H-B- GULO F) containing Hind III and Bam HI restriction site was designed from the start codon (ATG), while the reverse primer (H-X- GULO R) was designed prior to the stop codon followed by Xho I and Hind III, respectively. Total RNA was extracted from the kidney of G. gallus using the TRlzol reagent (Gibco BRL, Gaithersburg, MD, USA) in accordance with the manufacturer's instructions in order to amplify full-length GULO cDNA. Briefly, 100 mg of the kidney was homogenized using mini-beadbeater-16 (Thermo Fisher Scientific, Waltham, MA, USA) and was subsequently extracted using the conventional phenol-chloroform method with some modifications. To eliminate genomic DNA, the dissolved total RNA was treated with RQ1 RNase-Free DNase (Promega Corporation, Madison, WI, USA). The three intact bands of RNA were visualized on agarose gel electrophoresis stained with SafeRed nucleic acid staining solution (Vivantis Technologies Sdn Bhd., Selangor, Malaysia). The Nanodrop 2000™ spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the quantity and quality of RNA. After that, first-strand cDNA was synthesized using the ImProm-II™ Reverse Transcription System kit (Promega Corporation, Madison, WI, USA) and kept at -20°C in a freezer until used. Cloning of the full-length GULO cDNA of G. gallus into pGEM®T-Easy To construct recombinant B. subtilis expressing GULO , the full-length GULO cDNA was amplified using gene-specific primers as described in 2.1.1 (Table 1 ). The PCR condition was performed as follows: at 95°C for 3 min, then 40 cycles at 95°C for 30 s, 59.9°C for 30 s, 72°C for 3 min, followed by at 72°C for 5 min. The PCR product was purified using FavorPrep™ GEL/PCR Purification Kit (Farvogen® Biotech Corp, Ping Tung, Taiwan) and subsequently sequenced using Macrogen sequencing service (Macrogen Inc., Seoul, South Korea) with forward (H-B- GULO F) and reverse (H-X- GULO R) primers to confirm nucleotide and amino acid sequences accuracy of the PCR product. After that, the purified PCR was ligated into a pGEM®T-Easy plasmid (Promega Corporation, Madison, WI, USA) under the conditions described in the manufacturer's protocol. Finally, the ligation product was transformed into100 µl of E. coli DH5α competent cells using the heat shock method, and the transformed bacteria containing plasmid DNA exhibiting white color colonies were selected for the further steps which consisted of colony PCR screening, the restriction enzymes ( Hind III, Bam HI), and confirmed the appearance of insert DNA by sequencing (Macrogen, Korea). Table 1 The list of oligonucleotide sequences used in this study Primer name 5′ to 3′ Nucleotide Sequences Product size (bp) Annealing temperature (°C) Purposes H-B- GULO F AAGCTTGGATCCATGGTTCACGGCCAAGGAGG 1,323 55 Cloning H-X- GULO R AAGCTTCTCGAGGTAGAACACCTTTTCCAGAT Cloning GULO -qPCRF ACAGGGACGCACAACACTGG 172 59 qRT-PCR GULO -qPCRR TGACGGTGAGCACAACACCC qRT-PCR β-actinF ACAGGATGCAGAAGGAGATCACAG 155 55 qRT-PCR β-actinR GTACTCCTGCTTGCTGATCCACAT qRT-PCR On CC-F ACAGAGCCGATCTTGGGTTACTTG 229 55 qRT-PCR On CC-R TGAAGGAGAGGCGGTGGATGTTAT qRT-PCR On TNF-αF GAGGCCAATAAAATCATCATCCC 161 55 qRT-PCR On TNF-αR CTTCCCATAGACTCTGAGTAGCG qRT-PCR Table 2 Growth performance of Nile tilapia fed experimental diets for 30- and 90-days post-feeding Diet Initial weight Final weight Initial length Final length Weight gain FCR ADG SGR RGR PER (g) (g) (cm) (cm) (g) (g day − 1 ) (% day − 1 ) 30 days CON 75.11 ± 5.81 141.47 ± 13.78 15.97 ± 0.58 19.40 ± 0.51 66.36 ± 8.78 1.52 ± 0.06 2.21 ± 0.29 0.91 ± 0.06 88.23 ± 7.43 2.14 ± 0.07 a VC 73.16 ± 2.39 138.80 ± 6.24 15.71 ± 0.19 19.19 ± 0.25 65.64 ± 4.90 1.55 ± 0.02 2.19 ± 0.16 0.93 ± 0.05 89.74 ± 6.13 2.15 ± 0.02 a BS 80.18 ± 1.34 151.29 ± 10.30 16.30 ± 0.13 19.73 ± 0.46 71.11 ± 10.24 1.44 ± 0.07 2.57 ± 0.07 0.97 ± 0.04 95.94 ± 4.78 2.32 ± 0.12 b BS + GULO 78.56 ± 3.50 158.64 ± 3.55 16.21 ± 0.45 19.99 ± 0.09 80.09 ± 0.50 1.41 ± 0.01 2.67 ± 0.02 1.02 ± 0.03 102.09 ± 4.56 2.37 ± 0.02 b 90 days CON 75.11 ± 5.81 268.75 ± 7.19 a 15.97 ± 0.58 25.15 ± 1.74 195.72 ± 0.73 a 1.60 ± 0.07 b 2.17 ± 0.01 a 0.63 ± 0.03 a 268.99 ± 22.79 a 2.23 ± 0.09 VC 73.16 ± 2.39 312.17 ± 13.12 b 15.71 ± 0.19 25.83 ± 0.35 237.73 ± 14.47 b 1.52 ± 0.09 ab 2.64 ± 0.16 b 0.69 ± 0.03 a 319.60 ± 24.91 a 2.20 ± 0.13 BS 80.18 ± 1.34 327.06 ± 12.45 b 16.30 ± 0.13 25.94 ± 0.49 246.88 ± 12.08 b 1.54 ± 0.03 ab 2.74 ± 0.13 b 0.68 ± 0.02 a 307.93 ± 14.78 a 2.17 ± 0.05 BS + GULO 78.56 ± 3.50 381.25 ± 8.13 c 16.21 ± 0.45 27.46 ± 0.41 302.75 ± 3.18 c 1.42 ± 0.00 a 3.36 ± 0.04 c 0.76 ± 0.02 b 386.31 ± 20.30 b 2.34 ± 0.00 Means with a different superscript in each column differed significantly from each other ( P < 0.05). Values are means ± SD of ten replicates. Transformation of GULO plasmid into probiotic B. subtilis by electroporation The positive GULO plasmid from 2.1.2 and pBES expression vector (Takara Bio USA, Inc., San Jose, CA, USA) were double-digested with Hind III and Bam HI and purified before ligation. The ligation reaction was then transformed into E. coli DH5α competent cells and confirmed the accuracy of nucleotide and amino acid sequence by sequencing. The electroporation method was used to transform the pBES GULO plasmid into probiotic B. subtilis competent cells which were prepared following the method of Xue et al. [ 35 ] with minor modifications. To identify the positive clones, the transformants were spread onto an LB plate with 100 µg/mL of kanamycin and incubated for 16–18 h at 37°C, and the apparent clones were proved by colony PCR, double restriction enzyme digestion, and sequencing to confirm nucleotide and amino acid sequence accuracy. Western blotting analysis Prior to commencing the feeding experiment, the presence of secreted GULO produced from probiotic B. subtilis was confirmed through the western blot method as within the method of our previous study [ 34 ]. Ethics statement All animal experiments were conducted in compliance with the regulations approved by the Ethics Committee of Suranaree University of Technology (SUT), Animal Care and Use Committee (approval no.SUT-IACUC-0012/2023). The effect of dietary recombinant probiotic B. subtilis expressing GULO supplementation in normal fish Experimental design This experiment was assigned to four groups, each with three replication tanks, and ten individual fish, using a completely randomized design. A total of 120 healthy Nile tilapia were divided into twelve 700-liter fiber tanks containing clean freshwater with an aeration system. After a 2-week acclimatization period, the fish were fed ad libitum twice daily with the following 4 experimental diets, including a basal diet (CON), a basal diet supplemented with vitamin C (VC), a basal diet supplemented with wild-type B. subtilis (BS), and a basal diet supplemented with recombinant B. subtilis expressing GULO (BS + GULO). Diet preparation Before commencing this experiment, both wild-type isolated B. subtilis and the recombinant probiotic B. subtilis expressing GULO were proliferated, aliquoted, and stored in glycerol stocks at -80 ℃ until use. For the preparation of each experimental diet, aliquots of wild-type isolated B. subtilis and probiotic B. subtilis expression GULO were separately inoculated into LB broth and LB broth containing kanamycin, respectively. The inoculated cultures were then incubated in an incubator shaker at 37°C for 18–24 h. After harvesting each bacterial suspension by centrifugation at 5000 xg for 5 min, the bacterial pellets were washed twice with sterile 0.85% NaCl and then resuspended in the same solution to adjust the concentration to 1x10 8 colony-forming units (CFU/ml) before being mixed with a commercial diet. Growth performance The individual body weight and length of fish from each tank were measured at 0, 30, and 90 days to calculate the growth performance indices, including weight gain (WG), specific growth rate (SGR), average daily gain (ADG), and feed conversion ratio (FCR), protein efficiency ratio (PER), and relative growth rate (RGR). Determination of ascorbic acid in Nile tilapia serum using HPLC analysis To analyze the concentration of ascorbic acid in experimental fish, the serum was collected from the experimental fish at the end of the feeding trial. The HP 1100 series reversed-phase high-performance liquid chromatography (HPLC) system (Agilent Technologies, Waldbronn, Germany) with C18 HPLC column, 5 µm, 250 x 4.0 mm was performed in this experiment according to the method described by Pitaksong et al. [ 36 ]. The high-purity grade of ascorbic acid (Sigma, St Louis, MO, USA) was used as the reference standard for quantifying ascorbic acid in fish serum. Each experimental group was conducted in triplicate. Immune parameters At 30 and 90 days of the trial, serum LZM activity [ 37 ], serum total Ig concentration [ 34 ], and serum ACH50 activity [ 38 ] were performed in a slightly modified manner. The optical density of each sample was measured using an absorbance microplate reader Epoch BioTek instruments (Agilent Technologies, CA, USA). In addition, at 90 days of the trial, the phagocytic activity of peripheral blood leukocytes (PBLs) was determined by appropriately modifying the methods described by Puangkaew et al. [ 39 ]. Serum antioxidant enzyme activities The activity of catalase (CAT), total antioxidant capacity (TAC), superoxide dismutase (SOD), Glutathione Peroxidase (GSH-Px), malondialdehyde (MDA) in the serum of the experimental fish at 90 days of the trial were measured using a commercial kit (Abbkine Corporation, Georgia, USA) according to the manufacturer’s recommended protocol. Expression of GULO mRNA in normal fish by qRT-PCR To construct cDNA plasmid standards for qRT-PCR, cloning of each target gene of interest was performed to evaluate the mRNA expression level of Nile tilapia at the end of the feeding trial. The primer sets for qRT-PCR analysis used in this study are shown in Table 1 . PCR products of the expected size were purified using a FavorPrep GEL/PCR Purification Kit according to the manufacturer’s instructions. The purified DNA was cloned into pGEM® T-Easy plasmid and the positive clones were screened as described in 2.1.2. Finally, the selected plasmids were sequenced by Macrogen, Inc. (Seoul, Korea) and stored at -20°C for use as a standard for qRT-PCR. One microliter of first-strand cDNAs was subjected to qPCR analysis (in triplicate) using the CFX Opus Real-Time PCR System machine (Bio-Rad, Hercules, CA, USA). Each reaction was performed in a final volume of 10 µl containing 1 µl cDNA, 5 µl thunderbird SYBR® qPCR master mix (TOYOBO, Osaka, Japan), 2 µl dH 2 O, and 1 µl each specific primer as shown in Table 1 . The PCR conditions were performed at 95°C for 3 min, followed by 40 cycles of 95°C for 30 s and 55–59°C for 30 s. DNA melting curve analysis was used to verify the specificity of the primers. The internal reference for data normalization was the β-actin mRNA. The effect of dietary supplementation with probiotic B. subtilis expression GULO after a challenge with S. agalactiae in Nile tilapia Experimental design To determine the immune response of Nile tilapia following injection with S. agalactiae , a total of 60 fish were used in this experiment after one month of the feeding trial. The fish were distributed into twelve 500 L fiber tanks, with three replication tanks per diet group, each containing five individual fish. Preparation of S. agalactiae and challenge test The virulent strain of S. agalactiae was used in the challenge experiment after the feeding trial for 30 days. The single colony of S. agalactiae was inoculated in tryptic soy broth (Merck KGaA, Darmstadt, Germany) at 37°C for 16–18 h with shaking. The concentration of S. agalactiae was adjusted to 1×10 8 CFU/ml with an optical density at 600 nm of 1.0. The experimental fish were intraperitoneally injected (i.p.) with a 1×10 8 CFU/mL suspension of live S. agalactiae , in a volume of 0.1 ml per 100 g of fish body weight. Immune parameters and expression of pro-inflammation genes in challenged fish After the challenge, the liver, spleen, and serum of injected fish were collected at 0 h, 6 h, 12 h, 24 h, and 48 h. The serum samples were then analyzed for immune parameters (LZM, total Ig, and ACH50), as well as pro-inflammatory gene expressions (CC chemokine and tumor necrosis factor alpha (TNFα)) in the liver and spleen of challenged fish, as described above. Statistical analysis The statistical analyses using the SPSS software ver.25 (SPSS Inc., Chicago, IL, USA). The data was analyzed using a one-way analysis of variance followed by the post hoc Tukey’s test to assess the significance of differences between the groups. A paired-sample T-test was conducted to evaluate the difference between 30 and 90 days after the feeding trial within immune parameters and the expression of GULO mRNA. The difference between groups in comparative experiments was determined by statistical significance at P < 0.05. Results Construction of recombinant B. subtilis expressing GULO and Western blot analysis To determine the accuracy of the nucleotide sequence and the correct in-frame insertion, the sequence of GULO gene was confirmed by sequencing. The result demonstrated that the full-length cDNA encoding the GULO gene of G. gallus comprised 1,323 bp open reading frame (ORF) and the predicted amino acid sequence of GULO contained 440 amino acid residues (Online Resource 1). In addition, the double restriction enzyme ( Bam HI and Hind III) could identify the insertion of the GULO gene into cloning and expression vectors (Online Resource 2). Before the initiation of the feeding trial, the presence of the GULO produced by probiotic B. subtilis was confirmed through Western blot analysis, revealing its molecular weight (Mw) to be approximately 50 kDa (Online Resource 3). Growth performance The results of growth performance in Nile tilapia fed with experimental diets are presented in Table 2. At day 30 of the feeding trial, there were no significant differences in growth performance parameters among the experimental diets, except for the PER in BS and BS + GULO groups. The results showed that the PER of these groups was significantly increased ( P < 0.05) when compared with the VC and CON groups. Interestingly, at day 90 of the feeding trial, the BS + GULO group exhibited the highest positive effect on FW, WG, FCR, ADG, SGR, and RGR in comparison to the other groups, whereas supplementation with vitamin C and wild-type B. subtilis improved only FW, WG, and ADG ( P < 0.05). Determination of ascorbic acid in Nile tilapia serum using HPLC analysis Following a 90-day feeding trial, the assessment of ascorbic acid levels in the serum of Nile tilapia was performed using HPLC analysis. The findings indicated a significant elevation in the serum ascorbic acid levels in the BS + GULO group compared to the CON group. However, these levels were also lower than those observed in the VC group (Table 3 ). Table 3 Accumulation of serum ascorbic acid in Nile tilapia fed with experimental diets for 90 days Diet Ascorbic acid level (µg mL − 1 ) CON 5.88 ± 1.21 a VC 20.29 ± 2.91 c BS + GULO 10.43 ± 1.20 b Significant differences among diet groups are denoted by different letters ( P < 0.05). Values are means ± SD of three replicates. Expression of GULO mRNA in normal fish by qRT-PCR To provide supporting evidence regarding the existence of GULO in Nile tilapia, qRT-PCR was carried out to quantify GULO mRNA expression in the intestines of the experimental fish at days 30 and 90 of the feeding trial. The GULO mRNA expression level was detected only in the BS + GULO group at both time points. Moreover, on day 90, the expression level of GULO mRNA exhibited a significant increase compared to day 30, as shown in Fig. 1 . Immune responses At day 30, the VC and BS + GULO groups showed a significant increase in ACH50 levels compared to the BS and CON groups, respectively. The BS + GULO group exhibited the highest significant increase in ACH50 levels on day 90 of the feeding trial. Interestingly, only the BS and BS + GULO groups demonstrated a significant increase in ACH50 levels between days 30 and 90 (Fig. 2 A). Regarding total Ig level, the results showed no significant difference in total Ig levels among the experimental groups on day 30 of the feeding trial. However, on day 90, the VC, BS, and BS + GULO groups exhibited a significant increase in total Ig levels compared to the control group. Moreover, the VC and BS + GULO groups exhibited a significant increase in total Ig levels between days 30 and 90 (Fig. 2 B). In terms of lysozyme activity, the VC, BS, and BS + GULO groups exhibited a significant increase on days 30 and 90 compared to the control group. Additionally, there was a significant increase in lysozyme activity observed among the vit C, BS, and BS + GULO groups between days 30 and 90 (Fig. 2 C). Finally, the VC and BS + GULO groups exhibited a significant increase in phagocytic activity compared to the BS and CON groups, respectively (Fig. 2 D). Antioxidant enzyme parameters in Nile tilapia serum At the end of the 90-day feeding trial, a significant increase in serum levels of SOD, CAT, TAC, and GSH-Px, along with a decrease in MDA levels, was observed in the VC and BS + GULO groups compared to the BS and CON groups, respectively (Table 4 ). Table 4 Antioxidant parameters of Nile tilapia fed experimental diets for 90 days Diet TAC SOD MDA GSH-Px CAT µmol mL − 1 U mL − 1 nmol mL − 1 U mL − 1 nmol min − 1 mL − 1 CON 28.16 ± 0.91 a 3.32 ± 0.10 a 0.36 ± 0.006 c 0.068 ± 0.001 a 10.39 ± 0.83 a VC 38.85 ± 1.32 b 4.34 ± 0.34 b 0.23 ± 0.025 a 0.121 ± 0.013 b 31.27 ± 2.59 c BS 32.03 ± 1.02 ab 4.04 ± 0.12 ab 0.31 ± 0.002 b 0.088 ± 0.007 ab 17.29 ± 1.32 ab BS + GULO 36.01 ± 1.78 b 4.69 ± 0.32 b 0.28 ± 0.006 b 0.117 ± 0.016 b 20.34 ± 4.16 b Means with a different superscript in each column differed significantly from each other ( P < 0.05). Values are means ± SD of three replicates. Immune parameter after S. agalactiae injection After the challenge test, a rapid upregulation of ACH50 and lysozyme activity was observed at 6 h post-injection in the VC, BS, and BS + GULO groups (Fig. 3 A, 3 C). In the case of total Ig, a significant increase was observed at 24 and 48 h post-injection, but only in the VC and BS + GULO groups compared to the control group (Fig. 3 B). Pro-inflammatory gene expressions after S. agalactiae injection After the challenge test, compared to the control group, the VC, BS, and BS + GULO groups displayed a significant up-regulation in mRNA levels of CC chemokine at 6 h in the liver and spleen of infected fish in response to S. agalactiae . Furthermore, CC chemokine mRNAs of the BS + GULO group exhibited peak expression at 12 h in both the liver and spleen. Subsequently, the expression level of CC chemokine declined to baseline at 48 h in both tested tissues among all experimental diet groups (Fig. 5 ). In the case of TNFα, mRNA upregulation was initially observed 6 h after intraperitoneal injection of S. agalactiae . Significant increases in TNFα mRNA levels were observed in the spleen at 12 h post-injection in the BS + GULO group compared to the control group. Meanwhile, in the liver, TNFα mRNA levels gradually increased at 6 h post-injection in the VC, BS, and BS + GULO groups compared to the control group. Moreover, this upregulation continued persistently until 48 h post-injection (Fig. 6). Discussion Advances in biotechnology have generated novel approaches to alleviate the vulnerability associated with the application of dietary vitamin C supplementation in aquaculture [ 24 , 40 – 43 ]. In this study, a recombinant probiotic B. subtilis expressing GULO was successfully constructed and applied as a dietary supplement for Nile tilapia. To evaluate its potential as a growth promoter and immunostimulant, the expression of L-gulonolactone oxidase produced by probiotic B. subtilis was validated through Western blot analysis before being applied as a dietary supplement. According to the results of this study, the group of fish fed with recombinant probiotic B. subtilis expressing GULO demonstrated superior overall growth performance and feed utilization compared to the other groups. After 30 days of the feeding trial, the fish fed a diet supplemented with either wild type or recombinant probiotic B. subtilis expressing GULO showed a significantly improved PER, correlating with an increase in fish weight gain. The significant difference may be due to the presence of the protease-producing capacity of isolated B. subtilis to enhance the digestibility of protein content as reported in our previous study [ 34 ]. However, no significant differences appeared in other growth parameters. Interestingly, after 90 days of the feeding trial, the fish that exhibited the most notable overall growth performances were those fed a diet supplemented with recombinant B. subtilis expressing GULO . This phenomenon may be attributed to the incorporation function of probiotics and vitamin C in enhancing the digestibility and absorption of nutrients within the fish's body. Numerous studies have reported that dietary supplementation with B. subtilis can enhance intestinal digestive enzyme activities, thereby leading to an improvement in the growth performance of the fish [ 6 , 44 ]. Meanwhile, several pieces of evidence have encouraged the positive impact of vitamin C on nutrient utilization within metabolic processes and protein synthesis, resulting in a beneficial influence on the growth performance of aquatic animals [ 45 ]. Nevertheless, the effect of dietary supplementation with vitamin C can vary based on fish species, age, size, the form of vitamin C, differences in experimental conditions, as well as the health status and stress levels of the fish [ 25 , 46 ]. In this study, HPLC analysis was conducted to validate and confirm the role of L-gulonolactone oxidase, produced by probiotic B. subtilis , in the biosynthesis of ascorbic acid. This was supported by the significant increase in ascorbic acid levels observed in the serum of fish-fed recombinant B. subtilis expressing GULO for 90 days compared to the control group. The increase in serum ascorbic acid levels in fish-fed recombinant B. subtilis expressing GULO corresponded to their growth performance results, which exhibited the highest positive effect on growth performance parameters compared to the other groups. This result aligns with several previous studies that have documented the advantageous effects of using both B. subtilis and vitamin C as supplements in aquafeed, aiming to improve the overall growth of fish [ 7, 16, 44, 47–49]. Beyond their role in enhancing growth performance, both vitamin C and probiotics are recognized as powerful immunomodulators that elicit immune responses in fish. In this study, normal fish fed with vitamin C, recombinant B. subtilis expressing GULO , and wild-type probiotic B. subtilis exhibited an increase in ACH50 activity, LZM activity, total Ig level, and phagocytic activity compared to the control group. According to our previous study [ 34 ], the probiotic B. subtilis isolated from the intestine of Nile tilapia demonstrates substantial tolerance to the hostile environment of the gastrointestinal (GI) tract, thus increasing its chances of survival and colonization on the internal surfaces of the GI tract. Like other probiotics, the presence of probiotic B. subtilis in the GI tract could activate the immune system of Nile tilapia through signaling by toll-like receptors (TLRs) on intestinal epithelial cells and antigen-presenting cells (APCs) [ 50 ]. Meanwhile, the concentration of vitamin C in leukocytes and tissues has been reported to stimulate the activity of innate immune responses [ 51 ]. A significant difference in ACH50 levels between day 30 and day 90 of the feeding trial was observed only in the groups of fish-fed a diet supplemented with B. subtilis expressing GULO and the wild-type B. subtilis . This finding indicates that the continuous administration of B. subtilis could enhance the ACH50 activity of Nile tilapia, consistent with evidence from previous studies [ 2 – 3 ]. The continuous administration of probiotics has led to an increase in complement component 3 (C3) through the stimulation of cytokines following recognition by TLRs, as described above [ 52 , 53 ]. Moreover, C3 is a central component in three complement pathways (classical, alternative, and lectin pathway). It interacts with other proteins in the complement cascade to form the membrane attack complex (MAC), ultimately killing pathogens. In addition, previous studies have demonstrated that supplementing with an appropriate amount of vitamin C can enhance complement activity in fish [ 19 , 54 , 55 ]. The concentration of vitamin C in tissues has an impact on the ACH50 activity; however, the precise function of vitamin C in the complement pathways is not fully elucidated [ 47 ]. As a result, the highest ACH50 level was observed in the fish-fed recombinant probiotic B. subtilis expressing GULO on day 90. This finding confirms the synergistic roles of vitamin C and B. subtilis in this study. In addition, fish fed a diet supplemented with vitamin C, wild-type B. subtilis , and B. subtilis expressing GULO showed a significant increase in the total Ig level at day 90 compared to day 30 of the feeding trial. This result demonstrated the immunostimulatory function of vitamin C and probiotic B. subtilis to stimulate the total Ig in Nile tilapia which could enhance the adaptive immune response. In this study, the results of LZM activity also confirmed the vital role of probiotic B. subtilis and vitamin C in enhancing innate immunity through the mechanism of this enzyme. Similarly, several studies have stated that the supplementation with both vitamin C and probiotic B. subtilis in fish diets could stimulate LZM activity by activating myeloid cells (macrophages, monocytes, and neutrophils) [ 7 , 56 , 57 ]. In fish, LZM has emerged as a powerful innate defense that exerts antimicrobial activity directly against gram-positive bacteria or indirectly against gram-negative bacteria after disrupting the bacterial cell wall through the action of complement and other enzymes. In addition to the function described above, LZM and complement components (C1q, C3b, and Bb) also act as an innate opsonin that binds bacteria to accelerate and facilitate phagocytic activity in fish. This is evident in our phagocytic activity results, where fish fed with dietary supplementation of vitamin C and recombinant probiotic B. subtilis expressing GULO exhibited significantly higher phagocytic activity. In teleost, SOD, MDA, GSH-Px, and CAT are the main antioxidant enzymes that protect fish from oxidative stress damage caused by free radicals. In this study, dietary supplementation with vitamin C and recombinant B. subtilis expressing GULO exhibited higher contents of TAC, SOD, CAT, and GSH-Px, and lower levels of MDA in the serum of Nile tilapia compared to wild-type B. subtilis and control groups, respectively. Although dietary supplementation with wild-type probiotic B. subtilis tends to enhance the activity of these enzymes, there was no significant difference observed. Therefore, the increase in SOD, CAT, TAC, and GSH-Px levels, as well as the decrease in MDA levels in this study could primarily be attributed to the supplementation with vitamin C in the fish diet rather than resulting from probiotics. This result, indicating the enhancement of antioxidant enzymes, possibly occurs because of vitamin C's ability to readily donate electrons, aligning with previous findings in several teleost species [ 16 , 42 , 57 – 58 ]. In an intensive culture system, Nile tilapia frequently encounter periods of stress at any time of their lives. The stress condition can cause an imbalance between oxygen-reactive species (ROS) and endogenous antioxidants in cells and tissues, potentially leading to cell and tissue damage. Hence, the continuous supply of an exogenous antioxidant, such as vitamin C supplementation in fish diets, becomes necessary to counteract the adverse effects of oxidative stress. In Thailand, S. agalactiae has emerged as a major pathogenic bacterium, causing severe economic losses in tilapia farming [ 59 ]. To investigate the effect of dietary supplementation with recombinant probiotic B. subtilis expressing GULO on immune response following a challenge with S. agalactiae , Nile tilapia were intraperitoneally injected with this bacterium after a 30-day feeding trial. The results showed that ACH50 level rapidly increased at 6 h post-injection in fish-fed vitamin C, wild-type, and recombinant probiotics compared to the control group. Meanwhile, total Ig levels were subsequently elevated at 24 and 48 h post-injection in the same groups. The rapid increase in ACH50 indicated its ability to attenuate/limit the spread of invading pathogens, a consequence of activation by either wild-type or recombinant probiotic B. subtilis , as well as by vitamin C. The elevation of total Ig at 24 and 48 h post-injection could result from the opsonization facilitated by immune genes such as cytokines, phagocytes, and complement components, leading to the activation of the phase of adaptive immune responses. In the challenge test, LZM showed a significant elevation in levels starting at 6 h and continuing up to 48 h in fish fed with vitamin C, wild-type, and recombinant probiotics compared to the control group. These results reflect the enhanced ability of lysozyme, due to vitamin C and probiotic B. subtilis , to eliminate S. agalactiae in Nile tilapia. Our immune parameter results indicate that dietary supplementation with recombinant probiotic B. subtilis expressing GULO could effectively enhance the immune response against S. agalactiae infection in Nile tilapia. This enhancement is possibly due to the synergistic effects of vitamin C and probiotic B. subtilis on fish immunity. Probiotic B. subtilis is recognized for its role in regulating the fish gut's immune response, while vitamin C is notable for reinforcing the immune response and disease resistance, probably attributable to its antioxidant and immunostimulatory properties [ 60 – 61 ]. Under normal conditions, the continuous application of probiotic B. subtilis in fish feed influences the triggering of TLR4, serving as the pattern-recognition receptors that initiate the activation of the immune cascade. Additionally, dietary supplementation with vitamin C not only modulates the production of fish immune cells, contributing to maintaining immune homeostasis but also plays a role in disease resistance by activating the expression of inflammatory cytokines under stress conditions [ 62 ]. In the challenge test, mRNA levels of proinflammatory cytokines, including CC chemokine and TNFα, in response to S. agalactiae , were analyzed among the experimental fish after a 30-day feeding trial using qRT-PCR. The results indicated a significant and rapid increase in the expression of CC chemokine mRNAs at 6 h post S . agalactiae injection in the liver and spleen of fish supplemented with dietary vitamin C, wild-type, and recombinant probiotic B. subtilis expressing GULO , compared to the control group. Similarly, a significant up-regulation of TNFα mRNA levels was exhibited in the liver at 6 h and in the spleen at 12 h post S. agalactiae injection. These findings suggest that both vitamin C and probiotic B. subtilis may potentially contribute to enhancing the production and chemoattractant activity of CC chemokine and TNFα. This facilitates the recruitment of white blood cells to the site of infection during the initial stage. Furthermore, our previous in vitro study confirmed that the potential probiotic B. subtilis , isolated from the intestine of Nile tilapia, exhibited antibacterial activity and effectively antagonized pathogenic S. agalactiae . [ 34 ]. Together, these findings suggest that the improvement of antagonistic activity against S. agalactiae in recombinant B. subtilis may be attributed to the synergistic effect of B. subtilis and vitamin C, modulating innate and adaptive immunity in Nile tilapia. Conclusions In conclusion, based on the overall results, dietary supplementation with recombinant probiotic B. subtilis expressing GULO exhibited the synergistic effects of vitamin C and probiotic B. subtilis . These effects resulted in improvements in growth performance, antioxidant activity, immune response, and antagonistic activity by enhancing the immune response and pro-inflammatory cytokine against S. agalactiae in Nile tilapia. The application of probiotic B. subtilis expressing GULO could provide a possible novel prophylactic strategy for the intensive aquaculture industry, which often relies on the application of drugs and chemicals. Declarations Competing Interests We certify that there is no conflict of interest in the manuscript. Funding This work (Grant No. RGNS 64–117) was financially supported by Office of the Permanent Secretary, Ministry of Higher Education, Science, Research and Innovation. In addition, we also deeply appreciate Suranaree University of Technology (SUT). Author Contribution S.B. and C.N. Conceptualization and project administration, C.N. funding acquisition, C.N., J.K. and P.M. methodology, data curation, C.N. validation, S.B. supervision, J.K. and C.N. writing original draft, P.S. and C.N. writing review and editing. All authors have read and agreed to the published version of the manuscript. Data Availability The data presented in this study are available on request from the corresponding author. References Liu H, Wang S, Cai Y et al (2017) Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus . Fish Shellfish Immunol 60:326–333. https://doi.org/10.1016/j.fsi.2016.12.003 Liu C-H, Chiu C-H, Wang S-W, Cheng W (2012) Dietary administration of the probiotic, Bacillus subtilis E20, enhances the growth, innate immune responses, and disease resistance of the grouper, Epinephelus coioides . Fish Shellfish Immunol 33:699–706. https://doi.org/10.1016/j.fsi.2012.06.012 Aly SM, Ahmed YA-G, Ghareeb AA-A, Mohamed MF (2008) Studies on Bacillus subtilis and Lactobacillus acidophilus , as potential probiotics, on the immune response and resistance of Tilapia nilotica ( Oreochromis niloticus ) to challenge infections. Fish Shellfish Immunol 25:128–136. https://doi.org/10.1016/j.fsi.2008.03.013 Liu L, Liu Y, Shin H et al (2013) Developing Bacillus spp. as a cell factory for production of microbial enzymes and industrially important biochemicals in the context of systems and synthetic biology. Appl Microb Biotech 97:6113–6127. https://doi.org/10.1007/s00253-013-4960-4 Cui W, Han L, Suo F et al (2018) Exploitation of Bacillus subtilis as a robust workhorse for production of heterologous proteins and beyond. World J Microbiol Biotechnol 34:1–19. https://doi.org/10.1007/s11274-018-2531-7 Harsij M, Kanani HG, Adineh H (2020) Effects of antioxidant supplementation (nano–selenium, vitamin C and E) on growth performance, blood biochemistry, immune status and body composition of rainbow trout ( Oncorhynchus mykiss ) under sub-lethal ammonia exposure. Aquaculture 521:734942. https://doi.org/10.1016/j.aquaculture.2020.734942 Zafar N, Khan MA (2020) Effects of dietary iron on growth, haematology, oxidative stress and hepatic ascorbic acid concentration of stinging catfish Heteropneustes fossilis . Aquaculture 516:734642. https://doi.org/10.1016/j.aquaculture.2019.734642 John T, George J, Hilton J, Slinger S (1979) Influence of dietary ascorbic acid on plasma lipid levels in the rainbow trout. Int J Vitam Nutr Res 49:400–405 Barros MM, Falcon DR, de Oliveira Orsi R et al (2014) Non-specific immune parameters and physiological response of Nile tilapia fed β-glucan and vitamin C for different periods and submitted to stress and bacterial challenge. Fish Shellfish Immunol 39:188–195. https://doi.org/10.1016/j.fsi.2014.05.004 Caxico Vieira CAS, Vieira JS, Bastos MS et al (2018) Expression of genes related to antioxidant activity in Nile tilapia kept under salinity stress and fed diets containing different levels of vitamin C. J Toxicol Environ Health Part A 81:20–30. https://doi.org/10.1080/15287394.2017.14 01968 Gasco L, Gai F, Maricchiolo G et al (2018) Supplementation of vitamins, minerals, enzymes and antioxidants in fish feeds. Feeds Aquac Sect Curr Situat Altern Sources 63–103. https://doi.org/10.1007/978-3-319-77941-6_4 Gouda A, Amer SA, Gabr S, Tolba SA (2020) Effect of dietary supplemental ascorbic acid and folic acid on the growth performance, redox status, and immune status of broiler chickens under heat stress. Trop Anim Health Prod 52:2987–2996. https://doi.org/10.1007/s11250-020-02316-4 Jauncey K, Soliman A, Roberts R (1985) Ascorbic acid requirements in relation to wound healing in the cultured tilapia Oreochromis niloticus (Trewavas). Aquac Res 16:139–149. https://doi.org/10.1111/j.1365-2109.1985.tb00303.x Mæland A, Waagbø R (1998) Examination of the qualitative ability of some cold water marine teleosts to synthesise ascorbic acid. Comp Biochem Physiol Mol Integr Physiol 121:249–255. https://doi.org/10.1016/S1095-6433(98)10125-3 Zehra S, Khan S MA (2012) Dietary vitamin C requirement of fingerling, Cirrhinus mrigala (Hamilton), based on growth, feed conversion, protein retention, hematological indices, and liver vitamin C concentration. J World Aquac Soc 43:648–658. https://doi.org/10.1111/j.1749-7345.2012.00597.x Xu C, Yu H, Li L et al (2022) Effects of Dietary Vitamin C on the Growth Performance, Biochemical Parameters, and Antioxidant Activity of Coho Salmon Oncorhynchus kisutch (Walbaum, 1792) Postsmolts. Aquac Nutr 2022. https://doi.org/10.1155/2022/6866578 Lin M-F, Shiau S-Y (2005) Dietary L-ascorbic acid affects growth, nonspecific immune responses and disease resistance in juvenile grouper, Epinephelus malabaricus . Aquaculture 244:215–221. https://doi.org/10.1016/j.aquaculture.2004.10.026 Roosta Z, Hajimoradloo A, Ghorbani R, Hoseinifar SH (2014) The effects of dietary vitamin C on mucosal immune responses and growth performance in Caspian roach ( Rutilus rutilus caspicus ) fry. Fish Physiol Biochem 40:1601–1607. https://doi.org/10.1007/s10695-014-9951-6 Ai Q, Mai K, Zhang C et al (2004) Effects of dietary vitamin C on growth and immune response of Japanese seabass, Lateolabrax japonicus . Aquaculture 242:489–500. https://doi.org/10.1016/j.aquaculture.2004.08.016 Abo-Al-Ela HG, El-Nahas AF, Mahmoud S, Ibrahim EM (2017) Vitamin C modulates the immunotoxic effect of 17α-methyltestosterone in Nile tilapia. Biochemistry 56:2042–2050. https://doi.org/10.1021/acs.biochem.6b01284 Shahkar E, Yun H, Kim D-J et al (2015) Effects of dietary vitamin C levels on tissue ascorbic acid concentration, hematology, non-specific immune response and gonad histology in broodstock Japanese eel, Anguilla japonica . Aquaculture 438:115–121. https://doi.org/10.1016/j.aquaculture.2015.01.001 Eo J, Lee K-J (2008) Effect of dietary ascorbic acid on growth and non-specific immune responses of tiger puffer, Takifugu rubripes . Fish Shellfish Immunol 25:611–616. https://doi.org/10.1016/j.fsi.2008.08.009 Smirnoff N (2001) L-ascorbic acid biosynthesis. Vitam Horm 61:241–266. https://doi.org/10.1016/S0083-6729(01)61008-2 Shanaka K, Jung S, Janson N et al (2021) Growth and Antioxidant-Related Effects of the Reestablished Ascorbic Acid Pathway in Zebrafish ( Danio rerio ) by Genomic Integration of L-Gulonolactone Oxidase From Cloudy Catshark ( Scyliorhinus torazame ). Front Physiol 12:685595. https://doi.org/10.3389/fphys.2021.685595 Drouin G, Godin J-R, Pagé B (2011) The genetics of vitamin C loss in vertebrates. Curr Genom 12:371–378. https://doi.org/10.2174/138920211796429736 Wang X, Kim K-W, Bai SC et al (2003) Effects of the different levels of dietary vitamin C on growth and tissue ascorbic acid changes in parrot fish ( Oplegnathus fasciatus ). Aquaculture 215:203–211. https://doi.org/10.1016/S0044-8486(02)00042-X Sheraz M, Khan MF, Ahmed S et al (2015) Stability and stabilization of ascorbic acid. Househ Pers Care Today 10:22–25 Yin X, Chen K, Cheng H et al (2022) Chemical stability of ascorbic acid integrated into commercial products: A review on bioactivity and delivery technology. Antioxid 11:153. https://doi.org/10.3390/antiox11010153 Comunian TA, Abbaspourrad A, Favaro-Trindade CS, Weitz DA (2014) Fabrication of solid lipid microcapsules containing ascorbic acid using a microfluidic technique. Food Chem 152:271–275. https://doi.org/10.1016/j.foodchem.2013.11.149 Liu Y, Liu C, Li J (2020) Comparison of vitamin c and its derivative antioxidant activity: Evaluated by using density functional theory. ACS omega 5:25467–25475. https://doi.org/10.1021/acsomega.0c04318 Toyohara H, Nakata T, Touhata K et al (1996) Transgenic Expression of l-Gulono-γ-lactone Oxidase in Medaka ( Oryzias latipes ), a Teleost Fish That Lacks This Enzyme Necessary for l-Ascorbic Acid Biosynthesis. Biochem Biophys Res Commun 223:650–653. https://doi.org/10.1006/bbrc.1996.0949 Shi M, Gao M, Sun H et al (2023) Exogenous 2-keto-L-gulonic Acid Supplementation as a Novel Approach to Enhancing L-ascorbic Acid Biosynthesis in Zebrafish ( Danio rerio ). Animals 13:2502. https://doi.org/10.3390/ani13152502 T CRAWFORD TC (1982) Synthesis of L-ascorbic acid. ACS Publications. https://doi.org/10.1021/ba-1982-0200.ch001 Nakharuthai C, Boonanuntanasarn S, Kaewda J, Manassila P (2023) Isolation of Potential Probiotic Bacillus spp. from the Intestine of Nile Tilapia to Construct Recombinant Probiotic Expressing CC Chemokine and Its Effectiveness on Innate Immune Responses in Nile Tilapia. Animals 13:986. https://doi.org/10.3390/ani13060986 Xue G-P, Johnson JS, Dalrymple BP (1999) High osmolarity improves the electro-transformation efficiency of the gram-positive bacteria Bacillus subtilis and Bacillus licheniformis . J Microbiol Methods 34:183–191. https://doi.org/10.1016/S0167-7012(98)00087-6 Pitaksong T, Kupittayanant P, Boonanuntanasarn S (2013) The effects of vitamins C and E on the growth, tissue accumulation and prophylactic response to thermal and acidic stress of hybrid catfish. Aquac Nutr 19:148–162. https://doi.org/10.1111/j.1365-2095.2012.00950.x Siwicki A, Studnicka M (1987) The phagocytic ability of neutrophils and serum lysozyme activity in experimentally infected carp, Cyprinus carpio L. J Fish Biol 31:57–60. https://doi.org/10.1111/j.1095-8649.1987.tb05293.x Milla S, Mathieu C, Wang N et al (2010) Spleen immune status is affected after acute handling stress but not regulated by cortisol in Eurasian perch, Perca fluviatilis . Fish Shellfish Immunol 28:931–941. https://doi.org/10.1016/j.fsi.2010.02.012 Puangkaew J, Kiron V, Somamoto T et al (2004) Nonspecific immune response of rainbow trout ( Oncorhynchus mykiss Walbaum) in relation to different status of vitamin E and highly unsaturated fatty acids. Fish Shellfish Immunol 16:25–39. https://doi.org/10.1016/S1050-4648(03)00028-7 Bremus C, Herrmann U, Bringer-Meyer S, Sahm H (2006) The use of microorganisms in L-ascorbic acid production. J Biotech 124:196–205. https://doi.org/10.1016/j.jbiotec.2006.01.010 Jiménez-Fernández E, Ruyra A, Roher N et al (2014) Nanoparticles as a novel delivery system for vitamin C administration in aquaculture. Aquaculture 432:426–433. https://doi.org/10.1016/j.aquaculture.2014.03.006 Ibrahim RE, Amer SA, Farroh KY et al (2021) The effects of chitosan-vitamin C nanocomposite supplementation on the growth performance, antioxidant status, immune response, and disease resistance of Nile tilapia ( Oreochromis niloticus ) fingerlings. Aquaculture 534:736269. https://doi.org/10.1016/j.aquaculture.2020.736269 Tian Y-S, Deng Y-D, Zhang W-H et al (2022) Metabolic engineering of Escherichia coli for direct production of vitamin C from D-glucose. Biotechnol Biofuels Bioprod 15:1–13. https://doi.org/10.1186/s13068-022-02184-0 Won S, Hamidoghli A, Choi W et al (2020) Effects of Bacillus subtilis WB60 and Lactococcus lactis on growth, immune responses, histology and gene expression in Nile tilapia, Oreochromis niloticus . Microorganisms 8(1). https://doi.org/10.3390/microorganisms8010067 Dawood M, Koshio S (2016) Vitamin C supplementation to optimize growth, health and stress resistance in aquatic animals. Rev Aquac 10(2):334–350. https://doi.org/10.1111/raq.12163 Wang L, Chen D, Lou B et al (2017) The effects of dietary vitamin C on growth performance, serum enzymes activities and resistance to Vibrio alginolyticus challenge of yellow drum Nibea albiflora . Aquac Res 48:4684–4695. https://doi.org/10.1111/are.13290 Chen R, Lochmann R, Goodwin A et al (2004) Effects of dietary vitamins C and E on alternative complement activity, hematology, tissue composition, vitamin concentrations and response to heat stress in juvenile golden shiner ( Notemigonus crysoleucas ). Aquaculture 242:553–569. https://doi.org/10.1016/j.aquaculture.2004.09.012 Lim C, Yildirim-Aksoy M, Welker T et al (2010) Growth performance, immune response, and resistance to Streptococcus iniae of Nile tilapia, Oreochromis niloticus , fed diets containing various levels of vitamins C and E. J World Aquac Soc 41:35–48. https://doi.org/10.1111/j.1749-7345.2009.00311.x Nayak S, Swain P, Mukherjee S (2007) Effect of dietary supplementation of probiotic and vitamin C on the immune response of Indian major carp, Labeo rohita . Fish Shellfish Immunol 23:892–896. https://doi.org/10.1016/j.fsi.2007.02.008 Fong F, Shah FLY, Kirjavainen NP, El-Nezami P H (2016) Mechanism of action of probiotic bacteria on intestinal and systemic immunities and antigen-presenting cells. Int Rev Immunol 35:179–188. https://doi.org/10.3109/08830185.2015.1096937 Verlhac V, Gabaudan J, Obach A et al (1996) Influence of dietary glucan and vitamin C on non-specific and specific immune responses of rainbow trout ( Oncorhynchus mykiss ). Aquaculture 143:123–133. https://doi.org/10.1016/0044-8486(95)01238-9 Chen M, Daha MR, Kallenberg CG (2010) The complement system in systemic autoimmune disease. J Autoimmun 34:J276–J286. https://doi.org/10.1016/j.jaut.2009.11.014 Panase A, Thirabunyanon M, Promya J, Chitmanat C (2023) Influences of Bacillus subtilis and fructooligosaccharide on growth performances, immune responses, and disease resistance of Nile tilapia, Oreochromis niloticus . Front Vet Sci 9:1094681. https://doi.org/10.3389/fvets.2022.1094681 Li Y, Lovell R (1985) Elevated levels of dietary ascorbic acid increase immune responses in channel catfish. J Nutr 115:123–131. https://doi.org/10.1093/jn/115.1.123 Hardie L, Fletcher T, Secombes C (1991) The effect of dietary vitamin C on the immune response of the Atlantic salmon ( Salmo salar L ). Aquaculture 95:201–214. https://doi.org/10.1016/0044-8486(91)90087-N Adorian TJ, Jamali H, Farsani HG et al (2019) Effects of probiotic bacteria Bacillus on growth performance, digestive enzyme activity, and hematological parameters of Asian sea bass, Lates calcarifer (Bloch). Probiotics Antimicrob Proteins 11:248–255. https://doi.org/10.1007/s12602-018-9393-z Medagoda N, Chotikachinda R, Hasanthi M, Lee K-J (2023) Dietary Supplementation of a Mixture of Nucleotides, β-Glucan and Vitamins C and E Improved the Growth and Health Performance of Olive Flounder, Paralichthys olivaceus . Fishes 8:302. https://doi.org/10.3390/fishes8060302 Dawood MA, Zommara M, Eweedah NM et al (2020) The potential role of nano-selenium and vitamin C on the performances of Nile tilapia ( Oreochromis niloticus ). Environ Sci Pollut Res 27:9843–9852. https://doi.org/10.1007/s11356-020-07651-5 Suanyuk N, Kong F, Ko D et al (2008) Occurrence of rare genotypes of Streptococcus agalactiae in cultured red tilapia Oreochromis sp. and Nile tilapia O. niloticus in Thailand—relationship to human isolates? Aquaculture 284:35–40. https://doi.org/10.1016/j.aquaculture.2008.07.034 Nayak SK (2010) Probiotics and immunity: A fish perspective. Fish Shellfish Immunol 29:2–14. https://doi.org/10.1016/j.fsi.2010.02.017 Santos-Sánchez NF, Salas-Coronado R, Villanueva-Cañongo C, Hernández-Carlos B (2019) Antioxidant compounds and their antioxidant mechanism. Antioxid 10:1–29. http://dx.doi.org/10.5772/intechopen.85270 Carr AC, Maggini S (2017) Vitamin C and immune function. Nutrients 9:1211. https://doi.org/10.3390/nu9111211 Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile1.docx Supplementaryfile2.docx Supplementaryfile3.docx Supplementaryfile4.docx Supplementaryfile5.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3997297","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":279090584,"identity":"19b2478d-8c06-4aef-aef3-a01d0f621040","order_by":0,"name":"Jirawadee Kaewda","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Jirawadee","middleName":"","lastName":"Kaewda","suffix":""},{"id":279090585,"identity":"761354a7-2d54-4c1d-95ae-30472b7d0352","order_by":1,"name":"Surintorn Boonanuntanasarn","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Surintorn","middleName":"","lastName":"Boonanuntanasarn","suffix":""},{"id":279090586,"identity":"71d28d7e-615f-4f73-913f-254d54223540","order_by":2,"name":"Pimpisut Manassila","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Pimpisut","middleName":"","lastName":"Manassila","suffix":""},{"id":279090587,"identity":"4fb3b7ee-0f33-469b-9dfa-c7d6ef19255c","order_by":3,"name":"Papungkorn Sangsawad","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Papungkorn","middleName":"","lastName":"Sangsawad","suffix":""},{"id":279090588,"identity":"a759f8cf-7378-42be-9d20-458a71e8e73a","order_by":4,"name":"Chatsirin Nakharuthai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBAC/hkg0oCBB0QxNlTAJQ7g1CJxA6gQoeUMA4TFkIBbi0EESAsUMDa2EaNFuvn5wx8F92TMGXgPfpw5ry5xPwPzww+MP+7g1iJzzLCZx6CYx7KBL1ly47bDiT0MbMYSDAnPcGuRSDBsZjBI4DE4wGMg+XDbAaAWBjOgww7j0ZL+sfEHRIvxz4dz6oBa2L/h1xKRY9jAA9FiJrmxgRmohQe/LRI3cgpnw7RYzjh22LjnME+xREIabi38M9I3fPzxJ8Ee5LCbPTV1su3t7Rs/fLDBrQUB5B9AGcxAnECEhlEwCkbBKBgFuAEAQMlTbb3QnRcAAAAASUVORK5CYII=","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":true,"prefix":"","firstName":"Chatsirin","middleName":"","lastName":"Nakharuthai","suffix":""}],"badges":[],"createdAt":"2024-02-28 17:00:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3997297/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3997297/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52664563,"identity":"0e67723d-e082-49d7-9d86-cbc4e6c987d3","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":45097,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of \u003cem\u003eGULO\u003c/em\u003e mRNA in the intestine of Nile tilapia were compared between those fed experimental diets at 30 days and those at 90 days of the feeding trial. The asterisk indicates significant statistical differences (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/ef0eb6210068c611817641b6.jpg"},{"id":52664564,"identity":"e236ced5-d1bc-43c3-ae46-5f13a5936d6a","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":80567,"visible":true,"origin":"","legend":"\u003cp\u003eImmune parameters of Nile tilapia fed experimental diets for 30 days and 90 days of feeding trial.Alternative complement hemolysis 50 (ACH50) (a); total immunoglobulin (b); lysozyme activity (c). Bars with asterisks indicate significant differences between day 30 and day 90 of the feeding trial, whereas bars labeled with different lowercase letters denote significant differences for day 30 of the feeding trial, and bars labeled with uppercase letters indicate significant differences for day 90 of the feeding trial, respectively (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05). Phagocytic activity (%) of phagocytic cells in PBLs of Nile tilapia fed experimental diets for 90 days of the feeding trial (D). Bars with different letters indicate significant differences (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/f21c52ab013b136c41d290e2.jpg"},{"id":52664568,"identity":"a3f196f6-2612-4881-9f03-e6ef95552964","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":142679,"visible":true,"origin":"","legend":"\u003cp\u003eImmune parameters of Nile tilapia in response to \u003cem\u003eS. agalactiae\u003c/em\u003e at different time points following the 30-day feeding trial. Alternative complement hemolysis 50 (ACH50) (a); total immunoglobulin (b); lysozyme activity (c). Bars with different letters indicate significant differences (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/eceeacdaed6aefc58f0d31b6.jpg"},{"id":52664565,"identity":"c836cd13-a42d-4db2-a96b-d418a6842ca1","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":124734,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative real-time PCR analysis of CC chemokine expression in the spleen (a) and liver (b) of Nile tilapia in response to \u003cem\u003eS. agalactiae\u003c/em\u003e at different time points following the 30-day feeding trial. The different letters on each bar indicate significant differences at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/82423fd82db6e3e172deb30c.jpg"},{"id":52664566,"identity":"4b57fac0-8c1e-4f0d-959a-2ce4964807e4","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":129704,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative real-time PCR analysis of tumor necrosis factor α expression in the spleen (a) and liver (b) of Nile tilapia in response to \u003cem\u003eS. agalactiae\u003c/em\u003e at different time points following the 30-day feeding trial. The different letters on each bar indicate significant differences at \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/44316dbf8bfb01e7605ffc65.jpg"},{"id":70885891,"identity":"d5310e84-b9fb-4456-aede-10abd5cc1ee5","added_by":"auto","created_at":"2024-12-09 01:54:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1652061,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/0e22c8b3-e8d3-4ec3-b5e7-c857a86d00ca.pdf"},{"id":52664569,"identity":"609ac865-5a48-4537-97db-7f0b33815753","added_by":"auto","created_at":"2024-03-14 08:36:24","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":454490,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/11f29db92dcb480f1b45c3fd.docx"},{"id":52664572,"identity":"4ea5a732-d87d-4643-9be6-b1acb10c304c","added_by":"auto","created_at":"2024-03-14 08:36:24","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":105589,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/07031122111d0b067d26e458.docx"},{"id":52664570,"identity":"79a06085-dfbd-453a-b470-457214ea4137","added_by":"auto","created_at":"2024-03-14 08:36:24","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":114088,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile3.docx","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/b707d52c4f7cbca230466d45.docx"},{"id":52664573,"identity":"e4009c9c-45dc-48d3-89dc-e0f219feebeb","added_by":"auto","created_at":"2024-03-14 08:36:24","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":189756,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile4.docx","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/369a7a38249b063c5c944d47.docx"},{"id":52664567,"identity":"0dc3165c-c88e-4ef1-b24e-61c51263e7fd","added_by":"auto","created_at":"2024-03-14 08:36:23","extension":"docx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":126659,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile5.docx","url":"https://assets-eu.researchsquare.com/files/rs-3997297/v1/6c44bcef5e5360062a349b9d.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Improvement of antagonistic activity against Streptococcus agalactiae using recombinant Bacillus subtilis expressing L-gulonolactone oxidase: its effects on growth performance, immune response, and antioxidant activity in Nile tilapia, Oreochromis niloticus","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOver the past decades, the production of Nile tilapia has steadily shifted towards intensive culture systems. However, the advancement of intensive culture has led to the deterioration of water quality, which facilitates the proliferation of pathogens in aquatic environments. In such situations, coupled with the impact of climate change, fish are more susceptible to stress, leading to impaired growth performance and a weakened immune system. To address this issue, fish farmers have prioritized fish health maintenance through the implementation of effective management practices, supplying high-quality nutritional feed, and administering immunostimulants. Among the immunostimulant agents, probiotics \u003cem\u003eB. subtilis\u003c/em\u003e and vitamin C have become a field of interest for researchers to apply in intensive culture systems. The probiotic \u003cem\u003eB. subtilis\u003c/em\u003e is considered one of the most commonly used dietary supplements in various fish species, owing to its ability to exert numerous positive effects on the gut microbiota, growth performance, disease resistance, health status of aquatic animals, and water quality [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In addition, it is generally recognized as safe (GRAS) and well-known as an ideal bacterial factory for producing heterologous proteins [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn modern fish farming, vitamin C has emerged as a crucial exogenous micronutrient element and immunostimulant supplemented in aquafeed. This is due to the frequent inadequacy of its natural quantities to sustain normal body functions in fish, particularly under high stocking density conditions. Since vitamin C's pivotal function as an enzyme cofactor, it has a crucial part in facilitating many physiological processes that involve biosynthesis, protein metabolism [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], iron metabolism [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], lipid metabolism [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], immune response [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], stress [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and physiological antioxidant activity [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In fish, vitamin C deficiency results in various adverse consequences, including impaired growth performance and survival rate, increased susceptibility to stress, depressed immune status, reduced reproductive performance, skeletal alterations, impaired collagen formation, slow wound healing, and anemia [\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. On the other hand, the adequate intake of vitamin C has been widely shown to have beneficial effects on the growth and health of fish. For example, dietary supplementation with the optimal level of vitamin C markedly improved growth performance [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], as well as serum antioxidant activities [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It also enhanced several immune responses, including phagocytic activity, phagocytic index, alternative complement activity, and lysozyme activity [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In addition, dietary vitamin C increment has also been proven to enhance the proliferation of spermatogonia, and hematocrit value in Japanese eel broodstock (\u003cem\u003eAnguilla japonica\u003c/em\u003e) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In aquaculture conditions, vitamin C is naturally derived from plants found in aquatic environments. However, in intensive commercial operations, natural plant-based food sources are usually inadequate to meet the demand for fish. Moreover, more advanced teleosts, including Nile tilapia, are incapable of synthesizing vitamin C \u003cem\u003ede novo\u003c/em\u003e due to a lack/mutation of the L-gulonolactone oxidase (\u003cem\u003eGULO\u003c/em\u003e) which is an enzyme necessary for the last step of ascorbic acid biosynthesis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In contrast, amphibians, reptiles, certain mammals, birds, chickens, primitive lobe-finned fish, certain cartilaginous fish species, and almost all plants possess the ability to synthesize vitamin C due to the presence of the functional \u003cem\u003eGULO\u003c/em\u003e gene [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. For this reason, more advanced teleost species must obtain vitamin C through dietary supplementation to ensure their optimum growth and health, especially in intensive culture conditions where limited natural foods are available [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Unfortunately, the stability of vitamin C as a dietary component often makes it inadequate at useful levels for aquatic animals due to its rapid oxidation. The loss of vitamin C is accelerated in inappropriate environmental conditions during the commercial manufacturing process of aquafeed, storage, handling, and feeding conditions. The rate of loss depends on various factors, including temperature, oxygen, UV irradiation, light, pH levels, and the presence of transition metal ions [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo overcome these roadblocks, various approaches have emerged to ensure that animals receive a sufficient amount of vitamin C and to enhance the stability and bioavailability of vitamin C. It includes the shielding of vitamin C through encapsulation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], the development of chemical vitamin C derivatives [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], genomic integration of L-gulonolactone oxidase [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], utilization of exogenous 2-keto-L-gulonic acid supplementation [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], and so on. In this study, we aimed to construct a recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e from the red junglefowl (\u003cem\u003eG. gallus\u003c/em\u003e) to reestablish the ascorbic acid pathway in Nile tilapia and evaluate its potential as a dietary supplement for Nile tilapia. Since the ascorbate biosynthesis pathway, starting with D-glucose-1-phosphate as the initial precursor and progressing until L-gulonate, is conserved in all animal species [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], it may be possible to reestablish this pathway by integrating the \u003cem\u003eGULO\u003c/em\u003e gene into probiotic \u003cem\u003eB. subtilis\u003c/em\u003e using recombinant probiotic technology. In addition, our previous study revealed the beneficial effects of \u003cem\u003eB. subtilis\u003c/em\u003e isolated from the intestine of Nile tilapia, including, antagonistic activity, bile salts and pH tolerance, protease-producing capacity, antibiotic susceptibility, and pathogenicity tests [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Therefore, the application of recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e may provide a possible alternative option to achieve the combined effect of probiotic \u003cem\u003eB. subtilis\u003c/em\u003e and vitamin C supplementation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eConstruction of recombinant probiotic\u003c/strong\u003e \u003cstrong\u003eB. subtilis\u003c/strong\u003e \u003cstrong\u003eexpressing\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003ePrimer design, RNA isolation, and cDNA synthesis\u003c/h2\u003e\n\u003cp\u003eSpecific primers were deliberately designed to amplify the full-length \u003cem\u003eGULO\u003c/em\u003e cDNA of \u003cem\u003eG. gallus\u003c/em\u003e (accession no. XM_015285218) published on the GenBank database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003c/span\u003e). The forward primer (H-B-\u003cem\u003eGULO\u003c/em\u003eF) containing \u003cem\u003eHind\u003c/em\u003eIII and \u003cem\u003eBam\u003c/em\u003eHI restriction site was designed from the start codon (ATG), while the reverse primer (H-X-\u003cem\u003eGULO\u003c/em\u003eR) was designed prior to the stop codon followed by \u003cem\u003eXho\u003c/em\u003eI and \u003cem\u003eHind\u003c/em\u003eIII, respectively. Total RNA was extracted from the kidney of \u003cem\u003eG. gallus\u003c/em\u003e using the TRlzol reagent (Gibco BRL, Gaithersburg, MD, USA) in accordance with the manufacturer's instructions in order to amplify full-length \u003cem\u003eGULO\u003c/em\u003e cDNA. Briefly, 100 mg of the kidney was homogenized using mini-beadbeater-16 (Thermo Fisher Scientific, Waltham, MA, USA) and was subsequently extracted using the conventional phenol-chloroform method with some modifications. To eliminate genomic DNA, the dissolved total RNA was treated with RQ1 RNase-Free DNase (Promega Corporation, Madison, WI, USA). The three intact bands of RNA were visualized on agarose gel electrophoresis stained with SafeRed nucleic acid staining solution (Vivantis Technologies Sdn Bhd., Selangor, Malaysia). The Nanodrop 2000\u0026trade; spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the quantity and quality of RNA. After that, first-strand cDNA was synthesized using the ImProm-II\u0026trade; Reverse Transcription System kit (Promega Corporation, Madison, WI, USA) and kept at -20\u0026deg;C in a freezer until used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCloning of the full-length\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003ecDNA of\u003c/strong\u003e \u003cstrong\u003eG. gallus\u003c/strong\u003e \u003cstrong\u003einto pGEM\u0026reg;T-Easy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo construct recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e, the full-length \u003cem\u003eGULO\u003c/em\u003e cDNA was amplified using gene-specific primers as described in 2.1.1 (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The PCR condition was performed as follows: at 95\u0026deg;C for 3 min, then 40 cycles at 95\u0026deg;C for 30 s, 59.9\u0026deg;C for 30 s, 72\u0026deg;C for 3 min, followed by at 72\u0026deg;C for 5 min. The PCR product was purified using FavorPrep\u0026trade; GEL/PCR Purification Kit (Farvogen\u0026reg; Biotech Corp, Ping Tung, Taiwan) and subsequently sequenced using Macrogen sequencing service (Macrogen Inc., Seoul, South Korea) with forward (H-B-\u003cem\u003eGULO\u003c/em\u003eF) and reverse (H-X-\u003cem\u003eGULO\u003c/em\u003eR) primers to confirm nucleotide and amino acid sequences accuracy of the PCR product. After that, the purified PCR was ligated into a pGEM\u0026reg;T-Easy plasmid (Promega Corporation, Madison, WI, USA) under the conditions described in the manufacturer's protocol. Finally, the ligation product was transformed into100 \u0026micro;l of \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; competent cells using the heat shock method, and the transformed bacteria containing plasmid DNA exhibiting white color colonies were selected for the further steps which consisted of colony PCR screening, the restriction enzymes (\u003cem\u003eHind\u003c/em\u003eIII, \u003cem\u003eBam\u003c/em\u003eHI), and confirmed the appearance of insert DNA by sequencing (Macrogen, Korea).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eThe list of oligonucleotide sequences used in this study\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimer name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e5\u0026prime; to 3\u0026prime; Nucleotide Sequences\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct size (bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eAnnealing temperature\u003c/p\u003e\n\u003cp\u003e(\u0026deg;C)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePurposes\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eH-B- \u003cem\u003eGULO\u003c/em\u003eF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGCTTGGATCCATGGTTCACGGCCAAGGAGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e1,323\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCloning\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eH-X- \u003cem\u003eGULO\u003c/em\u003eR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGCTTCTCGAGGTAGAACACCTTTTCCAGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCloning\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eGULO\u003c/em\u003e-qPCRF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACAGGGACGCACAACACTGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e172\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e59\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eGULO\u003c/em\u003e-qPCRR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGACGGTGAGCACAACACCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026beta;-actinF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACAGGATGCAGAAGGAGATCACAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e155\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026beta;-actinR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGTACTCCTGCTTGCTGATCCACAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eOn\u003c/em\u003eCC-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACAGAGCCGATCTTGGGTTACTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e229\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eOn\u003c/em\u003eCC-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGAAGGAGAGGCGGTGGATGTTAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eOn\u003c/em\u003eTNF-\u0026alpha;F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAGGCCAATAAAATCATCATCCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e161\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eOn\u003c/em\u003eTNF-\u0026alpha;R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCTTCCCATAGACTCTGAGTAGCG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eqRT-PCR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;Table\u0026nbsp;2 Growth performance of Nile tilapia fed experimental diets for 30- and 90-days post-feeding\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Taba\" border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDiet\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eInitial weight\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFinal weight\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eInitial length\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFinal length\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eWeight gain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFCR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eADG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSGR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eRGR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePER\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(g)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(g)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(cm)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(cm)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(g)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(g day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(% day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e30 days\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCON\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e75.11\u0026thinsp;\u0026plusmn;\u0026thinsp;5.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e141.47\u0026thinsp;\u0026plusmn;\u0026thinsp;13.78\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e66.36\u0026thinsp;\u0026plusmn;\u0026thinsp;8.78\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e88.23\u0026thinsp;\u0026plusmn;\u0026thinsp;7.43\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eVC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e73.16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e138.80\u0026thinsp;\u0026plusmn;\u0026thinsp;6.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e65.64\u0026thinsp;\u0026plusmn;\u0026thinsp;4.90\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e89.74\u0026thinsp;\u0026plusmn;\u0026thinsp;6.13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e80.18\u0026thinsp;\u0026plusmn;\u0026thinsp;1.34\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e151.29\u0026thinsp;\u0026plusmn;\u0026thinsp;10.30\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e71.11\u0026thinsp;\u0026plusmn;\u0026thinsp;10.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e95.94\u0026thinsp;\u0026plusmn;\u0026thinsp;4.78\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u0026thinsp;+\u0026thinsp;GULO\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e78.56\u0026thinsp;\u0026plusmn;\u0026thinsp;3.50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e158.64\u0026thinsp;\u0026plusmn;\u0026thinsp;3.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e19.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e80.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e102.09\u0026thinsp;\u0026plusmn;\u0026thinsp;4.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e90 days\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCON\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e75.11\u0026thinsp;\u0026plusmn;\u0026thinsp;5.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e268.75\u0026thinsp;\u0026plusmn;\u0026thinsp;7.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25.15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.74\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e195.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e268.99\u0026thinsp;\u0026plusmn;\u0026thinsp;22.79\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eVC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e73.16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e312.17\u0026thinsp;\u0026plusmn;\u0026thinsp;13.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e15.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e237.73\u0026thinsp;\u0026plusmn;\u0026thinsp;14.47\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e319.60\u0026thinsp;\u0026plusmn;\u0026thinsp;24.91\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e80.18\u0026thinsp;\u0026plusmn;\u0026thinsp;1.34\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e327.06\u0026thinsp;\u0026plusmn;\u0026thinsp;12.45\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e25.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e246.88\u0026thinsp;\u0026plusmn;\u0026thinsp;12.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e307.93\u0026thinsp;\u0026plusmn;\u0026thinsp;14.78\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u0026thinsp;+\u0026thinsp;GULO\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e78.56\u0026thinsp;\u0026plusmn;\u0026thinsp;3.50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e381.25\u0026thinsp;\u0026plusmn;\u0026thinsp;8.13\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e27.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e302.75\u0026thinsp;\u0026plusmn;\u0026thinsp;3.18\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e386.31\u0026thinsp;\u0026plusmn;\u0026thinsp;20.30\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"11\"\u003eMeans with a different superscript in each column differed significantly from each other (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Values are means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of ten replicates.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eTransformation of\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003eplasmid into probiotic\u003c/strong\u003e \u003cstrong\u003eB. subtilis\u003c/strong\u003e \u003cstrong\u003eby electroporation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe positive \u003cem\u003eGULO\u003c/em\u003e plasmid from 2.1.2 and pBES expression vector (Takara Bio USA, Inc., San Jose, CA, USA) were double-digested with \u003cem\u003eHind\u003c/em\u003eIII and \u003cem\u003eBam\u003c/em\u003eHI and purified before ligation. The ligation reaction was then transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; competent cells and confirmed the accuracy of nucleotide and amino acid sequence by sequencing. The electroporation method was used to transform the pBES\u003cem\u003eGULO\u003c/em\u003e plasmid into probiotic \u003cem\u003eB. subtilis\u003c/em\u003e competent cells which were prepared following the method of Xue et al. [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e] with minor modifications. To identify the positive clones, the transformants were spread onto an LB plate with 100 \u0026micro;g/mL of kanamycin and incubated for 16\u0026ndash;18 h at 37\u0026deg;C, and the apparent clones were proved by colony PCR, double restriction enzyme digestion, and sequencing to confirm nucleotide and amino acid sequence accuracy.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eWestern blotting analysis\u003c/h2\u003e\n\u003cp\u003ePrior to commencing the feeding experiment, the presence of secreted \u003cem\u003eGULO\u003c/em\u003e produced from probiotic \u003cem\u003eB. subtilis\u003c/em\u003e was confirmed through the western blot method as within the method of our previous study [\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eEthics statement\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were conducted in compliance with the regulations approved by the Ethics Committee of Suranaree University of Technology (SUT), Animal Care and Use Committee (approval no.SUT-IACUC-0012/2023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe effect of dietary recombinant probiotic\u003c/strong\u003e \u003cstrong\u003eB. subtilis\u003c/strong\u003e \u003cstrong\u003eexpressing\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003esupplementation in normal fish\u003c/strong\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003eExperimental design\u003c/h2\u003e\n\u003cp\u003eThis experiment was assigned to four groups, each with three replication tanks, and ten individual fish, using a completely randomized design. A total of 120 healthy Nile tilapia were divided into twelve 700-liter fiber tanks containing clean freshwater with an aeration system. After a 2-week acclimatization period, the fish were fed \u003cem\u003ead libitum\u003c/em\u003e twice daily with the following 4 experimental diets, including a basal diet (CON), a basal diet supplemented with vitamin C (VC), a basal diet supplemented with wild-type \u003cem\u003eB. subtilis\u003c/em\u003e (BS), and a basal diet supplemented with recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e (BS\u0026thinsp;+\u0026thinsp;GULO).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eDiet preparation\u003c/h2\u003e\n\u003cp\u003eBefore commencing this experiment, both wild-type isolated \u003cem\u003eB. subtilis\u003c/em\u003e and the recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e were proliferated, aliquoted, and stored in glycerol stocks at -80 ℃ until use. For the preparation of each experimental diet, aliquots of wild-type isolated \u003cem\u003eB. subtilis\u003c/em\u003e and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expression \u003cem\u003eGULO\u003c/em\u003e were separately inoculated into LB broth and LB broth containing kanamycin, respectively. The inoculated cultures were then incubated in an incubator shaker at 37\u0026deg;C for 18\u0026ndash;24 h. After harvesting each bacterial suspension by centrifugation at 5000 xg for 5 min, the bacterial pellets were washed twice with sterile 0.85% NaCl and then resuspended in the same solution to adjust the concentration to 1x10\u003csup\u003e8\u003c/sup\u003e colony-forming units (CFU/ml) before being mixed with a commercial diet.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eGrowth performance\u003c/h2\u003e\n\u003cp\u003eThe individual body weight and length of fish from each tank were measured at 0, 30, and 90 days to calculate the growth performance indices, including weight gain (WG), specific growth rate (SGR), average daily gain (ADG), and feed conversion ratio (FCR), protein efficiency ratio (PER), and relative growth rate (RGR).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eDetermination of ascorbic acid in Nile tilapia serum using HPLC analysis\u003c/h2\u003e\n\u003cp\u003eTo analyze the concentration of ascorbic acid in experimental fish, the serum was collected from the experimental fish at the end of the feeding trial. The HP 1100 series reversed-phase high-performance liquid chromatography (HPLC) system (Agilent Technologies, Waldbronn, Germany) with C18 HPLC column, 5 \u0026micro;m, 250 x 4.0 mm was performed in this experiment according to the method described by Pitaksong et al. [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. The high-purity grade of ascorbic acid (Sigma, St Louis, MO, USA) was used as the reference standard for quantifying ascorbic acid in fish serum. Each experimental group was conducted in triplicate.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eImmune parameters\u003c/h2\u003e\n\u003cp\u003eAt 30 and 90 days of the trial, serum LZM activity [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e], serum total Ig concentration [\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e], and serum ACH50 activity [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e] were performed in a slightly modified manner. The optical density of each sample was measured using an absorbance microplate reader Epoch BioTek instruments (Agilent Technologies, CA, USA). In addition, at 90 days of the trial, the phagocytic activity of peripheral blood leukocytes (PBLs) was determined by appropriately modifying the methods described by Puangkaew et al. [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eSerum antioxidant enzyme activities\u003c/h2\u003e\n\u003cp\u003eThe activity of catalase (CAT), total antioxidant capacity (TAC), superoxide dismutase (SOD), Glutathione Peroxidase (GSH-Px), malondialdehyde (MDA) in the serum of the experimental fish at 90 days of the trial were measured using a commercial kit (Abbkine Corporation, Georgia, USA) according to the manufacturer\u0026rsquo;s recommended protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression of\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003emRNA in normal fish by qRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo construct cDNA plasmid standards for qRT-PCR, cloning of each target gene of interest was performed to evaluate the mRNA expression level of Nile tilapia at the end of the feeding trial. The primer sets for qRT-PCR analysis used in this study are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR products of the expected size were purified using a FavorPrep GEL/PCR Purification Kit according to the manufacturer\u0026rsquo;s instructions. The purified DNA was cloned into pGEM\u0026reg; T-Easy plasmid and the positive clones were screened as described in 2.1.2. Finally, the selected plasmids were sequenced by Macrogen, Inc. (Seoul, Korea) and stored at -20\u0026deg;C for use as a standard for qRT-PCR. One microliter of first-strand cDNAs was subjected to qPCR analysis (in triplicate) using the CFX Opus Real-Time PCR System machine (Bio-Rad, Hercules, CA, USA). Each reaction was performed in a final volume of 10 \u0026micro;l containing 1 \u0026micro;l cDNA, 5 \u0026micro;l thunderbird SYBR\u0026reg; qPCR master mix (TOYOBO, Osaka, Japan), 2 \u0026micro;l dH\u003csub\u003e2\u003c/sub\u003eO, and 1 \u0026micro;l each specific primer as shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The PCR conditions were performed at 95\u0026deg;C for 3 min, followed by 40 cycles of 95\u0026deg;C for 30 s and 55\u0026ndash;59\u0026deg;C for 30 s. DNA melting curve analysis was used to verify the specificity of the primers. The internal reference for data normalization was the \u0026beta;-actin mRNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe effect of dietary supplementation with probiotic\u003c/strong\u003e \u003cstrong\u003eB. subtilis\u003c/strong\u003e \u003cstrong\u003eexpression\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003eafter a challenge with\u003c/strong\u003e \u003cstrong\u003eS. agalactiae\u003c/strong\u003e \u003cstrong\u003ein Nile tilapia\u003c/strong\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eExperimental design\u003c/h2\u003e\n\u003cp\u003eTo determine the immune response of Nile tilapia following injection with \u003cem\u003eS. agalactiae\u003c/em\u003e, a total of 60 fish were used in this experiment after one month of the feeding trial. The fish were distributed into twelve 500 L fiber tanks, with three replication tanks per diet group, each containing five individual fish.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of\u003c/strong\u003e \u003cstrong\u003eS. agalactiae\u003c/strong\u003e \u003cstrong\u003eand challenge test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe virulent strain of \u003cem\u003eS. agalactiae\u003c/em\u003e was used in the challenge experiment after the feeding trial for 30 days. The single colony of \u003cem\u003eS. agalactiae\u003c/em\u003e was inoculated in tryptic soy broth (Merck KGaA, Darmstadt, Germany) at 37\u0026deg;C for 16\u0026ndash;18 h with shaking. The concentration of \u003cem\u003eS. agalactiae\u003c/em\u003e was adjusted to 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/ml with an optical density at 600 nm of 1.0. The experimental fish were intraperitoneally injected (i.p.) with a 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU/mL suspension of live \u003cem\u003eS. agalactiae\u003c/em\u003e, in a volume of 0.1 ml per 100 g of fish body weight.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003e\u003cstrong\u003eImmune parameters and expression of pro-inflammation genes in challenged fish\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAfter the challenge, the liver, spleen, and serum of injected fish were collected at 0 h, 6 h, 12 h, 24 h, and 48 h. The serum samples were then analyzed for immune parameters (LZM, total Ig, and ACH50), as well as pro-inflammatory gene expressions (CC chemokine and tumor necrosis factor alpha (TNF\u0026alpha;)) in the liver and spleen of challenged fish, as described above.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eThe statistical analyses using the SPSS software ver.25 (SPSS Inc., Chicago, IL, USA). The data was analyzed using a one-way analysis of variance followed by the post hoc Tukey\u0026rsquo;s test to assess the significance of differences between the groups. A paired-sample T-test was conducted to evaluate the difference between 30 and 90 days after the feeding trial within immune parameters and the expression of \u003cem\u003eGULO\u003c/em\u003e mRNA. The difference between groups in comparative experiments was determined by statistical significance at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eConstruction of recombinant\u003c/strong\u003e \u003cstrong\u003eB. subtilis\u003c/strong\u003e \u003cstrong\u003eexpressing\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003eand Western blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the accuracy of the nucleotide sequence and the correct in-frame insertion, the sequence of \u003cem\u003eGULO\u003c/em\u003e gene was confirmed by sequencing. The result demonstrated that the full-length cDNA encoding the \u003cem\u003eGULO\u003c/em\u003e gene of \u003cem\u003eG. gallus\u003c/em\u003e comprised 1,323 bp open reading frame (ORF) and the predicted amino acid sequence of \u003cem\u003eGULO\u003c/em\u003e contained 440 amino acid residues (Online Resource 1). In addition, the double restriction enzyme (\u003cem\u003eBam\u003c/em\u003eHI and \u003cem\u003eHind\u003c/em\u003eIII) could identify the insertion of the \u003cem\u003eGULO\u003c/em\u003e gene into cloning and expression vectors (Online Resource 2). Before the initiation of the feeding trial, the presence of the \u003cem\u003eGULO\u003c/em\u003e produced by probiotic \u003cem\u003eB. subtilis\u003c/em\u003e was confirmed through Western blot analysis, revealing its molecular weight (Mw) to be approximately 50 kDa (Online Resource 3).\u003c/p\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eGrowth performance\u003c/h2\u003e\n\u003cp\u003eThe results of growth performance in Nile tilapia fed with experimental diets are presented in Table\u0026nbsp;2. At day 30 of the feeding trial, there were no significant differences in growth performance parameters among the experimental diets, except for the PER in BS and BS\u0026thinsp;+\u0026thinsp;GULO groups. The results showed that the PER of these groups was significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) when compared with the VC and CON groups. Interestingly, at day 90 of the feeding trial, the BS\u0026thinsp;+\u0026thinsp;GULO group exhibited the highest positive effect on FW, WG, FCR, ADG, SGR, and RGR in comparison to the other groups, whereas supplementation with vitamin C and wild-type \u003cem\u003eB. subtilis\u003c/em\u003e improved only FW, WG, and ADG (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003eDetermination of ascorbic acid in Nile tilapia serum using HPLC analysis\u003c/h2\u003e\n\u003cp\u003eFollowing a 90-day feeding trial, the assessment of ascorbic acid levels in the serum of Nile tilapia was performed using HPLC analysis. The findings indicated a significant elevation in the serum ascorbic acid levels in the BS\u0026thinsp;+\u0026thinsp;GULO group compared to the CON group. However, these levels were also lower than those observed in the VC group (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eAccumulation of serum ascorbic acid in Nile tilapia fed with experimental diets for 90 days\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eDiet\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eAscorbic acid level (\u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCON\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.88\u0026thinsp;\u0026plusmn;\u0026thinsp;1.21\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eVC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20.29\u0026thinsp;\u0026plusmn;\u0026thinsp;2.91\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u0026thinsp;+\u0026thinsp;GULO\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.43\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\"\u003eSignificant differences among diet groups are denoted by different letters (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Values are means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of three replicates.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eExpression of\u003c/strong\u003e \u003cstrong\u003eGULO\u003c/strong\u003e \u003cstrong\u003emRNA in normal fish by qRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo provide supporting evidence regarding the existence of \u003cem\u003eGULO\u003c/em\u003e in Nile tilapia, qRT-PCR was carried out to quantify \u003cem\u003eGULO\u003c/em\u003e mRNA expression in the intestines of the experimental fish at days 30 and 90 of the feeding trial. The \u003cem\u003eGULO\u003c/em\u003e mRNA expression level was detected only in the BS\u0026thinsp;+\u0026thinsp;GULO group at both time points. Moreover, on day 90, the expression level of \u003cem\u003eGULO\u003c/em\u003e mRNA exhibited a significant increase compared to day 30, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eImmune responses\u003c/h2\u003e\n\u003cp\u003eAt day 30, the VC and BS\u0026thinsp;+\u0026thinsp;GULO groups showed a significant increase in ACH50 levels compared to the BS and CON groups, respectively. The BS\u0026thinsp;+\u0026thinsp;GULO group exhibited the highest significant increase in ACH50 levels on day 90 of the feeding trial. Interestingly, only the BS and BS\u0026thinsp;+\u0026thinsp;GULO groups demonstrated a significant increase in ACH50 levels between days 30 and 90 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Regarding total Ig level, the results showed no significant difference in total Ig levels among the experimental groups on day 30 of the feeding trial. However, on day 90, the VC, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups exhibited a significant increase in total Ig levels compared to the control group. Moreover, the VC and BS\u0026thinsp;+\u0026thinsp;GULO groups exhibited a significant increase in total Ig levels between days 30 and 90 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). In terms of lysozyme activity, the VC, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups exhibited a significant increase on days 30 and 90 compared to the control group. Additionally, there was a significant increase in lysozyme activity observed among the vit C, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups between days 30 and 90 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). Finally, the VC and BS\u0026thinsp;+\u0026thinsp;GULO groups exhibited a significant increase in phagocytic activity compared to the BS and CON groups, respectively (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003eAntioxidant enzyme parameters in Nile tilapia serum\u003c/h2\u003e\n\u003cp\u003eAt the end of the 90-day feeding trial, a significant increase in serum levels of SOD, CAT, TAC, and GSH-Px, along with a decrease in MDA levels, was observed in the VC and BS\u0026thinsp;+\u0026thinsp;GULO groups compared to the BS and CON groups, respectively (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eAntioxidant parameters of Nile tilapia fed experimental diets for 90 days\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eDiet\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTAC\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSOD\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMDA\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGSH-Px\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eCAT\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026micro;mol mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003enmol mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003enmol min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCON\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e28.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.068\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e10.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eVC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e38.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.025\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.121\u0026thinsp;\u0026plusmn;\u0026thinsp;0.013\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e31.27\u0026thinsp;\u0026plusmn;\u0026thinsp;2.59\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e32.03\u0026thinsp;\u0026plusmn;\u0026thinsp;1.02\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.088\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e17.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBS\u0026thinsp;+\u0026thinsp;GULO\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e36.01\u0026thinsp;\u0026plusmn;\u0026thinsp;1.78\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.117\u0026thinsp;\u0026plusmn;\u0026thinsp;0.016\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20.34\u0026thinsp;\u0026plusmn;\u0026thinsp;4.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"6\"\u003eMeans with a different superscript in each column differed significantly from each other (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Values are means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of three replicates.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eImmune parameter after\u003c/strong\u003e \u003cstrong\u003eS. agalactiae\u003c/strong\u003e \u003cstrong\u003einjection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the challenge test, a rapid upregulation of ACH50 and lysozyme activity was observed at 6 h post-injection in the VC, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). In the case of total Ig, a significant increase was observed at 24 and 48 h post-injection, but only in the VC and BS\u0026thinsp;+\u0026thinsp;GULO groups compared to the control group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePro-inflammatory gene expressions after\u003c/strong\u003e \u003cstrong\u003eS. agalactiae\u003c/strong\u003e \u003cstrong\u003einjection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the challenge test, compared to the control group, the VC, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups displayed a significant up-regulation in mRNA levels of CC chemokine at 6 h in the liver and spleen of infected fish in response to \u003cem\u003eS. agalactiae\u003c/em\u003e. Furthermore, CC chemokine mRNAs of the BS\u0026thinsp;+\u0026thinsp;GULO group exhibited peak expression at 12 h in both the liver and spleen. Subsequently, the expression level of CC chemokine declined to baseline at 48 h in both tested tissues among all experimental diet groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). In the case of TNF\u0026alpha;, mRNA upregulation was initially observed 6 h after intraperitoneal injection of \u003cem\u003eS. agalactiae\u003c/em\u003e. Significant increases in TNF\u0026alpha; mRNA levels were observed in the spleen at 12 h post-injection in the BS\u0026thinsp;+\u0026thinsp;GULO group compared to the control group. Meanwhile, in the liver, TNF\u0026alpha; mRNA levels gradually increased at 6 h post-injection in the VC, BS, and BS\u0026thinsp;+\u0026thinsp;GULO groups compared to the control group. Moreover, this upregulation continued persistently until 48 h post-injection (Fig.\u0026nbsp;6).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAdvances in biotechnology have generated novel approaches to alleviate the vulnerability associated with the application of dietary vitamin C supplementation in aquaculture [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan additionalcitationids=\"CR41 CR42\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, a recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e was successfully constructed and applied as a dietary supplement for Nile tilapia. To evaluate its potential as a growth promoter and immunostimulant, the expression of L-gulonolactone oxidase produced by probiotic \u003cem\u003eB. subtilis\u003c/em\u003e was validated through Western blot analysis before being applied as a dietary supplement. According to the results of this study, the group of fish fed with recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e demonstrated superior overall growth performance and feed utilization compared to the other groups. After 30 days of the feeding trial, the fish fed a diet supplemented with either wild type or recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e showed a significantly improved PER, correlating with an increase in fish weight gain. The significant difference may be due to the presence of the protease-producing capacity of isolated \u003cem\u003eB. subtilis\u003c/em\u003e to enhance the digestibility of protein content as reported in our previous study [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. However, no significant differences appeared in other growth parameters. Interestingly, after 90 days of the feeding trial, the fish that exhibited the most notable overall growth performances were those fed a diet supplemented with recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e. This phenomenon may be attributed to the incorporation function of probiotics and vitamin C in enhancing the digestibility and absorption of nutrients within the fish's body. Numerous studies have reported that dietary supplementation with \u003cem\u003eB. subtilis\u003c/em\u003e can enhance intestinal digestive enzyme activities, thereby leading to an improvement in the growth performance of the fish [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Meanwhile, several pieces of evidence have encouraged the positive impact of vitamin C on nutrient utilization within metabolic processes and protein synthesis, resulting in a beneficial influence on the growth performance of aquatic animals [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Nevertheless, the effect of dietary supplementation with vitamin C can vary based on fish species, age, size, the form of vitamin C, differences in experimental conditions, as well as the health status and stress levels of the fish [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In this study, HPLC analysis was conducted to validate and confirm the role of L-gulonolactone oxidase, produced by probiotic \u003cem\u003eB. subtilis\u003c/em\u003e, in the biosynthesis of ascorbic acid. This was supported by the significant increase in ascorbic acid levels observed in the serum of fish-fed recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e for 90 days compared to the control group. The increase in serum ascorbic acid levels in fish-fed recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e corresponded to their growth performance results, which exhibited the highest positive effect on growth performance parameters compared to the other groups. This result aligns with several previous studies that have documented the advantageous effects of using both \u003cem\u003eB. subtilis\u003c/em\u003e and vitamin C as supplements in aquafeed, aiming to improve the overall growth of fish [ 7, 16, 44, 47\u0026ndash;49].\u003c/p\u003e \u003cp\u003eBeyond their role in enhancing growth performance, both vitamin C and probiotics are recognized as powerful immunomodulators that elicit immune responses in fish. In this study, normal fish fed with vitamin C, recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e, and wild-type probiotic \u003cem\u003eB. subtilis\u003c/em\u003e exhibited an increase in ACH50 activity, LZM activity, total Ig level, and phagocytic activity compared to the control group. According to our previous study [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], the probiotic \u003cem\u003eB. subtilis\u003c/em\u003e isolated from the intestine of Nile tilapia demonstrates substantial tolerance to the hostile environment of the gastrointestinal (GI) tract, thus increasing its chances of survival and colonization on the internal surfaces of the GI tract. Like other probiotics, the presence of probiotic \u003cem\u003eB. subtilis\u003c/em\u003e in the GI tract could activate the immune system of Nile tilapia through signaling by toll-like receptors (TLRs) on intestinal epithelial cells and antigen-presenting cells (APCs) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Meanwhile, the concentration of vitamin C in leukocytes and tissues has been reported to stimulate the activity of innate immune responses [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. A significant difference in ACH50 levels between day 30 and day 90 of the feeding trial was observed only in the groups of fish-fed a diet supplemented with \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e and the wild-type \u003cem\u003eB. subtilis\u003c/em\u003e. This finding indicates that the continuous administration of \u003cem\u003eB. subtilis\u003c/em\u003e could enhance the ACH50 activity of Nile tilapia, consistent with evidence from previous studies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The continuous administration of probiotics has led to an increase in complement component 3 (C3) through the stimulation of cytokines following recognition by TLRs, as described above [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Moreover, C3 is a central component in three complement pathways (classical, alternative, and lectin pathway). It interacts with other proteins in the complement cascade to form the membrane attack complex (MAC), ultimately killing pathogens. In addition, previous studies have demonstrated that supplementing with an appropriate amount of vitamin C can enhance complement activity in fish [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The concentration of vitamin C in tissues has an impact on the ACH50 activity; however, the precise function of vitamin C in the complement pathways is not fully elucidated [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. As a result, the highest ACH50 level was observed in the fish-fed recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e on day 90. This finding confirms the synergistic roles of vitamin C and \u003cem\u003eB. subtilis\u003c/em\u003e in this study. In addition, fish fed a diet supplemented with vitamin C, wild-type \u003cem\u003eB. subtilis\u003c/em\u003e, and \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e showed a significant increase in the total Ig level at day 90 compared to day 30 of the feeding trial. This result demonstrated the immunostimulatory function of vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e to stimulate the total Ig in Nile tilapia which could enhance the adaptive immune response.\u003c/p\u003e \u003cp\u003eIn this study, the results of LZM activity also confirmed the vital role of probiotic \u003cem\u003eB. subtilis\u003c/em\u003e and vitamin C in enhancing innate immunity through the mechanism of this enzyme. Similarly, several studies have stated that the supplementation with both vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e in fish diets could stimulate LZM activity by activating myeloid cells (macrophages, monocytes, and neutrophils) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In fish, LZM has emerged as a powerful innate defense that exerts antimicrobial activity directly against gram-positive bacteria or indirectly against gram-negative bacteria after disrupting the bacterial cell wall through the action of complement and other enzymes. In addition to the function described above, LZM and complement components (C1q, C3b, and Bb) also act as an innate opsonin that binds bacteria to accelerate and facilitate phagocytic activity in fish. This is evident in our phagocytic activity results, where fish fed with dietary supplementation of vitamin C and recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e exhibited significantly higher phagocytic activity. In teleost, SOD, MDA, GSH-Px, and CAT are the main antioxidant enzymes that protect fish from oxidative stress damage caused by free radicals. In this study, dietary supplementation with vitamin C and recombinant \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e exhibited higher contents of TAC, SOD, CAT, and GSH-Px, and lower levels of MDA in the serum of Nile tilapia compared to wild-type \u003cem\u003eB. subtilis\u003c/em\u003e and control groups, respectively. Although dietary supplementation with wild-type probiotic \u003cem\u003eB. subtilis\u003c/em\u003e tends to enhance the activity of these enzymes, there was no significant difference observed. Therefore, the increase in SOD, CAT, TAC, and GSH-Px levels, as well as the decrease in MDA levels in this study could primarily be attributed to the supplementation with vitamin C in the fish diet rather than resulting from probiotics. This result, indicating the enhancement of antioxidant enzymes, possibly occurs because of vitamin C's ability to readily donate electrons, aligning with previous findings in several teleost species [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. In an intensive culture system, Nile tilapia frequently encounter periods of stress at any time of their lives. The stress condition can cause an imbalance between oxygen-reactive species (ROS) and endogenous antioxidants in cells and tissues, potentially leading to cell and tissue damage. Hence, the continuous supply of an exogenous antioxidant, such as vitamin C supplementation in fish diets, becomes necessary to counteract the adverse effects of oxidative stress.\u003c/p\u003e \u003cp\u003eIn Thailand, \u003cem\u003eS. agalactiae\u003c/em\u003e has emerged as a major pathogenic bacterium, causing severe economic losses in tilapia farming [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. To investigate the effect of dietary supplementation with recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e on immune response following a challenge with \u003cem\u003eS. agalactiae\u003c/em\u003e, Nile tilapia were intraperitoneally injected with this bacterium after a 30-day feeding trial. The results showed that ACH50 level rapidly increased at 6 h post-injection in fish-fed vitamin C, wild-type, and recombinant probiotics compared to the control group. Meanwhile, total Ig levels were subsequently elevated at 24 and 48 h post-injection in the same groups. The rapid increase in ACH50 indicated its ability to attenuate/limit the spread of invading pathogens, a consequence of activation by either wild-type or recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e, as well as by vitamin C. The elevation of total Ig at 24 and 48 h post-injection could result from the opsonization facilitated by immune genes such as cytokines, phagocytes, and complement components, leading to the activation of the phase of adaptive immune responses. In the challenge test, LZM showed a significant elevation in levels starting at 6 h and continuing up to 48 h in fish fed with vitamin C, wild-type, and recombinant probiotics compared to the control group. These results reflect the enhanced ability of lysozyme, due to vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e, to eliminate \u003cem\u003eS. agalactiae\u003c/em\u003e in Nile tilapia. Our immune parameter results indicate that dietary supplementation with recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e could effectively enhance the immune response against \u003cem\u003eS. agalactiae\u003c/em\u003e infection in Nile tilapia. This enhancement is possibly due to the synergistic effects of vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e on fish immunity. Probiotic \u003cem\u003eB. subtilis\u003c/em\u003e is recognized for its role in regulating the fish gut's immune response, while vitamin C is notable for reinforcing the immune response and disease resistance, probably attributable to its antioxidant and immunostimulatory properties [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUnder normal conditions, the continuous application of probiotic \u003cem\u003eB. subtilis\u003c/em\u003e in fish feed influences the triggering of TLR4, serving as the pattern-recognition receptors that initiate the activation of the immune cascade. Additionally, dietary supplementation with vitamin C not only modulates the production of fish immune cells, contributing to maintaining immune homeostasis but also plays a role in disease resistance by activating the expression of inflammatory cytokines under stress conditions [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. In the challenge test, mRNA levels of proinflammatory cytokines, including CC chemokine and TNFα, in response to \u003cem\u003eS. agalactiae\u003c/em\u003e, were analyzed among the experimental fish after a 30-day feeding trial using qRT-PCR. The results indicated a significant and rapid increase in the expression of CC chemokine mRNAs at 6 h post \u003cem\u003eS\u003c/em\u003e. \u003cem\u003eagalactiae\u003c/em\u003e injection in the liver and spleen of fish supplemented with dietary vitamin C, wild-type, and recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e, compared to the control group. Similarly, a significant up-regulation of TNFα mRNA levels was exhibited in the liver at 6 h and in the spleen at 12 h post \u003cem\u003eS. agalactiae\u003c/em\u003e injection. These findings suggest that both vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e may potentially contribute to enhancing the production and chemoattractant activity of CC chemokine and TNFα. This facilitates the recruitment of white blood cells to the site of infection during the initial stage. Furthermore, our previous \u003cem\u003ein vitro\u003c/em\u003e study confirmed that the potential probiotic \u003cem\u003eB. subtilis\u003c/em\u003e, isolated from the intestine of Nile tilapia, exhibited antibacterial activity and effectively antagonized pathogenic \u003cem\u003eS. agalactiae\u003c/em\u003e. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Together, these findings suggest that the improvement of antagonistic activity against \u003cem\u003eS. agalactiae\u003c/em\u003e in recombinant \u003cem\u003eB. subtilis\u003c/em\u003e may be attributed to the synergistic effect of \u003cem\u003eB. subtilis\u003c/em\u003e and vitamin C, modulating innate and adaptive immunity in Nile tilapia.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, based on the overall results, dietary supplementation with recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e exhibited the synergistic effects of vitamin C and probiotic \u003cem\u003eB. subtilis\u003c/em\u003e. These effects resulted in improvements in growth performance, antioxidant activity, immune response, and antagonistic activity by enhancing the immune response and pro-inflammatory cytokine against \u003cem\u003eS. agalactiae\u003c/em\u003e in Nile tilapia. The application of probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e could provide a possible novel prophylactic strategy for the intensive aquaculture industry, which often relies on the application of drugs and chemicals.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eCompeting Interests\u003c/strong\u003e \u003cp\u003eWe certify that there is no conflict of interest in the manuscript.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work (Grant No. RGNS 64\u0026ndash;117) was financially supported by Office of the Permanent Secretary, Ministry of Higher Education, Science, Research and Innovation. In addition, we also deeply appreciate Suranaree University of Technology (SUT).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eS.B. and C.N. Conceptualization and project administration, C.N. funding acquisition, C.N., J.K. and P.M. methodology, data curation, C.N. validation, S.B. supervision, J.K. and C.N. writing original draft, P.S. and C.N. writing review and editing. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e \u003cp\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLiu H, Wang S, Cai Y et al (2017) Dietary administration of \u003cem\u003eBacillus subtilis\u003c/em\u003e HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. Fish Shellfish Immunol 60:326\u0026ndash;333. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2016.12.003\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2016.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C-H, Chiu C-H, Wang S-W, Cheng W (2012) Dietary administration of the probiotic, \u003cem\u003eBacillus subtilis\u003c/em\u003e E20, enhances the growth, innate immune responses, and disease resistance of the grouper, \u003cem\u003eEpinephelus coioides\u003c/em\u003e. Fish Shellfish Immunol 33:699\u0026ndash;706. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2012.06.012\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2012.06.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAly SM, Ahmed YA-G, Ghareeb AA-A, Mohamed MF (2008) Studies on \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e, as potential probiotics, on the immune response and resistance of Tilapia nilotica (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) to challenge infections. Fish Shellfish Immunol 25:128\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2008.03.013\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2008.03.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Liu Y, Shin H et al (2013) Developing \u003cem\u003eBacillus\u003c/em\u003e spp. as a cell factory for production of microbial enzymes and industrially important biochemicals in the context of systems and synthetic biology. Appl Microb Biotech 97:6113\u0026ndash;6127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00253-013-4960-4\u003c/span\u003e\u003cspan address=\"10.1007/s00253-013-4960-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui W, Han L, Suo F et al (2018) Exploitation of \u003cem\u003eBacillus subtilis\u003c/em\u003e as a robust workhorse for production of heterologous proteins and beyond. World J Microbiol Biotechnol 34:1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11274-018-2531-7\u003c/span\u003e\u003cspan address=\"10.1007/s11274-018-2531-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarsij M, Kanani HG, Adineh H (2020) Effects of antioxidant supplementation (nano\u0026ndash;selenium, vitamin C and E) on growth performance, blood biochemistry, immune status and body composition of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) under sub-lethal ammonia exposure. Aquaculture 521:734942. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2020.734942\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2020.734942\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZafar N, Khan MA (2020) Effects of dietary iron on growth, haematology, oxidative stress and hepatic ascorbic acid concentration of stinging catfish \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e. Aquaculture 516:734642. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2019.734642\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2019.734642\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohn T, George J, Hilton J, Slinger S (1979) Influence of dietary ascorbic acid on plasma lipid levels in the rainbow trout. Int J Vitam Nutr Res 49:400\u0026ndash;405\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarros MM, Falcon DR, de Oliveira Orsi R et al (2014) Non-specific immune parameters and physiological response of Nile tilapia fed β-glucan and vitamin C for different periods and submitted to stress and bacterial challenge. Fish Shellfish Immunol 39:188\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2014.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2014.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaxico Vieira CAS, Vieira JS, Bastos MS et al (2018) Expression of genes related to antioxidant activity in Nile tilapia kept under salinity stress and fed diets containing different levels of vitamin C. J Toxicol Environ Health Part A 81:20\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15287394.2017.14 01968\u003c/span\u003e\u003cspan address=\"10.1080/15287394.2017.14 01968\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGasco L, Gai F, Maricchiolo G et al (2018) Supplementation of vitamins, minerals, enzymes and antioxidants in fish feeds. Feeds Aquac Sect Curr Situat Altern Sources 63\u0026ndash;103. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-319-77941-6_4\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-77941-6_4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGouda A, Amer SA, Gabr S, Tolba SA (2020) Effect of dietary supplemental ascorbic acid and folic acid on the growth performance, redox status, and immune status of broiler chickens under heat stress. Trop Anim Health Prod 52:2987\u0026ndash;2996. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11250-020-02316-4\u003c/span\u003e\u003cspan address=\"10.1007/s11250-020-02316-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJauncey K, Soliman A, Roberts R (1985) Ascorbic acid requirements in relation to wound healing in the cultured tilapia \u003cem\u003eOreochromis niloticus\u003c/em\u003e (Trewavas). Aquac Res 16:139\u0026ndash;149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2109.1985.tb00303.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2109.1985.tb00303.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026aelig;land A, Waagb\u0026oslash; R (1998) Examination of the qualitative ability of some cold water marine teleosts to synthesise ascorbic acid. Comp Biochem Physiol Mol Integr Physiol 121:249\u0026ndash;255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1095-6433(98)10125-3\u003c/span\u003e\u003cspan address=\"10.1016/S1095-6433(98)10125-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZehra S, Khan S MA (2012) Dietary vitamin C requirement of fingerling, \u003cem\u003eCirrhinus mrigala\u003c/em\u003e (Hamilton), based on growth, feed conversion, protein retention, hematological indices, and liver vitamin C concentration. J World Aquac Soc 43:648\u0026ndash;658. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1749-7345.2012.00597.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1749-7345.2012.00597.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu C, Yu H, Li L et al (2022) Effects of Dietary Vitamin C on the Growth Performance, Biochemical Parameters, and Antioxidant Activity of Coho Salmon \u003cem\u003eOncorhynchus kisutch\u003c/em\u003e (Walbaum, 1792) Postsmolts. Aquac Nutr 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2022/6866578\u003c/span\u003e\u003cspan address=\"10.1155/2022/6866578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin M-F, Shiau S-Y (2005) Dietary L-ascorbic acid affects growth, nonspecific immune responses and disease resistance in juvenile grouper, \u003cem\u003eEpinephelus malabaricus\u003c/em\u003e. Aquaculture 244:215\u0026ndash;221. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2004.10.026\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2004.10.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoosta Z, Hajimoradloo A, Ghorbani R, Hoseinifar SH (2014) The effects of dietary vitamin C on mucosal immune responses and growth performance in Caspian roach (\u003cem\u003eRutilus rutilus caspicus\u003c/em\u003e) fry. Fish Physiol Biochem 40:1601\u0026ndash;1607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10695-014-9951-6\u003c/span\u003e\u003cspan address=\"10.1007/s10695-014-9951-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAi Q, Mai K, Zhang C et al (2004) Effects of dietary vitamin C on growth and immune response of Japanese seabass, \u003cem\u003eLateolabrax japonicus\u003c/em\u003e. Aquaculture 242:489\u0026ndash;500. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2004.08.016\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2004.08.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbo-Al-Ela HG, El-Nahas AF, Mahmoud S, Ibrahim EM (2017) Vitamin C modulates the immunotoxic effect of 17α-methyltestosterone in Nile tilapia. Biochemistry 56:2042\u0026ndash;2050. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.biochem.6b01284\u003c/span\u003e\u003cspan address=\"10.1021/acs.biochem.6b01284\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahkar E, Yun H, Kim D-J et al (2015) Effects of dietary vitamin C levels on tissue ascorbic acid concentration, hematology, non-specific immune response and gonad histology in broodstock Japanese eel, \u003cem\u003eAnguilla japonica\u003c/em\u003e. Aquaculture 438:115\u0026ndash;121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2015.01.001\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2015.01.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEo J, Lee K-J (2008) Effect of dietary ascorbic acid on growth and non-specific immune responses of tiger puffer, \u003cem\u003eTakifugu rubripes\u003c/em\u003e. Fish Shellfish Immunol 25:611\u0026ndash;616. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2008.08.009\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2008.08.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmirnoff N (2001) L-ascorbic acid biosynthesis. Vitam Horm 61:241\u0026ndash;266. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0083-6729(01)61008-2\u003c/span\u003e\u003cspan address=\"10.1016/S0083-6729(01)61008-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShanaka K, Jung S, Janson N et al (2021) Growth and Antioxidant-Related Effects of the Reestablished Ascorbic Acid Pathway in Zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) by Genomic Integration of L-Gulonolactone Oxidase From Cloudy Catshark (\u003cem\u003eScyliorhinus torazame\u003c/em\u003e). Front Physiol 12:685595. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2021.685595\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2021.685595\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrouin G, Godin J-R, Pag\u0026eacute; B (2011) The genetics of vitamin C loss in vertebrates. Curr Genom 12:371\u0026ndash;378. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/138920211796429736\u003c/span\u003e\u003cspan address=\"10.2174/138920211796429736\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Kim K-W, Bai SC et al (2003) Effects of the different levels of dietary vitamin C on growth and tissue ascorbic acid changes in parrot fish (\u003cem\u003eOplegnathus fasciatus\u003c/em\u003e). Aquaculture 215:203\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0044-8486(02)00042-X\u003c/span\u003e\u003cspan address=\"10.1016/S0044-8486(02)00042-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheraz M, Khan MF, Ahmed S et al (2015) Stability and stabilization of ascorbic acid. Househ Pers Care Today 10:22\u0026ndash;25\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin X, Chen K, Cheng H et al (2022) Chemical stability of ascorbic acid integrated into commercial products: A review on bioactivity and delivery technology. Antioxid 11:153. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox11010153\u003c/span\u003e\u003cspan address=\"10.3390/antiox11010153\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eComunian TA, Abbaspourrad A, Favaro-Trindade CS, Weitz DA (2014) Fabrication of solid lipid microcapsules containing ascorbic acid using a microfluidic technique. Food Chem 152:271\u0026ndash;275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2013.11.149\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2013.11.149\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Liu C, Li J (2020) Comparison of vitamin c and its derivative antioxidant activity: Evaluated by using density functional theory. ACS omega 5:25467\u0026ndash;25475. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acsomega.0c04318\u003c/span\u003e\u003cspan address=\"10.1021/acsomega.0c04318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToyohara H, Nakata T, Touhata K et al (1996) Transgenic Expression of l-Gulono-γ-lactone Oxidase in Medaka (\u003cem\u003eOryzias latipes\u003c/em\u003e), a Teleost Fish That Lacks This Enzyme Necessary for l-Ascorbic Acid Biosynthesis. Biochem Biophys Res Commun 223:650\u0026ndash;653. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/bbrc.1996.0949\u003c/span\u003e\u003cspan address=\"10.1006/bbrc.1996.0949\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi M, Gao M, Sun H et al (2023) Exogenous 2-keto-L-gulonic Acid Supplementation as a Novel Approach to Enhancing L-ascorbic Acid Biosynthesis in Zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e). Animals 13:2502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani13152502\u003c/span\u003e\u003cspan address=\"10.3390/ani13152502\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT CRAWFORD TC (1982) Synthesis of L-ascorbic acid. ACS Publications. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/ba-1982-0200.ch001\u003c/span\u003e\u003cspan address=\"10.1021/ba-1982-0200.ch001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakharuthai C, Boonanuntanasarn S, Kaewda J, Manassila P (2023) Isolation of Potential Probiotic \u003cem\u003eBacillus\u003c/em\u003e spp. from the Intestine of Nile Tilapia to Construct Recombinant Probiotic Expressing CC Chemokine and Its Effectiveness on Innate Immune Responses in Nile Tilapia. Animals 13:986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani13060986\u003c/span\u003e\u003cspan address=\"10.3390/ani13060986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue G-P, Johnson JS, Dalrymple BP (1999) High osmolarity improves the electro-transformation efficiency of the gram-positive bacteria \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eBacillus licheniformis\u003c/em\u003e. J Microbiol Methods 34:183\u0026ndash;191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0167-7012(98)00087-6\u003c/span\u003e\u003cspan address=\"10.1016/S0167-7012(98)00087-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePitaksong T, Kupittayanant P, Boonanuntanasarn S (2013) The effects of vitamins C and E on the growth, tissue accumulation and prophylactic response to thermal and acidic stress of hybrid catfish. Aquac Nutr 19:148\u0026ndash;162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2095.2012.00950.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2095.2012.00950.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiwicki A, Studnicka M (1987) The phagocytic ability of neutrophils and serum lysozyme activity in experimentally infected carp, \u003cem\u003eCyprinus carpio\u003c/em\u003e L. J Fish Biol 31:57\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1095-8649.1987.tb05293.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1095-8649.1987.tb05293.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilla S, Mathieu C, Wang N et al (2010) Spleen immune status is affected after acute handling stress but not regulated by cortisol in Eurasian perch, \u003cem\u003ePerca fluviatilis\u003c/em\u003e. Fish Shellfish Immunol 28:931\u0026ndash;941. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2010.02.012\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2010.02.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePuangkaew J, Kiron V, Somamoto T et al (2004) Nonspecific immune response of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e Walbaum) in relation to different status of vitamin E and highly unsaturated fatty acids. Fish Shellfish Immunol 16:25\u0026ndash;39. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1050-4648(03)00028-7\u003c/span\u003e\u003cspan address=\"10.1016/S1050-4648(03)00028-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBremus C, Herrmann U, Bringer-Meyer S, Sahm H (2006) The use of microorganisms in L-ascorbic acid production. J Biotech 124:196\u0026ndash;205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jbiotec.2006.01.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jbiotec.2006.01.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJim\u0026eacute;nez-Fern\u0026aacute;ndez E, Ruyra A, Roher N et al (2014) Nanoparticles as a novel delivery system for vitamin C administration in aquaculture. Aquaculture 432:426\u0026ndash;433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2014.03.006\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2014.03.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIbrahim RE, Amer SA, Farroh KY et al (2021) The effects of chitosan-vitamin C nanocomposite supplementation on the growth performance, antioxidant status, immune response, and disease resistance of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) fingerlings. Aquaculture 534:736269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2020.736269\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2020.736269\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian Y-S, Deng Y-D, Zhang W-H et al (2022) Metabolic engineering of \u003cem\u003eEscherichia coli\u003c/em\u003e for direct production of vitamin C from D-glucose. Biotechnol Biofuels Bioprod 15:1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13068-022-02184-0\u003c/span\u003e\u003cspan address=\"10.1186/s13068-022-02184-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWon S, Hamidoghli A, Choi W et al (2020) Effects of \u003cem\u003eBacillus subtilis\u003c/em\u003e WB60 and \u003cem\u003eLactococcus lactis\u003c/em\u003e on growth, immune responses, histology and gene expression in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. Microorganisms 8(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms8010067\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8010067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawood M, Koshio S (2016) Vitamin C supplementation to optimize growth, health and stress resistance in aquatic animals. Rev Aquac 10(2):334\u0026ndash;350. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12163\u003c/span\u003e\u003cspan address=\"10.1111/raq.12163\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Chen D, Lou B et al (2017) The effects of dietary vitamin C on growth performance, serum enzymes activities and resistance to \u003cem\u003eVibrio alginolyticus\u003c/em\u003e challenge of yellow drum \u003cem\u003eNibea albiflora\u003c/em\u003e. Aquac Res 48:4684\u0026ndash;4695. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.13290\u003c/span\u003e\u003cspan address=\"10.1111/are.13290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Lochmann R, Goodwin A et al (2004) Effects of dietary vitamins C and E on alternative complement activity, hematology, tissue composition, vitamin concentrations and response to heat stress in juvenile golden shiner (\u003cem\u003eNotemigonus crysoleucas\u003c/em\u003e). Aquaculture 242:553\u0026ndash;569. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2004.09.012\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2004.09.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim C, Yildirim-Aksoy M, Welker T et al (2010) Growth performance, immune response, and resistance to \u003cem\u003eStreptococcus iniae\u003c/em\u003e of Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e, fed diets containing various levels of vitamins C and E. J World Aquac Soc 41:35\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1749-7345.2009.00311.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1749-7345.2009.00311.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak S, Swain P, Mukherjee S (2007) Effect of dietary supplementation of probiotic and vitamin C on the immune response of Indian major carp, \u003cem\u003eLabeo rohita\u003c/em\u003e. Fish Shellfish Immunol 23:892\u0026ndash;896. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2007.02.008\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2007.02.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFong F, Shah FLY, Kirjavainen NP, El-Nezami P H (2016) Mechanism of action of probiotic bacteria on intestinal and systemic immunities and antigen-presenting cells. Int Rev Immunol 35:179\u0026ndash;188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/08830185.2015.1096937\u003c/span\u003e\u003cspan address=\"10.3109/08830185.2015.1096937\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerlhac V, Gabaudan J, Obach A et al (1996) Influence of dietary glucan and vitamin C on non-specific and specific immune responses of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Aquaculture 143:123\u0026ndash;133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0044-8486(95)01238-9\u003c/span\u003e\u003cspan address=\"10.1016/0044-8486(95)01238-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen M, Daha MR, Kallenberg CG (2010) The complement system in systemic autoimmune disease. J Autoimmun 34:J276\u0026ndash;J286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaut.2009.11.014\u003c/span\u003e\u003cspan address=\"10.1016/j.jaut.2009.11.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanase A, Thirabunyanon M, Promya J, Chitmanat C (2023) Influences of \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003efructooligosaccharide\u003c/em\u003e on growth performances, immune responses, and disease resistance of Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. Front Vet Sci 9:1094681. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2022.1094681\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2022.1094681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Lovell R (1985) Elevated levels of dietary ascorbic acid increase immune responses in channel catfish. J Nutr 115:123\u0026ndash;131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jn/115.1.123\u003c/span\u003e\u003cspan address=\"10.1093/jn/115.1.123\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHardie L, Fletcher T, Secombes C (1991) The effect of dietary vitamin C on the immune response of the Atlantic salmon (\u003cem\u003eSalmo salar L\u003c/em\u003e). Aquaculture 95:201\u0026ndash;214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0044-8486(91)90087-N\u003c/span\u003e\u003cspan address=\"10.1016/0044-8486(91)90087-N\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdorian TJ, Jamali H, Farsani HG et al (2019) Effects of probiotic bacteria \u003cem\u003eBacillus\u003c/em\u003e on growth performance, digestive enzyme activity, and hematological parameters of Asian sea bass, \u003cem\u003eLates calcarifer\u003c/em\u003e (Bloch). Probiotics Antimicrob Proteins 11:248\u0026ndash;255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-018-9393-z\u003c/span\u003e\u003cspan address=\"10.1007/s12602-018-9393-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedagoda N, Chotikachinda R, Hasanthi M, Lee K-J (2023) Dietary Supplementation of a Mixture of Nucleotides, β-Glucan and Vitamins C and E Improved the Growth and Health Performance of Olive Flounder, \u003cem\u003eParalichthys olivaceus\u003c/em\u003e. Fishes 8:302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/fishes8060302\u003c/span\u003e\u003cspan address=\"10.3390/fishes8060302\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawood MA, Zommara M, Eweedah NM et al (2020) The potential role of nano-selenium and vitamin C on the performances of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). Environ Sci Pollut Res 27:9843\u0026ndash;9852. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-020-07651-5\u003c/span\u003e\u003cspan address=\"10.1007/s11356-020-07651-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuanyuk N, Kong F, Ko D et al (2008) Occurrence of rare genotypes of \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e in cultured red tilapia \u003cem\u003eOreochromis\u003c/em\u003e sp. and Nile tilapia \u003cem\u003eO. niloticus\u003c/em\u003e in Thailand\u0026mdash;relationship to human isolates? Aquaculture 284:35\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2008.07.034\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2008.07.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak SK (2010) Probiotics and immunity: A fish perspective. Fish Shellfish Immunol 29:2\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2010.02.017\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2010.02.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos-S\u0026aacute;nchez NF, Salas-Coronado R, Villanueva-Ca\u0026ntilde;ongo C, Hern\u0026aacute;ndez-Carlos B (2019) Antioxidant compounds and their antioxidant mechanism. Antioxid 10:1\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.5772/intechopen.85270\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.85270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarr AC, Maggini S (2017) Vitamin C and immune function. Nutrients 9:1211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/nu9111211\u003c/span\u003e\u003cspan address=\"10.3390/nu9111211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"L-gulonolactone oxidase, Bacillus subtilis, antagonistic activity, Nile tilapia, Streptococcus agalactiae, Antioxidant","lastPublishedDoi":"10.21203/rs.3.rs-3997297/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3997297/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDue to the lack of the L-gulonolactone oxidase (\u003cem\u003eGULO\u003c/em\u003e) enzyme, Nile tilapia is unable to synthesize vitamin C and thus requires an adequate level of exogenous vitamin C in its diet. In our previous study, we isolated the probiotic \u003cem\u003eBacillus subtilis\u003c/em\u003e from the intestine of Nile tilapia. Our findings revealed its antagonistic activity against major pathogenic bacteria in Nile tilapia, as well as its ability to enhance the immune responses of the fish. In addition, \u003cem\u003eB. subtilis\u003c/em\u003e is an ideal bacterial factory to produce heterologous proteins. Therefore, this study aimed to construct a recombinant probiotic \u003cem\u003eB. subtilis\u003c/em\u003e expressing \u003cem\u003eGULO\u003c/em\u003e and investigated its effects as a dietary supplement in Nile tilapia. The fish were divided into four groups: those fed with a basal diet (CON), a basal diet\u0026thinsp;+\u0026thinsp;vitamin C (VC), a basal diet\u0026thinsp;+\u0026thinsp;wild-type \u003cem\u003eB. subtilis\u003c/em\u003e (BS), and a basal diet\u0026thinsp;+\u0026thinsp;recombinant \u003cem\u003eB. subtilis\u003c/em\u003e (BS\u0026thinsp;+\u0026thinsp;GULO). At day 90 of the feeding trial, significant enhancements in growth performance, immune response, and antioxidant capacity were observed in fish fed with BS\u0026thinsp;+\u0026thinsp;GULO. The HPLC analysis and qRT-PCR revealed a significant increase in serum ascorbic acid and \u003cem\u003eGULO\u003c/em\u003e mRNA levels in the intestine of the BS\u0026thinsp;+\u0026thinsp;GULO group, respectively. In the challenge test, a time-course experiment demonstrated a significant increase in the expression of pro-inflammatory genes and immune response against \u003cem\u003eS. agalactiae\u003c/em\u003e in the BS\u0026thinsp;+\u0026thinsp;GULO group, indicating an improvement in antagonistic activity compared to the wild-type \u003cem\u003eB. subtilis\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Improvement of antagonistic activity against Streptococcus agalactiae using recombinant Bacillus subtilis expressing L-gulonolactone oxidase: its effects on growth performance, immune response, and antioxidant activity in Nile tilapia, Oreochromis niloticus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-14 08:36:18","doi":"10.21203/rs.3.rs-3997297/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e3f4c159-43a2-4674-9346-fa5353df43d3","owner":[],"postedDate":"March 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T01:53:55+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-14 08:36:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3997297","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3997297","identity":"rs-3997297","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}