Trio-based whole-exome sequencing and Minigene assay identify a novel MYH11 splice site variant (c.2997+5G>C) in recurrent fetal megacystis

Trio-based whole-exome sequencing and Minigene assay identify a novel MYH11 splice site variant (c.2997+5G>C) in recurrent fetal megacystis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Trio-based whole-exome sequencing and Minigene assay identify a novel MYH11 splice site variant (c.2997+5G>C) in recurrent fetal megacystis Wenwen Li, Yeqing Qian, Pan Gao, Lihong Fan, Xinli Zhang, Xuekui Pan, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8478795/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Background Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a severe visceral myopathy attributed to defects in smooth muscle contraction. Although pathogenic variants in genes such as ACTG2 , LMOD1 , MYLK , MYH9 , and MYH11 have been associated with MMIHS, the complete genotypic spectrum remains inadequately characterized. Methods We reported a non-consanguineous Chinese family exhibiting recurrent fetal megacystis. Trio-based whole-exome sequencing (Trio-WES) was performed on the parents and the affected fetus. The functional impact of a novel splice site variant identified in the MYH11 gene was assessed using a Minigene splicing assay in vitro . Results Trio-based whole-exome sequencing identified compound heterozygous variants in the MYH11 gene: a maternally inherited 1.9 Mb deletion encompassing MYH11 at 16q13.11, and a novel paternally inherited splice site variant (c.2997 + 5G > C). Initially classified as a variant of uncertain significance (VUS), the pathogenicity of the c.2997 + 5G > C variant was confirmed through functional validation, which demonstrated aberrant splicing. This confirmation facilitated a definitive prenatal diagnosis. Conclusions This study identifies a novel pathogenic splice site variant in MYH11 associated with MMIHS and provides functional evidence supporting its role in the disease’s etiology. Our findings highlight the critical importance of integrating genomic analyses with functional assays to refine interpretation of VUS, expand the mutational spectrum of MMIHS, and improve genetic counseling for affected families. MMIHS Microdeletion 16q13.11 MYH11 Prenatal diagnosis Minigene splicing assay Figures Figure 1 Figure 2 Figure 3 Introduction Megacystis-Microcolon-Intestinal Hypoperistalsis Syndrome (MMIHS), also known as Berdon syndrome (OMIM#249210), is a rare congenital disorder that manifests early in life and is categorized under visceral myopathies. It is marked by significant abdominal distension caused by a large non-obstructive bladder, a microcolon, and reduced or absent intestinal peristalsis. This rare disorder is associated with high morbidity and mortality rates[ 1 ]. MMIHS has been reported globally, with a higher prevalence of cases documented in the United States, Canada, France, Japan, China, and Spain[ 2 ]. Despite its global presence, the incidence of MMIHS remains extremely low, underscoring its rarity and the challenges it poses for diagnosis. The disorder is predominantly inherited in an autosomal dominant manner, often linked to a heterozygous variant in the ACTG2 gene, which accounts for 44.1% of genetically resolved cases[ 3 ]. Nonetheless, autosomal recessive inheritance associated with MMIHS has also been documented, including genes such as MYH11 , MYLK , LMOD1 and MYL9 . These loci are significant pathogenic determinants that influence the development and function of smooth muscle, serving as primary etiological factors in MMIHS[ 4 ]. The prenatal detection of fetal megacystis via ultrasonographic can raise suspicion of MMIHS, aiding in the diagnosis in approximately 26% of cases[ 5 ]. With advancing insights into the molecular pathogenesis of MMIHS, prenatal genetic diagnosis has become crucial for providing precise genetic counseling. Although prenatal WES is now available in clinical settings, its effectiveness is limited by difficulties in interpreting variants and providing counseling, especially when novel homozygous mutations or VUS in disease-associated genes are identified[ 6 ]. Therefore, functional validation is essential to determine the clinical significance of these variants. In this study, we integrated Trio-WES with a Minigene splicing assay to confirm the genetic defect in a fetus suspected of having MMIHS, thereby improving diagnostic accuracy and informing clinical management. We reported on a non-consanguineous Chinese family in which two consecutive fetuses presenting pronounced megacystis. Through Trio-WES we identified compound heterozygous variants in the MYH11 gene: a maternally inherited heterozygous 1.9 Mb deletion at 16q13.11, which encompasses MYH11 , and a novel paternally inherited heterozygous splice site variant ( MYH11 : c.2997 + 5G > C). The c.2997 + 5G > C variant, is not documented in public databases such as ClinVar and HGMD and was classified as VUS according to ACMG/AMP guidelines. To ascertain its pathogenicity, we conducted functional studies to elucidate its impacts on RNA splicing. Based on these findings, we predicted its impact on myosin heavy chain 11 (MYH11) protein function. These investigations are intended to establish a definitive genotype-phenotype correlation, refine the classification of the variant, and provide evidence-based recommendations for prenatal diagnostics and family counseling. Materials and methods Subjects and tissue samples A 34-year-old healthy woman, with a history of two consecutive pregnancies complicated by severe fetal megacystis, was referred to the Prenatal Diagnosis Center, Huzhou Maternity & Child Health Care Hospital. Her first son was healthy. During her second pregnancy, ultrasound examination at 21 weeks of gestation identified fetal megacystis accompanied by bilateral renal collecting system dilation. While the fetal karyotype was normal, chromosomal microarray analysis (CMA) revealed a 1.9 Mb deletion at 16p13.11. The pregnancy was terminated. In her subsequent (third) pregnancy, which is the focus of this report, ultrasound at 15 weeks' gestation demonstrated a fetal abdominal cystic lesion (0.69 cm × 0.68 cm × 0.68 cm), suggestive of megacystis, along with bilateral pyelectasis (left: 0.29 cm, right: 0.39 cm). This pregnancy was also terminated. Peripheral blood samples were collected from both parents, and fetal muscle tissue was obtained from the third pregnancy for trio-WES. This study was carried out in accordance with the recommendations of the Ethics Committee of Huzhou Maternity & Child Health Care Hospital. The present study was approved by the hospital’s Institutional Review Board (2020-R-029), and written informed consent was obtained from the parents. Whole-exome sequencing and bioinformatic analysis Genomic DNA was extracted from the fetal muscle tissue and parental peripheral blood samples, followed by whole-exome sequencing. To identify minor allele frequencies (MAF < 0.1%) among all known variants, we utilized the Single Nucleotide Polymorphism database (dbSNP, http://www.ncbi.nlm.nih.gov/snp ), the 1000 Genomes Project database ( http://browser.1000genomes.org ), and the Genome Aggregation Database (gnomAD v4.0.0, http://gnomad.broadinstitute.org/ ). We employed online bioinformatics tools, including Mutation Taster ( http://www.mutationtaster.org ), PolyPhen-2 ( http://genetics.bwh.harvard.edu/pph2 ), SIFT ( http://sift.jcvi.org ), REVEL ( https://sites.google.com/site/revelgenomics/ ), CADD ( https://cadd.gs.washington.edu ), and SpliceAI ( https://github.com/lllumina/SpliceAl ), to predict the effects of these variants. The pathogenicity of candidate variants was interpreted and classified according to the guidelines of the American College of Medical Genetics and Genomics (ACMG)[ 7 ]. Segregation analysis within the family and carrier validation were performed using Sanger sequencing and real-time quantitative PCR. Sanger sequencing and real-time quantitative PCR (qPCR) Sanger sequencing was used to validate the MYH11 c.2997 + 5G > C variant in patient samples. Target-specific primers were designed using Primer 3 ( http://bioinfo.ut.ee/primer3-0.4.0/primer3/ ) and synthesized by TsingKe Biological Technology (China). The primer sequences were as follows: MYH11 -F (forward primer) TACTGACTACGGTGACCAGCTTGTC and MYH11 -R (reverse primer) CCTCCACAACAAAGGACCTTGA. PCR amplification was performed using a Taq DNA Polymerase Kit (TAKARA, Japan; Cat. No. R001A) under the following conditions: initial denaturation at 95°C for 5 minutes; 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. PCR products were analyzed by electrophoresis to confirm a single amplicon of the expected size before sequencing on an ABI 3730XL DNA Analyzer (Applied Biosystems). Sequence chromatograms were aligned and analyzed using Mutation Surveyor software (v4.0.4). To validate the copy number of the 16p13.11 region in patient samples, SYBR Green–based qPCR was performed. Amplifications were conducted using the SYBR Fast qPCR Mix (KAPA Biosystems, USA; Cat. No. KK4601) on a CFX96 Real-Time PCR Detection System (Bio-Rad, USA). The following primer sequences were used: -F (forward primer) CTCGTCACGTGATGGTCCTA and -R (reverse primer) CAACTTTGCGAGAACTCCGG. -F (forward primer) CGTGTGTGT NDE1 -F (forward primer) CTCGTCACGTGATGGTCCTA and NDE1 -R (reverse primer) CAACTTTGCGAGAACTCCGG. MYH11 -F (forward primer) CGTGTGTGT GCAGGTGAAG and MYH11 -R (reverse primer) CCCCAGCCATGCATCCATA. ABCC6 -F (forward primer) AACCAAGGTCATGTCTCCCC and ABCC6 -R (reverse primer) CGAACCCCTCCACCTTTGA. The thermal cycling protocol included an initial denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 2 seconds and annealing/extension at 60°C for 20 seconds. Fluorescence was measured at the end of each cycle. The relative gene copy number for each target was calculated using the 2 –ΔΔCt method, with β-actin as the reference gene. Minigene splicing assay We investigated the effect of the donor splice site mutations in intron 23 (c.2997 + 5G > C) and designed an in vitro strategy. Appropriate primers were designed for each intron/ exon segment for the variation. We designed the primers to amplify the regions of part of exon 21, intron 21, exon 22, intron 22, exon 23, intron 23, exon 24 and part of intron 24 with DNA of members of this pedigree and controls. The primers were designed by NCBI Primer-Blast software. The amplification length of product for MYH11 gene was 3458 bp (F: TTATGGGGTACGGGATCACCAGAATTCTGAACTGCAGAAGACCAAGG and R: ACGGGATCACCAGATATCTGGGATCCGTGATGCACGCCTGTAGTCT). We then constructed WT control and mutant mini genes using pSPL3 plasmid (Invitrogen Corporation, Carlsbad, CA). The empty vector was double digested using EcoR Ⅰ and BamH Ⅰ endonucleases at 37℃ for 4hrs and target DNA fragment PCR products amplifications were carried out with 20µl H 2 O, 25µl 2×phanta Max Master Mix, 2µl each primer and 1µl DNA in 50µl reaction volumes. The PCR reaction consisted of an initial denaturation at 95°C for 3min followed by 30 cycles of 15s at 95°C, 15s at 60°C, and 3 mins at 72°C, and a final extension step at 72°C for 5min. PCR product was purified using AxyGen Mag PCR Clean-Up Kit. The inserts were then recombination into pSPL3, the clean-up amplification products of DNA and linearized pSPL3 vector with 5×CE Ⅱ 4µl and Exnase Ⅱ 2µl were carried out in 20µl volumes and incubated at 37°C for 30min (ClonExpress Ⅱ, Vazyme Biotech Co., Ltd). E.coli DH5α competent cells were transformed with both the WT control and mutant mini gene constructs. The transformant constructs were then isolated using a NucleoBond Xtra midi kit (MN, Germany). The WT, mutant and empty control vector were transfected into COS7 cells using PolyJet reagent (SignaGen Laboratories, MD, USA). After 24 hours, RNA was extracted and RT-PCR (Primer script RT reagent, Takara) performed. The PCR products for the WT, mutant and empty vector were products was amplified using two pSPL3 primers (F: TCTGAGTCACCTGGACAACC and R: ATCTCAGTGGTATTTGTGAGC). The PCR products for both wildtype and mutant variants were analyzed on 2.5% agarose gel and sequenced. Results In this study, we examined the case of a 34-year-old healthy woman who experienced two consecutive pregnancies complicated by severe megacystis. Ultrasound evaluations of the third fetus at 15 weeks of gestation revealed a fetal abdominal cystic lesion measuring 0.69 cm × 0.68 cm × 0.68 cm, likely indicative of megacystis, along with bilateral pyelectasis (left: 0.29 cm, right: 0.39 cm) (Fig. 1 A, B). To investigate potential genetic etiologies, Trio-WES was conducted on genomic DNA exctracted from a fetal muscle tissue sample (gestational age: 15 weeks) and parental peripheral blood samples. This analysis identified compound heterozygous variants. The first variant was a large 1.9 Mb deletion at 16p13.11, inherited maternally, encompassing the MYH11 , NDE1 , and ABCC6 genes, and is frequently classified as a pathogenic copy number variation in clinical settings. This deletion was confirmed in the entire family via qPCR assay (Fig. 1 D). The second variant was an intronic variant in the MYH11 gene: chr16(hg38): g.15740046, c.2997 + 5G > C, p.? (NM_002474.3), inherited paternally (Fig. 1 E). This identified mutation is located in intron 23 of the MYH11 gene, and no mutation frequency is available in the gnomAD database. This mutation (c.2997 + 5G > C) has not been previously documented in any databases, including ClinVar, HGMD, or PubMed database, nor in the existing literature. Furthermore, functional prediction software, SpliceAI, has predicted the c.2997 + 5G > C variant to be pathogenic, with a score of 0.95. According to the ACMG guidelines, this variant is classified as a variant of uncertain significance due to insufficient evidence for definitive pathogenicity or benignity (PM2_Supporting + PM3 + PP3). To confirm the suspected genetic variants, Sanger sequencing and qPCR were conducted on the family, including the proband (the affected third fetus), the affected second fetus, and their parents. Both parents were identified as carriers of two variants, respectively. The two affected fetuses were compound heterozygotes, each possessing both parental mutations, which supporting an autosomal recessive inheritance pattern. Segregation analysis in the phenotypically normal son revealed that he carried only a single heterozygous deletion, consistent with carrier status and confirming the co-segregation of genotypes with the disease phenotype (Fig. 1 D, E). Finally, we constructed the genealogical tree of this family, incorporating genotypic data (Fig. 1 C). To verify the pathogenicity of the splice site mutation, we constructed the Minigene vectors for an in vitro splicing assay, utilizing both the wild-type and mutant c.2997 + 5G > C MYH11 gene sequences, spanning from part of exon 21 to exon 24 (Fig. 2 B). RT-PCR analysis of the wild-type MYH11 gene (encompassing part of exon 21 to exon 24) yielded an 808-bp product (Fig. 2 A, lane 2). COS7 cells transfected with an empty vector produced a 263-bp band (Fig. 2 A, lane 3). In contrast, cells expressing the c.2997 + 5G > C mutation generated an 868-bp product (Fig. 2 A, lane 1). Sequencing results confirmed that this mutation activates a cryptic splice site within intron 23, located downstream of the canonical donor splice site. This aberrant splicing event resulted in the retention of a 60-bp intronic sequence (GTGAGTAGGGGCCGGGTGCAGTGGCTCACGCCTATAATCCGAGCACTTTGGGAGGCCAAG) between exons 23 and 24, accounting for the observed 60-bp size increase in size, resulting in an in-frame insertion of 20 amino acids in the encoded protein. Structural analysis indicates that the in-frame insertion of 20 amino acids disrupts the canonical heptad repeat pattern of the coiled-coil domain (20 mod 7 = 6, corresponding to a + 1 phase shift), which is predicted to locally destabilize the helical dimer interface. This perturbation likely compromises the stability of myosin heavy chain dimerization and subsequent filament assembly, processes that are essential for smooth muscle contractility (Fig. 3 ). Discussion We report a novel case of MMIHS in a non-consanguineous Chinese family associated with compound heterozygous variants in the MYH11 gene. The affected fetuses inherited a 1.9 Mb microdeletion at 16p13.11 from the mother and a novel splice-site variant (c.2997 + 5G > C) from the father. Functional validation using a minigene splicing assay demonstrated that the c.2997 + 5G > C variant disrupts canonical splicing, resulting in retention of a 60-bp intronic segment and insertion of 20 amino acids into the C-terminal coiled-coil domain of myosin-11. Segregation analysis and functional evidence collectively support reclassification of this variant from a VUS to likely pathogenic under ACMG/AMP guidelines. This represents the first reported case of MYH11 -associated MMIHS due to compound heterozygosity between a large genomic deletion and a non-canonical intronic splice-altering variant. The recurrence of fetal phenotypes in two pregnancies, with an unaffected child carrying only one variant, is fully consistent with autosomal recessive inheritance. Our findings significantly expand the allelic spectrum of MYH11 -related disorders and underscore the clinical value of integrating trio-WES with functional assays for the interpretation of variants of uncertain significance in prenatal diagnostics. The pathophysiology of MMIHS remains incompletely elucidated, though accumulating evidence strongly supports a myogenic origin, characterized by defective smooth muscle contractility due to impaired actin-myosin interaction. Smooth muscle contraction is driven by the cyclical engagement of myosin heads with actin filaments, powered by ATP hydrolysis—a process orchestrated by the myosin motor protein complex[ 8 ]. MYH11 encodes the heavy chain of myosin-11, the primary structural component of thick filaments in visceral smooth muscle. Structurally, myosin-11 comprises three domains: an N-terminal motor domain responsible for actin binding and ATPase activity, a central neck region serving as a lever arm, and a C-terminal coiled-coil tail essential for dimerization and filament assembly[ 9 ]. Pathogenic variants in MYH11 disrupt the assembly of myosin thick filaments and their interaction with actin, thereby impairing contractile function in smooth muscle cells[ 10 , 11 ]. This systemic smooth muscle dysfunction underlies a spectrum of conditions, including thoracic aortic aneurysms and dissections, patent ductus arteriosus, visceral myopathy type 2, and MMIHS[ 12 ]. Notably, biallelic loss-of-function (LoF) mutations are the primary genetic cause of the recessive form of MMIHS. To date, six families with biallelic MYH11 -related MMIHS have been described. Among them, two consanguineous pedigrees harbored homozygous truncating variants[ 13 , 14 ], while the remaining exhibited compound heterozygosity with asymptomatic carrier parents. Although affected individuals show considerable clinical variability, they consistently present the diagnostic triad of megacystis, microcolon, and intestinal hypoperistalsis, reflecting widespread smooth muscle dysfunction. Beyond the core gastrointestinal and urinary features, multisystem involvement is frequently observed. Ocular abnormalities such as fixed mydriasis and impaired accommodation indicate iris sphincter dysfunction[ 15 , 16 ]. Respiratory complications include tracheobronchomalacia, pulmonary hypoplasia, and pulmonary hypertension[ 13 – 15 ]. Cardiovascular manifestations range from mild aortic dilation and patent ductus arteriosus to severe left ventricular hypoplasia with aortic stenosis[ 13 – 15 ]. Endocrine abnormalities such as growth hormone deficiency and central hypothyroidism have also been reported, possibly due to impaired hypothalamic-pituitary smooth muscle function[ 16 ]. Notably, recent evidence indicates that MYH11 -related MMIHS is not restricted to early life. Billon et al[ 17 ] described adult siblings in their third and fourth decades with late-onset manifestations, including severe bladder dysfunction, intestinal obstruction, recurrent sigmoid volvulus, and end-stage renal disease. This broad phenotypic continuum from neonatal lethality to adult survival, underscores the influence of allelic heterogeneity and residual protein function on disease severity and progression. At the molecular level, we report the first case of MMIHS associated with compound heterozygosity for a large deletion and an intronic variant in MYH11 . The proband carries a 1.9 Mb microdeletion at 16p13.11, which involves three established pathogenic genes cataloged in OMIM: NDE1 , ABCC6 , and MYH11 . NDE1 encoding nuclear neurodevelopment protein 1, represents the primary candidate gene for neurodevelopmental phenotypes associated with 16p13.11 microdeletions[ 18 ]. Pathogenic variants in ABCC6 (ATP-binding cassette subfamily C member 6) are etiologically linked to both pseudoxanthoma elasticum and generalized arterial calcification of infancy-two clinically distinct heritable disorders. The microdeletion also includes MYH11 , a gene exhibiting haploinsufficiency that is frequently classified as a pathogenic copy number variant in clinical diagnostics[ 19 ]. However, MYH11 haploinsufficiency alone is not pathogenic, as population studies demonstrate these large deletions occur in approximately 1:2300 individuals without apparent phenotypic consequences[ 20 ]. The 16p13.11 deletion is characterized by incomplete penetrance and highly variable phenotype expression, with affected individuals exhibiting global developmental delay, neuropsychiatric disorders, facial dysmorphism, microcephaly, and congenital defects[ 21 – 23 ]. In this study the proband's mother is unaffected and cognitively normal, consistent with the reduced penetrance reported for this deletion. While the deletion itself is insufficient to cause MMIHS, its inclusion of the MYH11 locus is critical for complete biallelic inactivation in the affected individual. The c.2997 + 5G > C variant resides at the + 5 position of the donor splice site in intron 23. Minigene assays confirmed that this change leads to aberrant splicing, producing an in-frame transcript with a 20-amino acid insertion within the coiled-coil tail domain. Structural modeling predicts that this insertion disrupts the canonical heptad repeat pattern, destabilizing the α-helical dimer interface and compromising filament assembly. The underlying mechanism likely involves activation of a cryptic splice site, causing misrecognition of intronic sequence as exonic. Intron retention, once considered transcriptional noise, is now recognized as a regulated process with pathogenic potential in monogenic diseases[ 24 , 25 ], and has been implicated in cancer, neurodevelopmental disorders, and immune dysregulation[ 26 ]. Our data reinforce that non-canonical splice variants—even those outside the invariant GT-AG dinucleotides—can exert profound functional consequences and warrant rigorous experimental validation. Genotype–phenotype correlations further illuminate disease mechanisms. Truncating variants—including nonsense mutations such as c.3598A > T (p.Lys1200*)[ 13 ] and c.1591C > T (p.Arg531*)[ 14 ], as well as frameshift mutations like c.2809_2810del (p.Arg937Glyfs*7) and c.3422_3470del (p.Lys1141Thrfs*20)[ 15 ]—are predominantly located in the coiled-coil tail domain and typically trigger nonsense-mediated decay, resulting in complete LoF and severe, often lethal, neonatal presentations. In contrast, missense mutations and in-frame deletions produce hypomorphic alleles that yield full-length but functionally impaired proteins, leading to delayed-onset or atypical clinical presentations. Pathogenic mechanisms include disruption of critical functional domains: for instance, the p.Pro127Ser substitution within the ATP-binding pocket demonstrably reduces ATP binding affinity and impairs energy transduction[ 16 ]; the p.Arg684His mutation adjacent to the head-neck salt bridge domain inhibits actin binding[ 27 ]; and the in-frame deletion p.Glu860del[ 17 ] induces a 90° conformational twist in the coiled-coil region, disrupting homodimerization and filament assembly. Collectively, these defects culminate in smooth muscle contractile failure. Disease severity is influenced by mutation type, genomic position, and allelic combination. Continued investigation into the genetics of MMIHS will further elucidate its pathological complexity and ultimately improve clinical management of affected individuals. Conclusions In summary, we describe a genetically and functionally characterized case of MYH11 -associated MMIHS arising from compound heterozygosity of a large 16p13.11 deletion and a novel splice-site variant. This expands the known mutational landscape of MYH11 and provides mechanistic insight into how non-canonical splicing defects can drive severe developmental phenotypes. Critically, our integrated approach—combining trio-WES with functional splicing assays—enabled definitive variant classification, demonstrating its utility in resolving VUS in prenatal settings. A precise molecular diagnosis not only clarifies disease etiology but also empowers families through accurate recurrence risk counseling (25%) and access to reproductive options such as preimplantation genetic testing (PGT-M) and early prenatal diagnosis. Future studies leveraging patient-derived models (e.g., iPSC-differentiated smooth muscle cells) will further elucidate the functional impact of MYH11 variants and inform therapeutic strategies. Although the study employed an in vitro minigene splicing assay to functionally validate the splice-altering effect and provided predictions regarding its potential impact on the protein, it did not experimentally assess the direct consequences of the aberrant splicing on MYH11 protein structure, expression levels, or functional activity. Consequently, the mechanistic understanding of pathogenicity remains somewhat limited. Abbreviations CMA chromosomal microarray analysis Trio-WES Trio-based whole-exome sequencing MMIHS megacystis-microcolon-intestinal hypoperistalsis syndrome VUS variants of uncertain significance qPCR real-time quantitative PCR Declarations Ethics approval and consent to participate The study was approved by the Ethics Committee of Huzhou Maternity & Child Health Care Hospital. Informed consent was obtained from the pregnant woman before the invasive procedure. Consent for publication Written informed consent was obtained from all individual participants (or their legal guardians) included in this study. The consent forms explicitly outlined that their anonymized data and any accompanying images (where applicable) would be used for publication in scientific journals. Competing interests The authors declare no competing interests. Author details 1 Center of Prenatal Diagnosis, Huzhou Maternity & Child Health Care Hospital, No. 2 East Street, Wuxing district, Huzhou 313000,Zhejiang,China 2 Women’s Hospital, School of Medicine, Zhejiang University, No.1 Xueshi road, Shangcheng district, Hangzhou 310006, Zhejiang, China Funding The work was supported by the Huzhou science and technology program (2022GY09). Author Contribution Manuscript writing: W.L.; Manuscript editing: X.S., G.S., and Q.L.; Ultrasound and data collection: X.P., L.F., and X.Z. All authors have read and agreed to the published version of the manuscript. Acknowledgement The authors would like to thank the families for their participation, and the staff of the Center of Prenatal Diagnosis, Huzhou Maternity & Child Health Care Hospital. Data Availability The raw sequencing data is available in the Sequence Read Archive (SRA) submission: PRJNA1397338. https://dataview.ncbi.nlm.nih.gov/object/PRJNA1397338 References Mc Laughlin D, Puri P. Familial megacystis microcolon intestinal hypoperistalsis syndrome: a systematic review. Pediatr Surg Int. 2013;29(9):947–51. Devavarapu PKV, Uppaluri KR, Nikhade VA, Palasamudram K, Sri Manjari K. Exploring the complexities of megacystis-microcolon-intestinal hypoperistalsis syndrome: insights from genetic studies. Clin J Gastroenterol. 2024;17(3):383–95. Nakamura H, O'Donnell AM, Puri P. Consanguinity and its relevance for the incidence of megacystis microcolon intestinal hypoperistalsis syndrome (MMIHS): systematic review. Pediatr Surg Int. 2019;35(2):175–80. Ambartsumyan L. Megacystis-Microcolon-Intestinal Hypoperistalsis Syndrome Overview. In: GeneReviews(®). Edited by Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Amemiya A. Seattle (WA): University of Washington, Seattle Copyright © 1993–2025, University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved.; 1993. Tuzovic L, Anyane-Yeboa K, Mills A, Glassberg K, Miller R. Megacystis-microcolon-intestinal hypoperistalsis syndrome: case report and review of prenatal ultrasonographic findings. Fetal Diagn Ther. 2014;36(1):74–80. Jelin AC, Sagaser KG, Wilkins-Haug L. Prenatal Genetic Testing Options. Pediatr Clin North Am. 2019;66(2):281–93. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405–24. Rayment I, Rypniewski WR, Schmidt-Bäse K, Smith R, Tomchick DR, Benning MM, Winkelmann DA, Wesenberg G, Holden HM. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science. 1993;261(5117):50–8. Krendel M, Mooseker MS. Myosins: tails (and heads) of functional diversity. Physiol (Bethesda). 2005;20:239–51. Chang Y, Yuan Q, Jiang P, Sun L, Ma Y, Ma X. Association of gene polymorphisms in MYH11 and TGF-β signaling with the susceptibility and clinical outcomes of DeBakey type III aortic dissection. Mamm Genome. 2022;33(3):555–63. Renard M, Callewaert B, Baetens M, Campens L, MacDermot K, Fryns JP, Bonduelle M, Dietz HC, Gaspar IM, Cavaco D, et al. Novel MYH11 and ACTA2 mutations reveal a role for enhanced TGFβ signaling in FTAAD. Int J Cardiol. 2013;165(2):314–21. Fournier N, Fabre A. Smooth muscle motility disorder phenotypes: A systematic review of cases associated with seven pathogenic genes (ACTG2, MYH11, FLNA, MYLK, RAD21, MYL9 and LMOD1). Intractable Rare Dis Res. 2022;11(3):113–9. Gauthier J, Ouled Amar Bencheikh B, Hamdan FF, Harrison SM, Baker LA, Couture F, Thiffault I, Ouazzani R, Samuels ME, Mitchell GA, et al. A homozygous loss-of-function variant in MYH11 in a case with megacystis-microcolon-intestinal hypoperistalsis syndrome. Eur J Hum Genet. 2015;23(9):1266–8. Billon C, Molin A, Poirsier C, Clemenson A, Dauge C, Grelet M, Sigaudy S, Patrier S, Goldenberg A, Layet V, et al. Fetal megacystis-microcolon: Genetic mutational spectrum and identification of PDCL3 as a novel candidate gene. Clin Genet. 2020;98(3):261–73. Yetman AT, Starr LJ. Newly described recessive MYH11 disorder with clinical overlap of Multisystemic smooth muscle dysfunction and Megacystis microcolon hypoperistalsis syndromes. Am J Med Genet A. 2018;176(4):1011–4. Kloth K, Renner S, Burmester G, Steinemann D, Pabst B, Lorenz B, Simon R, Kolbe V, Hempel M, Rosenberger G. 16p13.11 microdeletion uncovers loss-of-function of a MYH11 missense variant in a patient with megacystis-microcolon-intestinal-hypoperistalsis syndrome. Clin Genet. 2019;96(1):85–90. Billon C, Piccoli GB, de Sainte Agathe JM, Stoeva R, Derive N, Heidet L, Berrebi D, Bruneval P, Jeunemaitre X, Hureaux M. Genome-wide analysis identifies MYH11 compound heterozygous variants leading to visceral myopathy corresponding to late-onset form of megacystis-microcolon-intestinal hypoperistalsis syndrome. Mol Genet Genomics. 2024;299(1):44. Granata P, Cocciadiferro D, Zito A, Pessina C, Bassani A, Zambonin F, Novelli A, Fasano M, Casalone R. Whole Exome Sequencing in 16p13.11 Microdeletion Patients Reveals New Variants Through Deductive and Systems Medicine Approaches. Front Genet. 2022;13:798607. Cai M, Que Y, Chen X, Chen Y, Liang B, Huang H, Xu L, Lin N. 16p13.11 microdeletion/microduplication in fetuses: investigation of associated ultrasound phenotypes, genetic anomalies, and pregnancy outcome follow-up. BMC Pregnancy Childbirth. 2022;22(1):913. Tropeano M, Andrieux J, Collier DA. Clinical utility gene card for: 16p13.11 microdeletion syndrome. Eur J Hum Genet 2014, 22(5). Nagamani SC, Erez A, Bader P, Lalani SR, Scott DA, Scaglia F, Plon SE, Tsai CH, Reimschisel T, Roeder E, et al. Phenotypic manifestations of copy number variation in chromosome 16p13.11. Eur J Hum Genet. 2011;19(3):280–6. Atli EI, Yalcintepe S, Atli E, Demir S, Mail C, Gurkan H. Clinical Implications of Chromosome 16 Copy Number Variation. Mol Syndromol. 2022;13(3):184–92. Luo X, Wu L, Song J, Xu J, Huang R, Niu H, Zhou F, Pei Y, Liu W, Wei F. Prenatal Diagnosis, Ultrasound Findings, and Follow-Up Evaluation of 16p13.11 Deletion and Duplication Syndromes: Preliminary Assessment of Fetal Genotype-Phenotype. J Clin Lab Anal. 2025;39(13):e70051. Jacob AG, Smith CWJ. Intron retention as a component of regulated gene expression programs. Hum Genet. 2017;136(9):1043–57. Monteuuis G, Wong JJL, Bailey CG, Schmitz U, Rasko JEJ. The changing paradigm of intron retention: regulation, ramifications and recipes. Nucleic Acids Res. 2019;47(22):11497–513. Kumar M, Grammatikakis I. Causes, Consequences and Challenges of Intron Retention in lncRNAs. Mol Cell Biol 2025:1–9. Wang Q, Zhang J, Wang H, Feng Q, Luo F, Xie J. Compound heterozygous variants in MYH11 underlie autosomal recessive megacystis-microcolon-intestinal hypoperistalsis syndrome in a Chinese family. J Hum Genet. 2019;64(11):1067–73. Additional Declarations No competing interests reported. Supplementary Files PRJNA1397338.jpg SRR36662436.jpg SRA.jpg Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 17 Mar, 2026 Reviews received at journal 10 Mar, 2026 Reviews received at journal 08 Mar, 2026 Reviewers agreed at journal 18 Feb, 2026 Reviewers agreed at journal 18 Feb, 2026 Reviewers invited by journal 22 Jan, 2026 Editor assigned by journal 22 Jan, 2026 Editor invited by journal 12 Jan, 2026 Submission checks completed at journal 11 Jan, 2026 First submitted to journal 11 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8478795","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":580901331,"identity":"868382e0-fdd0-424d-bbf8-c23516d7af4f","order_by":0,"name":"Wenwen Li","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenwen","middleName":"","lastName":"Li","suffix":""},{"id":580901332,"identity":"f967a1e7-22f1-487c-b755-0685dce9b478","order_by":1,"name":"Yeqing Qian","email":"","orcid":"","institution":"Women's Hospital, School of Medicine, Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Yeqing","middleName":"","lastName":"Qian","suffix":""},{"id":580901333,"identity":"db41c503-11a6-45e3-808a-4404fd2a110b","order_by":2,"name":"Pan Gao","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Pan","middleName":"","lastName":"Gao","suffix":""},{"id":580901334,"identity":"0a3f95ee-a64f-4149-a904-fba7ec05561b","order_by":3,"name":"Lihong Fan","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Fan","suffix":""},{"id":580901335,"identity":"3bdcb047-e282-473d-8a62-f98941a776bb","order_by":4,"name":"Xinli Zhang","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xinli","middleName":"","lastName":"Zhang","suffix":""},{"id":580901336,"identity":"9d13b838-fb7b-4719-bb4d-19d59671ebe5","order_by":5,"name":"Xuekui Pan","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xuekui","middleName":"","lastName":"Pan","suffix":""},{"id":580901340,"identity":"8ada2008-f4b2-49f9-b297-e1c0ec3df99e","order_by":6,"name":"Guosong Shen","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Guosong","middleName":"","lastName":"Shen","suffix":""},{"id":580901342,"identity":"b607ab88-4e6d-45c2-bdea-ff06e5cc99c4","order_by":7,"name":"Qiongshan Li","email":"","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qiongshan","middleName":"","lastName":"Li","suffix":""},{"id":580901346,"identity":"e3024d5a-683b-49da-880a-55728a98357b","order_by":8,"name":"Xueping Shen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIie3RMQrCMBSA4ZRAXaJZU7p4hAeFuuQmLhEhk+4OBVsEuwiuCr2FFyg86FTwAF0CXiAnEIubKCSjQ/75fcN7j5BQ6C+Laqt2gnJK0XgS2hHby0lSxxo8Sayj61FzuLO58AIwnPIHizHNkBEghVw6SdL0i4wxzHKctoZ0elu6CBcbSJnAdY4zBVGJbhK/CeD+dmAgvAgXWicXpSlQX5I0iGBbSQWOR1Y+u8BQVWb1HF95RjS2kG5CPn6hnONfJBQKhUK/egHnpj0GXyW4JQAAAABJRU5ErkJggg==","orcid":"","institution":"Huzhou Maternity \u0026 Child Health Care Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xueping","middleName":"","lastName":"Shen","suffix":""}],"badges":[],"createdAt":"2025-12-30 07:54:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8478795/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8478795/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101397983,"identity":"3ff8a768-1068-4965-9fa6-ddbf29e8a3e1","added_by":"auto","created_at":"2026-01-29 09:38:41","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":254254,"visible":true,"origin":"","legend":"\u003cp\u003eA compound heterozygous mutation in the \u003cem\u003eMYH11\u003c/em\u003e gene was identified in a fetus presenting severe megacystis. A-B: Ultrasound scans of the third fetus. Severe megacystis (0.69 cm×0.68 cm×0.68 cm) and bilateral pyelectasis (left: 0.29 cm, right: 0.39 cm) at 15weeks' gestation. C: Pedigree of the family (arrow indicates the fetus in this study). D: Quantitative PCR validation of 16p13.11 microdeletion encompassing \u003cem\u003eNDE1\u003c/em\u003e, \u003cem\u003eMYH11\u003c/em\u003e, and \u003cem\u003eABCC6\u003c/em\u003e genes in both control individuals and family members. A copy number ratio of approximately 1.0 indicates normal diploidy, whereas ratios approximately 0.5 suggest a heterozygous deletion. E: Sanger sequencing validation of the \u003cem\u003eMYH11\u003c/em\u003e c.2997+5G\u0026gt;C variant identified by whole-exome sequencing (red box indicates the mutation). The Sanger sequencing chromatograms show the \u003cem\u003eMYH11\u003c/em\u003e: c.2997+5G\u0026gt;C variant in the proband, mother, father, and a second affected fetus, in comparison to the reference sequence (RefSeq).\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/2359167a7fcd7d4154d81d52.jpg"},{"id":101351552,"identity":"4ea0af4c-84fe-481a-bd8e-91787cc53e56","added_by":"auto","created_at":"2026-01-28 18:52:28","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":114020,"visible":true,"origin":"","legend":"\u003cp\u003eMinigene splicing assay. A: Agarose gel electrophoresis of RT-PCR products from\u003cem\u003e MYH11\u003c/em\u003e wild-type and mutant minigene constructs. Lane M: the 1500bp marker/ladder; Lane1: the mutant mRNA aberrantly spliced is 868 bp, Lane2: the wild-type correctly spliced is 808 bp, Lane3: empty vector 263 bp, Lane4: blank control. B: Splicing schematic representation of the Minigene splicing assay. The wild-type splicing model shown by continuous lines leading to a transcript that includes part of exon 21 to exon 24 as well as the exogenous plasmid sequences SD6 and SA2. Splicing schematic representation showing normal splicing in the wild-type transcript and aberrant splicing with partial intron 23 retention in the mutant. C: Sanger sequencing of the RT-PCR products. The mutation causes missplicing, leading to the inclusion of a 60-bp segment from intron 23.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/1568c05b4a5ac603c1683be9.jpg"},{"id":101351555,"identity":"4059458c-feb4-412e-bdf6-8cbebadb83c9","added_by":"auto","created_at":"2026-01-28 18:52:28","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":54934,"visible":true,"origin":"","legend":"\u003cp\u003eDomain architecture of the human MYH11 protein (NM_002474.3) highlighting a +20-amino acid insertion between exons 23 and 24 that disrupts coiled-coil stability. The schematic depicts the domain structure of smooth muscle MYH11 (NM_002474.3), featuring the N-terminal motor domain (Myosin_head, PF00063), two IQ motifs (PF00612), and the C-terminal coiled-coil rod domain (Myosin_tail_1, PF01576). The inset highlights exons 21-29, where an alternatively spliced 60-nucleotide cryptic exon between exons 23 and 24 leads to an in-frame insertion of 20 amino acids (+20 aa). Structural modeling predicts this insertion disrupts the heptad repeat register (20 mod 7 = 6; +1 phase shift), potentially destabilizing the coiled-coil dimer interface and impairing myosin filament assembly.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/88a14558c7baa96e71c10df0.jpg"},{"id":101755960,"identity":"68ab8b36-d978-4023-8672-f87103e9b501","added_by":"auto","created_at":"2026-02-03 10:55:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1052807,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/1db0577c-a236-48cf-b606-4af0f41cae27.pdf"},{"id":101397929,"identity":"530e40b7-2d98-4c16-ba78-75195ca74912","added_by":"auto","created_at":"2026-01-29 09:38:12","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":201212,"visible":true,"origin":"","legend":"","description":"","filename":"PRJNA1397338.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/ccc4eb05b001b904426685a7.jpg"},{"id":101751520,"identity":"c70cf379-f1d3-476b-b087-fd26846dc75d","added_by":"auto","created_at":"2026-02-03 10:20:59","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":227598,"visible":true,"origin":"","legend":"","description":"","filename":"SRR36662436.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/fd41ca7958709818727d1b8a.jpg"},{"id":101398472,"identity":"0e32032d-812e-4b80-b799-4104b4b5ae98","added_by":"auto","created_at":"2026-01-29 09:41:44","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":252014,"visible":true,"origin":"","legend":"","description":"","filename":"SRA.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8478795/v1/e676873e36442ff2423f21e4.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Trio-based whole-exome sequencing and Minigene assay identify a novel MYH11 splice site variant (c.2997+5G\u003eC) in recurrent fetal megacystis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMegacystis-Microcolon-Intestinal Hypoperistalsis Syndrome (MMIHS), also known as Berdon syndrome (OMIM#249210), is a rare congenital disorder that manifests early in life and is categorized under visceral myopathies. It is marked by significant abdominal distension caused by a large non-obstructive bladder, a microcolon, and reduced or absent intestinal peristalsis. This rare disorder is associated with high morbidity and mortality rates[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. MMIHS has been reported globally, with a higher prevalence of cases documented in the United States, Canada, France, Japan, China, and Spain[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite its global presence, the incidence of MMIHS remains extremely low, underscoring its rarity and the challenges it poses for diagnosis.\u003c/p\u003e \u003cp\u003eThe disorder is predominantly inherited in an autosomal dominant manner, often linked to a heterozygous variant in the \u003cem\u003eACTG2\u003c/em\u003e gene, which accounts for 44.1% of genetically resolved cases[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Nonetheless, autosomal recessive inheritance associated with MMIHS has also been documented, including genes such as \u003cem\u003eMYH11\u003c/em\u003e, \u003cem\u003eMYLK\u003c/em\u003e, \u003cem\u003eLMOD1\u003c/em\u003e and \u003cem\u003eMYL9\u003c/em\u003e. These loci are significant pathogenic determinants that influence the development and function of smooth muscle, serving as primary etiological factors in MMIHS[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The prenatal detection of fetal megacystis via ultrasonographic can raise suspicion of MMIHS, aiding in the diagnosis in approximately 26% of cases[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. With advancing insights into the molecular pathogenesis of MMIHS, prenatal genetic diagnosis has become crucial for providing precise genetic counseling. Although prenatal WES is now available in clinical settings, its effectiveness is limited by difficulties in interpreting variants and providing counseling, especially when novel homozygous mutations or VUS in disease-associated genes are identified[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therefore, functional validation is essential to determine the clinical significance of these variants. In this study, we integrated Trio-WES with a Minigene splicing assay to confirm the genetic defect in a fetus suspected of having MMIHS, thereby improving diagnostic accuracy and informing clinical management.\u003c/p\u003e \u003cp\u003eWe reported on a non-consanguineous Chinese family in which two consecutive fetuses presenting pronounced megacystis. Through Trio-WES we identified compound heterozygous variants in the \u003cem\u003eMYH11\u003c/em\u003e gene: a maternally inherited heterozygous 1.9 Mb deletion at 16q13.11, which encompasses \u003cem\u003eMYH11\u003c/em\u003e, and a novel paternally inherited heterozygous splice site variant (\u003cem\u003eMYH11\u003c/em\u003e: c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C). The c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant, is not documented in public databases such as ClinVar and HGMD and was classified as VUS according to ACMG/AMP guidelines. To ascertain its pathogenicity, we conducted functional studies to elucidate its impacts on RNA splicing. Based on these findings, we predicted its impact on myosin heavy chain 11 (MYH11) protein function. These investigations are intended to establish a definitive genotype-phenotype correlation, refine the classification of the variant, and provide evidence-based recommendations for prenatal diagnostics and family counseling.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSubjects and tissue samples\u003c/h2\u003e \u003cp\u003eA 34-year-old healthy woman, with a history of two consecutive pregnancies complicated by severe fetal megacystis, was referred to the Prenatal Diagnosis Center, Huzhou Maternity \u0026amp; Child Health Care Hospital. Her first son was healthy. During her second pregnancy, ultrasound examination at 21 weeks of gestation identified fetal megacystis accompanied by bilateral renal collecting system dilation. While the fetal karyotype was normal, chromosomal microarray analysis (CMA) revealed a 1.9 Mb deletion at 16p13.11. The pregnancy was terminated. In her subsequent (third) pregnancy, which is the focus of this report, ultrasound at 15 weeks' gestation demonstrated a fetal abdominal cystic lesion (0.69 cm \u0026times; 0.68 cm \u0026times; 0.68 cm), suggestive of megacystis, along with bilateral pyelectasis (left: 0.29 cm, right: 0.39 cm). This pregnancy was also terminated.\u003c/p\u003e \u003cp\u003ePeripheral blood samples were collected from both parents, and fetal muscle tissue was obtained from the third pregnancy for trio-WES. This study was carried out in accordance with the recommendations of the Ethics Committee of Huzhou Maternity \u0026amp; Child Health Care Hospital. The present study was approved by the hospital\u0026rsquo;s Institutional Review Board (2020-R-029), and written informed consent was obtained from the parents.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eWhole-exome sequencing and bioinformatic analysis\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted from the fetal muscle tissue and parental peripheral blood samples, followed by whole-exome sequencing. To identify minor allele frequencies (MAF\u0026thinsp;\u0026lt;\u0026thinsp;0.1%) among all known variants, we utilized the Single Nucleotide Polymorphism database (dbSNP, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/snp\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/snp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), the 1000 Genomes Project database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://browser.1000genomes.org\u003c/span\u003e\u003cspan address=\"http://browser.1000genomes.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the Genome Aggregation Database (gnomAD v4.0.0, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gnomad.broadinstitute.org/\u003c/span\u003e\u003cspan address=\"http://gnomad.broadinstitute.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). We employed online bioinformatics tools, including Mutation Taster (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mutationtaster.org\u003c/span\u003e\u003cspan address=\"http://www.mutationtaster.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), PolyPhen-2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://genetics.bwh.harvard.edu/pph2\u003c/span\u003e\u003cspan address=\"http://genetics.bwh.harvard.edu/pph2\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), SIFT (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://sift.jcvi.org\u003c/span\u003e\u003cspan address=\"http://sift.jcvi.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), REVEL (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://sites.google.com/site/revelgenomics/\u003c/span\u003e\u003cspan address=\"https://sites.google.com/site/revelgenomics/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), CADD (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cadd.gs.washington.edu\u003c/span\u003e\u003cspan address=\"https://cadd.gs.washington.edu\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and SpliceAI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/lllumina/SpliceAl\u003c/span\u003e\u003cspan address=\"https://github.com/lllumina/SpliceAl\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), to predict the effects of these variants. The pathogenicity of candidate variants was interpreted and classified according to the guidelines of the American College of Medical Genetics and Genomics (ACMG)[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Segregation analysis within the family and carrier validation were performed using Sanger sequencing and real-time quantitative PCR.\u003c/p\u003e\n\u003ch3\u003eSanger sequencing and real-time quantitative PCR (qPCR)\u003c/h3\u003e\n\u003cp\u003eSanger sequencing was used to validate the \u003cem\u003eMYH11\u003c/em\u003e c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant in patient samples. Target-specific primers were designed using Primer 3 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinfo.ut.ee/primer3-0.4.0/primer3/\u003c/span\u003e\u003cspan address=\"http://bioinfo.ut.ee/primer3-0.4.0/primer3/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and synthesized by TsingKe Biological Technology (China). The primer sequences were as follows: \u003cem\u003eMYH11\u003c/em\u003e-F (forward primer) TACTGACTACGGTGACCAGCTTGTC and \u003cem\u003eMYH11\u003c/em\u003e-R (reverse primer) CCTCCACAACAAAGGACCTTGA. PCR amplification was performed using a Taq DNA Polymerase Kit (TAKARA, Japan; Cat. No. R001A) under the following conditions: initial denaturation at 95\u0026deg;C for 5 minutes; 35 cycles of denaturation at 95\u0026deg;C for 30 seconds, annealing at 60\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 30 seconds. PCR products were analyzed by electrophoresis to confirm a single amplicon of the expected size before sequencing on an ABI 3730XL DNA Analyzer (Applied Biosystems). Sequence chromatograms were aligned and analyzed using Mutation Surveyor software (v4.0.4).\u003c/p\u003e \u003cp\u003eTo validate the copy number of the 16p13.11 region in patient samples, SYBR Green\u0026ndash;based qPCR was performed. Amplifications were conducted using the SYBR Fast qPCR Mix (KAPA Biosystems, USA; Cat. No. KK4601) on a CFX96 Real-Time PCR Detection System (Bio-Rad, USA). The following primer sequences were used:\u003c/p\u003e\n\u003ch3\u003e-F (forward primer) CTCGTCACGTGATGGTCCTA and -R (reverse primer) CAACTTTGCGAGAACTCCGG. -F (forward primer) CGTGTGTGT\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cem\u003eNDE1\u003c/em\u003e-F (forward primer) CTCGTCACGTGATGGTCCTA and \u003cem\u003eNDE1\u003c/em\u003e-R (reverse primer) CAACTTTGCGAGAACTCCGG. \u003cem\u003eMYH11\u003c/em\u003e-F (forward primer) CGTGTGTGT\u003c/div\u003e \u003cp\u003eGCAGGTGAAG and \u003cem\u003eMYH11\u003c/em\u003e-R (reverse primer) CCCCAGCCATGCATCCATA. \u003cem\u003eABCC6\u003c/em\u003e-F (forward primer) AACCAAGGTCATGTCTCCCC and \u003cem\u003eABCC6\u003c/em\u003e-R (reverse primer) CGAACCCCTCCACCTTTGA. The thermal cycling protocol included an initial denaturation at 95\u0026deg;C for 3 minutes, followed by 40 cycles of denaturation at 95\u0026deg;C for 2 seconds and annealing/extension at 60\u0026deg;C for 20 seconds. Fluorescence was measured at the end of each cycle. The relative gene copy number for each target was calculated using the 2\u003csup\u003e\u0026ndash;ΔΔCt\u003c/sup\u003e method, with β-actin as the reference gene.\u003c/p\u003e\n\u003ch3\u003eMinigene splicing assay\u003c/h3\u003e\n\u003cp\u003eWe investigated the effect of the donor splice site mutations in intron 23 (c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C) and designed an in vitro strategy. Appropriate primers were designed for each intron/ exon segment for the variation. We designed the primers to amplify the regions of part of exon 21, intron 21, exon 22, intron 22, exon 23, intron 23, exon 24 and part of intron 24 with DNA of members of this pedigree and controls. The primers were designed by NCBI Primer-Blast software. The amplification length of product for \u003cem\u003eMYH11\u003c/em\u003e gene was 3458 bp (F: TTATGGGGTACGGGATCACCAGAATTCTGAACTGCAGAAGACCAAGG and R: ACGGGATCACCAGATATCTGGGATCCGTGATGCACGCCTGTAGTCT). We then constructed WT control and mutant mini genes using pSPL3 plasmid (Invitrogen Corporation, Carlsbad, CA). The empty vector was double digested using EcoR Ⅰ and BamH Ⅰ endonucleases at 37℃ for 4hrs and target DNA fragment PCR products amplifications were carried out with 20\u0026micro;l H\u003csub\u003e2\u003c/sub\u003eO, 25\u0026micro;l 2\u0026times;phanta Max Master Mix, 2\u0026micro;l each primer and 1\u0026micro;l DNA in 50\u0026micro;l reaction volumes. The PCR reaction consisted of an initial denaturation at 95\u0026deg;C for 3min followed by 30 cycles of 15s at 95\u0026deg;C, 15s at 60\u0026deg;C, and 3 mins at 72\u0026deg;C, and a final extension step at 72\u0026deg;C for 5min. PCR product was purified using AxyGen Mag PCR Clean-Up Kit.\u003c/p\u003e \u003cp\u003eThe inserts were then recombination into pSPL3, the clean-up amplification products of DNA and linearized pSPL3 vector with 5\u0026times;CE Ⅱ 4\u0026micro;l and Exnase Ⅱ 2\u0026micro;l were carried out in 20\u0026micro;l volumes and incubated at 37\u0026deg;C for 30min (ClonExpress Ⅱ, Vazyme Biotech Co., Ltd). \u003cem\u003eE.coli\u003c/em\u003e DH5α competent cells were transformed with both the WT control and mutant mini gene constructs. The transformant constructs were then isolated using a NucleoBond Xtra midi kit (MN, Germany). The WT, mutant and empty control vector were transfected into COS7 cells using PolyJet reagent (SignaGen Laboratories, MD, USA). After 24 hours, RNA was extracted and RT-PCR (Primer script RT reagent, Takara) performed. The PCR products for the WT, mutant and empty vector were products was amplified using two pSPL3 primers (F: TCTGAGTCACCTGGACAACC and R: ATCTCAGTGGTATTTGTGAGC). The PCR products for both wildtype and mutant variants were analyzed on 2.5% agarose gel and sequenced.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIn this study, we examined the case of a 34-year-old healthy woman who experienced two consecutive pregnancies complicated by severe megacystis. Ultrasound evaluations of the third fetus at 15 weeks of gestation revealed a fetal abdominal cystic lesion measuring 0.69 cm \u0026times; 0.68 cm \u0026times; 0.68 cm, likely indicative of megacystis, along with bilateral pyelectasis (left: 0.29 cm, right: 0.39 cm) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). To investigate potential genetic etiologies, Trio-WES was conducted on genomic DNA exctracted from a fetal muscle tissue sample (gestational age: 15 weeks) and parental peripheral blood samples. This analysis identified compound heterozygous variants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe first variant was a large 1.9 Mb deletion at 16p13.11, inherited maternally, encompassing the \u003cem\u003eMYH11\u003c/em\u003e, \u003cem\u003eNDE1\u003c/em\u003e, and \u003cem\u003eABCC6\u003c/em\u003e genes, and is frequently classified as a pathogenic copy number variation in clinical settings. This deletion was confirmed in the entire family via qPCR assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The second variant was an intronic variant in the \u003cem\u003eMYH11\u003c/em\u003e gene: chr16(hg38): g.15740046, c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C, p.? (NM_002474.3), inherited paternally (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). This identified mutation is located in intron 23 of the \u003cem\u003eMYH11\u003c/em\u003e gene, and no mutation frequency is available in the gnomAD database. This mutation (c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C) has not been previously documented in any databases, including ClinVar, HGMD, or PubMed database, nor in the existing literature. Furthermore, functional prediction software, SpliceAI, has predicted the c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant to be pathogenic, with a score of 0.95. According to the ACMG guidelines, this variant is classified as a variant of uncertain significance due to insufficient evidence for definitive pathogenicity or benignity (PM2_Supporting\u0026thinsp;+\u0026thinsp;PM3\u0026thinsp;+\u0026thinsp;PP3).\u003c/p\u003e \u003cp\u003eTo confirm the suspected genetic variants, Sanger sequencing and qPCR were conducted on the family, including the proband (the affected third fetus), the affected second fetus, and their parents. Both parents were identified as carriers of two variants, respectively. The two affected fetuses were compound heterozygotes, each possessing both parental mutations, which supporting an autosomal recessive inheritance pattern. Segregation analysis in the phenotypically normal son revealed that he carried only a single heterozygous deletion, consistent with carrier status and confirming the co-segregation of genotypes with the disease phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, E). Finally, we constructed the genealogical tree of this family, incorporating genotypic data (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eTo verify the pathogenicity of the splice site mutation, we constructed the Minigene vectors for an in vitro splicing assay, utilizing both the wild-type and mutant c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C \u003cem\u003eMYH11\u003c/em\u003e gene sequences, spanning from part of exon 21 to exon 24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). RT-PCR analysis of the wild-type \u003cem\u003eMYH11\u003c/em\u003e gene (encompassing part of exon 21 to exon 24) yielded an 808-bp product (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, lane 2). COS7 cells transfected with an empty vector produced a 263-bp band (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, lane 3). In contrast, cells expressing the c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C mutation generated an 868-bp product (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, lane 1). Sequencing results confirmed that this mutation activates a cryptic splice site within intron 23, located downstream of the canonical donor splice site. This aberrant splicing event resulted in the retention of a 60-bp intronic sequence (GTGAGTAGGGGCCGGGTGCAGTGGCTCACGCCTATAATCCGAGCACTTTGGGAGGCCAAG) between exons 23 and 24, accounting for the observed 60-bp size increase in size, resulting in an in-frame insertion of 20 amino acids in the encoded protein. Structural analysis indicates that the in-frame insertion of 20 amino acids disrupts the canonical heptad repeat pattern of the coiled-coil domain (20 mod 7\u0026thinsp;=\u0026thinsp;6, corresponding to a\u0026thinsp;+\u0026thinsp;1 phase shift), which is predicted to locally destabilize the helical dimer interface. This perturbation likely compromises the stability of myosin heavy chain dimerization and subsequent filament assembly, processes that are essential for smooth muscle contractility (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe report a novel case of MMIHS in a non-consanguineous Chinese family associated with compound heterozygous variants in the \u003cem\u003eMYH11\u003c/em\u003e gene. The affected fetuses inherited a 1.9 Mb microdeletion at 16p13.11 from the mother and a novel splice-site variant (c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C) from the father. Functional validation using a minigene splicing assay demonstrated that the c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant disrupts canonical splicing, resulting in retention of a 60-bp intronic segment and insertion of 20 amino acids into the C-terminal coiled-coil domain of myosin-11. Segregation analysis and functional evidence collectively support reclassification of this variant from a VUS to likely pathogenic under ACMG/AMP guidelines. This represents the first reported case of \u003cem\u003eMYH11\u003c/em\u003e-associated MMIHS due to compound heterozygosity between a large genomic deletion and a non-canonical intronic splice-altering variant. The recurrence of fetal phenotypes in two pregnancies, with an unaffected child carrying only one variant, is fully consistent with autosomal recessive inheritance. Our findings significantly expand the allelic spectrum of \u003cem\u003eMYH11\u003c/em\u003e-related disorders and underscore the clinical value of integrating trio-WES with functional assays for the interpretation of variants of uncertain significance in prenatal diagnostics.\u003c/p\u003e \u003cp\u003eThe pathophysiology of MMIHS remains incompletely elucidated, though accumulating evidence strongly supports a myogenic origin, characterized by defective smooth muscle contractility due to impaired actin-myosin interaction. Smooth muscle contraction is driven by the cyclical engagement of myosin heads with actin filaments, powered by ATP hydrolysis\u0026mdash;a process orchestrated by the myosin motor protein complex[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. \u003cem\u003eMYH11\u003c/em\u003e encodes the heavy chain of myosin-11, the primary structural component of thick filaments in visceral smooth muscle. Structurally, myosin-11 comprises three domains: an N-terminal motor domain responsible for actin binding and ATPase activity, a central neck region serving as a lever arm, and a C-terminal coiled-coil tail essential for dimerization and filament assembly[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Pathogenic variants in \u003cem\u003eMYH11\u003c/em\u003e disrupt the assembly of myosin thick filaments and their interaction with actin, thereby impairing contractile function in smooth muscle cells[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This systemic smooth muscle dysfunction underlies a spectrum of conditions, including thoracic aortic aneurysms and dissections, patent ductus arteriosus, visceral myopathy type 2, and MMIHS[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Notably, biallelic loss-of-function (LoF) mutations are the primary genetic cause of the recessive form of MMIHS.\u003c/p\u003e \u003cp\u003eTo date, six families with biallelic \u003cem\u003eMYH11\u003c/em\u003e-related MMIHS have been described. Among them, two consanguineous pedigrees harbored homozygous truncating variants[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], while the remaining exhibited compound heterozygosity with asymptomatic carrier parents. Although affected individuals show considerable clinical variability, they consistently present the diagnostic triad of megacystis, microcolon, and intestinal hypoperistalsis, reflecting widespread smooth muscle dysfunction. Beyond the core gastrointestinal and urinary features, multisystem involvement is frequently observed. Ocular abnormalities such as fixed mydriasis and impaired accommodation indicate iris sphincter dysfunction[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Respiratory complications include tracheobronchomalacia, pulmonary hypoplasia, and pulmonary hypertension[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Cardiovascular manifestations range from mild aortic dilation and patent ductus arteriosus to severe left ventricular hypoplasia with aortic stenosis[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Endocrine abnormalities such as growth hormone deficiency and central hypothyroidism have also been reported, possibly due to impaired hypothalamic-pituitary smooth muscle function[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Notably, recent evidence indicates that \u003cem\u003eMYH11\u003c/em\u003e-related MMIHS is not restricted to early life. Billon et al[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] described adult siblings in their third and fourth decades with late-onset manifestations, including severe bladder dysfunction, intestinal obstruction, recurrent sigmoid volvulus, and end-stage renal disease. This broad phenotypic continuum from neonatal lethality to adult survival, underscores the influence of allelic heterogeneity and residual protein function on disease severity and progression.\u003c/p\u003e \u003cp\u003eAt the molecular level, we report the first case of MMIHS associated with compound heterozygosity for a large deletion and an intronic variant in \u003cem\u003eMYH11\u003c/em\u003e. The proband carries a 1.9 Mb microdeletion at 16p13.11, which involves three established pathogenic genes cataloged in OMIM: \u003cem\u003eNDE1\u003c/em\u003e, \u003cem\u003eABCC6\u003c/em\u003e, and \u003cem\u003eMYH11\u003c/em\u003e. \u003cem\u003eNDE1\u003c/em\u003e encoding nuclear neurodevelopment protein 1, represents the primary candidate gene for neurodevelopmental phenotypes associated with 16p13.11 microdeletions[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Pathogenic variants in \u003cem\u003eABCC6\u003c/em\u003e (ATP-binding cassette subfamily C member 6) are etiologically linked to both pseudoxanthoma elasticum and generalized arterial calcification of infancy-two clinically distinct heritable disorders. The microdeletion also includes \u003cem\u003eMYH11\u003c/em\u003e, a gene exhibiting haploinsufficiency that is frequently classified as a pathogenic copy number variant in clinical diagnostics[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, \u003cem\u003eMYH11\u003c/em\u003e haploinsufficiency alone is not pathogenic, as population studies demonstrate these large deletions occur in approximately 1:2300 individuals without apparent phenotypic consequences[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The 16p13.11 deletion is characterized by incomplete penetrance and highly variable phenotype expression, with affected individuals exhibiting global developmental delay, neuropsychiatric disorders, facial dysmorphism, microcephaly, and congenital defects[\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In this study the proband's mother is unaffected and cognitively normal, consistent with the reduced penetrance reported for this deletion. While the deletion itself is insufficient to cause MMIHS, its inclusion of the \u003cem\u003eMYH11\u003c/em\u003e locus is critical for complete biallelic inactivation in the affected individual. The c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant resides at the +\u0026thinsp;5 position of the donor splice site in intron 23. Minigene assays confirmed that this change leads to aberrant splicing, producing an in-frame transcript with a 20-amino acid insertion within the coiled-coil tail domain. Structural modeling predicts that this insertion disrupts the canonical heptad repeat pattern, destabilizing the α-helical dimer interface and compromising filament assembly. The underlying mechanism likely involves activation of a cryptic splice site, causing misrecognition of intronic sequence as exonic. Intron retention, once considered transcriptional noise, is now recognized as a regulated process with pathogenic potential in monogenic diseases[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and has been implicated in cancer, neurodevelopmental disorders, and immune dysregulation[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Our data reinforce that non-canonical splice variants\u0026mdash;even those outside the invariant GT-AG dinucleotides\u0026mdash;can exert profound functional consequences and warrant rigorous experimental validation.\u003c/p\u003e \u003cp\u003eGenotype\u0026ndash;phenotype correlations further illuminate disease mechanisms. Truncating variants\u0026mdash;including nonsense mutations such as c.3598A\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Lys1200*)[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and c.1591C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Arg531*)[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], as well as frameshift mutations like c.2809_2810del (p.Arg937Glyfs*7) and c.3422_3470del (p.Lys1141Thrfs*20)[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u0026mdash;are predominantly located in the coiled-coil tail domain and typically trigger nonsense-mediated decay, resulting in complete LoF and severe, often lethal, neonatal presentations. In contrast, missense mutations and in-frame deletions produce hypomorphic alleles that yield full-length but functionally impaired proteins, leading to delayed-onset or atypical clinical presentations. Pathogenic mechanisms include disruption of critical functional domains: for instance, the p.Pro127Ser substitution within the ATP-binding pocket demonstrably reduces ATP binding affinity and impairs energy transduction[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]; the p.Arg684His mutation adjacent to the head-neck salt bridge domain inhibits actin binding[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]; and the in-frame deletion p.Glu860del[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] induces a 90\u0026deg; conformational twist in the coiled-coil region, disrupting homodimerization and filament assembly. Collectively, these defects culminate in smooth muscle contractile failure. Disease severity is influenced by mutation type, genomic position, and allelic combination. Continued investigation into the genetics of MMIHS will further elucidate its pathological complexity and ultimately improve clinical management of affected individuals.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, we describe a genetically and functionally characterized case of \u003cem\u003eMYH11\u003c/em\u003e-associated MMIHS arising from compound heterozygosity of a large 16p13.11 deletion and a novel splice-site variant. This expands the known mutational landscape of \u003cem\u003eMYH11\u003c/em\u003e and provides mechanistic insight into how non-canonical splicing defects can drive severe developmental phenotypes. Critically, our integrated approach\u0026mdash;combining trio-WES with functional splicing assays\u0026mdash;enabled definitive variant classification, demonstrating its utility in resolving VUS in prenatal settings. A precise molecular diagnosis not only clarifies disease etiology but also empowers families through accurate recurrence risk counseling (25%) and access to reproductive options such as preimplantation genetic testing (PGT-M) and early prenatal diagnosis. Future studies leveraging patient-derived models (e.g., iPSC-differentiated smooth muscle cells) will further elucidate the functional impact of \u003cem\u003eMYH11\u003c/em\u003e variants and inform therapeutic strategies. Although the study employed an in vitro minigene splicing assay to functionally validate the splice-altering effect and provided predictions regarding its potential impact on the protein, it did not experimentally assess the direct consequences of the aberrant splicing on MYH11 protein structure, expression levels, or functional activity. Consequently, the mechanistic understanding of pathogenicity remains somewhat limited.\u003c/p\u003e"},{"header":"Abbreviations","content":" \u003cp\u003eCMA chromosomal microarray analysis\u003c/p\u003e \u003cp\u003eTrio-WES Trio-based whole-exome sequencing\u003c/p\u003e \u003cp\u003eMMIHS megacystis-microcolon-intestinal hypoperistalsis syndrome\u003c/p\u003e \u003cp\u003eVUS variants of uncertain significance\u003c/p\u003e \u003cp\u003eqPCR real-time quantitative PCR\u003c/p\u003e \u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eThe study was approved by the Ethics Committee of Huzhou Maternity \u0026amp; Child Health Care Hospital. Informed consent was obtained from the pregnant woman before the invasive procedure.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eWritten informed consent was obtained from all individual participants (or their legal guardians) included in this study. The consent forms explicitly outlined that their anonymized data and any accompanying images (where applicable) would be used for publication in scientific journals.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eAuthor details\u003c/h2\u003e \u003cp\u003e1 Center of Prenatal Diagnosis, Huzhou Maternity \u0026amp; Child Health Care Hospital, No. 2 East Street, Wuxing\u003c/p\u003e \u003cp\u003edistrict, Huzhou 313000,Zhejiang,China\u003c/p\u003e \u003cp\u003e2 Women\u0026rsquo;s Hospital, School of Medicine, Zhejiang University, No.1 Xueshi road, Shangcheng district, Hangzhou\u003c/p\u003e \u003cp\u003e310006, Zhejiang, China\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe work was supported by the Huzhou science and technology program (2022GY09).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eManuscript writing: W.L.; Manuscript editing: X.S., G.S., and Q.L.; Ultrasound and data collection: X.P., L.F., and X.Z. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank the families for their participation, and the staff of the Center of Prenatal Diagnosis, Huzhou Maternity \u0026amp; Child Health Care Hospital.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe raw sequencing data is available in the Sequence Read Archive (SRA) submission: PRJNA1397338. https://dataview.ncbi.nlm.nih.gov/object/PRJNA1397338\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMc Laughlin D, Puri P. Familial megacystis microcolon intestinal hypoperistalsis syndrome: a systematic review. Pediatr Surg Int. 2013;29(9):947\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDevavarapu PKV, Uppaluri KR, Nikhade VA, Palasamudram K, Sri Manjari K. Exploring the complexities of megacystis-microcolon-intestinal hypoperistalsis syndrome: insights from genetic studies. Clin J Gastroenterol. 2024;17(3):383\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura H, O'Donnell AM, Puri P. Consanguinity and its relevance for the incidence of megacystis microcolon intestinal hypoperistalsis syndrome (MMIHS): systematic review. Pediatr Surg Int. 2019;35(2):175\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmbartsumyan L. Megacystis-Microcolon-Intestinal Hypoperistalsis Syndrome Overview. In: \u003cem\u003eGeneReviews(\u0026reg;).\u003c/em\u003e Edited by Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE, Amemiya A. Seattle (WA): University of Washington, Seattle Copyright \u0026copy; 1993\u0026ndash;2025, University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved.; 1993.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuzovic L, Anyane-Yeboa K, Mills A, Glassberg K, Miller R. Megacystis-microcolon-intestinal hypoperistalsis syndrome: case report and review of prenatal ultrasonographic findings. Fetal Diagn Ther. 2014;36(1):74\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJelin AC, Sagaser KG, Wilkins-Haug L. Prenatal Genetic Testing Options. Pediatr Clin North Am. 2019;66(2):281\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRayment I, Rypniewski WR, Schmidt-B\u0026auml;se K, Smith R, Tomchick DR, Benning MM, Winkelmann DA, Wesenberg G, Holden HM. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science. 1993;261(5117):50\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrendel M, Mooseker MS. Myosins: tails (and heads) of functional diversity. Physiol (Bethesda). 2005;20:239\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang Y, Yuan Q, Jiang P, Sun L, Ma Y, Ma X. Association of gene polymorphisms in MYH11 and TGF-β signaling with the susceptibility and clinical outcomes of DeBakey type III aortic dissection. Mamm Genome. 2022;33(3):555\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenard M, Callewaert B, Baetens M, Campens L, MacDermot K, Fryns JP, Bonduelle M, Dietz HC, Gaspar IM, Cavaco D, et al. Novel MYH11 and ACTA2 mutations reveal a role for enhanced TGFβ signaling in FTAAD. Int J Cardiol. 2013;165(2):314\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFournier N, Fabre A. Smooth muscle motility disorder phenotypes: A systematic review of cases associated with seven pathogenic genes (ACTG2, MYH11, FLNA, MYLK, RAD21, MYL9 and LMOD1). Intractable Rare Dis Res. 2022;11(3):113\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGauthier J, Ouled Amar Bencheikh B, Hamdan FF, Harrison SM, Baker LA, Couture F, Thiffault I, Ouazzani R, Samuels ME, Mitchell GA, et al. A homozygous loss-of-function variant in MYH11 in a case with megacystis-microcolon-intestinal hypoperistalsis syndrome. Eur J Hum Genet. 2015;23(9):1266\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBillon C, Molin A, Poirsier C, Clemenson A, Dauge C, Grelet M, Sigaudy S, Patrier S, Goldenberg A, Layet V, et al. Fetal megacystis-microcolon: Genetic mutational spectrum and identification of PDCL3 as a novel candidate gene. Clin Genet. 2020;98(3):261\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYetman AT, Starr LJ. Newly described recessive MYH11 disorder with clinical overlap of Multisystemic smooth muscle dysfunction and Megacystis microcolon hypoperistalsis syndromes. Am J Med Genet A. 2018;176(4):1011\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKloth K, Renner S, Burmester G, Steinemann D, Pabst B, Lorenz B, Simon R, Kolbe V, Hempel M, Rosenberger G. 16p13.11 microdeletion uncovers loss-of-function of a MYH11 missense variant in a patient with megacystis-microcolon-intestinal-hypoperistalsis syndrome. Clin Genet. 2019;96(1):85\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBillon C, Piccoli GB, de Sainte Agathe JM, Stoeva R, Derive N, Heidet L, Berrebi D, Bruneval P, Jeunemaitre X, Hureaux M. Genome-wide analysis identifies MYH11 compound heterozygous variants leading to visceral myopathy corresponding to late-onset form of megacystis-microcolon-intestinal hypoperistalsis syndrome. Mol Genet Genomics. 2024;299(1):44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGranata P, Cocciadiferro D, Zito A, Pessina C, Bassani A, Zambonin F, Novelli A, Fasano M, Casalone R. Whole Exome Sequencing in 16p13.11 Microdeletion Patients Reveals New Variants Through Deductive and Systems Medicine Approaches. Front Genet. 2022;13:798607.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai M, Que Y, Chen X, Chen Y, Liang B, Huang H, Xu L, Lin N. 16p13.11 microdeletion/microduplication in fetuses: investigation of associated ultrasound phenotypes, genetic anomalies, and pregnancy outcome follow-up. BMC Pregnancy Childbirth. 2022;22(1):913.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTropeano M, Andrieux J, Collier DA. Clinical utility gene card for: 16p13.11 microdeletion syndrome. Eur J Hum Genet 2014, 22(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagamani SC, Erez A, Bader P, Lalani SR, Scott DA, Scaglia F, Plon SE, Tsai CH, Reimschisel T, Roeder E, et al. Phenotypic manifestations of copy number variation in chromosome 16p13.11. Eur J Hum Genet. 2011;19(3):280\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtli EI, Yalcintepe S, Atli E, Demir S, Mail C, Gurkan H. Clinical Implications of Chromosome 16 Copy Number Variation. Mol Syndromol. 2022;13(3):184\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo X, Wu L, Song J, Xu J, Huang R, Niu H, Zhou F, Pei Y, Liu W, Wei F. Prenatal Diagnosis, Ultrasound Findings, and Follow-Up Evaluation of 16p13.11 Deletion and Duplication Syndromes: Preliminary Assessment of Fetal Genotype-Phenotype. J Clin Lab Anal. 2025;39(13):e70051.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacob AG, Smith CWJ. Intron retention as a component of regulated gene expression programs. Hum Genet. 2017;136(9):1043\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteuuis G, Wong JJL, Bailey CG, Schmitz U, Rasko JEJ. The changing paradigm of intron retention: regulation, ramifications and recipes. Nucleic Acids Res. 2019;47(22):11497\u0026ndash;513.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar M, Grammatikakis I. Causes, Consequences and Challenges of Intron Retention in lncRNAs. Mol Cell Biol 2025:1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Zhang J, Wang H, Feng Q, Luo F, Xie J. Compound heterozygous variants in MYH11 underlie autosomal recessive megacystis-microcolon-intestinal hypoperistalsis syndrome in a Chinese family. J Hum Genet. 2019;64(11):1067\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-medical-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mgnm","sideBox":"Learn more about [BMC Medical Genomics](http://bmcmedgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mgnm/default.aspx","title":"BMC Medical Genomics","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"MMIHS, Microdeletion 16q13.11, MYH11, Prenatal diagnosis, Minigene splicing assay","lastPublishedDoi":"10.21203/rs.3.rs-8478795/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8478795/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMegacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a severe visceral myopathy attributed to defects in smooth muscle contraction. Although pathogenic variants in genes such as \u003cem\u003eACTG2\u003c/em\u003e, \u003cem\u003eLMOD1\u003c/em\u003e, \u003cem\u003eMYLK\u003c/em\u003e, \u003cem\u003eMYH9\u003c/em\u003e, and \u003cem\u003eMYH11\u003c/em\u003e have been associated with MMIHS, the complete genotypic spectrum remains inadequately characterized.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe reported a non-consanguineous Chinese family exhibiting recurrent fetal megacystis. Trio-based whole-exome sequencing (Trio-WES) was performed on the parents and the affected fetus. The functional impact of a novel splice site variant identified in the \u003cem\u003eMYH11\u003c/em\u003e gene was assessed using a Minigene splicing assay \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eTrio-based whole-exome sequencing identified compound heterozygous variants in the \u003cem\u003eMYH11\u003c/em\u003e gene: a maternally inherited 1.9 Mb deletion encompassing \u003cem\u003eMYH11\u003c/em\u003e at 16q13.11, and a novel paternally inherited splice site variant (c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C). Initially classified as a variant of uncertain significance (VUS), the pathogenicity of the c.2997\u0026thinsp;+\u0026thinsp;5G\u0026thinsp;\u0026gt;\u0026thinsp;C variant was confirmed through functional validation, which demonstrated aberrant splicing. This confirmation facilitated a definitive prenatal diagnosis.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study identifies a novel pathogenic splice site variant in \u003cem\u003eMYH11\u003c/em\u003e associated with MMIHS and provides functional evidence supporting its role in the disease\u0026rsquo;s etiology. Our findings highlight the critical importance of integrating genomic analyses with functional assays to refine interpretation of VUS, expand the mutational spectrum of MMIHS, and improve genetic counseling for affected families.\u003c/p\u003e","manuscriptTitle":"Trio-based whole-exome sequencing and Minigene assay identify a novel MYH11 splice site variant (c.2997+5G\u0026gt;C) in recurrent fetal megacystis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-28 18:52:23","doi":"10.21203/rs.3.rs-8478795/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-17T10:47:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-10T09:22:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-08T15:20:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"226916891555672181120403346837102796327","date":"2026-02-18T14:02:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"143241956321723632347859826505768418936","date":"2026-02-18T13:44:37+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-22T05:08:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-22T05:01:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-01-12T09:29:12+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-11T05:32:23+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Medical Genomics","date":"2026-01-11T05:26:55+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-medical-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mgnm","sideBox":"Learn more about [BMC Medical Genomics](http://bmcmedgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mgnm/default.aspx","title":"BMC Medical Genomics","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9f2d200a-648d-4272-adb5-7df4b632c72e","owner":[],"postedDate":"January 28th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-03-17T10:56:41+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-28 18:52:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8478795","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8478795","identity":"rs-8478795","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}