A modular system to label endogenous presynaptic proteins using split fluorophores inC. elegans

A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans Mizuki Kurashina , Andrew W. Snow , View ORCID Profile Kota Mizumoto doi: https://doi.org/10.1101/2024.07.29.605690 Mizuki Kurashina 1 Graduate Program of Cell and Developmental Biology, Life Sciences Institute 2 Department of Zoology Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrew W. Snow 1 Graduate Program of Cell and Developmental Biology, Life Sciences Institute 2 Department of Zoology Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kota Mizumoto 1 Graduate Program of Cell and Developmental Biology, Life Sciences Institute 2 Department of Zoology 3 Djavad Mowafaghian Centre for Brain Health, The University of British Columbia , Vancouver, Canada , V6T Z3 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Kota Mizumoto For correspondence: kota.mizumoto{at}ubc.ca Abstract Full Text Info/History Metrics Preview PDF Abstract Visualizing the subcellular localization of presynaptic proteins with fluorescent proteins is a powerful tool to dissect the genetic and molecular mechanisms underlying synapse formation and patterning in live animals. Here, we utilize split green and red fluorescent proteins to visualize the localization of endogenously expressed presynaptic proteins at a single neuron resolution in Caenorhabditis elegans. By using CRISPR/Cas9 genome editing, we generated a collection of C. elegans strains in which endogenously expressed presynaptic proteins (RAB-3/Rab3, CLA-1/Piccolo, SYD-2/Liprin-α, UNC-10/RIM and ELKS-1/ELKS) are tagged with tandem repeats of GFP 11 and/or wrmScarlet 11 . We show that the expression of wrmScarlet 1-10 and GFP 1-10 under neuron-specific promoters can robustly label presynaptic proteins in different neuron types. We believe that combinations of knock-in strains and wrmScarlet 1-10 and GFP 1-10 plasmids are a versatile modular system to examine the localization of endogenous presynaptic proteins in any neuron type. Introduction The synapse is the basic functional unit of the nervous system and consists of the presynaptic specialization that sends a chemical signal via exocytosis of neurotransmitter-containing synaptic vesicles (SVs) and the postsynaptic specialization that receives neurotransmitters through postsynaptic receptors ( Figure 1A ). The presynaptic specialization is defined by the cluster of SVs and the electron-dense region known as the active zone 1 , 2 , where SNARE-complex dependent SV exocytosis occurs 3 . The active zone consists of a group of conserved proteins known as active zone proteins which includes Liprin-α, ELKS, RIM (Rab3-interacting molecule), RIM-BP (RIM-binding protein), Munc13 (Mammalian UNC-13), and Piccolo/Bassoon. The functional and structural homologs in Caenorhabditis elegans also play crucial roles in the formation and function of the active zone, and these homologs include SYD-2/Liprin-α, ELKS-1/ELKS, UNC-10/RIM, RIMB-1/RIM-BP, UNC-13/Munc13, and CLA-1/Piccolo/Bassoon. The functions of these active zone proteins are summarized in a recent review 4 . Download figure Open in new tab Figure 1. Schematic of split fluorescent protein system and insertion sites (A) Schematic of the presynaptic structure of two neurons (Neuron A and B) and the split fluorescent protein system to label presynaptic proteins in a specific neuron. An active zone protein and RAB-3 are tagged with seven tandem repeats of GFP 11 and four tandem repeats of wrmScarlet 11 , respectively (represented by triangles). Neuron A-specific expression of GFP 1-10 and wrmScarlet 1-10 specifically reconstitutes fluorescent GFP and wrmScarlet in neuron A but not in neuron B. Created with BioRender.com. (B) Schematics of the genomic regions of cla-1, syd-2, elks-1, unc-10, and rab-3. The knock-in sites of GFP 11 and/or wrmScarlet 11 are indicated by the black arrowheads. In C. elegans , transgenic expression of fluorescently tagged presynaptic proteins under neuron-type specific promoters has been widely used to visualize presynaptic structures in live animals 4 , 5 . Particularly, forward genetic screenings using the transgenic animals expressing fluorescently tagged SV-associated proteins (SNB-1/Synaptobrevin and RAB-3/Rab3) have played key roles in identifying genes essential for presynaptic assembly and specificity 6 – 8 . On the other hand, labeling active zone proteins by using traditional transgenic overexpression of fluorescently-tagged active zone proteins is more challenging, as the overexpression of these proteins often results in aberrant subcellular localization 9 , 10 that does not recapitulate the active zone structure observed by electron microscopy 9 , 11 , 12 . This is likely because overexpression of active zone proteins affects proper presynaptic assembly. Visualizing endogenous active zone proteins by knocking-in fluorescent protein sequences using CRISPR/Cas9 mitigates the issues associated with transgenic overexpression. However, this method labels in all the cells in which the tagged protein is expressed and therefore cannot be used to examine the changes to protein subcellular localization in a single neuron 13 . It is also possible that the expression level of the endogenous protein may be too low to visualize when a single fluorescent protein is fused. The recent employment of split-fluorescent proteins to visualize endogenous proteins can mitigate both limitations described above. By tagging proteins of interest with tandem repeats of one fragment of the fluorescent protein and expressing the remaining part of the fluorescent protein under a tissue-specific promoter, an endogenously expressed protein can be labeled with multiple copies of fluorescent proteins in a cell-type specific manner 14 – 18 . Here by using CRISPR/Cas9 genome editing, we generated a collection of C. elegans strains to visualize endogenous presynaptic proteins in a neuron-specific manner. We knocked-in sequences of tandem repeats of the last β-sheet of GFP (GFP 11 ) 14 – 17 and/or wrmScarlet (wrmScarlet 11 ) 18 into the genomic loci of rab-3 and active zone genes ( syd-2, elks-1, unc-10, and cla-1 ), and show that these strains can visualize endogenous presynaptic proteins in neuron-specific manners when the remainder of the fluorescent protein (GFP 1-10 and wrmScarlet 1-10 ) are expressed under the neuron type-specific promoters. We believe that these strains are useful to researchers to examine the presynaptic specialization in the neuron-types of their interest. Materials and Methods C. elegans strains Bristol N2 strain was used as a wild-type reference. All strains were cultured in the nematode growth medium (NGM) with OP50 as described previously 19 . All strains were maintained at room temperature (22°C). The following alleles were used in this study: rab-3(miz237[4×wrmScarlet 11 ::rab-3]) II , cla-1(miz321[cla-1::7×GFP 11 ]) IV , cla-1(miz329[cla-1:: 8×wrmScarlet 11 ]) IV, elks-1(miz364[elks-1::7×GFP 11 ]) IV , unc-10(miz404[unc-10::7×GFP 11 ]) X , syd-2(miz231[7×GFP 11 ::syd-2]) X , syd-2(miz329[8×wrmScarlet 11 ::syd-2]) X , syd-2(ok217) X . Transgenes The following transgenes were used in this study: mizIs41 ( mig-13 p:: wrmScarlet 1-10 ::SL2::GFP 1-10 (10 ng/μL) ; odr-1 p ::GFP ), mizEx605 ( itr-1 p:: wrmScarlet 1-10 ::SL2::GFP 1-10 (20 ng/μL) ; odr-1 p ::GFP ), mizEx657 ( itr-1 p:: wrmScarlet 1-10 ::SL2::GFP 1-10 (200 ng/μL) ; odr-1 p ::GFP ), mizEx607 ( dat-1 p ::wrmScarlet 1-10 ::SL2::GFP 1-10 (10 ng/μL ); odr-1 p ::GFP ), mizEx624(unc-25 p ::wrmScarlet 1-10 ::SL2::GFP 1-10 (2 ng/μL ); odr-1 p ::GFP ), wyIs685 ( mig-13 p:: TdTomato::rab-3b, mig-13 p ::3×GFPnovo2::cla-1; odr-1 p ::GFP ). The mizIs41 transgene was obtained by a spontaneous integration when trying to generate the extrachromosomal arrays for mig-13 p:: wrmScarlet 1-10 ::SL2::GFP 1-10 . The transgenic lines with extrachromosomal arrays were generated using the standard microinjection method 20 , 21 . The odr-1 p ::GFP co-injection marker plasmid was injected at 20 ng/μL. Plasmid construction C. elegans expression plasmids were made in a derivative of pPD49.26 (A. Fire), the pSM vector. To visualize the presynaptic specializations of the DA9 neuron, VD and DD neurons and the PDE neurons, we cloned the DA9 specific promoters ( itr-1B p 22 or mig-13 p 23 ) 24 , VD/DD-specific promoter ( unc-25 p) 25 , PDE-specific promoter( dat-1 p) 10 , 26 into the Sph I and Asc I sites of the wrmScarlet 1-10:: SL2::GFP 1-10 plasmid. 4×wrmScarlet 11, 7×GFP 11 , 8×wrmScarlet 11 sequences were synthesized using GeneArt Gene Synthesis service (ThermoFisher Scientific) and were cloned into either their default plasmids or pBluescriptII (SK-). These plasmids were used as a PCR template to amplify the homology directed repair (HDR) template. The sequences of the HDR templates and primers used to amplify the HDR templates are available in the supplemental information. CRISPR/Cas9 genome editing Insertion of the tandem repeats of GFP 11 and/or wrmScarlet 11 into the loci of presynaptic genes was conducted using CRISPR/Cas9 genome editing according to the protocols described previously 27 , 28 . We amplified the donor HDR template of the tandem repeats of GFP 11 and/or wrmScarlet 11 with 50-60 bp of homology arm sequences to each of the synaptic gene loci using Phusion or Q5 high-fidelity DNA polymerases (New England Biolabs). The PCR products were ‘melted’ and injected along with the Cas9-gRNA RNP complex and a pRf4 rol-6 co-injection marker plasmid 21 into both gonad arms of gravid worms. F1s were singled and screened for knock-in by PCR genotyping. The insertions and their flanking sequences were confirmed by Sanger sequencing. The primer sequences for amplifying the HDR templates and genotyping are listed in the supplemental information. Aldicarb assay The stock solution of aldicarb (Sigma-Aldrich: 33386-100MG), prepared at 100 mM in 70% ethanol, was added to the NGM to a final concentration of 1 mM concentration after autoclaving and cooling to 55 °C. 25-30 adult animals were transferred to the 1mM aldicarb plates and scored for paralysis every 20 minutes. We defined animals as paralyzed when they were completely motionless and unresponsive when prodded with a platinum wire 3 times. Each genotype was assayed 3 times. Confocal Microscopy Images of fluorescently tagged fusion proteins were captured in live C. elegans using a Zeiss LSM800 Airyscan confocal microscope (Carl Zeiss, Germany) equipped with a 63× magnification oil objective lens (Carl Zeiss, Germany). Worms were immobilized using a 3:1 mixture of 0.225 M 2,3-butanedione monoxime (Sigma-Aldrich) and 7.5 mM levamisole hydrochloride (Sigma-Aldrich) and mounted on 2.5% agarose pads. Images were analyzed and processed using Zen software (Carl Zeiss) and ImageJ (NIH, USA). Fluorescent signal intensity quantification Signal intensity of CLA-1::7×GFP from 35 z-stacks (0.15 μm thickness) of ∼50 μm segment of the DA9 synaptic domain were examined in N2 animals. Using ImageJ, images were processed via Z-projection sum slices and straightened. Particle thresholding and analysis were conducted by first subtracting background fluorescence and applying Gaussian blur. Auto-local thresholding using Bernsen’s thresholding was applied using the default values. Regions of interest (ROI) denoting the CLA-1 puncta were manually examined to confirm visible fluorescence. Particles were then measured to obtain the mean fluorescence value of each ROI. Statistics Prism10 (GraphPad Software, USA) was used for statistical analyses. We applied the one-way ANOVA method with post hoc Tukey’s multiple comparison test for comparison among three or more parallel groups with multiple plotting points, and log-rank survival test with Bonferroni correction for comparison of paralysis on aldicarb. Data were plotted with error bars representing standard deviation (SD). Results Generating GFP 11 and wrmScarlet 11 knock-in strains to visualize endogenous presynaptic proteins We employed split-GFP and split-wrmScarlet to label endogenous presynaptic proteins in a neuron-specific manner 15 – 18 . Split-wrmScarlet is an engineered split fluorophore that has been codon-optimized for C. elegans and is a derivative of yeast codon-optimized mScarlet 18 . Specifically, we knocked-in seven tandem repeats of GFP 11 ( 7×GFP 11 ) or eight tandem repeats of wrmScarlet 11 ( 8×wrmScarlet 11 ) sequences to the core active zone genes ( syd-2, elks-1, unc-10, and cla-1 ) using the CRISPR/Cas9 genome editing technology ( Figure 1B ). 7×GFP 11 and 8×wrmScarlet 11 were inserted at the 5’ end of syd-2 locus and at the 3’ end of cla-1 , respectively. 7×GFP 11 was inserted at the 3’ ends of unc-10 , and elks-1 loci, according to previous works which used transgenic labeling of these active zone proteins 13 , 29 – 31 ( Figure 1B ). To visualize SVs, four tandem repeats of the wrmScarlet 11 ( 4×wrmScarlet 11 ) sequence were inserted at the 5’ end of rab-3 B isoform ( Figure 1B ) 13 , 32 – 35 . The fusion of any small sequences including 7×GFP 11 and/or 8×wrmScarlet 11 to the endogenous active zone proteins may interfere with their functions as they may cause steric hinderance to other proteins or misfolding. To rule out the potential deleterious effects of the insertion of these sequences into our genes of interest, we first examined the locomotion pattern of the knocked-in strains. The null mutants of syd-2 and unc-10 exhibit uncoordinated locomotion ( Unc ) phenotypes 7 , 19 , while all the knock-in strains we generated, including 7×GFP 11 ::syd-2 and unc-10::7×GFP 11 are superficially wild-type in terms of their locomotion ( Figure S1 and not shown). This suggests that the 7×GFP 11 and 8×wrmScarlet 11 tags do not abolish the functions of these proteins. Download figure Open in new tab Figure S1. 7×GFP 11 ::syd-2 animals exhibit normal locomotion. 9-10 wild type (N2), syd-2(ok217), syd-2(miz231[7×GFP 11 ::syd-2) animals at the 4 th larval stage were placed onto the NGM plates, and images were taken 20 seconds after placing the animals. While the locomotion of these animals indicate that they are superficially wild type, we further characterized the effects of GFP 11 and/or wrmScarlet 11 knock-ins on neurotransmission by aldicarb assay 36 , 37 . Previous works showed that null mutants of cla-1 and syd-2 are resistant to aldicarb due to impaired neurotransmission 7 , 13 . We found that that cla-1::7×GFP 11 and 7×GFP 11 ::syd-2 mutants exhibited normal sensitivity to aldicarb ( Figure 2 ), suggesting that CLA-1::7×GFP 11 and 7×GFP 11 ::SYD-2 fusion proteins retain wild type functions in neurotransmission. Loss of function mutants of unc-10 also exhibit strong aldicarb resistance 38 . In unc-10::7×GFP 11 animals, we observed modest aldicarb resistance ( Figure 2 ), suggesting that the 7×GFP 11 insertion weakly affects unc-10 function. Null mutants of elks-1 do not exhibit any defects in aldicarb sensitivity 39 . Interestingly, we observed that elks-1::7×GFP 11 animals exhibit a modest resistance to aldicarb ( Figure 2 ). It is possible that ELKS-1::7×GFP 11 fusion protein weakly interferes with the functions of other active zone proteins that interact with ELKS-1, thereby affecting neurotransmission. 4×wrmScarlet 11 ::rab-3 animals exhibited a strong aldicarb resistance ( Figure 2 ), similar to the null mutant of rab-3 , as previously described 40 , 41 . This suggests that 4×wrmScarlet 11 ::RAB-3 is not functional in neurotransmission. Nevertheless, the localization patterns of 4×wrmScarlet::RAB-3 is similar to transgenically expressed RAB-3 and other SV markers 7 , 10 , 13 , 42 , 43 (see below) ( Figures 3E , 3F, 4). While the function of RAB-3 is affected in 4×wrmScarlet 11 ::rab-3 animals, we conclude that 4×wrmScarlet 11 ::rab-3b can be used as a SV marker strain. Download figure Open in new tab Figure 2. Effects of split-fluorophore sequence knock-ins on neurotransmission. The time course of paralysis for wild type, cla-1::7×GFP 11 , 7×GFP 11 ::syd-2, unc-10::7×GFP 11 , 4×wrmScarlet 11 ::rab-3 , and elks-1::7×GFP 11 animals on 1.0 mM aldicarb plates from three independent trials with n > 20 for each genotype in each trial. Log-rank survival test with Bonferroni correction compared to wild type. n.s. not significant; **** p < 0.0001 Download figure Open in new tab Figure 3. Labeling endogenous presynaptic proteins in DA9. (A) Schematic of the DA9 motor neuron. The dotted box represents the imaging area of the presynaptic domains shown in (G-K). (B) Representative image of the DA9 motor neuron labeled with endogenous 4×wrmScarlet 11 ::RAB-3 and CLA-1::7×GFP 11 . The mig-13 promoter was used to express GFP 1-10 and wrmScarlet 1-10 . The asterisk denotes the DA9 cell body. Scale bar: 10 μm. (C) Quantification of fluorescence intensity of CLA-1::7×GFP in animals expressing GFP 1-10 and wrmScarlet 1-10 under the itr-1 promoter. The itr-1 p ::wrmScarlet 1-10 ::SL2::GFP 1-10 plasmids were injected at 20 ng/μL and 200 ng/μL, and two independent lines per each injection were quantified. Each dot represents average CLA-1::7×GFP 11 signal intensity per synapse per animal. n.s. not significant. (D) Representative image of the DA9 motor neuron expressing GFP 1-10 and wrmScarlet 1-10 under the mig-13 promoter in wild type animals. We observed a dim GFP 1-10 signal in the cell body of DA9. The asterisk denotes the DA9 cell body. Scale bar: 10 μm. (E) Representative images of a few DA9 presynaptic specializations within the DA9 synaptic domain visualized by the wyIs685 transgene expressing CLA-1::3×GFPnovo2 (green) and TdTomato::RAB-3 (magenta) in wild type (top) and syd-2(ok217) mutant (bottom). Scale bar: 2 μm (F) Representative images of a few DA9 presynaptic specializations within the DA9 synaptic domain visualized by the endogenous CLA-1::7×GFP 11 (green) and 4×wrmScarlet::RAB-3 11 (magenta) in wild type (top) and syd-2(ok217) mutant (bottom). Scale bar: 2 μm. (G-J) Representative images of the DA9 presynaptic specializations labeled with CLA-1::7×GFP 11 (top), 4×wrmScarlet::RAB-3 (middle), and merged image (bottom) (G), 7×GFP 11 ::SYD-2 (top), 4×wrmScarlet 11 ::RAB-3 (middle), and merged image (bottom) (H), ELKS-1::7×GFP 11 (top), 4×wrmScarlet 11 ::RAB-3 (middle), and merged image (I), UNC-10::7×GFP 11 (top), 4×wrmScarlet 11 ::RAB-3 (middle), and merged image (bottom) (J). Scale bar: 2 μm. (K) Representative image of CLA-1::7×GFP 11 and 8×wrmScarlet 11 ::SYD-2 localization in the DA9 neuron. Scale bar: 2 μm. The corresponding fluorescent intensity plots for CLA-1::7×GFP 11 and 8×wrmScarlet 11 ::SYD-2 are shown below. Labeling endogenous presynaptic proteins in the DA9 motor neuron We tested if these knock-in strains can be used to visualize endogenous presynaptic proteins in a neuron-specific manner using the DA9 motor neuron. DA9 is one of nine dorsal A-type (DA) cholinergic motor neurons required for the backward locomotion of C. elegans 44 . The cell body of DA9 resides in the ventral side of the worm near the preanal ganglion and sends a dendrite ventrally and an axon dorsally where it forms approximately 20 en passant synapses onto the dorsal body wall muscles 45 ( Figures 3A and 3B ). Previous works have shown that transgenic overexpression of CLA-1::3×GFPnovo2 and TdTomato::RAB-3 can label the presynaptic structures of DA9; CLA-1::3×GFPnovo2 is localized at the tip of each presynaptic varicosity labeled with TdTomato::RAB-3 13 , 32 ( Figures 3A and 3I ). We examined the localization patterns of CLA-1::7×GFP 11 and 4×wrmScarlet 11 ::RAB-3 in DA9 using a transgene mizIs41 (mig-13 p ::wrmScarlet 1-10 ::SL2::GFP 1-10 ) expressing wrmScarlet 1-10 and GFP 1-10 in DA9 of 4×wrmScarlet 11 ::rab-3; cla-1::7×GFP 11 animals. The localization patterns of 4×wrmScarlet 11 ::RAB-3 and CLA-1::7×GFP 11 were reminiscent to those of transgenically expressed TdTomato::RAB-3 and CLA-1::3×GFPnovo2; we observed CLA-1::7×GFP 11 puncta that are localized at the tip of the presynaptic varicosity labeled with 4×wrmScarlet 11 ::RAB-3 ( Figure 3B ). We also observed similar localization pattern of 8×wrmScarlet 11 ::CLA-1 (data not shown). To test if overexpression of GFP 1-10 and wrmScarlet 1-10 affects the localization patterns and fluorescent intensities of CLA-1::7×GFP 11 and 4×wrmScarlet 11 ::RAB-3, we compared the transgenic animals carrying itr-1 p (DA9 specific promoter)::wrmScarlet 1-10 ::SL2::GFP 1-10 extrachromosomal arrays generated at 20 ng/μL and 200 ng/μL concentrations. We did not observe a significant difference in the localization patterns and fluorescence intensity of CLA-1::7×GFP 11 between animals injected at 20 ng/μL and 200 ng/μL concentrations ( Figure S2 and Figure 3C ). This is consistent with the idea that the endogenous expression level of CLA-1 defines the maximum signal intensity. For 4×wrmScarlet 11 ::RAB-3, we did not observe a difference in the localization pattern, however, we noticed a tendency of higher fluorescence intensity of 4×wrmScarlet::RAB-3 in the animals injected at higher concentrations of wrmScarlet 1-10 ::SL2::GFP 1-10 ( Figure S2 ). This suggests that 4×wrmScarlet 11 ::RAB-3 is not fully saturated with wrmScarlet 1-10 in animals injected with wrmScarlet 1-10 ::SL2::GFP 1-10 at 20 ng/μL and therefore have not yet reached the maximum fluorescence intensity set by the endogenous expression level of RAB-3. Nevertheless, our result suggests that overexpression of wrmScarlet 1-10 and GFP 1-10 does not affect localization of endogenously labeled synaptic proteins. We note a dim green signal in the cell body of DA9 of mizIs41 (mig-13 p ::wrmScarlet1-10::SL2::GFP1-10) animals ( Figure 3D ), consistent with previous observations that GFP 1-10 by itself has a weak fluorescence 16 . Download figure Open in new tab Figure S2. Overexpression of wrmScarlet 1-10 ::SL2::GFP 1-10 does not affect the localization pattern of RAB-3 and CLA-1. Representative images of the DA9 presynaptic specializations labeled with endogenous 4×wrmScarlet::RAB-3 and CLA-1::7×GFP. 4×wrmScarlet::rab-3; cla-1::7×GFP animals were injected with itr-1 p::wrmScarlet 1-10 ::SL2::GFP 1-10 at 20 ng/uL (top) and 200 ng/uL (bottom). We noticed a tendency of 4×wrmScarlet::RAB-3 to be brighter in animals injected at higher concentrations. Scale bar: 2 um. In DA9, presynaptic localization of CLA-1 and RAB-3 depends on syd-2 13 . Consistent with previous studies, the localization of TdTomato::RAB-3 and CLA-1::3×GFPnovo2 are greatly diminished from the axon in syd-2(ok217) mutants ( Figure 3E ). Similarly, signals of endogenously labeled CLA-1::7×GFP 11 and 4×wrmScarlet 11 ::RAB-3 were greatly diminished in the syd-2 mutant; we observed dim diffuse signal of CLA-1::7×GFP 11 and sporadic dim clusters of 4×wrmScarlet 11 ::RAB-3 ( Figure 3F ). This further supports that the knock-in strains accurately recapitulate the localization patterns of CLA-1 and RAB-3, as described previously. We used the mizIs41 (mig-13 p ::wrmScarlet1-10::SL2::GFP1-10) transgene to examine the localization patterns of other active zone proteins (SYD-2, UNC-10, and ELKS-1). The localization patterns of these active zone proteins tend to be inconsistent when labeling these proteins using traditional transgenic overexpression (unpublished observations). We found that the endogenously expressed 7×GFP 11 ::SYD-2, UNC-10::7×GFP 11 , and ELKS-1::7×GFP 11 were localized at the tip of synaptic varicosity labeled with 4×wrmScarlet::RAB-3 ( Figures 3H - 3J ), similar to the CLA-1::7×GFP localization ( Figure 3G ). We also examined the co-localization between SYD-2 and CLA-1 in the 8×wrmScarlet 11 ::syd-2; cla-1::7×GFP 11 ; mizIs41 strain. We observed near-perfect co-localization between 8×wrmScarlet 11 ::SYD-2 with CLA-1::7×GFP 11 puncta ( Figure 3K ). This demonstrates that our endogenous labeling system is beneficial for labeling active zone proteins, which have been challenging with the traditional transgenic overexpression methods. Labeling presynaptic proteins in the D-type GABAergic motor neurons and PDE dopaminergic sensory neurons We next examined if our knock-in strains can be used to visualize the presynaptic specializations in different neuron types. First, we examined the localization of endogenous CLA-1 and RAB-3 in the D-type GABAergic motor neurons (DDs and VDs). By the adult stage, DD and VD neurons have formed synapses onto the dorsal and ventral body wall muscles, respectively 45 ( Figure 4A ). We expressed wrmScarlet 1-10 ::SL2::GFP 1-10 under the GABAergic motor neurons specific promoter, unc-25 p 46 , 47 in 4×wrmScarlet 11 ::rab-3; cla-1::7×GFP 11 animals. Similar to DA9, we observed CLA-1::7×GFP 11 puncta at the tip of presynaptic varicosity labeled with 4×wrmScarlet 11 ::RAB-3 ( Figures 4B and 4C ). We next examined the localization patterns of endogenous CLA-1 and RAB-3 in the PDE dopaminergic sensory neurons by expressing wrmScarlet 1-10 ::SL2::GFP 1-10 under the dopaminergic neuron-specific promoter, dat-1 p 10 , 26 in 4×wrmScarlet 11 ::rab-3; cla-1::7×GFP 11 animals. The PDE neurons are postembryonically-born bilaterally symmetric neurons, each of which extends an axon along the ventral nerve cord and forms en passant synapses onto the DVA interneuron 10 , 48 ( Figure 4D ). Similar to previous observations using transgenically expressed RAB-3 and CLA-1 10 , the endogenously labeled 4×wrmScarlet 11 ::RAB-3 and CLA-1::7×GFP 11 puncta are colocalized along their axons ( Figures 4E and 4F ). Download figure Open in new tab Figure 4. Labeling of endogenous CLA-1 and RAB-3 in DD/VD and PDE neurons (A) The schematic of the most posterior VD (light grey) and DD (dark grey) motor neurons, VD13 and DD6. Magenta dots on the dorsal and ventral neurites represent presynaptic specializations of DDs and VDs, respectively. The dotted box represents the imaging area of the presynaptic domain of the DD6 neuron shown in (C.) (B) Representative image of the posterior VD and DD motor neurons labeled with endogenous 4×wrmScarlet::RAB-3 and CLA-1::7×GFP. The unc-25 promoter was used to express GFP 1-10 and wrmScarlet 1-10 . The asterisks denote VD and DD cell bodies. Scale bar: 10 μm. (C) Representative image of the DD6 presynaptic specializations labeled with endogenous CLA-1::7×GFP (top), 4×wrmScarlet::RAB-3 (middle), and merged image (bottom). Scale bar: 2 μm. (D) Schematic of the part of PDE neurons around the vulva. Magenta dots on the ventral neurites represent presynaptic specializations of the PDE neurons (PDEL and PDER). The dotted box represents the imaging area of the presynaptic domain of the PDE neuron shown in (F.) (E) Representative image of the part of the PDE neurons around vulva labeled with endogenous 4×wrmScarlet::RAB-3 and CLA-1::7×GFP. The dat-1 promoter was used to express GFP 1-10 and wrmScarlet 1-10 . The asterisk denotes the PDE cell body. Scale bar: 10 μm. (F) Representative image of the PDE presynaptic specializations labeled with endogenous CLA-1::7×GFP (top), 4×wrmScarlet::RAB-3 (middle), and merged image (bottom) in the axonal region anterior to the cell body and posterior to the vulva. Scale bar: 2 μm. Together, we show that the localization pattern of endogenous 4×wrmScarlet 11 ::RAB-3 and CLA-1::7×GFP 11 are consistent among different neuron types, and the versatility of our system to label presynaptic proteins in different neuron types simply by using different promoters to express wrmScarlet 1-10 and GFP 1-10 . Discussion Here we generated a collection of strains in which sequences of tandem repeats of GFP 11 and/or wrmScarlet 11 are knocked into the loci of presynaptic genes. We show that transgenic expression of the remaining split fluorescent proteins from neuron- or neuron-type-specific promoters enables a robust and consistent visualization of the active zone proteins. We showed that overexpression of wrmScarlet 1-10 and GFP 1-10 does not affect the localization pattern and minimally affects the signal intensity of endogenously labeled presynaptic proteins. Comparisons between strains that transgenically overexpress synaptic proteins fused to fluorophores may be difficult as the fluorescence intensities and localization patterns are directly affected by differing expression levels of the transgene. In our strains, the maximal signal intensity of the labeled synaptic protein is determined by the endogenous expression level of the protein. Therefore, the use of these knock-in strains may provide a better standard for which labs can easily compare the qualitative differences of different genetic backgrounds in synapse formation and patterning. A CRISPR generated single copy insertion of GFP 1-10 and/or wrmScarlet 1-10 may further minimize the variability of the synaptic labeling, however, the ease of modularity of using different cell-specific promoters expressed using extrachromosomal arrays would be diminished. Previous works have suggested that the mechanisms of presynaptic assembly vary among different neuron types 4 . For example, in the hermaphrodite-specific neurons (HSNs), the Arp2/3-dependent branched filamentous-actin (F-actin) functions as a structural scaffold to recruit active zone proteins including SYD-1 and SYD-2, which subsequently recruit other active zone proteins and SVs 49 . On the other hand, in the AIY interneurons, SYD-1 and SYD-2 are recruited to the synapses independent of F-actin 50 . Our marker strains would be useful to exclude the possibility that the difference in presynaptic assembly in each neuron type is due to differential expression levels of the transgenes used to visualize active zone proteins. Limitations of the endogenous labeling system using split-fluorescent proteins While our endogenous labeling platform provides robust visualization of the presynaptic proteins, there are several limitations to this labeling method as we discuss below. First, our marker strains cannot distinguish/label certain isoforms of some active zone proteins. For example, CLA-1 has 6 isoforms, which are classified into 3 categories: CLA-1L (long), which includes CLA-1a and CLA-1b isoforms, CLA-1M (medium), which includes CLA-1c and CLA-1d isoforms, and CLA-1S (small) which includes CLA-1e and CLA-1f isoforms 13 . Transgenic labeling of CLA-1L and CLA-1S revealed a distinct subsynaptic localization of these isoforms 13 , 51 . Our knock-in strains labels CLA-1a, CLA-1d and CLA-1e isoforms, effectively labeling all 3 categories of CLA-1S/M/L isoforms. However, CLA-1b/c/f isoforms remain unlabeled, whose localization and functions have not been studied 13 . It is possible that these isoforms are expressed differently in different neurons which may account for neuron-type specific functions of CLA-1 in presynaptic assembly and functions 13 . It is therefore interesting to generate a series of knock-in strains to visualize specific isoforms of each active zone protein. Second, a fusion of tandem repeats of GFP 11 or wrmScarlet 11 to endogenous presynaptic proteins could interfere with the protein functions. We show that endogenously tagged unc-10, elks-1, and rab-3 strains exhibit mild to severe synaptic transmission defects. Extra caution should be paid when using these strains to examine synaptic functions in certain genetic backgrounds. Tagging unc-10 and elks-1 loci at their 5’ end may reduce the potential effects of GFP 11 or wrmScarlet 11 tags on their functions. For rab-3 we note that our 4×wrmScarlet 11 ::rab-3b strain also labels rab-3a which is a relatively understudied isoform 40 . Although the expression of the rab-3B isoform is sufficient rescue rab-3 mutants 40 , it is possible that 4×wrmScarlet 11 inserted in the middle of rab-3 A isoform disrupted the functions of RAB-3 in neurotransmission. Alternatively, the functional defect of 4×wrmScarlet 11 ::rab-3b animals may be due to the wrmScarlet 11 insertion. Examination of GFP 11 tagged rab-3 would provide a clarification. C-terminal tagging of RAB-3 cannot be done as RAB-3 contains a CXC prenylation site required for proper association to the SV membrane 40 , 52 . Tagging other SV-associated proteins such as SNG-1/Synaptogyrin 53 , SNT/Synaptotagmin 54 and SNN-1/Synapsin 55 may provide a better labeling platform for visualizing SVs without functional perturbations. Data Availability Strains and plasmids are available from the Caenorhabditis Genetics Center (CGC) and Addgene. Funding CIHR Project Grants (Project Grants (PJT-180563, OGB-190360). NSERC (RGPIN-2015–04022) Conflict of Interest None declared. Supplemental Information Genotyping primers: syd-2(ok217) F: CGCGGGAATTATGCCTATTA R: AATCTCTAACCATGCGGTCG Internal R: GCTTCTTCCGCTTCTGCTGC rab-3(miz237[4×wrmScarlet 11 ::rab-3]) F: ATCAGTTCCCTCTCGTTTCTC R: CACCCTACCAACTAGGTCAAC cla-1(miz321[cla-1::7×GFP 11 ] and miz378[cla-1::8×wrmScarlet 11 ]) F: CAGTGTCACTGGACATCGGCT R: ACAACGGACCTACTACCCT syd-2(miz231[7×GFP 11 ::syd-2] and miz329[8×mScarlet 11 ::syd-2]) F: ACAAGGGCAAGCTGATTCAC R: TGTCCCGGTCTTCCAACATG elks-1(miz364[elks-1::7×GFP 11 ])) F: TACCGGCTCCAGTGATTCC R: TGTGTGCCATTGGATGTGAG unc-10(miz404[unc-10::7×GFP 11 ]) F: CGAACTCGGATCTCAACCAC R: TTGGATGCACCGATTAGCTG CRISPR: rab-3 gRNA: TCTGAAAATAGGGCTACTGT 4×wrmScarlet11::rab-3 HDR template GCTCTTTTAAAATAAATCTACAGTAGCCCTATTTTCAGATGTATACAGTTGTGGAACAATACGAGAAGTCCGTGGCCCGACATTGCACAGGCGGAGGTGGAAGTGGTGGCTACACGGTTGTAGAACAGTACGAGAAGAGTGTCGCACGTCATTGTACTGGCGGTGGAGGCTCTGGAGGATACACCGTAGTAGAGCAATATGAGAAAAGTGTGGCTCGTCATTGTACCGGCGGAGGAGGTTCCGGCGGATACACAGTGGTAGAACAGTACGAAAAGAGTGTCGCAAGACATTGTACAGGTGGCGCGGCTGGCGGACAACCTCAAGGCGCTACACCGGGACAAC F: GCTCTTTTAAAATAAATCTACAGTAGCCCTATTTTCAGATGTATACAGTTGTGGAACAATACG R: GTTGTCCCGGTGTAGCGCCTTGAGGTTGTCCGCCAGCCGCGCCACCTGTACAATGTCTTGCG cla-1 gRNA: GCAGTTTTCAGTTTATTGCA cla-1::7×GFP 11 HDR template GTCTTTTTTTTAAATATCTAAATCATTTAAATTTTTCAGTGTCACTGGACATCGGCTACCCTGCAATAAACGGTGCAGGAGCTGGAGCTGGAGCCGGAGCCGGAGCCCGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACAGGTGGCTCTGGAGGTAGAGATCATATGGTTCTCCACGAATACGTTAACGCCGCAGGCATCACTGGCGGTAGTGGAGGACGCGACCATATGGTACTACATGAATATGTCAATGCAGCCGGAATAACCGGAGGGTCCGGAGGCCGGGATCACATGGTGCTGCATGAGTATGTGAACGCGGCGGGTATAACTGGTGGGTCGGGCGGACGAGACCATATGGTGCTTCACGAATACGTAAACGCAGCTGGCATTACTGGCGGATCAGGTGGCAGGGATCACATGGTACTCCATGAGTACGTGAACGCTGCTGGAATCACAGGCGGTAGCGGCGGTCGGGACCATATGGTCCTGCACGAATATGTCAATGCTGCCGGTATCACCGCAGCTGGAGGTTGAAAACTGCTCATAATGCTCAAAAATCTTTCTCAAAAGTTGACCAAAAAGCTCAAAAACTCAAACTTCT F: GTCTTTTTTTTAAATATCTAAATCATTTAAATTTTTCAGTGTCACTGGACATCGGCTACCCTGCAATAAACGGTGCAGGAGCTGGAGCTGGAG R: AGAAGTTTGAGTTTTTGAGCTTTTTGGTCAACTTTTGAGAAAGATTTTTGAGCATTATGAGCAGTTTTCAACCTCCAGCTGCGGTGATACCG cla-1::8×wrmScarlet 11 HDR template GTCTTTTTTTTAAATATCTAAATCATTTAAATTTTTCAGTGTCACTGGACATCGGCTATCCTGCAATAAACGGATCAGGATCTGGAAGTGGAAGCGGTGGATCTGGTGGATACACAGTTGTTGAGCAGTACGAGAAATCGGTTGCTCGACATTGCACAGGTGGTGGTGGAAGTGGTGGATATACTGTGGTGGAACAATACGAGAAGTCTGTGGCTAGACACTGTACTGGTGGTGGTGGTAGCGGAGGATACACAGTCGTCGAACAATACGAAAAGAGCGTTGCACGACACTGCACCGGTGGTGGTGGTTCTGGTGGTTATACAGTAGTAGAGCAATATGAGAAGAGTGTGGCTCGTCACTGCACTGGTGGTGGTGGTAGTGGTGGTTACACTGTTGTTGAACAATATGAGAAAAGCGTCGCCCGCCACTGTACAGGTGGTGGTGGATCCGGTGGATACACCGTAGTGGAACAGTATGAGAAATCAGTGGCCCGTCATTGCACCGGTGGTGGTGGATCTGGTGGATACACAGTGGTAGAACAATATGAGAAATCGGTGGCACGGCACTGTACTGGTGGTGGTGGAAGCGGTGGTTATACCGTCGTTGAGCAATACGAAAAATCAGTCGCCAGACACTGCACAGGTGGTTGAAAACTGCTCATAATGCTCAAAAATCTTTCTCAAAAGTTGACCAAAAAGCTCAAAAACTCAAACTTCT F: GTCTTTTTTTTAAATATCTAAATCATTTAAATTTTTCAGTGTCACTGGACATCGGCTATCCTGCAATAAACGGATCAGGATCTGGAAGTGGAAGCGG R: AGAAGTTTGAGTTTTTGAGCTTTTTGGTCAACTTTTGAGAAAGATTTTTGAGCATTATGAGCAGTTTTCAACCACCTGTGCAGTGTCTGGCGACT syd-2 gRNA: AGAAATATGAGCTACAGCAA 7×GFP11::syd-2 HDR template GAAATTTAGTTATCAATTTTAATCTGTTTCAGAAATATGGCCCGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACAGGTGGCTCTGGAGGTAGAGATCATATGGTTCTCCACGAATACGTTAACGCCGCAGGCATCACTGGCGGTAGTGGAGGACGCGACCATATGGTACTACATGAATATGTCAATGCAGCCGGAATAACCGGAGGGTCCGGAGGCC GGGATCACATGGTGCTGCATGAGTATGTGAACGCGGCGGGTATAACTGGTGGGTCGGGCGGACGAGACCATATGGTGCTTCACGAATACGTAAACGCAGCTGGCATTACTGGCGGATCAGGTGGCAGGGATCACATGGTACTCCATGAGTACGTGAACGCTGCTGGAATCACAGGCGGTAGCGGCGGTCGGGACCATATGGTCCTGCACGAATATGTCAATGCTGCCGGTATCACCGGAGCCAGCTACAGCAATGGAAACATAAATTGTGATATAATGCCGACAATCT F: GAAATTTAGTTATCAATTTTAATCTGTTTCAGAAATATGGCCCGTGACCACATGGTCCTTCATGAGTATG R: GATTGTCGGCATTATATCACAATTTATGTTTCCATTGCTGTAGCTGGCTCCGGTGATACCGGCAGCATTGACATATTCG 8×wrmScarlet11::syd-2 HDR template AACATTTATTAATGTTTTGTTTTTGATTGAAAATCTGAAATTTAGTTATCAATTTTAATCTGTTTCAGAAATATGGGATCAGGATCTGGAAGTGGAAGCGGAGGATCTGGTGGATACACAGTTGTTGAGCAGTACGAGAAATCGGTTGCTCGACATTGCACAGGTGGTGGTGGAAGTGGTGGATATACTGTGGTGGAACAATACGAGAAGTCTGTGGCTAGACACTGTACTGGTGGTGGTGGTAGCGGAGGATACACAGTCGTCGAACAATACGAAAAGAGCGTTGCACGACACTGCACCGGTGGTGGTGGTTCTGGTGGTTATACAGTAGTAGAGCAATATGAGAAGAGTGTGGCTCGTCACTGCACTGGTGGTGGTGGTAGTGGTGGTTACACTGTTGTTGAACAATATGAGAAAAGCGTCGCCCGCCACTGTACAGGTGGTGGTGGATCCGGTGGATACACCGTAGTGGAACAGTATGAGAAATCAGTGGCCCGTCATTGCACCGGTGGTGGTGGATCTGGTGGATACACAGTGGTAGAACAATATGAGAAATCGGTGGCACGGCACTGTACTGGTGGTGGTGGAAGCGGTGGTTATACCGTCGTTGAGCAATACGAAAAATCAGTCGCCAGACACTGCACAGGTGGTGGATCATCTGGATCTGGATCCGGTAGCTATAGTAATGGAAACATAAATTGTGATATAATGCCGACAATCTCGGAAGATGGAGTGGACAACGGCGG TCCCA F: AACATTTATTAATGTTTTGTTTTTGATTGAAAATCTGAAATTTAGTTATCAATTTTAATCTGTTTCAGAAATATGGGATCAGGATCTGGAAGTGGAAGC R: TGGGACCGCCGTTGTCCACTCCATCTTCCGAGATTGTCGGCATTATATCACAATTTATGTTTCCATTACTATAGCTACCGGATCCAGATCCAGATGATCC elks-1 gRNA: TCGTCGTGATCTACCTGTGG elks-1::7×GFP 11 HDR template GTACCATTGGCATTCCACAACACTCTCAGCACCCGCCGCAAGTAGATCACGACGATGCTGACGGAATTTGGGCCGGTGCAGGAGCTGGAGCTGGAGCCGGAGCCGGAGCCCGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACAGGTGGCTCTGGAGGTAGAGATCATATGGTTCTCCACGAATACGTTAACGCCGCAGGCATCACTGGCGGTAGTGGAGGACGCGACCATATGGTACTACATGAATATGTCAATGCAGCCGGAATAACCGGAGGGTCCGGAGGCCGGGATCACATGGTGCTGCATGAGTATGTGAACGCGGCGGGTATAACTGGTGGGTCGGGCGGACGAGACCATATGGTGCTTCACGAATACGTAAACGCAGCTGGCATTACTGGCGGATCAGGTGGCAGGGATCACATGGTACTCCATGAGTACGTGAACGCTGCTGGAATCACAGGCGGTAGCGGCGGTCGGGACCATATGGTCCTGCACGAATATGTCAATGCTGCCGGTATCACCGCAGCTGGAGGTTGAAAATTGTCTAGAATTGTCTGAACTTTTCCGAAATTTCCCAGTTTTTTCTCATATCTGTTCACTTACTTTTT F: GTACCATTGGCATTCCACAACACTCTCAGCACCCGCCGCAAGTAGATCACGACGATGCTGACGGAATTTGGGCCGGTGCAGGAGCTGGAGCTGGAGCCGG R: AAAAAGTAAGTGAACAGATATGAGAAAAAACTGGGAAATTTCGGAAAAGTTCAGACAATTCTAGACAATTTTCAACCTCCAGCTGCGGTGATACCGGCA unc-10 gRNA: TTTTTTGTCTTAATTACCAC unc-10::7×GFP 11 HDR template AAGATTCCGATGTATCAGTTGGAGGTGCTCAGCAGGGAGCCCGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACAGGTGGCTCTGGAGGTAGAGATCATATGGTTCTCCACGAATACGTTAACGCCGCAGGCATCACTGGCGGTAGTGGAGGACGCGACCATATGGTACTACATGAATATGTCAATGCAGCCGGAATAACCGGAGGGTCCGGAGGCCGGGATCACATGGTGCTGCATGAGTATGTGAACGCGGCGGGTATAACTGGTGGGTCGGGCGGACGAGACCATATGGTGCTTCACGAATACGTAAACGCAGCTGGCATTACTGGCGGATCAGGTGGCAGGGATCACATGGTACTCCATGAGTACGTGAACGCTGCTGGAATCACAGGCGGTAGCGGCGGTCGGGACCATATGGTCCTGCACGAATATGTCAATGCTGCCGGTATCACCTAAcaaatttcatatgtttttgtttgttttttgtcttaattaccacaCgtcatttctctctttctatcgtcattttctt F: AAGATTCCGATGTATCAGTTGGAGGTGCTCAGCAGGGAGCCCGTGACCACATGGTCC TTCA R: AAGAAAATGACGATAGAAAGAGAGAAATGACGTGTGGTAATTAAGACAAAAAACAAACAAAAACATATGAAATTTGTTAGGTGATACCGGCAGCATTGA Acknowledgements We would like to thank Don Moerman for the general discussion and all of his work on the gene knockout consortium, including the generation of the syd-2(ok217) mutant strain, Peri Kurshan for providing the wyIs685 transgenic strain, and Ardalan Hendi, Mo Miao, Sydney Ko, Menghao Lu for comments on the manuscript. We also thank the Mizumoto lab and colleagues for their general discussions. syd-2(ok217) used in this study were obtained from the Caenorhabditis Genetics Center, CGC, funded by the National Institute of Health (NIH) - Office of Research Infrastructure Programs (P40 OD010440) and C. elegans gene knockout consortium. This work is supported by the Canadian Institutes of Health Research (CIHR) and the Natural Sciences and Engineering Research Council of Canada (NSERC). M. K. is a recipient of CIHR CGS-D and the UBC 4-year fellowship. A. W. S. is a recipient of UBC Cell 1-year fellowship, and the Alzheimer Society Doctoral Award. References ↵ Couteaux , R. & Pecot-Dechavassine , M . [Synaptic vesicles and pouches at the level of “active zones” of the neuromuscular junction] . C R Acad Sci Hebd Seances Acad Sci D 271 , 2346 – 2349 ( 1970 ). OpenUrl PubMed ↵ Dreyer , F. , Peper , K. , Akert , K. , Sandri , C. & Moor , H . Ultrastructure of the “active zone” in the frog neuromuscular junction . Brain Res 62 , 373 – 380 ( 1973 ). doi: 10.1016/0006-8993(73)90699-9 OpenUrl CrossRef PubMed Web of Science ↵ Sudhof , T. C . The presynaptic active zone . Neuron 75 , 11 – 25 ( 2012 ). doi: 10.1016/j.neuron.2012.06.012 OpenUrl CrossRef PubMed Web of Science ↵ Mizumoto , K. , Jin , Y. & Bessereau , J. L . Synaptogenesis: unmasking molecular mechanisms using Caenorhabditis elegans . Genetics 223 ( 2023 ). doi: 10.1093/genetics/iyac176 OpenUrl CrossRef ↵ Hendi , A. , Kurashina , M. & Mizumoto , K . Intrinsic and extrinsic mechanisms of synapse formation and specificity in C. elegans . Cell Mol Life Sci 76 , 2719 – 2738 ( 2019 ). doi: 10.1007/s00018-019-03109-1 OpenUrl CrossRef ↵ Hallam , S. J. , Goncharov , A. , McEwen , J. , Baran , R. & Jin , Y . SYD-1, a presynaptic protein with PDZ, C2 and rhoGAP-like domains, specifies axon identity in C. elegans . Nat Neurosci 5 , 1137 – 1146 ( 2002 ). doi: 10.1038/nn959 OpenUrl CrossRef PubMed Web of Science ↵ Zhen , M. & Jin , Y . The liprin protein SYD-2 regulates the differentiation of presynaptic termini in C. elegans . Nature 401 , 371 – 375 ( 1999 ). doi: 10.1038/43886 OpenUrl CrossRef PubMed Web of Science ↵ Shen , K. & Bargmann , C. I . The immunoglobulin superfamily protein SYG-1 determines the location of specific synapses in C. elegans . Cell 112 , 619 – 630 ( 2003 ). doi: 10.1016/s0092-8674(03)00113-2 OpenUrl CrossRef PubMed Web of Science ↵ Yeh , E. et al. Caenorhabditis elegans innexins regulate active zone differentiation . J Neurosci 29 , 5207 – 5217 ( 2009 ). doi: 10.1523/JNEUROSCI.0637-09.2009 OpenUrl Abstract / FREE Full Text ↵ Lipton , D. M. , Maeder , C. I. & Shen , K . Rapid Assembly of Presynaptic Materials behind the Growth Cone in Dopaminergic Neurons Is Mediated by Precise Regulation of Axonal Transport . Cell Rep 24 , 2709 – 2722 ( 2018 ). doi: 10.1016/j.celrep.2018.07.096 OpenUrl CrossRef ↵ Kushibiki , Y. , Suzuki , T. , Jin , Y. & Taru , H . RIMB-1/RIM-Binding Protein and UNC-10/RIM Redundantly Regulate Presynaptic Localization of the Voltage-Gated Calcium Channel in Caenorhabditis elegans . J Neurosci 39 , 8617 – 8631 ( 2019 ). doi: 10.1523/JNEUROSCI.0506-19.2019 OpenUrl Abstract / FREE Full Text ↵ Weimer , R. M. et al. UNC-13 and UNC-10/rim localize synaptic vesicles to specific membrane domains . J Neurosci 26 , 8040 – 8047 ( 2006 ). doi: 10.1523/JNEUROSCI.2350-06.2006 OpenUrl Abstract / FREE Full Text ↵ Xuan , Z. et al. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release . eLife 6 ( 2017 ). doi: 10.7554/eLife.29276 OpenUrl CrossRef ↵ Hefel , A. & Smolikove , S . Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline . G3 (Bethesda) 9 , 1933 – 1943 ( 2019 ). doi: 10.1534/g3.119.400162 OpenUrl Abstract / FREE Full Text ↵ Cabantous , S. & Waldo , G. S . In vivo and in vitro protein solubility assays using split GFP . Nat Methods 3 , 845 – 854 ( 2006 ). doi: 10.1038/nmeth932 OpenUrl CrossRef PubMed Web of Science ↵ Feng , S. et al. Improved split fluorescent proteins for endogenous protein labeling . Nat Commun 8 , 370 ( 2017 ). doi: 10.1038/s41467-017-00494-8 OpenUrl CrossRef PubMed ↵ He , S. , Cuentas-Condori , A. & Miller , D. M ., 3rd. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans . Genetics 212 , 387 – 395 ( 2019 ). doi: 10.1534/genetics.119.302063 OpenUrl Abstract / FREE Full Text ↵ Goudeau , J. et al. Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans . Genetics 217 ( 2021 ). doi: 10.1093/genetics/iyab014 OpenUrl CrossRef ↵ Brenner , S . The genetics of Caenorhabditis elegans . Genetics 77 , 71 – 94 ( 1974 ). OpenUrl Abstract / FREE Full Text ↵ Fire , A . Integrative transformation of Caenorhabditis elegans . EMBO J 5 , 2673 – 2680 ( 1986 ). OpenUrl CrossRef PubMed Web of Science ↵ Mello , C. C. , Kramer , J. M. , Stinchcomb , D. & Ambros , V . Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences . EMBO J 10 , 3959 – 3970 ( 1991 ). OpenUrl CrossRef PubMed Web of Science ↵ Gower , N. J. et al. Dissection of the promoter region of the inositol 1,4,5-trisphosphate receptor gene, itr-1, in C. elegans: a molecular basis for cell-specific expression of IP3R isoforms . J Mol Biol 306 , 145 – 157 ( 2001 ). doi: 10.1006/jmbi.2000.4388 OpenUrl CrossRef PubMed Web of Science ↵ Sym , M. , Robinson , N. & Kenyon , C . MIG-13 positions migrating cells along the anteroposterior body axis of C. elegans . Cell 98 , 25 – 36 ( 1999 ). doi: 10.1016/S0092-8674(00)80603-0 OpenUrl CrossRef PubMed Web of Science ↵ Kratsios , P. et al. An intersectional gene regulatory strategy defines subclass diversity of C. elegans motor neurons . eLife 6 ( 2017 ). doi: 10.7554/eLife.25751 OpenUrl CrossRef ↵ Jin , Y. , Jorgensen , E. , Hartwieg , E. & Horvitz , H. R . The Caenorhabditis elegans gene unc-25 encodes glutamic acid decarboxylase and is required for synaptic transmission but not synaptic development . J Neurosci 19 , 539 – 548 ( 1999 ). doi: 10.1523/JNEUROSCI.19-02-00539.1999 OpenUrl Abstract / FREE Full Text ↵ Nass , R. , Hall , D. H. , Miller , D. M ., 3rd & Blakely , R. D. Neurotoxin-induced degeneration of dopamine neurons in Caenorhabditis elegans . Proc Natl Acad Sci U S A 99 , 3264 – 3269 ( 2002 ). doi: 10.1073/pnas.042497999 OpenUrl Abstract / FREE Full Text ↵ Ghanta , K. S. & Mello , C. C . Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans . Genetics 216 , 643 – 650 ( 2020 ). doi: 10.1534/genetics.120.303564 OpenUrl Abstract / FREE Full Text ↵ Kurashina , M. & Mizumoto , K . Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans . STAR Protoc 4 , 102028 ( 2023 ). doi: 10.1016/j.xpro.2022.102028 OpenUrl CrossRef ↵ Hu , Z. , Tong , X. J. & Kaplan , J. M . UNC-13L, UNC-13S, and Tomosyn form a protein code for fast and slow neurotransmitter release in Caenorhabditis elegans . eLife 2 , e00967 ( 2013 ). doi: 10.7554/eLife.00967 OpenUrl CrossRef PubMed McDonald , N. A. , Fetter , R. D. & Shen , K . Assembly of synaptic active zones requires phase separation of scaffold molecules . Nature 588 , 454 – 458 ( 2020 ). doi: 10.1038/s41586-020-2942-0 OpenUrl CrossRef ↵ Dai , Y. et al. SYD-2 Liprin-alpha organizes presynaptic active zone formation through ELKS . Nat Neurosci 9 , 1479 – 1487 ( 2006 ). doi: 10.1038/nn1808 OpenUrl CrossRef PubMed Web of Science ↵ Kurshan , P. T. et al. gamma-Neurexin and Frizzled Mediate Parallel Synapse Assembly Pathways Antagonized by Receptor Endocytosis . Neuron 100 , 150 – 166 e154 ( 2018 ). doi: 10.1016/j.neuron.2018.09.007 OpenUrl CrossRef PubMed Kurashina , M. et al. Sustained expression of unc-4 homeobox gene and unc-37/Groucho in postmitotic neurons specifies the spatial organization of the cholinergic synapses in C. elegans . eLife 10 ( 2021 ). doi: 10.7554/eLife.66011 OpenUrl CrossRef Hendi , A. et al. Channel-independent function of UNC-9/Innexin in spatial arrangement of GABAergic synapses in C. elegans . eLife 11 ( 2022 ). doi: 10.7554/eLife.80555 OpenUrl CrossRef ↵ Niwa , S. et al. Autoinhibition of a Neuronal Kinesin UNC-104/KIF1A Regulates the Size and Density of Synapses . Cell Rep 16 , 2129 – 2141 ( 2016 ). doi: 10.1016/j.celrep.2016.07.043 OpenUrl CrossRef PubMed ↵ Mahoney , T. R. et al. Regulation of synaptic transmission by RAB-3 and RAB-27 in Caenorhabditis elegans . Mol Biol Cell 17 , 2617 – 2625 ( 2006 ). doi: 10.1091/mbc.e05-12-1170 OpenUrl Abstract / FREE Full Text ↵ Oh , K. H. & Kim , H . Aldicarb-induced Paralysis Assay to Determine Defects in Synaptic Transmission in Caenorhabditis elegans . Bio-protocol 7 ( 2017 ). doi: 10.21769/BioProtoc.2400 OpenUrl CrossRef ↵ Koushika , S. P. et al. A post-docking role for active zone protein Rim . Nat Neurosci 4 , 997 – 1005 ( 2001 ). doi: 10.1038/nn732 OpenUrl CrossRef PubMed Web of Science ↵ Deken , S. L. et al. Redundant localization mechanisms of RIM and ELKS in Caenorhabditis elegans . J Neurosci 25 , 5975 – 5983 ( 2005 ). doi: 10.1523/jneurosci.0804-05.2005 OpenUrl Abstract / FREE Full Text ↵ Nonet , M. L. et al. Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles . J Neurosci 17 , 8061 – 8073 ( 1997 ). OpenUrl Abstract / FREE Full Text ↵ Johnson , J. R. , Kashyap , S. , Rankin , K. & Barclay , J. W . Rab-3 and unc-18 interactions in alcohol sensitivity are distinct from synaptic transmission . PLoS One 8 , e81117 ( 2013 ). doi: 10.1371/journal.pone.0081117 OpenUrl CrossRef PubMed ↵ Klassen , M. P. & Shen , K . Wnt signaling positions neuromuscular connectivity by inhibiting synapse formation in C. elegans . Cell 130 , 704 – 716 ( 2007 ). doi: 10.1016/j.cell.2007.06.046 OpenUrl CrossRef PubMed Web of Science ↵ He , S. et al. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein . Curr Biol 25 , 2541 – 2548 ( 2015 ). doi: 10.1016/j.cub.2015.08.022 OpenUrl CrossRef PubMed ↵ Chalfie , M. et al. The neural circuit for touch sensitivity in Caenorhabditis elegans . J Neurosci 5 , 956 – 964 ( 1985 ). OpenUrl Abstract / FREE Full Text ↵ White , J. G. , Southgate , E. , Thomson , J. N. & Brenner , S . The structure of the ventral nerve cord of Caenorhabditis elegans . Philos Trans R Soc Lond B Biol Sci 275 , 327 – 348 ( 1976 ). doi: 10.1098/rstb.1976.0086 OpenUrl CrossRef PubMed ↵ Eastman , C. , Horvitz , H. R. & Jin , Y . Coordinated transcriptional regulation of the unc-25 glutamic acid decarboxylase and the unc-47 GABA vesicular transporter by the Caenorhabditis elegans UNC-30 homeodomain protein . J Neurosci 19 , 6225 – 6234 ( 1999 ). doi: 10.1523/JNEUROSCI.19-15-06225.1999 OpenUrl Abstract / FREE Full Text ↵ McIntire , S. L. , Jorgensen , E. & Horvitz , H. R . Genes required for GABA function in Caenorhabditis elegans . Nature 364 , 334 – 337 ( 1993 ). doi: 10.1038/364334a0 OpenUrl CrossRef PubMed Web of Science ↵ White , J. G. , Southgate , E. , Thomson , J. N. & Brenner , S . The structure of the nervous system of the nematode Caenorhabditis elegans . Philos Trans R Soc Lond B Biol Sci 314 , 1 – 340 ( 1986 ). OpenUrl CrossRef PubMed ↵ Chia , P. H. , Chen , B. , Li , P. , Rosen , M. K. & Shen , K . Local F-actin network links synapse formation and axon branching . Cell 156 , 208 – 220 ( 2014 ). doi: 10.1016/j.cell.2013.12.009 OpenUrl CrossRef PubMed ↵ Stavoe , A. K. & Colón-Ramos , D. A . Netrin instructs synaptic vesicle clustering through Rac GTPase, MIG-10, and the actin cytoskeleton . J Cell Biol 197 , 75 – 88 ( 2012 ). doi: 10.1083/jcb.201110127 OpenUrl Abstract / FREE Full Text ↵ Xuan , Z. et al. The active zone protein Clarinet regulates synaptic sorting of ATG-9 and presynaptic autophagy . PLoS Biol 21 , e3002030 ( 2023 ). doi: 10.1371/journal.pbio.3002030 OpenUrl CrossRef ↵ Johnston , P. A. et al. rab3A attachment to the synaptic vesicle membrane mediated by a conserved polyisoprenylated carboxy-terminal sequence . Neuron 7 , 101 – 109 ( 1991 ). doi: 10.1016/0896-6273(91)90078-e OpenUrl CrossRef PubMed Web of Science ↵ Zhao , H. & Nonet , M. L . A conserved mechanism of synaptogyrin localization . Mol Biol Cell 12 , 2275 – 2289 ( 2001 ). doi: 10.1091/mbc.12.8.2275 OpenUrl Abstract / FREE Full Text ↵ Li , L. et al. SNT-1 Functions as the Ca(2+) Sensor for Tonic and Evoked Neurotransmitter Release in Caenorhabditis Elegans . J Neurosci 38 , 5313 – 5324 ( 2018 ). doi: 10.1523/JNEUROSCI.3097-17.2018 OpenUrl Abstract / FREE Full Text ↵ Stavoe , A. K. et al. Synaptic vesicle clustering requires a distinct MIG-10/Lamellipodin isoform and ABI-1 downstream from Netrin . Genes Dev 26 , 2206 – 2221 ( 2012 ). doi: 10.1101/gad.193409.112 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted July 30, 2024. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans Mizuki Kurashina , Andrew W. Snow , Kota Mizumoto bioRxiv 2024.07.29.605690; doi: https://doi.org/10.1101/2024.07.29.605690 Share This Article: Copy Citation Tools A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans Mizuki Kurashina , Andrew W. Snow , Kota Mizumoto bioRxiv 2024.07.29.605690; doi: https://doi.org/10.1101/2024.07.29.605690 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7647) Biochemistry (17728) Bioengineering (13921) Bioinformatics (42047) Biophysics (21490) Cancer Biology (18637) Cell Biology (25555) Clinical Trials (138) Developmental Biology (13403) Ecology (19942) Epidemiology (2067) Evolutionary Biology (24368) Genetics (15625) Genomics (22549) Immunology (17764) Microbiology (40475) Molecular Biology (17208) Neuroscience (88761) Paleontology (667) Pathology (2842) Pharmacology and Toxicology (4834) Physiology (7659) Plant Biology (15175) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9835) Zoology (2272)