Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils

Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils Emihle Ngonini, Anathi Magadlela This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4621168/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Vicia sativa and Vicia villosa are nitrogen (N) fixing legumes commonly used as forage and cover crops due to their ability to enhance N fixation, soil N contributions, and enzyme activities in nutrient-deficient soils. Using V. sativa and V. villosa as cover crops can potentially improve nutrient cycling in nutrient-deficient sugarcane plantations owned by small-scale growers (SSGs) in KwaZulu-Natal, South Africa. This study investigated the chemical and biological inputs of V. sativa and V. villosa in nutrient-deficient sugarcane plantation soils. The nutrient concentration, N and phosphorus (P) cycling bacteria, and extracellular enzyme activities of soils collected from five small-scale sugarcane plantations were determined pre-planting and post- V. sativa and V. villosa harvest. Post- V. sativa and V. villosa soils had higher pH levels than pre-planting soils across all plantation soils. The number of plant growth-promoting rhizobacteria (PGPR) isolated from soils post- V. sativa and V. villosa harvest increased across all plantation soils. The Arthrobacter , Burkholderia and Paraburkholderia Pseudomonas were the most dominant genera isolated from post-harvest soils. The number of P-solubilising bacteria increased, increasing acid phosphatase activities. The findings of this study reveal that V. sativa and V. villosa increase PGPR, pH and enzyme activities in soils, making them sustainable options as cover crops for nutrient-deficient sugarcane plantation soils owned by SSGs. Small-scale sugarcane plantations nutrient-deficient Vicia sativa Vicia villosa cover crops plant growth-promoting rhizobacteria soil nitrogen nutrition soil pH Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Introduction Arable land availability is one of the main factors affecting crop productivity worldwide [ 1 ]. According to [ 2 ], arable land per person in 2050 is expected to decrease by 33% from what it was in 1970. Reduced arable land coupled with the ever-increasing world population raises concerns about food security [ 3 ]. In recent years, food insecurity levels have increased steadily in southern Africa and remain a significant developmental problem in the sub-region [ 4 ]. [ 5 ] reported increases in food insecurity rates in most South African households, with food insecurity and poverty being some of the dominant socioeconomic issues in the country [ 6 ]. In 2021, 3.7 million out of 17.9 million households were reported to be food insecure [ 7 ], with food insecurity affecting most small-scale farming homesteads [ 8 , 9 ]. Food insecurity is exacerbated by the declining soil fertility and low crop yield experienced by many SSGs in the country [ 10 ]. Approximately 70% of South African SSGs residing in rural areas rely on subsistence farming as their source of livelihood [ 11 ]. Sugarcane is the main cash crop cultivated by SSGs in KwaZulu-Natal [ 12 ]. The sugar industry, primarily rural-based, plays a crucial role in supporting these SSGs by generating income and aiding in poverty alleviation and food security [ 12 ]. However, SSGs have been experiencing a decline in productivity [ 12 ], which could result from the intensive farming practices employed for cane production [ 13 ]. Small-scale growers practice monoculture because of land limitations. However, it has been reported to lead to land degradation and declining soil health and fertility [ 13 ]. This is due to the loss of the soil's organic matter, breakdown of the soil structure, soil acidification and nutrient leaching [ 14 ]. Furthermore, high-yield intensive farming systems require extensive amounts of chemical fertilisers, which are detrimental to the environment and are too costly for poor, resource-limited SSGs [ 10 ]. Increased fertiliser inputs do not guarantee fertility and productivity, as a significant portion of the fertiliser is lost through leaching and runoff [ 15 , 16 ]. Therefore, soil fertility management practices that sustainably improve soil health and increase production by SSGs are required to mitigate food insecurity and poverty. Vicia species have been reported to be a green manure alternatives in sustainable agricultural systems [ 17 , 18 ]. Vicia species can effectively enhance soil fertility when used as cover crops by fixing atmospheric N and returning it to the soil through N spillover [ 19 ]. The success of Vicia species can be attributed to their association with diverse microorganisms that benefit the plants’ development [ 20 ]. [ 21 ] suggested that Vicia species foster a substantial community of rhizobial bacteria, promoting the ecosystem function of the bacteria as plant growth promoters. Vicia villosa has been reported to improve acid phosphatase activities and promote soil physical and chemical properties, thereby increasing crop yields and quality [ 22 ]. Incorporating V. sativa and V. villosa as green manure between sugarcane plant cycles can help alleviate the long-term effects of sugarcane monoculture by reducing the need for N fertiliser for subsequent crops, offering a cheaper alternative to synthetic fertilisers [ 23 ]. Moreover, adding V. sativa and V. villosa in between the crop cycles increases crop diversity [ 24 ], reducing the population of detrimental soil microbes [ 25 ] and diversifying the root exudates released by the plant roots into the soil [ 26 ]. The function of plant growth-promoting rhizobacteria (PGPR) can be limited by several environmental conditions, including decreases in soil pH and reduced nutrient availability. However, root exudates can increase their plant growth-promoting activities by influencing the physiochemical properties of the soil [ 27 ] which influences the soil enzyme activities [ 26 ]. The decomposition of roots from the cover crop residue can release the stored N into the soil [ 28 ], introducing organic matter, increasing resistance to biological degradation, facilitating a longer and deeper carbon for the next crop [ 29 ]. Although the utilisation of V. sativa and V. villosa as green manure and cover crop is a growing practice in many agroecosystems [ 30 , 31 ], its biological and chemical contribution to sugarcane farming systems in South Africa is unknown. Therefore, this study aims to investigate the chemical and biological contributions of V. sativa and V. villosa to small-scale KwaZulu-Natal sugarcane soils. Additionally, the study seeks to examine how the soil conditions influence the growth physiology and nutrient assimilation rates of V. sativa and V. villosa cover crops. The objectives of the study are to isolate and identify nutrient-cycling bacteria, their associated enzymes and soil chemical characteristics in sugarcane soils collected from five different sugarcane plantation sites pre-planting and post- V. sativa and villosa harvest. Understanding the growth physiology of V. sativa a nd V. villosa in the different plantation soils will help quantify the N and P accumulated by the legume, which will facilitate the biomass residue management of the crop. 2 Materials and Methods 2.1 Soil Collection Sites Soil samples were collected from five small-scale sugarcane plantations at different geographical locations in the north and south coast of KwaZulu-Natal (KZN). The northern KZN plantation sites included Mvutshini (28° 50’ 52.9” S 32°00’09.0” E), Mpembeni (28°51’ 25.7” S 31°58’19.4” E), and Gingindlovu (28°56’29.3”S 31°34’58.9”E). The southern KZN plantations, Hibberdene (30°35’37.1214”S,30°31’30.2916”E) and Mzinto (30°16’41.0262”S,30°39’47.9658”E), were located in the South Coast. Northern KZN has a subtropical climate that is warm and humid but is characterised by heavy rainfalls throughout the year. The South coast of KZN is characterised by a subtropical climate, with warm temperatures, mild winters, high humidity, and generous summer rainfall. From each site, the experimental soils, classified as sandy soils, were collected from 20 random points of the plantation at a depth of 10–20 cm, where microbial nutrient cycling activities occur, using a Dutch auger. Pre-planting, the soils for enzyme activity assays, bacterial extraction and identification experiments were collected and packaged into sterile plastic bags. The soils were then immediately placed on ice during transportation and stored at 4°C before analysis. 2.2 Experimental setup, Growth conditions, and Soil Chemical Analysis Vicia sativa a nd V. villosa seeds used in this study were obtained from AGT Foods Africa, Marji Mizuri farm, KwaZulu-Natal. The seeds were handled as per Plant Improvement Act 53 of 1976, Regulations Relations To Establishment, Varieties, Plant And Propagation Material. The seeds were germinated by soaking in warm water overnight to stimulate germination, and then transferred into petri dishes lined with moist, sterile filter paper and stored in the dark for four days at room temperature. After germination, the seeds were planted at 1–2 cm depths in 10 cm diameter pots filled with soil from the different plantations. The experiment was a completely randomised design with the plantation sites as treatments with 10 replications per site per species, resulting in a total of 100 experimental pots. The experimental trials were conducted in the greenhouse at the University of KwaZulu-Natal, Westville campus, School of Life Sciences building, South Africa. The average night and day temperatures in the greenhouse ranged from 11–15°C and 30–35°C, respectively. Initial and final harvesting were conducted 14 and 45 days after seedling emergence. The initial and final harvesting was required for the growth, nutrient assimilation, and utilisation calculations. Post-harvest, the plants were rinsed with distilled H 2 O, separated into roots, stems and leaves, and dried at 65°C until constant weight was reached. The plant dry weights (DW) were recorded, and dried material was ground using a mortar and pestle. The ground plant material was then sent for carbon (C) and N isotope analysis at the Archaeometry Department at the University of Cape Town, South Africa, and P analysis at the Central Analytical Facilities of Stellenbosch University, South Africa. Post final harvest, the soils were transferred into sterile plastic bags and stored at 4°C to be used for nutrient analysis, enzyme activity assays, and bacterial extraction and identification. For total soil nutrient analysis, three kilogram (kg) soil samples from each plantation (initial and post-harvest) were air-dried, sieved through a 2 mm sieve, and sent to the South African Sugarcane Research Institute (SASRI) Fertiliser Advisory Services (FAS) for pH, exchange acidity, total cations, primary, secondary and micronutrients analysis. 2.3 Soil Bacterial Extraction Three-fold soil serial dilutions were conducted where 10 g of soil sample were diluted in 100 ml of autoclaved distilled water under sterile conditions. The dilutions were then transferred into selective media plates by inoculating each plate with 100 µl of the dilution. Jensen media plates were used to grow N-fixing bacteria, while tricalcium phosphate and Simmons citrate plates were used to grow P-solubilising and N-cycling bacteria, respectively. The media plates were incubated at 30°C and allowed to grow for 3 to 7 days. Thereafter, single colonies were distinguished according to colour and size and sub-cultured into sterile, separate media plates to form pure colonies/cultures. 2.4 Bacterial Amplification and Identification Pure colonies/cultures obtained from repeated streaking were amplified using a colony PCR where pure bacterial colonies were amplified using the 63F (5’- CAGGCCTAACACATGCAAGTC − 3′) and 1387R (5′- GGGCGGTGTGTACAAGGC − 3′) primers. A T100 Thermal Cycler (Bio-Rad, USA) was used for amplification with the initial denaturation at 94°C for 2 min, 30 cycles of denaturation at 92°C for 30 sec, annealing at 56°C for 45 sec and elongation at 75°C for 45 sec. with the final elongation at 75°C for 10 min. The PCR products were resolved on 1.0% (w/v) agarose gels (Seakem) and visualised after staining. Positive amplicons were sent for sequencing at Inqaba Biotech Pty. Ltd., Pretoria, South Africa. Thereafter, the sequences were edited and compared against the GenBank database. Homologues were identified using the BLASTN program at the National Center for Biotechnology Information (NCBI) ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ) (accessed 27 December 2023). 2.5 Soil Enzyme Activity Analysis 2.5.1 β-Glucosidase and acid phosphatase activity The soil β-Glucosidase and acid phosphatase activity (nmolh − 1 g − 1 ) was determined using the fluorescence-based method adapted from [ 32 ]. Briefly, 10 g of soil sample were homogenised in 100 ml of dH 2 O at low speed for 2 hrs. An appropriate MUB substrate, bicarbonate buffer (100 mM) and a 4-Methylumbelliferone standard (100 µM) were prepared. The different solutions were then transferred into 96-well microplates and incubated for 1hr at 30°C; 0.5 M of NaOH was used to stop the reaction. MUB-phosphatase substrate and 4-MUB-glucopyranoside substrates were used for acid phosphatase and β-Glucosidase activities, respectively. The buffer and standard had their pH adjusted to 5 for the acid phosphatase activity. The fluorescent absorbance was measured at 450 nm using an Apex Scientific microplate reader (Durban, South Africa). 2.5.2 Nitrate Reductase Activity The nitrate reductase activity was determined using the method adapted from [ 33 ]. Briefly, 5 g of soil sample were mixed with 4 ml of 0.9 mM 2.4 DNP, 1 ml of 25 mM KNO 3 and 5ml of autoclaved distilled water in a conical flask wrapped with foil to prevent light penetration. The mixture was mixed vigorously before incubation for 24 hrs at 30°C. After incubation, 10ml of 4 M KCl was added to each sample, mixed, and passed through Whatman no. 1 filter paper. The enzyme activity was initiated by adding 2 ml of the filtrate into 1.2 ml of 0.19 M of ammonium chloride (pH ~ 8.5) and 0.8ml of the colour reagent (1% sulphanilamide in 1 N HCl and 0.2% N-(1-naphthyl) ethylenediamine dihydrochloride (NEDD). The sample was then incubated at 30°C for 30 mins. After that, the absorbance was measured at 520 nm using an Agilent Cary 60UV-Vis spectrophotometer (Agilent, Santa Clara, CA, USA). The amount of nitrite released into the medium was expressed as 0.1 µmolh − 1 g − 1 . 2.6 Plant Nutrition 2.6.1 Calculation of Percentage Nitrogen Derived from the Atmosphere (%NDFA) Nitrogen isotope analyses were conducted at the Archeometry Department, University of Cape Town, South Africa. The isotopic ratio of N was calculated as δ = 1000‰ (Rsample/ Rstandard), where R is the molar ratio of the heavier to the lighter isotope of the samples and standards as described by [ 34 ]. Between 2.100 and 2.200 mg of each milled sample were weighed into 8 mm x 5-mm tin capsules (Elemental Micro-analysis, Devon, UK) on a Sartorius microbalance (Goettingen, Germany). The samples were then combusted in a Fisons NA 1500 (Series 2) CHN analyser (Fisons Instruments SpA, Milan, Italy). The N isotope values for the N gas released were determined on a Finnigan Matt 252 mass spectrometer (Finnigan MAT GmbH, Bremen, Germany), which was connected to a CHN analyser by a Finnigan MAT Conflo control unit. Three standards were used to correct the samples for machine drift, namely, two in-house standards (Merck Gel and Nasturtium) and the IAEA (International Atomic Energy Agency) standard (NH 4 ) 2 SO 4 . %NDFA was calculated according to [ 35 ], as follows: %NDFA= \(100\left(\frac{{\delta }^{15}{N}_{reference plant}-{\delta }^{15}{N}_{legume}}{{\delta }^{15}{N}_{referece plant}-B}\right)\) ; Where the reference plant was non-nodulated V. sativa or V. villosa , planted 2 weeks later than the experimental plants and grown under the same glasshouse conditions using 500 mM N in a Long Ashton nutrient solution (25% strength). The B value is the d 15 N natural abundance of the N derived exclusively from biological N-fixation of nodulated V. sativa or V. villosa . The seeds were germinated in the natural inoculum, and thereafter, the seedlings were grown with N-free 25% strength Long Ashton nutrient solution in sterile-sand culture. The B-value of V. sativa was determined as − 2.58. 2.6.2 Specific N/P Absorption Rate (SNAR/SPAR) The net N/P absorption rate per unit root DW was calculated according to [ 36 ] using the plant's total N/P content. SNAR= \(({N}_{2}-{N}_{1}/{t}_{2}-{t}_{1})\times \left(({\text{log}}_{e}{R}_{2}-{\text{log}}_{e}{R}_{1})/({R}_{2}-{R}_{1})\right)\) SPAR= \(({P}_{2}-{P}_{1}/{t}_{2}-{t}_{1})\times \left(({\text{log}}_{e}{R}_{2}-{\text{log}}_{e}{R}_{1})/({R}_{2}-{R}_{1})\right)\) Where N2 and N1 are the final and initial N, respectively; P2 and P1 are the P content, t is the duration of plant growth, and R is the root. dry weight (mg N g − 1 root DW day − 1 ) 2.6.3 Specific N/P utilisation rates (SNUR/SPUR) The total N/P were used to calculate the specific N/P utilisation rate (g DW mg − 1 N/P day − 1 ) according to [ 36 ]. SNUR= \(({W}_{2}-{W}_{1}/{t}_{2}-{t}_{1})\times \left(({\text{log}}_{e}{N}_{2}-{\text{log}}_{e}{N}_{1})/({N}_{2}-{N}_{1})\right)\) SPUR= \(({W}_{2}-{W}_{1}/{t}_{2}-{t}_{1})\times \left(({\text{log}}_{e}{M}_{2}-{\text{log}}_{e}{M}_{1})/({M}_{2}-{M}_{1})\right)\) Where W, N, P and t represent the plant DW, total N content, total P content and the duration of the plant growth, respectively. 2.6.5 Relative Growth Rate (RGR) The relative growth rate was calculated using the method by [ 37 ]: RGR= \(\left[(\text{ln}{W}_{2}-{W}_{1})/{t}_{2}-{t}_{1}\right]\) Where W denotes the dry plant weights accumulated from the initial (W 1 ) and final (W 2 ) harvest and t is the time for plant growth. 2.6.6 Root: shoot ratio The root: shoot ratio was calculated according to [ 37 ] using the root biomass per shoot biomass of the plant. Root: shoot= \({D}_{R}/{D}_{S}\) Where D R is the dry weight of the root while D S is the dry weight of the shoot. 2.7 Statistical Analysis R- studio (R version 4.3.1) was used for all analyses where soil nutrition (pre- and post-planting and harvest), soil enzyme activities (pre- and post-harvest), growth kinetics, plant biomass and plant mineral nutrition of V. sativa and V. villosa were examined using the analysis of variance (One-way ANOVA). A Tukey multiple comparisons post hoc test was conducted when significant results were observed in the ANOVA (p < 0.05). The assumptions for normal distribution were tested using the Shapiro-Wilk test, while the assumption for homogeneity of variance was tested using Levene’s test (library car package). A non-parametric (Kruskal-Walli’s test) alternative was used when the assumptions were not met. 3 Results 3.1 Soil Chemical Analysis Post-harvesting, there was a significant decrease in soil N concentrations in Mpembeni, Mzinto, and Gingindlovu under both species (Table 1 ). The soil P concentrations decreased significantly in Mvutshini, Mzinto and Hibberdene under V. sativa treatment, while a significant decrease was observed under both species treatments in Gingindlovu (Table 1 ). The potassium (K) concentrations post-harvesting showed a significant increase in Mpembeni and a decrease in Hibberdene under both species treatments (Table 1 ). Calcium (Ca) concentrations significantly increased across all sites, while magnesium (Mg) concentrations increased significantly in Mpembeni, Mzinto, and Hibberdene. The soil pH increased significantly across all sites under both species except for Mvutshini- V. sativa , which showed no significant differences (4.67 to 5.04). The exchange acidity increased significantly in Mvutshini, Mpembeni, and Gingindlovu post-harvesting soils. Table 1 The chemical parameters of pre-planting and post- Vicia sativa and Vicia villosa harvest in soils collected from Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu. The different values are presented as mean ± SE. Different letters represent significant differences after One-Way ANOVA Nitrogen (mg/L) Phosphorus (mg/L) Potassium (mg/L) Calcium (mg/L) Magnesium (mg/L) pH Exchange Acidity (Al + H) Mvutshini Pre 0.085 ± 0.00 ab 3.70 ± 0.12 a 33.00 ± 0.00 a 196.00 ± 13.86 a 72.50 ± 8.37 a 4.67 ± 0.03 a 0.50 ± 0.15 a Vicia sativa 0.070 ± 0.01 a 2.85 ± 0.14 b 40.50 ± 4.91 a 400.00 ± 54.80 b 134.50 ± 22.80 b 4.75 ± 0.16 a 0.36 ± 0.03 b Vicia villosa 0.090 ± 0.00 b 3.60 ± 0.00 a 43.00 ± 0.00 a 391.00 ± 3.46 b 119.00 ± 1.15 ab 5.04 ± 0.05 b 0.33 ± 0.00 b Mpembeni Pre 0.055 ± 0.00 a 3.30 ± 0.00 a 18.50 ± 0.29 a 150.50 ± 0.29 a 46.00 ± 0.00 a 4.64 ± 0.02 a 0.27 ± 0.02 a Vicia sativa 0.025 ± 0.00 b 3.15 ± 0.14 a 26.50 ± 0.29 b 270.00 ± 2.89 b 79.50 ± 0.87 b 5.99 ± 0.05 b 0.05 ± 0.00 b Vicia villosa 0.020 ± 0.00 b 3.00 ± 0.06 a 22.00 ± 0.58 c 219.00 ± 4.04 c 58.50 ± 3.75 c 5.49 ± 0.26 b 0.08 ± 0.01 b Mzinto Pre 0.070 ± 0.00 a 10.70 ± 0.29 a 61.00 ± 1.73 a 726.00 ± 53.12 a 151.00 ± 12.12 a 5.71 ± 0.04 a 0.05 ± 0.00 a Vicia sativa 0.035 ± 0.00 b 9.75 ± 0.03 b 72.00 ± 1.73 a 923.00 ± 7.51 b 219.00 ± 2.89 b 6.40 ± 0.02 b 0.05 ± 0.00 a Vicia villosa 0.040 ± 0.00 b 10.10 ± 0.23 ab 68.50 ± 3.75 a 930.50 ± 68.99 b 222.00 ± 22.52 b 6.38 ± 0.01 b 0.05 ± 0.00 a Hibberdene Pre 0.060 ± 0.00 a 11.40 ± 0.63 a 100.50 ± 2.60 a 563.00 ± 3.46 a 156.00 ± 5.77 a 5.53 ± 0.13 a 0.06 ± 0.01 a Vicia sativa 0.045 ± 0.00 a 6.60 ± 0.64 b 73.00 ± 0.00 b 726.00 ± 6.06 b 204.00 ± 0.58 b 6.39 ± 0.06 b 0.05 ± 0.00 a Vicia villosa 0.050 ± 0.01 a 8.70 ± 1.10 ab 64.50 ± 3.75 b 694.50 ± 1.44 c 202.50 ± 3.75 b 6.39 ± 0.01 b 0.05 ± 0.00 a Gingindlovu Pre 0.055 ± 0.00 a 5.90 ± 0.46 a 55.00 ± 1.73 a 221.00 ± 0.58 a 128.50 ± 1.44 a 4.64 ± 0.04 a 0.30 ± 0.01 a Vicia sativa 0.030 ± 0.00 b 2.70 ± 0.06 b 60.50 ± 5.48 a 337.00 ± 31.70 b 158.00 ± 18.48 a 5.83 ± 0.01 b 0.05 ± 0.00 b Vicia villosa 0.035 ± 0.00 b 3.00 ± 0.06 b 51.00 ± 1.73 a 338.00 ± 6.93 b 152.50 ± 3.18 a 5.83 ± 0.01 b 0.05 ± 0.00 b 3.2 Bacterial identification and abundance A total of 16 bacterial strains were isolated pre-planting, compared to 31 isolated post- V. sativa harvest and 27 post- V. villosa harvesting (Fig. 1 , Table 2 ). Pre-planting, six bacterial strains were isolated from Mvutshini (1 N-fixing; 1 phosphate solubilising and N-cycling; 1 N-cycling; 3 N-fixing and phosphate solubilising). The number of bacterial strains increased to seven post- V. sativa harvest (1 N-cycling; 4 N-fixing and phosphate solubilising; 2 N-fixing, phosphate solubilising and N-cycling) and five post- V. villosa harvesting (3 N-fixing and phosphate solubilising, and 2 phosphate solubilising, N-fixing and N-cycling). In Mpembeni, five bacterial strains were isolated pre-planting (1 phosphate solubilising; 3 N-fixing and phosphate solubilising; 1 phosphate solubilising, N-fixing and N- cycling). The number of isolated strains increased to eight (2 N- fixing, phosphate solubilising and N-cycling, and 6 N- fixing and phosphate solubilising) post- V. sativa harvest and eight N-fixing and phosphate solubilising strains post- V. villosa harvest. Two N-fixing, phosphate solubilising and N-cycling bacterial strains were isolated from Mzinto pre-planting, which increased to six (2 phosphate solubilising, N- fixing and N- cycling; 1 phosphate solubilising and N cycling; 3 N- fixing & phosphate solubilising) post- V. sativa harvest and four (1 phosphate solubilising, N- fixing and N- cycling, and 3 N- fixing and phosphate solubilising) bacterial strains post- V. villosa harvest. Pre-planting, two bacterial strains (1 phosphate solubilising and 1 N- fixing and phosphate solubilising) were isolated from Hibberdene, which increased to five (2 phosphate solubilising and N- fixing; 1 N-cycling and phosphate solubilising; 1 N-cycling; 1 phosphate solubilising) bacterial strains post- V. sativa and harvesting and five phosphate solubilising, N-fixing and N-cycling bacterial strains isolated post- V. villosa harvest. One phosphate solubilising and N-cycling bacterial strain was isolated from Gingindlovu pre-planting compared to five (2 phosphate solubilising, N-fixing and N-cycling; 1 N-fixing; 2 N-fixing and phosphate solubilising) isolated post- V. sativa harvest and five (1 N-fixing, phosphate solubilising and N-cycling, and 4 N-fixing and phosphate solubilising) bacterial strains isolated post- V. villosa harvest. Table 2 Nutrient cycling bacteria (accession no. and percentage identity) isolated from Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu plantation soil, pre and post- Vicia villosa planting and harvest Pre-planting Vicia sativa Vicia villosa Site Species Functional traits Species Functional traits Species Functional traits Mvutshini Paraburkholderia phymatum (Acc: HE864336.1,%ID:100) N-fixing Arthrobacter sp. (MT826384.1, %ID:97.2) N-fixing, P-solubilising, N-cycling Lycinibacillus sphaericus (Acc: MH260970.1, %ID: 96.46) N-fixing, P-solubilising, N-cycling Paraburkholderia sabiae (Acc:MK139731.1, %ID:99.8) N-fixing, P-solubilising Pseudomonas sp. (Acc: MN305768.1, %ID: 972.6) N-fixing, P-solubilising Burkholderia sp. (Acc: LC661717.1, %ID: 99.11 ) N-fixing, P-solubilising Pseudomonas koreensis (Acc:ON428965.1, %ID:100) N-fixing, P-solubilising Arthrobacter sp. (AF409020.1, %ID94.2) N-fixing, P-solubilising, N-cycling Burkholderia sp. (Acc: KY022417.1, %ID: 98.17) N-fixing, P-solubilising Burkholderia sp. (Acc:MK612762.1, %ID: 100) N-fixing, P-solubilising Bacillus sp. (Acc: OP890999.1, %ID: 94.2) N-fixing, P-solubilising Pseudomonas sp. (Acc: CP117460.1, %ID: 98.59) N-fixing, P-solubilising Chromobacterium piscinae (Acc: LR634122.1, %ID: 99.9) P-solubilising, N-cycling Burkholderia sp. (Acc: AB911043.1, %ID: 99.3) N-fixing, P-solubilising Pseudomonas bengalensis (Acc: MT912698.2, %ID: 96.79) N-cycling, N-fixing, P-solubilising Pseudomonas nitroreducens (Acc: KY038284.1, %ID: 99.6) N-cycling Burkholderia sp. (Acc: AB299574.1, %ID: 99.2) N-fixing, P-solubilising Pseudomonas saccarophila (Acc: AF368755.1, %ID: 83.5) N-cycling Mpembeni Burkholderia cepacian (Acc: MN691121.1, %ID: 99.4) N-fixing, P-solubilising, N-cycling Pseudomonas sp. (Acc: CP117460.1, %ID: 98.5) N-fixing, P-solubilising Pseudomonas sp. (Acc: EU449118.2, %ID: 97.65) N-fixing, P-solubilising Burkholderia sp. (Acc: KT390908.1, %ID: 98.3) N-fixing, P-solubilising Pseudomonas sp. (Acc: HQ403189.1, %ID: 97.8) N-fixing, P-solubilising Pseudomonas moraviensis (Acc: LR027434.1, %ID: 98.26) N-fixing, P-solubilising Burkholderia sp. (Acc: MN594801.1, %ID: 99.7) N-fixing, P-solubilising Pseudomonas sp. (Acc: 117452.1, %ID: 97.8) N-fixing, P-solubilising Pseudomonas koreensis (Acc: KJ567119.2, %ID: 97.56) N-fixing, P-solubilising Pseudomonas protegens (Acc: MT505104.1, %ID: 100) N-fixing, P-solubilising Pseudomonas sp. (Acc: AF368755.1, %ID: 96.4) N-fixing, P-solubilising Bacillus sp. (Acc: KY618763.1, %ID: 98.11) N-fixing, P-solubilising Burkholderia cenocepacia (Acc: MT001454.1, %ID: 99.4) P-solubilising Caulobacter rhizosphaerae (Acc: CF048815.1, %ID: 97.86) N-cycling, N-fixing, P-solubilising Pseudomonas sp. (Acc: MN305768.1, %ID: 97.47) N-fixing, P-solubilising Pseudomonas koreensis (Acc: MT998061.1, %ID: 99) N-fixing, P-solubilising, N-cycling Pseudomonas sp. (Acc: OR131167.1, %ID: 97.81) N-fixing, P-solubilising Paraburkholderia sp. (Acc: MH118322.1, %ID: 98.7) N-fixing, P-solubilising Pseudomonas sp. (Acc: OP990591.1, %ID: 97.71) N-fixing, P-solubilising Pseudomonas koreensis (Acc:MH17853.1, %ID: 99.3) N-fixing, P-solubilising Pseudomonas koreensis (Acc: MH725617.1, %ID: 98.25) N-fixing, P-solubilising Mzinto Arthrobacter sp. (Acc: MN081011.1, %ID: 100) N-cycling, N-fixing, P-solubilising Arthrobacter sp. (Acc: MH669311.1, %ID: 98.95) N-cycling, N-fixing, P-solubilising Pseudomonas sp. (Acc: JN411662.1, %ID: 99.18) N-fixing, P-solubilising Pseudomonas sp. (Acc: MT354507.1, %ID: 99.9) N-cycling, N-fixing, P-solubilising Pseudomonas sp. (Acc: HQ403180.1, %ID: 97.42) N-fixing, P-solubilising Caulobacter sp. (Acc: MH899441.1, %ID: 97.47) N-fixing, P-solubilising, N-cycling Caulobacter rhizosphaerae (Acc: CP048815.1, %ID: 97.86) N-fixing, P-solubilising, N-cycling Pseudomonas umsongensis (Acc: KP409809.1, %ID: 98.28) N-fixing, P-solubilising Burkholderia sp. (Acc: AB982940.1, %ID: 98.37) N-fixing, P-solubilising Pseudomonas sp. (Acc: FJ605433.1, %ID: 97.78) N-fixing, P-solubilising Burkholderia sp. (Acc: MH337960.1, %ID: 99.69) N-fixing, P-solubilising Pseudomonas frederiksbergensis (Acc: KT369914.1, %ID: 97.38) N-cycling, P-solubilising Hibberdene Pseudomonas poae (Acc: OR122193.1, %ID: 99.9) P-solubilising Pseudomonas sp. (Acc: MK602511.1, %ID: 98.54) N-fixing, P-solubilising Pseudomonas sp. (Acc: MT354507.1, %ID: 97.99 ) N-fixing, P-solubilising Pseudomonas sp. (Acc: MT354507.1, %ID: 99.3) N-fixing, P-solubilising Pseudoarthrobacter chlorophenolicus (Acc: MT192880.1, %ID: 98.85) P-solubilising, N-cycling Pseudomonas sp. (Acc: MZ571910.1, %ID: 98.14) N-fixing, P-solubilising Cupriavidus yeoncheonensis (Acc: MK824648.1, %ID: 97.13) P-solubilising Pseudomonas vancouverensis (Acc: MT409572.1, %ID: 98.80) N-fixing, P-solubilising Pseudomonas sp. (Acc: LC474074.1, %ID: 99.57) N-fixing, P-solubilising Pseudomonas sp. (Acc: OR131117.1, %ID: 97.79) N-fixing, P-solubilising Caulobacter sp. (Acc: MN181102.1, %ID: 98.09) N-cycling Pseudomonas sp. (Acc: KU738933.1, %ID: 99.04) N-fixing, P-solubilising Gingindlovu Pseudomonas frederiksbergensis (Acc: MT378522.1, %ID: 99.8) P-solubilising, N-cycling Caulobacter sp. (Acc: MN181102.1, %ID: 98.09) N-fixing, P-solubilising, N-cycling Lycinibacillus sp. (Acc: MN335310.1, %ID: 98.12) N-fixing, N-cycling, P-solubilising Pseudomonas sp. (Acc: CP117460.1, %ID: 98.71) N-fixing, P-solubilising Pseudomonas sp. (Acc: MN559094.1, %ID: 96.95) N-fixing, P-solubilising Pseudomonas sp. (Acc: CP117460.1, %ID: 98.71) N-fixing, P-solubilising Burkholderia sp. (Acc: AB911072.1, %ID: 98.18) N-fixing, P-solubilising Rhodobacter sp. (Acc: MH136844.1, %ID: 97.69) N-fixing, P-solubilising, N-cycling Paraburkholderia sp. (Acc: OR191068.1, %ID: 98.58) N-fixing, P-solubilising Xanthobacter sp. (Acc: KF560403.1, %ID: 99.13) N-fixing Cupriavidus sp. (Acc: HQ443228.1, %ID: 98.14) N-fixing, P-solubilising 3.3 Enzyme activities The soil enzyme activities varied across all sites and treatments (Fig. 2 ). Nitrate reductase activities increased significantly in Mvutshini post- V. sativa harvest, increased in Mzinto post- V. sativa and V. villosa harvest and decreased significantly in Hibberdene and Gingindlovu post- V. villosa harvests (Fig. 2 A). Acid phosphatase activities increased significantly in Gingindlovu and Hibberdene post- V. villosa harvest, and also increased in Mvutshini soils post- V. sativa and V. villosa harvest (Fig. 2 B). The glucosidase activities increased significantly across all sites and treatments (Fig. 2 C). 3.4 Plant Biomass and Mineral Nutrition Vicia sativa accumulated significantly higher root biomass in Mzinto and Gingindlovu, while shoot and total biomass were significantly higher in Mzinto plantation soils (Table 3 ). Gingindlovu-grown V. villosa plants accumulated more biomass, with Gingindlovu showing a significantly higher root: shoot ratio (Table 3 ). Table 3 The relative growth rate (g/day) of Vicia sativa and Vicia villosa plants grown in Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu plantation soils for 45 days. The different values are presented as mean ± SE. The different letters represent significant differences between the sites after a One-Way ANOVA RGR (g/day) Root RGR (g/day) Shoot RGR (g/day) Root: Shoot RGR Vicia sativa Mvutshini 0.009 ± 0.00 a 0.006 ± 0.01 a 0.010 ± 0.00 a 0.608 ± 0.06 a Mpembeni 0.016 ± 0.00 a 0.013 ± 0.01 ac 0.018 ± 0.00 a 0.635 ± 0.10 a Mzinto 0.036 ± 0.00 b 0.041 ± 0.00 b 0.033 ± 0.00 b 0.861 ± 0.03 a Hibberdene 0.012 ± 0.00 a 0.014 ± 0.00 ac 0.011 ± 0.00 a 0.671 ± 0.06 a Gingindlovu 0.029 ± 0.00 b 0.023 ± 0.00 c 0.033 ± 0.00 b 0.671 ± 0.06 a Vicia villosa Mvutshini 0.021 ± 0.001 ab 0.022 ± 0.000 a 0.020 ± 0.001 a 0.667 ± 0.052 a Mpembeni 0.027 ± 0.002 ab 0.022 ± 0.006 a 0.029 ± 0.001 a 0.667 ± 0.052 a Mzinto 0.014 ± 0.003 a 0.021 ± 0.002 a 0.007 ± 0.004 b 1.156 ± 0.14 a Hibberdene - - - - Gingindlovu 0.028 ± 0.004 b 0.038 ± 0.005 a 0.019 ± 0.002 ab 1.459 ± 0.198 b Vicia villosa grown in Hibberdene died before the final harvest date was reached. Vicia sativa cultivated in Mzinto, Hibberdene, and Gingindlovu had the highest specific N absorption rates compared to Mvutshini and Mpembeni (Fig. 3 A). Mzinto showed the highest N utilisation rate, followed by Gingindlovu, while Hibberdene showed a decrease in N utilisation (Fig. 3 B). Mpembeni and Gingindlovu showed increased P absorption rates, while Hibberdene showed a decrease in P absorption rates (Fig. 3 C). Hibberdene showed the highest P utilisation rate (Fig. 3 D). Vicia villosa grown in Mpembeni had the highest specific N assimilation rate, while Mzinto and Gingindlovu had the lowest (Fig. 4 A). Gingindlovu had the highest specific N utilisation rate, while Mzinto had the lowest (Fig. 4 B). The specific P assimilation rate was highest in Gingindlovu, while the other sites didn’t show significant differences (Fig. 4 C). Lastly, the specific P utilisation rate was highest in Mpembeni and lowest in Mzinto (Fig. 4 D). Mzinto had the highest %N derived from the atmosphere (55%), while Mpembeni had the lowest (20%) (Fig. 5 A). Total plant N content was highest in Mzinto and lowest in Hibberdene (Fig. 5 B). Plants from all the sites derived most of their N from the soil, except for Mzinto, which derived most of its N from the atmosphere (Fig. 5 C). Total plant P content was the lowest in Hibberdene (Fig. 5 D). Mzinto had the highest %NDFA (41%), while Gingindlovu had the lowest (5%) (Fig. 6 A). Mpembeni-grown V. villosa had the highest plant N, followed by Gingindlovu (Fig. 6 B). All the plants from the different plantation sites derived most of their N from the soil (Fig. 6 C). Vicia villosa cultivated in Gingindlovu had the highest total P content, while Mzinto had the lowest (Fig. 6 D). 4 Discussion The study investigated the effects of planting V. sativa and V. villo sa as cover crops in nutrient-deficient KZN small-scale sugarcane plantation soils. Post-harvest soil analysis showed that both species increased the presence of PGPR, with N-fixing, N-cycling, and P-solubilising functions in the genus Arthrobacter , Bacillus , Burkholderia , Caulobacter and Pseudomonas . The presence of these bacterial species post-harvest can be attributed to the release of different compounds, such as organic acids by the legumes, increasing bacterial activity during nutrient deficiency [ 27 ]. The composition and function of rhizospheric bacteria can be influenced by the composition and quantity of root exudates released by the plants [ 27 ]. During nutrient deficiency, plant roots can modulate the chemical composition of their exudates according to the plants’ requirements [ 27 ]. This influences the composition of the rhizospheric microbial community and forms the basis for the attraction and repulsion of certain bacterial species [ 38 – 40 ]. The experimental soils in this study were N and P deficient; this may have resulted in an increase in N-fixing and P-solubilising activities and efficiency to compensate for the soil deficient nutrients for plant use. This suggests an increase in the root exudates signals of V. sativa and V. villosa roots for N and P-cycling bacteria under nutrient-deficient conditions [ 27 ]. Similar results were obtained by [ 41 ] who reported increases in bacterial diversity under soybean soils compared to sugarcane monoculture. [ 42 ] reported that cover crop treatments increased the relative abundance of Streptomyces , Arthrobacter and Bacillus sp. compared to no cover crop treatments. Therefore, it would be expected that in a sugarcane- V. sativa or V. villosa rotation system, nutrient cycling microbes and associated enzymes would increase activities, increasing nutrient fixing and cycling of deficient soil nutrients in sugarcane plantation soils. Bacteria from these genera have been reported to mineralise phosphates by secreting acid phosphatases and phytases [ 43 ]. In this study, Mvutshini and Mzinto recorded increased acid phosphatase activities post-harvest, which could be attributed to the co-occurrence of Burkholderia and Pseudomonas in Mzinto and Pseudomonas, Bacillus and Burkholderia in Mvutshini. Mixed cultures of P-solubilising bacteria are more effective in mineralising organic phosphates [ 44 ]. [ 45 ] found that the co-inoculation of Burkholderia anthina and Enterobacter aerogenes released the highest soluble P content as compared to single inoculations. The presence of these P-solubilising bacteria makes available the cation bound P, increasing P availability for plant assimilation, and this is shown by the increased P assimilation rates in this study across all sites [ 46 , 47 ]. Post-harvest, soil acidity was slightly decreased to less acidic, and similar results were reported by [ 42 ] and [ 48 ], who reported increases in pH levels (4 to 6) under cover crop systems. [ 47 ] reported contradicting results as legume cover crops (white clover and orchard grass) in their study decreased pH levels, which was attributed to the secretion of organic acids and protons by the legume roots. Soil acidity is a key constraint associated with poor root health and nutrient availability [ 49 ]. Under acidic conditions, nutrients such as P form insoluble complexes with cations, rendering them unavailable for plant uptake [ 50 ]. Since P is an important macronutrient required for metabolic processes in plants and is a significant constituent of ATP, its deficiency can decrease the photosynthetic rates [ 51 ] and N fixation in legumes [ 52 ]. The decreased biomass and %NDFA across all plantation soil treatments in this study can be linked to V. sativa and V. villosa using the available P sparingly to maintain growth function. This is shown by the low P utilisation rates across all soil treatments. Legumes switch their N sources during nutritional stress, favouring soil N to reserve energy [ 53 ]. Biological N fixation (BNF) is a high-energy process and requires 16 ATP molecules to fix one molecule of atmospheric N 2 to NH 3 [ 54 ]. Vicia sativa and V. villosa growing in Mvutshini, Mpembeni, and Gingindlovu plantation soils showed a reduced %NDFA and increased their reliance on soil N. This shows that the plants were able to use the deficient soil P sparingly, reducing the ATP-demanding BNF to maintain their growth and function. These findings are similar to findings reported by [ 55 ], [ 56 ], and [ 57 ] who reported decreased N 2 fixation rates under low P, which were reversed when P inputs were increased. Interestingly, Hibberdene-grown V. villosa died before harvest, while V. sativa persisted. This could be attributed to the documented persistence of V. sativa in diverse environments where other legumes would be poorly suited [ 58 ]. Mzinto-grown plants showed increased %NDFA values, and the soil had high P concentrations and decreased acidity. Even though the plants in this study did not nodulate, the plants were able to reduce atmospheric N, suggesting a symbiosis with non-nodulating endophytic N 2 fixing rhizobacteria [ 53 ]. Similar results were recorded by [ 53 ], who reported high %NDFA in non-nodulated Leucaena leucocephala plants growing in grassland ecosystem soils. The high V. sativa N concentrations, despite low soil N concentrations in Mzinto plantation soils, can indicate the high efficiency of the free-living N-fixing bacteria and P-solubilising bacteria isolated from the rhizosphere of these plantation soils. This is further supported by the increased nitrate reductase and acid phosphatase activities in Mzinto plantation soils post- V. sativa harvest. Soil N and P concentrations decreased post-harvest, possibly due to the uptake and use of nutrients by the legumes during growth [ 59 ]. These results are consistent with those reported by [ 60 ] and [ 59 ], who reported decreases in soil nutrient contents under cover crop treatments. However, the scavenged nutrients can be made available for the subsequent crop through the decomposition and mineralisation of V. sativa and V. villosa when it is incorporated into the soil as legume biomass [ 61 ]. In a study by [ 18 ], vetch ecotypes contributed up to 211 kg N ha − 1 from aboveground biomass. This serves as a sustainable form of N and P feedback as the nutrients released from the slow decomposition of the legume biomass reduce contaminant leaching from the application of chemical fertilisers [ 23 ], and provide a steady amount of N throughout the growing season [ 62 ]. Furthermore, the organic matter present from the rotation and buried legume biomass may be resistant to biological degradation, fostering a longer and deeper carbon stock in the soil. This extended carbon stock is beneficial to the subsequent plant [ 29 ]. Soil rehabilitation processes occur over an extended period. Therefore, field trials over a prolonged experimental duration might elicit different responses as plant-microbe interactions are sensitive to environmental conditions, which might affect their associated enzyme activities and nutritional contributions. Future studies should identify and quantify the root exudates released by V. sativa and V. villosa to better understand the interactions between plant roots and soil ecosystems. Additionally, future studies should use next-generation sequencing to identify all the microbial populations present, which will better estimate the microbial diversity and the effects that the legume species had on the soil microbiota. 5 Conclusion In this study, V. sativa and V. villosa increased the bacterial composition, acid phosphatase, and glucosidase activities and reduced the exchange acidity in the sugarcane plantation soils, and these are an indicator of improved soil health. Even so, allowing their biomass to decompose and release stored nutrients into the soil would contribute to nutrient cycling. Therefore, integrating V. sativa and V. villosa as cover crops is a promising strategy to enhance soil biological health and promote sustainable agricultural practices in sugarcane plantations. Declarations Acknowledgments: We acknowledge the support of the University of KwaZulu-Natal, School of Life Sciences, Durban, South Africa. Funding: The research leading to the results received funding from the National Research Foundation under Grant agreement number (Grant UID 138091) Declarations Conflicts of Interest: We declare no known competing financial and non-financial interests with regard to the current research. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. Data Availability: The datasets generated and/or analysed during the current study will be stored and available in ResearchGate corresponding author (Anathi Magadlela) account and tagged to the manuscript: Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils. Also, all raw data can be requested from the corresponding author, Prof. Anathi Magadlela at [email protected] . Author contributions: Conceptualisation, A. M; methodology, A. M and E. N; validation, A. M and E. N; formal analysis, E. N; writing-original draft preparation, E. N; writing-review and editing, A. M; supervision, A. M; project administration, A. M and E. N; funding acquisition, A. M. All authors reviewed the manuscript before submission for publication. References Benke K, Tomkins B. Future food-production systems: vertical farming and controlled-environment agriculture. Sustainability: Science, Practice and Policy. 2017;13(1):13-26. FAO. Database on Arable land 2016 [Available from: http://data.worldbank.org/indicator/AG.LND.ARBL.HA.PC?end¼2013&start¼1961&view¼chart. Gerland P, Raftery AE, Ševčíková H, Li N, Gu D, Spoorenberg T, et al. World population stabilization unlikely this century. Science. 2014;346(6206):234-7. Chun I-A, Ryu S-Y, Park J, Ro H-K, Han M-A. Associations between food insecurity and healthy behaviors among Korean adults. Nutrition research and practice. 2015;9(4):425. Hendriks S. South Africa's National Development Plan and New Growth Path: reflections on policy contradictions and implications for food security. Agrekon. 2013;52(3):1-17. Bayat A, Louw W, Rena R. The impact of socio-economic factors on the performance of selected high school learners in the Western Cape Province, South Africa. Journal of Human Ecology. 2014;45(3):183-96. STATSSA. Focus on food inadequacy and hunger in South Africa in 2021 2021 [Available from: https://www.statssa.gov.za/?p=16235#:~:text=Results%20indicate%20that%20out%20of,inadequate%20access%20to%20food%2C%20respectively. Siphesihle Q, Lelethu M. Factors affecting subsistence farming in rural areas of Nyandeni local municipality in the Eastern Cape Province. South African Journal of Agricultural Extension. 2020;48(2):92-105. Zantsi S, Bester B. Revisiting the benefits of animal traction to subsistence smallholder farmers: A case study of Ndabakazi villages in Butterworth, Eastern Cape Province of South Africa. South African Journal of Agricultural Extension. 2019;47(3):1-13. Mthembu BE, Everson TM, Everson CS. Intercropping for enhancement and provisioning of ecosystem services in smallholder, rural farming systems in KwaZulu-Natal Province, South Africa: a review. Journal of Crop Improvement. 2019;33(2):145-76. Hlatshwayo SI, Ngidi MSC, Ojo TO, Modi AT, Mabhaudhi T, Slotow R. The determinants of crop productivity and its effect on food and nutrition security in rural communities of South Africa. Frontiers in sustainable food systems. 2023;7:1091333. Zulu NS, Sibanda M, Tlali BS. Factors affecting sugarcane production by small-scale growers in Ndwedwe Local Unicipality, South Africa. Agriculture. 2019;9(8):170. Belete T, Yadete E. Effect of Mono Cropping on Soil Health and Fertility Management for Sustainable Agriculture Practices: A Review. Journal of Plant Sciences. 2023;11(6):192-7. Graham M, Haynes R, Meyer J. Changes in soil chemistry and aggregate stability induced by fertilizer applications, burning and trash retention on a long‐term sugarcane experiment in South Africa. European Journal of Soil Science. 2002;53(4):589-98. Adesemoye AO, Kloepper JW. Plant–microbes interactions in enhanced fertilizer-use efficiency. Applied microbiology and biotechnology. 2009;85(1):1-12. Rosenstock TS, Tully KL, Arias-Navarro C, Neufeldt H, Butterbach-Bahl K, Verchot LV. Agroforestry with N2-fixing trees: sustainable development's friend or foe? Current Opinion in Environmental Sustainability. 2014;6:15-21. Abd-Alla MH, Issa AA, Ohyama T. Impact of harsh environmental conditions on nodule formation and dinitrogen fixation of legumes. Advances in biology and ecology of nitrogen fixation. 2014;9:1. Perrone S, Grossman J, Liebman A, Sooksa-Nguan T, Gutknecht J. Nitrogen fixation and productivity of winter annual legume cover crops in Upper Midwest organic cropping systems. Nutrient cycling in agroecosystems. 2020;117:61-76. Sun WH, Wu FF, Cong L, Jin MY, Wang XG. Assessment of genetic diversity and population structure of the genus Vicia ( Vicia L.) using simple sequence repeat markers. Grassland Science. 2022;68(3):205-13. Carreón-Abud Y, Sanchez-Yañez J. Rhizosphere effect of Vicia sativa L. on soil microbial population from Tiripetio town, Michoacan, México. Biologicas. 1998;4. Ibañez S, Medina MI, Agostini E. Vicia : A green bridge to clean up polluted environments. Applied microbiology and biotechnology. 2020;104(1):13-21. Mao L, Zhu R, Yi K, Wang X, Sun J. Transcriptome Analysis of Vicia villosa in Response to Low Phosphorus Stress at Seedling Stage. Agronomy. 2023;13(7):1665. Salmerón M, Isla R, Cavero J. Effect of winter cover crop species and planting methods on maize yield and N availability under irrigated Mediterranean conditions. Field Crops Research. 2011;123(2):89-99. Stevenson FJ, Cole MA. Cycles of soils: carbon, nitrogen, phosphorus, sulfur, micronutrients: John Wiley & Sons; 1999. Pankhurst C, Magarey R, Stirling G, Blair B, Bell M, Garside A, et al. Management practices to improve soil health and reduce the effects of detrimental soil biota associated with yield decline of sugarcane in Queensland, Australia. Soil and Tillage Research. 2003;72(2):125-37. Marais A, Hardy M, Booyse M, Botha A. Effects of monoculture, crop rotation, and soil moisture content on selected soil physicochemical and microbial parameters in wheat fields. Applied and Environmental Soil Science. 2012;2012. Yetgin A. The dynamic interplay of root exudates and rhizosphere microbiome. Soil Studies. 2023;12(2):111-20. Jani AD, Grossman J, Smyth TJ, Hu S. Winter legume cover-crop root decomposition and N release dynamics under disking and roller-crimping termination approaches. Renewable Agriculture and Food Systems. 2016;31(3):214-29. Gregorich E, Drury C, Baldock J. Changes in soil carbon under long-term maize in monoculture and legume-based rotation. Canadian journal of soil science. 2001;81(1):21-31. Ranells NN, Wagger MG. Nitrogen release from grass and legume cover crop monocultures and bicultures. Agronomy Journal. 1996;88(5):777-882. Yang C, Sun R, Lu X, Jin T, Peng X, Zhang N, et al. Seed-germination ecology of Vicia villosa Roth, a cover crop in orchards. Agronomy. 2022;12(10):2488. Jackson CR, Tyler HL, Millar JJ. Determination of microbial extracellular enzyme activity in waters, soils, and sediments using high throughput microplate assays. JoVE (Journal of Visualized Experiments). 2013(80):e50399. Bruckner A, Wright J, Kampichler C, Bauer R, Kandeler E. A method of preparing mesocosms for assessing complex biotic processes in soils. Biology and fertility of soils. 1995;19:257-62. Farquhar GD, Ehleringer JR, Hubick KT. Carbon isotope discrimination and photosynthesis. Annual review of plant biology. 1989;40(1):503-37. Shearer G, Kohl DH. N2-fixation in field settings: estimations based on natural 15N abundance. Functional Plant Biology. 1986;13(6):699-756. Nielsen KL, Eshel A, Lynch JP. The effect of phosphorus availability on the carbon economy of contrasting common bean ( Phaseolus vulgaris L.) genotypes. Journal of experimental botany. 2001;52(355):329-39. ÅGREN GI, Franklin O. Root: shoot ratios, optimization and nitrogen productivity. Annals of botany. 2003;92(6):795-800. Chaparro JM, Sheflin AM, Manter DK, Vivanco JM. Manipulating the soil microbiome to increase soil health and plant fertility. Biology and Fertility of Soils. 2012;48:489-99. Kumar R, Bhatia R, Kukreja K, Behl RK, Dudeja SS, Narula N. Establishment of Azotobacter on plant roots: chemotactic response, development and analysis of root exudates of cotton ( Gossypium hirsutum L.) and wheat ( Triticum aestivum L.). Journal of basic microbiology. 2007;47(5):436-9. Zhalnina K, Louie KB, Hao Z, Mansoori N, Da Rocha UN, Shi S, et al. Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly. Nature microbiology. 2018;3(4):470-80. Mula-Michel H, White P, Hale A. Immediate impacts of soybean cover crop on bacterial community composition and diversity in soil under long-term Saccharum monoculture. PeerJ. 2023;11:e15754. Gao H, Tian G, Khashi u Rahman M, Wu F. Cover crop species composition alters the soil bacterial community in a continuous pepper cropping system. Frontiers in Microbiology. 2022;12:789034. Jorquera MA, Hernández MT, Rengel Z, Marschner P, de la Luz Mora M. Isolation of culturable phosphobacteria with both phytate-mineralization and phosphate-solubilization activity from the rhizosphere of plants grown in a volcanic soil. Biology and Fertility of Soils. 2008;44:1025-34. Molla M, Chowdhury A, Islam A, Hoque S. Microbial mineralization of organic phosphate in soil. Plant and soil. 1984;78:393-9. Park J-H, Lee H-H, Han C-H, Yoo J-A, Yoon M-H. Synergistic effect of co-inoculation with phosphate-solubilizing bacteria. Korean Journal of Agricultural Science. 2016;43(3):401-14. Katsalirou E, Deng S, Gerakis A, Nofziger DL. Long-term management effects on soil P, microbial biomass P, and phosphatase activities in prairie soils. European journal of soil biology. 2016;76:61-9. Wang Y, Huang Q, Gao H, Zhang R, Yang L, Guo Y, et al. Long-term cover crops improved soil phosphorus availability in a rain-fed apple orchard. Chemosphere. 2021;275:130093. Balota EL, Chaves JCD. Microbial activity in soil cultivated with different summer legumes in coffee crop. Brazilian Archives of Biology and Technology. 2011;54:35-44. van Antwerpen R, Titshall L, McFarlane S, Keeping M, editors. Soil regenerative agriculture in the South African sugarcane industry. Proceedings of the International Society of Sugar Cane Technologists; 2023. Vance CP, Graham PH, Allan DL. Biological nitrogen fixation: phosphorus-a critical future need? Nitrogen fixation: From molecules to crop productivity. 2000:509-14. Xu H, Weng X, Yang Y. Effect of phosphorus deficiency on the photosynthetic characteristics of rice plants. Russian Journal of Plant Physiology. 2007;54:741-8. HØGH‐JENSEN H, Schjoerring JK, SOUSSANA JF. The influence of phosphorus deficiency on growth and nitrogen fixation of white clover plants. Annals of Botany. 2002;90(6):745-53. Sithole N, Tsvuura Z, Kirkman K, Magadlela A. Nitrogen source preference and growth carbon costs of Leucaena leucocephala (Lam.) de Wit saplings in South African grassland soils. Plants. 2021;10(11):2242. Vance CP, Uhde‐Stone C, Allan DL. Phosphorus acquisition and use: critical adaptations by plants for securing a nonrenewable resource. New phytologist. 2003;157(3):423-47. Alkama N, Ounane G, Drevon JJ. Is genotypic variation of H+ efflux under P deficiency linked with nodulated-root respiration of N2–Fixing common-bean ( Phaseolus vulgaris L.)? Journal of plant physiology. 2012;169(11):1084-9. Benner JW, Vitousek PM. Cyanolichens: a link between the phosphorus and nitrogen cycles in a Hawaiian montane forest. Journal of Tropical Ecology. 2012;28(1):73-81. Míguez-Montero M, Valentine A, Pérez-Fernández M. Regulatory effect of phosphorus and nitrogen on nodulation and plant performance of leguminous shrubs. AoB Plants. 2020;12(1):plz047. Huang Y, Gao X, Nan Z, Zhang Z. Potential value of the common vetch (Vicia sativa L.) as an animal feedstuff: a review. Journal of animal physiology and animal nutrition. 2017;101(5):807-23. Weerasekara CS, Udawatta RP, Gantzer CJ, Kremer RJ, Jose S, Veum KS. Effects of cover crops on soil quality: selected chemical and biological parameters. Communications in Soil Science and Plant Analysis. 2017;48(17):2074-82. Zhou X, Liu X, Rui Y, Chen C, Wu H, Xu Z. Symbiotic nitrogen fixation and soil N availability under legume crops in an arid environment. Journal of Soils and Sediments. 2011;11:762-70. Shennan C. Cover crops, nitrogen cycling, and soil properties in semi-irrigated vegetable production systems. HortScience. 1992;27(7):749-54. Dinnes DL, Karlen DL, Jaynes DB, Kaspar TC, Hatfield JL, Colvin TS, et al. Nitrogen management strategies to reduce nitrate leaching in tile‐drained Midwestern soils. Agronomy journal. 2002;94(1):153-71. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4621168","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329834577,"identity":"8b86a22d-9b51-4c5d-8324-92c206cd3d3b","order_by":0,"name":"Emihle Ngonini","email":"","orcid":"","institution":"University of KwaZulu-Natal (Westville Campus)","correspondingAuthor":false,"prefix":"","firstName":"Emihle","middleName":"","lastName":"Ngonini","suffix":""},{"id":329834578,"identity":"2d7fc9a4-871a-462a-b9bd-93b0998e712c","order_by":1,"name":"Anathi Magadlela","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABE0lEQVRIiWNgGAWjYJACZgYDMG14gKGAQY6NgbmBgYENrw7GZqgWgwNAhjEbAyMxWhgQWhIbCGnhn938/HFBwTZ5effDGw58MLBL72M/2PiYp4xBnl/sAFYtEneOGTbPMLhtuPFMWsHBGQbJuW08ic3GPOcYDGfOTsBuzY0Ew2Yeg9uMGxtyDA7zGDDntkkwtknztjEkGNzGrkX+RvpHkBb7jf1vDA7/MahPZyOkxeBGDtiWxPkSQFsYDA4nENRieCOncDZQS/IGiWcFB3sMjhuC/GI455wETr/I3Ujf8Jnnz23b+f3JGx/8qKiWl28/fPDBmzIbeX5pHN6Hu/AAKl8Cv3IQkG8grGYUjIJRMApGKAAA0rFhngj9AY4AAAAASUVORK5CYII=","orcid":"","institution":"Sol Plaatjie University","correspondingAuthor":true,"prefix":"","firstName":"Anathi","middleName":"","lastName":"Magadlela","suffix":""}],"badges":[],"createdAt":"2024-06-22 09:21:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4621168/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4621168/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60815992,"identity":"5984f560-2f48-4cc4-9fca-fc682b6ab651","added_by":"auto","created_at":"2024-07-22 11:56:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":27586,"visible":true,"origin":"","legend":"\u003cp\u003eThe abundance of bacteria isolated from A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene, and E. Gingindlovu pre-planting and post-harvesting \u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/74ad8c2438118c0a531ec7e2.png"},{"id":60817152,"identity":"a1b325aa-ddc0-4635-9c7a-88c437efabdb","added_by":"auto","created_at":"2024-07-22 12:12:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":100461,"visible":true,"origin":"","legend":"\u003cp\u003eThe enzyme activities of soil collected from A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene and E. Gingindlovu pre-planting and post-\u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e harvest. The different values are presented as mean± SE. Different letters show significant differences between treatments after One-Way ANOVA\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/2b76c5fc3d3dacc95b269b2c.png"},{"id":60815991,"identity":"940eb72c-1c3e-40cd-adee-dae928cafa67","added_by":"auto","created_at":"2024-07-22 11:56:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":43478,"visible":true,"origin":"","legend":"\u003cp\u003eThe \u003cstrong\u003eA\u003c/strong\u003e. Specific N Absorption Rate, \u003cstrong\u003eB\u003c/strong\u003e. Specific N Utilization Rate, \u003cstrong\u003eC\u003c/strong\u003e. Specific P Absorption Rate and \u003cstrong\u003eD\u003c/strong\u003e. Specific P Utilisation Rate of \u003cem\u003eVicia sativa\u003c/em\u003e plants grown in A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene and E. Gingindlovu plantation soil for 45 days. The different values are presented as mean ± SE. The different letters show significant differences between the treatments after One-Way ANOVA.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/5535cbfff48403707a60c4a7.png"},{"id":60816683,"identity":"53aac15f-ba9b-4407-b761-91b86396f514","added_by":"auto","created_at":"2024-07-22 12:04:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":42354,"visible":true,"origin":"","legend":"\u003cp\u003eThe \u003cstrong\u003eA\u003c/strong\u003e. Specific N Utilisation Rate, \u003cstrong\u003eB\u003c/strong\u003e. Specific N Assimilation Rate, \u003cstrong\u003eC\u003c/strong\u003e. Specific P Assimilation Rate and \u003cstrong\u003eD\u003c/strong\u003e. Specific P Utilisation Rate of \u003cem\u003eVicia villosa\u003c/em\u003e plants grown in A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene and E. Gingindlovu plantation soil for 45 days. The different values are presented as mean ± SE. The different letters show significant differences between the treatmentsafter One-Way ANOVA\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/696b73f2a62aeae66bcccddd.png"},{"id":60815993,"identity":"a9c13474-e716-43b7-b746-f7f6162619d4","added_by":"auto","created_at":"2024-07-22 11:56:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":40509,"visible":true,"origin":"","legend":"\u003cp\u003eThe \u003cstrong\u003eA\u003c/strong\u003e. % N derived from the atmosphere, \u003cstrong\u003eB\u003c/strong\u003e. Total Plant N concentrations \u003cstrong\u003eC\u003c/strong\u003e. Total N concentrations derived from the atmosphere vs N derived from the soil and \u003cstrong\u003eD.\u003c/strong\u003e Total Plant P concentrations in \u003cem\u003eVicia sativa\u003c/em\u003e plants grown in A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene and E. Gingindlovu plantation soil for 45 days. The values are presented as mean ± SE. The different letters show significant differences after One-Way ANOVA\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/f0d52580cc5d94166b31f4de.png"},{"id":60815994,"identity":"4e4d3ae2-fff0-4c89-bec8-554bc34cc428","added_by":"auto","created_at":"2024-07-22 11:56:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":38364,"visible":true,"origin":"","legend":"\u003cp\u003eThe \u003cstrong\u003eA\u003c/strong\u003e. %N derived from the atmosphere, \u003cstrong\u003eB\u003c/strong\u003e. Total Plant N concentrations\u003cstrong\u003e C\u003c/strong\u003e. N concentrations derived from the atmosphere vs soil and\u003cstrong\u003e D\u003c/strong\u003e. Total Plant P concentrations of \u003cem\u003eVicia villosa\u003c/em\u003e plants grown in A. Mvutshini, B. Mpembeni, C. Mzinto, D. Hibberdene and E. Gingindlovu plantation soil for 45 days. The different values are presented as mean ± SE. The different letters show significant differences between the treatments after One-Way ANOVA\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/c589bedf5271a59312d36649.png"},{"id":63088054,"identity":"6db8318b-86fb-413d-b074-767296383309","added_by":"auto","created_at":"2024-08-23 03:37:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1450237,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4621168/v1/8efa1045-b3e1-4c1b-a67f-be37e7d3a2c3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eArable land availability is one of the main factors affecting crop productivity worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. According to [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], arable land per person in 2050 is expected to decrease by 33% from what it was in 1970. Reduced arable land coupled with the ever-increasing world population raises concerns about food security [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In recent years, food insecurity levels have increased steadily in southern Africa and remain a significant developmental problem in the sub-region [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] reported increases in food insecurity rates in most South African households, with food insecurity and poverty being some of the dominant socioeconomic issues in the country [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In 2021, 3.7\u0026nbsp;million out of 17.9\u0026nbsp;million households were reported to be food insecure [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], with food insecurity affecting most small-scale farming homesteads [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Food insecurity is exacerbated by the declining soil fertility and low crop yield experienced by many SSGs in the country [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Approximately 70% of South African SSGs residing in rural areas rely on subsistence farming as their source of livelihood [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSugarcane is the main cash crop cultivated by SSGs in KwaZulu-Natal [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The sugar industry, primarily rural-based, plays a crucial role in supporting these SSGs by generating income and aiding in poverty alleviation and food security [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, SSGs have been experiencing a decline in productivity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which could result from the intensive farming practices employed for cane production [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Small-scale growers practice monoculture because of land limitations. However, it has been reported to lead to land degradation and declining soil health and fertility [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. This is due to the loss of the soil's organic matter, breakdown of the soil structure, soil acidification and nutrient leaching [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Furthermore, high-yield intensive farming systems require extensive amounts of chemical fertilisers, which are detrimental to the environment and are too costly for poor, resource-limited SSGs [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Increased fertiliser inputs do not guarantee fertility and productivity, as a significant portion of the fertiliser is lost through leaching and runoff [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, soil fertility management practices that sustainably improve soil health and increase production by SSGs are required to mitigate food insecurity and poverty.\u003c/p\u003e \u003cp\u003e \u003cem\u003eVicia\u003c/em\u003e species have been reported to be a green manure alternatives in sustainable agricultural systems [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. \u003cem\u003eVicia\u003c/em\u003e species can effectively enhance soil fertility when used as cover crops by fixing atmospheric N and returning it to the soil through N spillover [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The success of \u003cem\u003eVicia\u003c/em\u003e species can be attributed to their association with diverse microorganisms that benefit the plants\u0026rsquo; development [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] suggested that \u003cem\u003eVicia\u003c/em\u003e species foster a substantial community of rhizobial bacteria, promoting the ecosystem function of the bacteria as plant growth promoters. \u003cem\u003eVicia villosa\u003c/em\u003e has been reported to improve acid phosphatase activities and promote soil physical and chemical properties, thereby increasing crop yields and quality [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIncorporating \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e as green manure between sugarcane plant cycles can help alleviate the long-term effects of sugarcane monoculture by reducing the need for N fertiliser for subsequent crops, offering a cheaper alternative to synthetic fertilisers [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, adding \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e in between the crop cycles increases crop diversity [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], reducing the population of detrimental soil microbes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and diversifying the root exudates released by the plant roots into the soil [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The function of plant growth-promoting rhizobacteria (PGPR) can be limited by several environmental conditions, including decreases in soil pH and reduced nutrient availability. However, root exudates can increase their plant growth-promoting activities by influencing the physiochemical properties of the soil [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] which influences the soil enzyme activities [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The decomposition of roots from the cover crop residue can release the stored N into the soil [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], introducing organic matter, increasing resistance to biological degradation, facilitating a longer and deeper carbon for the next crop [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough the utilisation of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e as green manure and cover crop is a growing practice in many agroecosystems [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], its biological and chemical contribution to sugarcane farming systems in South Africa is unknown. Therefore, this study aims to investigate the chemical and biological contributions of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e to small-scale KwaZulu-Natal sugarcane soils. Additionally, the study seeks to examine how the soil conditions influence the growth physiology and nutrient assimilation rates of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e cover crops. The objectives of the study are to isolate and identify nutrient-cycling bacteria, their associated enzymes and soil chemical characteristics in sugarcane soils collected from five different sugarcane plantation sites pre-planting and post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003evillosa\u003c/em\u003e harvest. Understanding the growth physiology of \u003cem\u003eV. sativa a\u003c/em\u003end \u003cem\u003eV. villosa\u003c/em\u003e in the different plantation soils will help quantify the N and P accumulated by the legume, which will facilitate the biomass residue management of the crop.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Soil Collection Sites\u003c/h2\u003e \u003cp\u003eSoil samples were collected from five small-scale sugarcane plantations at different geographical locations in the north and south coast of KwaZulu-Natal (KZN). The northern KZN plantation sites included Mvutshini (28\u0026deg; 50\u0026rsquo; 52.9\u0026rdquo; S 32\u0026deg;00\u0026rsquo;09.0\u0026rdquo; E), Mpembeni (28\u0026deg;51\u0026rsquo; 25.7\u0026rdquo; S 31\u0026deg;58\u0026rsquo;19.4\u0026rdquo; E), and Gingindlovu (28\u0026deg;56\u0026rsquo;29.3\u0026rdquo;S 31\u0026deg;34\u0026rsquo;58.9\u0026rdquo;E). The southern KZN plantations, Hibberdene (30\u0026deg;35\u0026rsquo;37.1214\u0026rdquo;S,30\u0026deg;31\u0026rsquo;30.2916\u0026rdquo;E) and Mzinto (30\u0026deg;16\u0026rsquo;41.0262\u0026rdquo;S,30\u0026deg;39\u0026rsquo;47.9658\u0026rdquo;E), were located in the South Coast. Northern KZN has a subtropical climate that is warm and humid but is characterised by heavy rainfalls throughout the year. The South coast of KZN is characterised by a subtropical climate, with warm temperatures, mild winters, high humidity, and generous summer rainfall. From each site, the experimental soils, classified as sandy soils, were collected from 20 random points of the plantation at a depth of 10\u0026ndash;20 cm, where microbial nutrient cycling activities occur, using a Dutch auger. Pre-planting, the soils for enzyme activity assays, bacterial extraction and identification experiments were collected and packaged into sterile plastic bags. The soils were then immediately placed on ice during transportation and stored at 4\u0026deg;C before analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental setup, Growth conditions, and Soil Chemical Analysis\u003c/h2\u003e \u003cp\u003e \u003cem\u003eVicia sativa a\u003c/em\u003end \u003cem\u003eV. villosa\u003c/em\u003e seeds used in this study were obtained from AGT Foods Africa, Marji Mizuri farm, KwaZulu-Natal. The seeds were handled as per Plant Improvement Act 53 of 1976, Regulations Relations To Establishment, Varieties, Plant And Propagation Material. The seeds were germinated by soaking in warm water overnight to stimulate germination, and then transferred into petri dishes lined with moist, sterile filter paper and stored in the dark for four days at room temperature. After germination, the seeds were planted at 1\u0026ndash;2 cm depths in 10 cm diameter pots filled with soil from the different plantations. The experiment was a completely randomised design with the plantation sites as treatments with 10 replications per site per species, resulting in a total of 100 experimental pots. The experimental trials were conducted in the greenhouse at the University of KwaZulu-Natal, Westville campus, School of Life Sciences building, South Africa. The average night and day temperatures in the greenhouse ranged from 11\u0026ndash;15\u0026deg;C and 30\u0026ndash;35\u0026deg;C, respectively. Initial and final harvesting were conducted 14 and 45 days after seedling emergence. The initial and final harvesting was required for the growth, nutrient assimilation, and utilisation calculations. Post-harvest, the plants were rinsed with distilled H\u003csub\u003e2\u003c/sub\u003eO, separated into roots, stems and leaves, and dried at 65\u0026deg;C until constant weight was reached. The plant dry weights (DW) were recorded, and dried material was ground using a mortar and pestle.\u003c/p\u003e \u003cp\u003eThe ground plant material was then sent for carbon (C) and N isotope analysis at the Archaeometry Department at the University of Cape Town, South Africa, and P analysis at the Central Analytical Facilities of Stellenbosch University, South Africa. Post final harvest, the soils were transferred into sterile plastic bags and stored at 4\u0026deg;C to be used for nutrient analysis, enzyme activity assays, and bacterial extraction and identification. For total soil nutrient analysis, three kilogram (kg) soil samples from each plantation (initial and post-harvest) were air-dried, sieved through a 2 mm sieve, and sent to the South African Sugarcane Research Institute (SASRI) Fertiliser Advisory Services (FAS) for pH, exchange acidity, total cations, primary, secondary and micronutrients analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Soil Bacterial Extraction\u003c/h2\u003e \u003cp\u003eThree-fold soil serial dilutions were conducted where 10 g of soil sample were diluted in 100 ml of autoclaved distilled water under sterile conditions. The dilutions were then transferred into selective media plates by inoculating each plate with 100 \u0026micro;l of the dilution. Jensen media plates were used to grow N-fixing bacteria, while tricalcium phosphate and Simmons citrate plates were used to grow P-solubilising and N-cycling bacteria, respectively. The media plates were incubated at 30\u0026deg;C and allowed to grow for 3 to 7 days. Thereafter, single colonies were distinguished according to colour and size and sub-cultured into sterile, separate media plates to form pure colonies/cultures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Bacterial Amplification and Identification\u003c/h2\u003e \u003cp\u003ePure colonies/cultures obtained from repeated streaking were amplified using a colony PCR where pure bacterial colonies were amplified using the 63F (5\u0026rsquo;- CAGGCCTAACACATGCAAGTC \u0026minus;\u0026thinsp;3\u0026prime;) and 1387R (5\u0026prime;- GGGCGGTGTGTACAAGGC \u0026minus;\u0026thinsp;3\u0026prime;) primers. A T100 Thermal Cycler (Bio-Rad, USA) was used for amplification with the initial denaturation at 94\u0026deg;C for 2 min, 30 cycles of denaturation at 92\u0026deg;C for 30 sec, annealing at 56\u0026deg;C for 45 sec and elongation at 75\u0026deg;C for 45 sec. with the final elongation at 75\u0026deg;C for 10 min. The PCR products were resolved on 1.0% (w/v) agarose gels (Seakem) and visualised after staining. Positive amplicons were sent for sequencing at Inqaba Biotech Pty. Ltd., Pretoria, South Africa. Thereafter, the sequences were edited and compared against the GenBank database. Homologues were identified using the BLASTN program at the National Center for Biotechnology Information (NCBI) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (accessed 27 December 2023).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Soil Enzyme Activity Analysis\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.5.1 β-Glucosidase and acid phosphatase activity\u003c/h2\u003e \u003cp\u003eThe soil β-Glucosidase and acid phosphatase activity (nmolh\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003eg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was determined using the fluorescence-based method adapted from [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Briefly, 10 g of soil sample were homogenised in 100 ml of dH\u003csub\u003e2\u003c/sub\u003eO at low speed for 2 hrs. An appropriate MUB substrate, bicarbonate buffer (100 mM) and a 4-Methylumbelliferone standard (100 \u0026micro;M) were prepared. The different solutions were then transferred into 96-well microplates and incubated for 1hr at 30\u0026deg;C; 0.5 M of NaOH was used to stop the reaction. MUB-phosphatase substrate and 4-MUB-glucopyranoside substrates were used for acid phosphatase and β-Glucosidase activities, respectively. The buffer and standard had their pH adjusted to 5 for the acid phosphatase activity. The fluorescent absorbance was measured at 450 nm using an Apex Scientific microplate reader (Durban, South Africa).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.5.2 Nitrate Reductase Activity\u003c/h2\u003e \u003cp\u003eThe nitrate reductase activity was determined using the method adapted from [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Briefly, 5 g of soil sample were mixed with 4 ml of 0.9 mM 2.4 DNP, 1 ml of 25 mM KNO\u003csub\u003e3\u003c/sub\u003e and 5ml of autoclaved distilled water in a conical flask wrapped with foil to prevent light penetration. The mixture was mixed vigorously before incubation for 24 hrs at 30\u0026deg;C. After incubation, 10ml of 4 M KCl was added to each sample, mixed, and passed through Whatman no. 1 filter paper. The enzyme activity was initiated by adding 2 ml of the filtrate into 1.2 ml of 0.19 M of ammonium chloride (pH\u0026thinsp;~\u0026thinsp;8.5) and 0.8ml of the colour reagent (1% sulphanilamide in 1 N HCl and 0.2% N-(1-naphthyl) ethylenediamine dihydrochloride (NEDD). The sample was then incubated at 30\u0026deg;C for 30 mins. After that, the absorbance was measured at 520 nm using an Agilent Cary 60UV-Vis spectrophotometer (Agilent, Santa Clara, CA, USA). The amount of nitrite released into the medium was expressed as 0.1 \u0026micro;molh\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003eg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Plant Nutrition\u003c/h2\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1 Calculation of Percentage Nitrogen Derived from the Atmosphere (%NDFA)\u003c/h2\u003e \u003cp\u003eNitrogen isotope analyses were conducted at the Archeometry Department, University of Cape Town, South Africa. The isotopic ratio of N was calculated as δ\u0026thinsp;=\u0026thinsp;1000\u0026permil; (Rsample/ Rstandard), where R is the molar ratio of the heavier to the lighter isotope of the samples and standards as described by [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Between 2.100 and 2.200 mg of each milled sample were weighed into 8 mm x 5-mm tin capsules (Elemental Micro-analysis, Devon, UK) on a Sartorius microbalance (Goettingen, Germany). The samples were then combusted in a Fisons NA 1500 (Series 2) CHN analyser (Fisons Instruments SpA, Milan, Italy). The N isotope values for the N gas released were determined on a Finnigan Matt 252 mass spectrometer (Finnigan MAT GmbH, Bremen, Germany), which was connected to a CHN analyser by a Finnigan MAT Conflo control unit. Three standards were used to correct the samples for machine drift, namely, two in-house standards (Merck Gel and Nasturtium) and the IAEA (International Atomic Energy Agency) standard (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003e%NDFA was calculated according to [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], as follows:\u003c/p\u003e \u003cp\u003e%NDFA= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(100\\left(\\frac{{\\delta }^{15}{N}_{reference plant}-{\\delta }^{15}{N}_{legume}}{{\\delta }^{15}{N}_{referece plant}-B}\\right)\\)\u003c/span\u003e\u003c/span\u003e;\u003c/p\u003e \u003cp\u003eWhere the reference plant was non-nodulated \u003cem\u003eV. sativa\u003c/em\u003e or \u003cem\u003eV. villosa\u003c/em\u003e, planted 2 weeks later than the experimental plants and grown under the same glasshouse conditions using 500 mM N in a Long Ashton nutrient solution (25% strength). The B value is the d\u003csup\u003e15\u003c/sup\u003eN natural abundance of the N derived exclusively from biological N-fixation of nodulated \u003cem\u003eV. sativa\u003c/em\u003e or \u003cem\u003eV. villosa\u003c/em\u003e. The seeds were germinated in the natural inoculum, and thereafter, the seedlings were grown with N-free 25% strength Long Ashton nutrient solution in sterile-sand culture. The B-value of \u003cem\u003eV. sativa\u003c/em\u003e was determined as \u0026minus;\u0026thinsp;2.58.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2 Specific N/P Absorption Rate (SNAR/SPAR)\u003c/h2\u003e \u003cp\u003eThe net N/P absorption rate per unit root DW was calculated according to [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] using the plant's total N/P content.\u003c/p\u003e \u003cp\u003eSNAR= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(({N}_{2}-{N}_{1}/{t}_{2}-{t}_{1})\\times \\left(({\\text{log}}_{e}{R}_{2}-{\\text{log}}_{e}{R}_{1})/({R}_{2}-{R}_{1})\\right)\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eSPAR= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(({P}_{2}-{P}_{1}/{t}_{2}-{t}_{1})\\times \\left(({\\text{log}}_{e}{R}_{2}-{\\text{log}}_{e}{R}_{1})/({R}_{2}-{R}_{1})\\right)\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eWhere N2 and N1 are the final and initial N, respectively; P2 and P1 are the P content, t is the duration of plant growth, and R is the root. dry weight (mg N g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e root DW day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3 Specific N/P utilisation rates (SNUR/SPUR)\u003c/h2\u003e \u003cp\u003eThe total N/P were used to calculate the specific N/P utilisation rate (g DW mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003eN/P day\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) according to [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSNUR= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(({W}_{2}-{W}_{1}/{t}_{2}-{t}_{1})\\times \\left(({\\text{log}}_{e}{N}_{2}-{\\text{log}}_{e}{N}_{1})/({N}_{2}-{N}_{1})\\right)\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eSPUR= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(({W}_{2}-{W}_{1}/{t}_{2}-{t}_{1})\\times \\left(({\\text{log}}_{e}{M}_{2}-{\\text{log}}_{e}{M}_{1})/({M}_{2}-{M}_{1})\\right)\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eWhere W, N, P and t represent the plant DW, total N content, total P content and the duration of the plant growth, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.6.5 Relative Growth Rate (RGR)\u003c/h2\u003e \u003cp\u003eThe relative growth rate was calculated using the method by [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]:\u003c/p\u003e \u003cp\u003eRGR= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\left[(\\text{ln}{W}_{2}-{W}_{1})/{t}_{2}-{t}_{1}\\right]\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eWhere W denotes the dry plant weights accumulated from the initial (W\u003csub\u003e1\u003c/sub\u003e) and final (W\u003csub\u003e2\u003c/sub\u003e) harvest and t is the time for plant growth.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e2.6.6 Root: shoot ratio\u003c/h2\u003e \u003cp\u003eThe root: shoot ratio was calculated according to [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] using the root biomass per shoot biomass of the plant.\u003c/p\u003e \u003cp\u003eRoot: shoot= \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\({D}_{R}/{D}_{S}\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003eWhere D\u003csub\u003eR\u003c/sub\u003e is the dry weight of the root while D\u003csub\u003eS\u003c/sub\u003e is the dry weight of the shoot.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Statistical Analysis\u003c/h2\u003e \u003cp\u003eR- studio (R version 4.3.1) was used for all analyses where soil nutrition (pre- and post-planting and harvest), soil enzyme activities (pre- and post-harvest), growth kinetics, plant biomass and plant mineral nutrition of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e were examined using the analysis of variance (One-way ANOVA). A Tukey multiple comparisons post hoc test was conducted when significant results were observed in the ANOVA (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The assumptions for normal distribution were tested using the Shapiro-Wilk test, while the assumption for homogeneity of variance was tested using Levene\u0026rsquo;s test (library car package). A non-parametric (Kruskal-Walli\u0026rsquo;s test) alternative was used when the assumptions were not met.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Soil Chemical Analysis\u003c/h2\u003e \u003cp\u003ePost-harvesting, there was a significant decrease in soil N concentrations in Mpembeni, Mzinto, and Gingindlovu under both species (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The soil P concentrations decreased significantly in Mvutshini, Mzinto and Hibberdene under \u003cem\u003eV. sativa\u003c/em\u003e treatment, while a significant decrease was observed under both species treatments in Gingindlovu (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The potassium (K) concentrations post-harvesting showed a significant increase in Mpembeni and a decrease in Hibberdene under both species treatments (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Calcium (Ca) concentrations significantly increased across all sites, while magnesium (Mg) concentrations increased significantly in Mpembeni, Mzinto, and Hibberdene. The soil pH increased significantly across all sites under both species except for Mvutshini- \u003cem\u003eV. sativa\u003c/em\u003e, which showed no significant differences (4.67 to 5.04). The exchange acidity increased significantly in Mvutshini, Mpembeni, and Gingindlovu post-harvesting soils.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe chemical parameters of pre-planting and post-\u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e harvest in soils collected from Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu. The different values are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Different letters represent significant differences after One-Way ANOVA\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNitrogen (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePhosphorus (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePotassium (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCalcium (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMagnesium (mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eExchange Acidity (Al\u0026thinsp;+\u0026thinsp;H)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMvutshini\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.085\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e196.00\u0026thinsp;\u0026plusmn;\u0026thinsp;13.86\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e72.50\u0026thinsp;\u0026plusmn;\u0026thinsp;8.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.070\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40.50\u0026thinsp;\u0026plusmn;\u0026thinsp;4.91\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e400.00\u0026thinsp;\u0026plusmn;\u0026thinsp;54.80\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e134.50\u0026thinsp;\u0026plusmn;\u0026thinsp;22.80\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.090\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e391.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.46\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e119.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMpembeni\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.055\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e150.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e46.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.025\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e270.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e79.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.020\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e219.00\u0026thinsp;\u0026plusmn;\u0026thinsp;4.04\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e58.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMzinto\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.070\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e61.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e726.00\u0026thinsp;\u0026plusmn;\u0026thinsp;53.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e151.00\u0026thinsp;\u0026plusmn;\u0026thinsp;12.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.035\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e72.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e923.00\u0026thinsp;\u0026plusmn;\u0026thinsp;7.51\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e219.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.89\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.040\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e68.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e930.50\u0026thinsp;\u0026plusmn;\u0026thinsp;68.99\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e222.00\u0026thinsp;\u0026plusmn;\u0026thinsp;22.52\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHibberdene\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.060\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.60\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e563.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.46\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e156.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.77\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.045\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e73.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e726.00\u0026thinsp;\u0026plusmn;\u0026thinsp;6.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e204.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.050\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.70\u0026thinsp;\u0026plusmn;\u0026thinsp;1.10\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e64.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e694.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.44\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e202.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGingindlovu\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.055\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e221.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e128.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.44\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.030\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60.50\u0026thinsp;\u0026plusmn;\u0026thinsp;5.48\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e337.00\u0026thinsp;\u0026plusmn;\u0026thinsp;31.70\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e158.00\u0026thinsp;\u0026plusmn;\u0026thinsp;18.48\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.035\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.73\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e338.00\u0026thinsp;\u0026plusmn;\u0026thinsp;6.93\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e152.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Bacterial identification and abundance\u003c/h2\u003e \u003cp\u003eA total of 16 bacterial strains were isolated pre-planting, compared to 31 isolated post-\u003cem\u003eV. sativa\u003c/em\u003e harvest and 27 post-\u003cem\u003eV. villosa\u003c/em\u003e harvesting (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Pre-planting, six bacterial strains were isolated from Mvutshini (1 N-fixing; 1 phosphate solubilising and N-cycling; 1 N-cycling; 3 N-fixing and phosphate solubilising). The number of bacterial strains increased to seven post-\u003cem\u003eV. sativa\u003c/em\u003e harvest (1 N-cycling; 4 N-fixing and phosphate solubilising; 2 N-fixing, phosphate solubilising and N-cycling) and five post-\u003cem\u003eV. villosa\u003c/em\u003e harvesting (3 N-fixing and phosphate solubilising, and 2 phosphate solubilising, N-fixing and N-cycling). In Mpembeni, five bacterial strains were isolated pre-planting (1 phosphate solubilising; 3 N-fixing and phosphate solubilising; 1 phosphate solubilising, N-fixing and N- cycling). The number of isolated strains increased to eight (2 N- fixing, phosphate solubilising and N-cycling, and 6 N- fixing and phosphate solubilising) post-\u003cem\u003eV. sativa\u003c/em\u003e harvest and eight N-fixing and phosphate solubilising strains post-\u003cem\u003eV. villosa\u003c/em\u003e harvest. Two N-fixing, phosphate solubilising and N-cycling bacterial strains were isolated from Mzinto pre-planting, which increased to six (2 phosphate solubilising, N- fixing and N- cycling; 1 phosphate solubilising and N cycling; 3 N- fixing \u0026amp; phosphate solubilising) post-\u003cem\u003eV. sativa\u003c/em\u003e harvest and four (1 phosphate solubilising, N- fixing and N- cycling, and 3 N- fixing and phosphate solubilising) bacterial strains post-\u003cem\u003eV. villosa\u003c/em\u003e harvest. Pre-planting, two bacterial strains (1 phosphate solubilising and 1 N- fixing and phosphate solubilising) were isolated from Hibberdene, which increased to five (2 phosphate solubilising and N- fixing; 1 N-cycling and phosphate solubilising; 1 N-cycling; 1 phosphate solubilising) bacterial strains post-\u003cem\u003eV. sativa\u003c/em\u003e and harvesting and five phosphate solubilising, N-fixing and N-cycling bacterial strains isolated post-\u003cem\u003eV. villosa\u003c/em\u003e harvest. One phosphate solubilising and N-cycling bacterial strain was isolated from Gingindlovu pre-planting compared to five (2 phosphate solubilising, N-fixing and N-cycling; 1 N-fixing; 2 N-fixing and phosphate solubilising) isolated post-\u003cem\u003eV. sativa\u003c/em\u003e harvest and five (1 N-fixing, phosphate solubilising and N-cycling, and 4 N-fixing and phosphate solubilising) bacterial strains isolated post-\u003cem\u003eV. villosa\u003c/em\u003e harvest.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNutrient cycling bacteria (accession no. and percentage identity) isolated from Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu plantation soil, pre and post-\u003cem\u003eVicia villosa\u003c/em\u003e planting and harvest\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePre-planting\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eVicia villosa\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSite\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFunctional traits\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFunctional traits\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFunctional traits\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMvutshini\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eParaburkholderia phymatum\u003c/em\u003e (Acc: HE864336.1,%ID:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArthrobacter sp.\u003c/em\u003e (MT826384.1, %ID:97.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eLycinibacillus sphaericus\u003c/em\u003e (Acc: MH260970.1, %ID: 96.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eParaburkholderia sabiae\u003c/em\u003e (Acc:MK139731.1, %ID:99.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MN305768.1, %ID: 972.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: LC661717.1, %ID: 99.11\u003cem\u003e)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas koreensis\u003c/em\u003e (Acc:ON428965.1, %ID:100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArthrobacter\u003c/em\u003e sp. (AF409020.1, %ID94.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: KY022417.1, %ID: 98.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc:MK612762.1, %ID: 100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eBacillus\u003c/em\u003e sp. (Acc: OP890999.1, %ID: 94.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas sp.\u003c/em\u003e (Acc: CP117460.1, %ID: 98.59)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eChromobacterium piscinae\u003c/em\u003e (Acc: LR634122.1, %ID: 99.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: AB911043.1, %ID: 99.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas bengalensis\u003c/em\u003e (Acc: MT912698.2, %ID: 96.79)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-cycling, N-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas nitroreducens\u003c/em\u003e (Acc: KY038284.1, %ID: 99.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: AB299574.1, %ID: 99.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas saccarophila\u003c/em\u003e (Acc: AF368755.1, %ID: 83.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMpembeni\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia cepacian\u003c/em\u003e (Acc: MN691121.1, %ID: 99.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: CP117460.1, %ID: 98.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas sp.\u003c/em\u003e (Acc: EU449118.2, %ID: 97.65)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: KT390908.1, %ID: 98.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: HQ403189.1, %ID: 97.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas moraviensis\u003c/em\u003e (Acc: LR027434.1, %ID: 98.26)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: MN594801.1, %ID: 99.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: 117452.1, %ID: 97.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas koreensis\u003c/em\u003e (Acc: KJ567119.2, %ID: 97.56)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas protegens\u003c/em\u003e (Acc: MT505104.1, %ID: 100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: AF368755.1, %ID: 96.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eBacillus\u003c/em\u003e sp. (Acc: KY618763.1, %ID: 98.11)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia cenocepacia\u003c/em\u003e (Acc: MT001454.1, %ID: 99.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCaulobacter rhizosphaerae\u003c/em\u003e (Acc: CF048815.1, %ID: 97.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-cycling, N-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MN305768.1, %ID: 97.47)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas koreensis\u003c/em\u003e (Acc: MT998061.1, %ID: 99)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: OR131167.1, %ID: 97.81)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eParaburkholderia\u003c/em\u003e sp. (Acc: MH118322.1, %ID: 98.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: OP990591.1, %ID: 97.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas koreensis\u003c/em\u003e (Acc:MH17853.1, %ID: 99.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas koreensis\u003c/em\u003e (Acc: MH725617.1, %ID: 98.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMzinto\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eArthrobacter\u003c/em\u003e sp. (Acc: MN081011.1, %ID: 100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-cycling, N-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eArthrobacter\u003c/em\u003e sp. (Acc: MH669311.1, %ID: 98.95)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-cycling, N-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: JN411662.1, %ID: 99.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MT354507.1, %ID: 99.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-cycling, N-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: HQ403180.1, %ID: 97.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eCaulobacter\u003c/em\u003e sp. (Acc: MH899441.1, %ID: 97.47)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCaulobacter rhizosphaerae\u003c/em\u003e (Acc: CP048815.1, %ID: 97.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas umsongensis\u003c/em\u003e (Acc: KP409809.1, %ID: 98.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: AB982940.1, %ID: 98.37)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: FJ605433.1, %ID: 97.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: MH337960.1, %ID: 99.69)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas frederiksbergensis\u003c/em\u003e (Acc: KT369914.1, %ID: 97.38)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-cycling, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHibberdene\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas poae\u003c/em\u003e (Acc: OR122193.1, %ID: 99.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MK602511.1, %ID: 98.54)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MT354507.1, %ID: 97.99\u003cem\u003e)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MT354507.1, %ID: 99.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudoarthrobacter chlorophenolicus\u003c/em\u003e (Acc: MT192880.1, %ID: 98.85)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MZ571910.1, %ID: 98.14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCupriavidus yeoncheonensis\u003c/em\u003e (Acc: MK824648.1, %ID: 97.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas vancouverensis\u003c/em\u003e (Acc: MT409572.1, %ID: 98.80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: LC474074.1, %ID: 99.57)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: OR131117.1, %ID: 97.79)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCaulobacter\u003c/em\u003e sp. (Acc: MN181102.1, %ID: 98.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: KU738933.1, %ID: 99.04)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGingindlovu\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas frederiksbergensis\u003c/em\u003e (Acc: MT378522.1, %ID: 99.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eCaulobacter\u003c/em\u003e sp. (Acc: MN181102.1, %ID: 98.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eLycinibacillus\u003c/em\u003e sp. (Acc: MN335310.1, %ID: 98.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, N-cycling, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: CP117460.1, %ID: 98.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: MN559094.1, %ID: 96.95)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. (Acc: CP117460.1, %ID: 98.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia\u003c/em\u003e sp. (Acc: AB911072.1, %ID: 98.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eRhodobacter\u003c/em\u003e sp. (Acc: MH136844.1, %ID: 97.69)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing, P-solubilising, N-cycling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eParaburkholderia\u003c/em\u003e sp. (Acc: OR191068.1, %ID: 98.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eXanthobacter\u003c/em\u003e sp. (Acc: KF560403.1, %ID: 99.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eN-fixing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eCupriavidus\u003c/em\u003e sp. (Acc: HQ443228.1, %ID: 98.14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eN-fixing, P-solubilising\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Enzyme activities\u003c/h2\u003e \u003cp\u003eThe soil enzyme activities varied across all sites and treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Nitrate reductase activities increased significantly in Mvutshini post-\u003cem\u003eV. sativa\u003c/em\u003e harvest, increased in Mzinto post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e harvest and decreased significantly in Hibberdene and Gingindlovu post-\u003cem\u003eV. villosa\u003c/em\u003e harvests (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Acid phosphatase activities increased significantly in Gingindlovu and Hibberdene post-\u003cem\u003eV. villosa\u003c/em\u003e harvest, and also increased in Mvutshini soils post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e harvest (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The glucosidase activities increased significantly across all sites and treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Plant Biomass and Mineral Nutrition\u003c/h2\u003e \u003cp\u003e \u003cem\u003eVicia sativa\u003c/em\u003e accumulated significantly higher root biomass in Mzinto and Gingindlovu, while shoot and total biomass were significantly higher in Mzinto plantation soils (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Gingindlovu-grown \u003cem\u003eV. villosa\u003c/em\u003e plants accumulated more biomass, with Gingindlovu showing a significantly higher root: shoot ratio (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe relative growth rate (g/day) of \u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e plants grown in Mvutshini, Mpembeni, Mzinto, Hibberdene and Gingindlovu plantation soils for 45 days. The different values are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. The different letters represent significant differences between the sites after a One-Way ANOVA\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRGR (g/day)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRoot RGR (g/day)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eShoot RGR (g/day)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRoot: Shoot RGR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVicia sativa\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMvutshini\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.009\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.006\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.010\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.608\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMpembeni\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.016\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.013\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eac\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.018\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.635\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMzinto\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.036\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.041\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.033\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.861\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eHibberdene\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.012\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.014\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eac\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.011\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.671\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGingindlovu\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.029\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.023\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.033\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.671\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVicia villosa\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMvutshini\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.021\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.022\u0026thinsp;\u0026plusmn;\u0026thinsp;0.000\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.020\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.667\u0026thinsp;\u0026plusmn;\u0026thinsp;0.052\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMpembeni\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.027\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.022\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.029\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.667\u0026thinsp;\u0026plusmn;\u0026thinsp;0.052\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eMzinto\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.014\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.021\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.007\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.156\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eHibberdene\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGingindlovu\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.028\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.038\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.019\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.459\u0026thinsp;\u0026plusmn;\u0026thinsp;0.198\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eVicia villosa\u003c/em\u003e grown in Hibberdene died before the final harvest date was reached.\u003c/p\u003e \u003cp\u003e \u003cem\u003eVicia sativa\u003c/em\u003e cultivated in Mzinto, Hibberdene, and Gingindlovu had the highest specific N absorption rates compared to Mvutshini and Mpembeni (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Mzinto showed the highest N utilisation rate, followed by Gingindlovu, while Hibberdene showed a decrease in N utilisation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Mpembeni and Gingindlovu showed increased P absorption rates, while Hibberdene showed a decrease in P absorption rates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Hibberdene showed the highest P utilisation rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eVicia villosa\u003c/em\u003e grown in Mpembeni had the highest specific N assimilation rate, while Mzinto and Gingindlovu had the lowest (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Gingindlovu had the highest specific N utilisation rate, while Mzinto had the lowest (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The specific P assimilation rate was highest in Gingindlovu, while the other sites didn\u0026rsquo;t show significant differences (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Lastly, the specific P utilisation rate was highest in Mpembeni and lowest in Mzinto (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMzinto had the highest %N derived from the atmosphere (55%), while Mpembeni had the lowest (20%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Total plant N content was highest in Mzinto and lowest in Hibberdene (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Plants from all the sites derived most of their N from the soil, except for Mzinto, which derived most of its N from the atmosphere (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Total plant P content was the lowest in Hibberdene (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Mzinto had the highest %NDFA (41%), while Gingindlovu had the lowest (5%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Mpembeni-grown \u003cem\u003eV. villosa\u003c/em\u003e had the highest plant N, followed by Gingindlovu (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). All the plants from the different plantation sites derived most of their N from the soil (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). \u003cem\u003eVicia villosa\u003c/em\u003e cultivated in Gingindlovu had the highest total P content, while Mzinto had the lowest (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThe study investigated the effects of planting \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villo\u003c/em\u003esa as cover crops in nutrient-deficient KZN small-scale sugarcane plantation soils. Post-harvest soil analysis showed that both species increased the presence of PGPR, with N-fixing, N-cycling, and P-solubilising functions in the genus \u003cem\u003eArthrobacter\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eBurkholderia\u003c/em\u003e, \u003cem\u003eCaulobacter\u003c/em\u003e and \u003cem\u003ePseudomonas\u003c/em\u003e. The presence of these bacterial species post-harvest can be attributed to the release of different compounds, such as organic acids by the legumes, increasing bacterial activity during nutrient deficiency [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The composition and function of rhizospheric bacteria can be influenced by the composition and quantity of root exudates released by the plants [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. During nutrient deficiency, plant roots can modulate the chemical composition of their exudates according to the plants\u0026rsquo; requirements [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. This influences the composition of the rhizospheric microbial community and forms the basis for the attraction and repulsion of certain bacterial species [\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The experimental soils in this study were N and P deficient; this may have resulted in an increase in N-fixing and P-solubilising activities and efficiency to compensate for the soil deficient nutrients for plant use. This suggests an increase in the root exudates signals of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e roots for N and P-cycling bacteria under nutrient-deficient conditions [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Similar results were obtained by [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] who reported increases in bacterial diversity under soybean soils compared to sugarcane monoculture. [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] reported that cover crop treatments increased the relative abundance of \u003cem\u003eStreptomyces\u003c/em\u003e, \u003cem\u003eArthrobacter\u003c/em\u003e and \u003cem\u003eBacillus\u003c/em\u003e sp. compared to no cover crop treatments. Therefore, it would be expected that in a sugarcane-\u003cem\u003eV. sativa\u003c/em\u003e or \u003cem\u003eV. villosa\u003c/em\u003e rotation system, nutrient cycling microbes and associated enzymes would increase activities, increasing nutrient fixing and cycling of deficient soil nutrients in sugarcane plantation soils. Bacteria from these genera have been reported to mineralise phosphates by secreting acid phosphatases and phytases [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, Mvutshini and Mzinto recorded increased acid phosphatase activities post-harvest, which could be attributed to the co-occurrence of \u003cem\u003eBurkholderia\u003c/em\u003e and \u003cem\u003ePseudomonas\u003c/em\u003e in Mzinto and \u003cem\u003ePseudomonas, Bacillus\u003c/em\u003e and \u003cem\u003eBurkholderia\u003c/em\u003e in Mvutshini. Mixed cultures of P-solubilising bacteria are more effective in mineralising organic phosphates [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] found that the co-inoculation of \u003cem\u003eBurkholderia anthina\u003c/em\u003e and \u003cem\u003eEnterobacter aerogenes\u003c/em\u003e released the highest soluble P content as compared to single inoculations. The presence of these P-solubilising bacteria makes available the cation bound P, increasing P availability for plant assimilation, and this is shown by the increased P assimilation rates in this study across all sites [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePost-harvest, soil acidity was slightly decreased to less acidic, and similar results were reported by [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], who reported increases in pH levels (4 to 6) under cover crop systems. [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] reported contradicting results as legume cover crops (white clover and orchard grass) in their study decreased pH levels, which was attributed to the secretion of organic acids and protons by the legume roots. Soil acidity is a key constraint associated with poor root health and nutrient availability [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Under acidic conditions, nutrients such as P form insoluble complexes with cations, rendering them unavailable for plant uptake [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Since P is an important macronutrient required for metabolic processes in plants and is a significant constituent of ATP, its deficiency can decrease the photosynthetic rates [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] and N fixation in legumes [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The decreased biomass and %NDFA across all plantation soil treatments in this study can be linked to \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e using the available P sparingly to maintain growth function. This is shown by the low P utilisation rates across all soil treatments. Legumes switch their N sources during nutritional stress, favouring soil N to reserve energy [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Biological N fixation (BNF) is a high-energy process and requires 16 ATP molecules to fix one molecule of atmospheric N\u003csub\u003e2\u003c/sub\u003e to NH\u003csub\u003e3\u003c/sub\u003e [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. \u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e growing in Mvutshini, Mpembeni, and Gingindlovu plantation soils showed a reduced %NDFA and increased their reliance on soil N. This shows that the plants were able to use the deficient soil P sparingly, reducing the ATP-demanding BNF to maintain their growth and function. These findings are similar to findings reported by [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], and [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e] who reported decreased N\u003csub\u003e2\u003c/sub\u003e fixation rates under low P, which were reversed when P inputs were increased. Interestingly, Hibberdene-grown \u003cem\u003eV. villosa\u003c/em\u003e died before harvest, while \u003cem\u003eV. sativa\u003c/em\u003e persisted. This could be attributed to the documented persistence of \u003cem\u003eV. sativa\u003c/em\u003e in diverse environments where other legumes would be poorly suited [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMzinto-grown plants showed increased %NDFA values, and the soil had high P concentrations and decreased acidity. Even though the plants in this study did not nodulate, the plants were able to reduce atmospheric N, suggesting a symbiosis with non-nodulating endophytic N\u003csub\u003e2\u003c/sub\u003e fixing rhizobacteria [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Similar results were recorded by [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], who reported high %NDFA in non-nodulated \u003cem\u003eLeucaena leucocephala\u003c/em\u003e plants growing in grassland ecosystem soils. The high \u003cem\u003eV. sativa\u003c/em\u003e N concentrations, despite low soil N concentrations in Mzinto plantation soils, can indicate the high efficiency of the free-living N-fixing bacteria and P-solubilising bacteria isolated from the rhizosphere of these plantation soils. This is further supported by the increased nitrate reductase and acid phosphatase activities in Mzinto plantation soils post-\u003cem\u003eV. sativa\u003c/em\u003e harvest. Soil N and P concentrations decreased post-harvest, possibly due to the uptake and use of nutrients by the legumes during growth [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. These results are consistent with those reported by [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e] and [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], who reported decreases in soil nutrient contents under cover crop treatments. However, the scavenged nutrients can be made available for the subsequent crop through the decomposition and mineralisation of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e when it is incorporated into the soil as legume biomass [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. In a study by [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], vetch ecotypes contributed up to 211 kg N ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e from aboveground biomass. This serves as a sustainable form of N and P feedback as the nutrients released from the slow decomposition of the legume biomass reduce contaminant leaching from the application of chemical fertilisers [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and provide a steady amount of N throughout the growing season [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Furthermore, the organic matter present from the rotation and buried legume biomass may be resistant to biological degradation, fostering a longer and deeper carbon stock in the soil. This extended carbon stock is beneficial to the subsequent plant [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Soil rehabilitation processes occur over an extended period. Therefore, field trials over a prolonged experimental duration might elicit different responses as plant-microbe interactions are sensitive to environmental conditions, which might affect their associated enzyme activities and nutritional contributions. Future studies should identify and quantify the root exudates released by \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e to better understand the interactions between plant roots and soil ecosystems. Additionally, future studies should use next-generation sequencing to identify all the microbial populations present, which will better estimate the microbial diversity and the effects that the legume species had on the soil microbiota.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eIn this study, \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e increased the bacterial composition, acid phosphatase, and glucosidase activities and reduced the exchange acidity in the sugarcane plantation soils, and these are an indicator of improved soil health. Even so, allowing their biomass to decompose and release stored nutrients into the soil would contribute to nutrient cycling. Therefore, integrating \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e as cover crops is a promising strategy to enhance soil biological health and promote sustainable agricultural practices in sugarcane plantations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We acknowledge the support of the University of KwaZulu-Natal, School of Life Sciences, Durban, South Africa.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe research leading to the results received funding from the National Research Foundation under Grant agreement number (Grant UID 138091)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003eWe declare no known competing financial and non-financial interests with regard to the current research. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability:\u0026nbsp;\u003c/strong\u003eThe datasets generated and/or analysed during the current study will be stored and available in ResearchGate corresponding author (Anathi Magadlela) account and tagged to the manuscript:\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eVicia\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003cem\u003esativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils.\u0026nbsp;\u003c/strong\u003eAlso, all raw data can be requested from the corresponding author, Prof. Anathi Magadlela at [email protected].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u0026nbsp;\u003c/strong\u003eConceptualisation, A. M; methodology, A. M and E. N; validation, A. M and E. N; formal analysis, E. N; writing-original draft preparation, E. N; writing-review and editing, A. M; supervision, A. M; project administration, A. M and E. N; funding acquisition, A. M. All authors reviewed the manuscript before submission for publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBenke K, Tomkins B. Future food-production systems: vertical farming and controlled-environment agriculture. Sustainability: Science, Practice and Policy. 2017;13(1):13-26.\u003c/li\u003e\n\u003cli\u003eFAO. Database on Arable land 2016 [Available from: http://data.worldbank.org/indicator/AG.LND.ARBL.HA.PC?end\u0026frac14;2013\u0026amp;start\u0026frac14;1961\u0026amp;view\u0026frac14;chart.\u003c/li\u003e\n\u003cli\u003eGerland P, Raftery AE, \u0026Scaron;evč\u0026iacute;kov\u0026aacute; H, Li N, Gu D, Spoorenberg T, et al. World population stabilization unlikely this century. Science. 2014;346(6206):234-7.\u003c/li\u003e\n\u003cli\u003eChun I-A, Ryu S-Y, Park J, Ro H-K, Han M-A. Associations between food insecurity and healthy behaviors among Korean adults. Nutrition research and practice. 2015;9(4):425.\u003c/li\u003e\n\u003cli\u003eHendriks S. South Africa\u0026apos;s National Development Plan and New Growth Path: reflections on policy contradictions and implications for food security. Agrekon. 2013;52(3):1-17.\u003c/li\u003e\n\u003cli\u003eBayat A, Louw W, Rena R. The impact of socio-economic factors on the performance of selected high school learners in the Western Cape Province, South Africa. Journal of Human Ecology. 2014;45(3):183-96.\u003c/li\u003e\n\u003cli\u003eSTATSSA. Focus on food inadequacy and hunger in South Africa in 2021 2021 [Available from: https://www.statssa.gov.za/?p=16235#:~:text=Results%20indicate%20that%20out%20of,inadequate%20access%20to%20food%2C%20respectively.\u003c/li\u003e\n\u003cli\u003eSiphesihle Q, Lelethu M. Factors affecting subsistence farming in rural areas of Nyandeni local municipality in the Eastern Cape Province. South African Journal of Agricultural Extension. 2020;48(2):92-105.\u003c/li\u003e\n\u003cli\u003eZantsi S, Bester B. Revisiting the benefits of animal traction to subsistence smallholder farmers: A case study of Ndabakazi villages in Butterworth, Eastern Cape Province of South Africa. South African Journal of Agricultural Extension. 2019;47(3):1-13.\u003c/li\u003e\n\u003cli\u003eMthembu BE, Everson TM, Everson CS. Intercropping for enhancement and provisioning of ecosystem services in smallholder, rural farming systems in KwaZulu-Natal Province, South Africa: a review. Journal of Crop Improvement. 2019;33(2):145-76.\u003c/li\u003e\n\u003cli\u003eHlatshwayo SI, Ngidi MSC, Ojo TO, Modi AT, Mabhaudhi T, Slotow R. The determinants of crop productivity and its effect on food and nutrition security in rural communities of South Africa. Frontiers in sustainable food systems. 2023;7:1091333.\u003c/li\u003e\n\u003cli\u003eZulu NS, Sibanda M, Tlali BS. Factors affecting sugarcane production by small-scale growers in Ndwedwe Local Unicipality, South Africa. Agriculture. 2019;9(8):170.\u003c/li\u003e\n\u003cli\u003eBelete T, Yadete E. Effect of Mono Cropping on Soil Health and Fertility Management for Sustainable Agriculture Practices: A Review. Journal of Plant Sciences. 2023;11(6):192-7.\u003c/li\u003e\n\u003cli\u003eGraham M, Haynes R, Meyer J. Changes in soil chemistry and aggregate stability induced by fertilizer applications, burning and trash retention on a long‐term sugarcane experiment in South Africa. European Journal of Soil Science. 2002;53(4):589-98.\u003c/li\u003e\n\u003cli\u003eAdesemoye AO, Kloepper JW. Plant\u0026ndash;microbes interactions in enhanced fertilizer-use efficiency. Applied microbiology and biotechnology. 2009;85(1):1-12.\u003c/li\u003e\n\u003cli\u003eRosenstock TS, Tully KL, Arias-Navarro C, Neufeldt H, Butterbach-Bahl K, Verchot LV. Agroforestry with N2-fixing trees: sustainable development\u0026apos;s friend or foe? Current Opinion in Environmental Sustainability. 2014;6:15-21.\u003c/li\u003e\n\u003cli\u003eAbd-Alla MH, Issa AA, Ohyama T. Impact of harsh environmental conditions on nodule formation and dinitrogen fixation of legumes. Advances in biology and ecology of nitrogen fixation. 2014;9:1.\u003c/li\u003e\n\u003cli\u003ePerrone S, Grossman J, Liebman A, Sooksa-Nguan T, Gutknecht J. Nitrogen fixation and productivity of winter annual legume cover crops in Upper Midwest organic cropping systems. Nutrient cycling in agroecosystems. 2020;117:61-76.\u003c/li\u003e\n\u003cli\u003eSun WH, Wu FF, Cong L, Jin MY, Wang XG. Assessment of genetic diversity and population structure of the genus \u003cem\u003eVicia\u003c/em\u003e (\u003cem\u003eVicia\u003c/em\u003e L.) using simple sequence repeat markers. Grassland Science. 2022;68(3):205-13.\u003c/li\u003e\n\u003cli\u003eCarre\u0026oacute;n-Abud Y, Sanchez-Ya\u0026ntilde;ez J. Rhizosphere effect of Vicia sativa L. on soil microbial population from Tiripetio town, Michoacan, M\u0026eacute;xico. Biologicas. 1998;4.\u003c/li\u003e\n\u003cli\u003eIba\u0026ntilde;ez S, Medina MI, Agostini E. \u003cem\u003eVicia\u003c/em\u003e: A green bridge to clean up polluted environments. Applied microbiology and biotechnology. 2020;104(1):13-21.\u003c/li\u003e\n\u003cli\u003eMao L, Zhu R, Yi K, Wang X, Sun J. Transcriptome Analysis of \u003cem\u003eVicia villosa\u003c/em\u003e in Response to Low Phosphorus Stress at Seedling Stage. Agronomy. 2023;13(7):1665.\u003c/li\u003e\n\u003cli\u003eSalmer\u0026oacute;n M, Isla R, Cavero J. Effect of winter cover crop species and planting methods on maize yield and N availability under irrigated Mediterranean conditions. Field Crops Research. 2011;123(2):89-99.\u003c/li\u003e\n\u003cli\u003eStevenson FJ, Cole MA. Cycles of soils: carbon, nitrogen, phosphorus, sulfur, micronutrients: John Wiley \u0026amp; Sons; 1999.\u003c/li\u003e\n\u003cli\u003ePankhurst C, Magarey R, Stirling G, Blair B, Bell M, Garside A, et al. Management practices to improve soil health and reduce the effects of detrimental soil biota associated with yield decline of sugarcane in Queensland, Australia. Soil and Tillage Research. 2003;72(2):125-37.\u003c/li\u003e\n\u003cli\u003eMarais A, Hardy M, Booyse M, Botha A. Effects of monoculture, crop rotation, and soil moisture content on selected soil physicochemical and microbial parameters in wheat fields. Applied and Environmental Soil Science. 2012;2012.\u003c/li\u003e\n\u003cli\u003eYetgin A. The dynamic interplay of root exudates and rhizosphere microbiome. Soil Studies. 2023;12(2):111-20.\u003c/li\u003e\n\u003cli\u003eJani AD, Grossman J, Smyth TJ, Hu S. Winter legume cover-crop root decomposition and N release dynamics under disking and roller-crimping termination approaches. Renewable Agriculture and Food Systems. 2016;31(3):214-29.\u003c/li\u003e\n\u003cli\u003eGregorich E, Drury C, Baldock J. Changes in soil carbon under long-term maize in monoculture and legume-based rotation. Canadian journal of soil science. 2001;81(1):21-31.\u003c/li\u003e\n\u003cli\u003eRanells NN, Wagger MG. Nitrogen release from grass and legume cover crop monocultures and bicultures. Agronomy Journal. 1996;88(5):777-882.\u003c/li\u003e\n\u003cli\u003eYang C, Sun R, Lu X, Jin T, Peng X, Zhang N, et al. Seed-germination ecology of \u003cem\u003eVicia villosa\u003c/em\u003e Roth, a cover crop in orchards. Agronomy. 2022;12(10):2488.\u003c/li\u003e\n\u003cli\u003eJackson CR, Tyler HL, Millar JJ. Determination of microbial extracellular enzyme activity in waters, soils, and sediments using high throughput microplate assays. JoVE (Journal of Visualized Experiments). 2013(80):e50399.\u003c/li\u003e\n\u003cli\u003eBruckner A, Wright J, Kampichler C, Bauer R, Kandeler E. A method of preparing mesocosms for assessing complex biotic processes in soils. Biology and fertility of soils. 1995;19:257-62.\u003c/li\u003e\n\u003cli\u003eFarquhar GD, Ehleringer JR, Hubick KT. Carbon isotope discrimination and photosynthesis. Annual review of plant biology. 1989;40(1):503-37.\u003c/li\u003e\n\u003cli\u003eShearer G, Kohl DH. N2-fixation in field settings: estimations based on natural 15N abundance. Functional Plant Biology. 1986;13(6):699-756.\u003c/li\u003e\n\u003cli\u003eNielsen KL, Eshel A, Lynch JP. The effect of phosphorus availability on the carbon economy of contrasting common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) genotypes. Journal of experimental botany. 2001;52(355):329-39.\u003c/li\u003e\n\u003cli\u003e\u0026Aring;GREN GI, Franklin O. Root: shoot ratios, optimization and nitrogen productivity. Annals of botany. 2003;92(6):795-800.\u003c/li\u003e\n\u003cli\u003eChaparro JM, Sheflin AM, Manter DK, Vivanco JM. Manipulating the soil microbiome to increase soil health and plant fertility. Biology and Fertility of Soils. 2012;48:489-99.\u003c/li\u003e\n\u003cli\u003eKumar R, Bhatia R, Kukreja K, Behl RK, Dudeja SS, Narula N. Establishment of Azotobacter on plant roots: chemotactic response, development and analysis of root exudates of cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) and wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.). Journal of basic microbiology. 2007;47(5):436-9.\u003c/li\u003e\n\u003cli\u003eZhalnina K, Louie KB, Hao Z, Mansoori N, Da Rocha UN, Shi S, et al. Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly. Nature microbiology. 2018;3(4):470-80.\u003c/li\u003e\n\u003cli\u003eMula-Michel H, White P, Hale A. Immediate impacts of soybean cover crop on bacterial community composition and diversity in soil under long-term Saccharum monoculture. PeerJ. 2023;11:e15754.\u003c/li\u003e\n\u003cli\u003eGao H, Tian G, Khashi u Rahman M, Wu F. Cover crop species composition alters the soil bacterial community in a continuous pepper cropping system. Frontiers in Microbiology. 2022;12:789034.\u003c/li\u003e\n\u003cli\u003eJorquera MA, Hern\u0026aacute;ndez MT, Rengel Z, Marschner P, de la Luz Mora M. Isolation of culturable phosphobacteria with both phytate-mineralization and phosphate-solubilization activity from the rhizosphere of plants grown in a volcanic soil. Biology and Fertility of Soils. 2008;44:1025-34.\u003c/li\u003e\n\u003cli\u003eMolla M, Chowdhury A, Islam A, Hoque S. Microbial mineralization of organic phosphate in soil. Plant and soil. 1984;78:393-9.\u003c/li\u003e\n\u003cli\u003ePark J-H, Lee H-H, Han C-H, Yoo J-A, Yoon M-H. Synergistic effect of co-inoculation with phosphate-solubilizing bacteria. Korean Journal of Agricultural Science. 2016;43(3):401-14.\u003c/li\u003e\n\u003cli\u003eKatsalirou E, Deng S, Gerakis A, Nofziger DL. Long-term management effects on soil P, microbial biomass P, and phosphatase activities in prairie soils. European journal of soil biology. 2016;76:61-9.\u003c/li\u003e\n\u003cli\u003eWang Y, Huang Q, Gao H, Zhang R, Yang L, Guo Y, et al. Long-term cover crops improved soil phosphorus availability in a rain-fed apple orchard. Chemosphere. 2021;275:130093.\u003c/li\u003e\n\u003cli\u003eBalota EL, Chaves JCD. Microbial activity in soil cultivated with different summer legumes in coffee crop. Brazilian Archives of Biology and Technology. 2011;54:35-44.\u003c/li\u003e\n\u003cli\u003evan Antwerpen R, Titshall L, McFarlane S, Keeping M, editors. Soil regenerative agriculture in the South African sugarcane industry. Proceedings of the International Society of Sugar Cane Technologists; 2023.\u003c/li\u003e\n\u003cli\u003eVance CP, Graham PH, Allan DL. Biological nitrogen fixation: phosphorus-a critical future need? Nitrogen fixation: From molecules to crop productivity. 2000:509-14.\u003c/li\u003e\n\u003cli\u003eXu H, Weng X, Yang Y. Effect of phosphorus deficiency on the photosynthetic characteristics of rice plants. Russian Journal of Plant Physiology. 2007;54:741-8.\u003c/li\u003e\n\u003cli\u003eH\u0026Oslash;GH‐JENSEN H, Schjoerring JK, SOUSSANA JF. The influence of phosphorus deficiency on growth and nitrogen fixation of white clover plants. Annals of Botany. 2002;90(6):745-53.\u003c/li\u003e\n\u003cli\u003eSithole N, Tsvuura Z, Kirkman K, Magadlela A. Nitrogen source preference and growth carbon costs of \u003cem\u003eLeucaena leucocephala\u003c/em\u003e (Lam.) de Wit saplings in South African grassland soils. Plants. 2021;10(11):2242.\u003c/li\u003e\n\u003cli\u003eVance CP, Uhde‐Stone C, Allan DL. Phosphorus acquisition and use: critical adaptations by plants for securing a nonrenewable resource. New phytologist. 2003;157(3):423-47.\u003c/li\u003e\n\u003cli\u003eAlkama N, Ounane G, Drevon JJ. Is genotypic variation of H+ efflux under P deficiency linked with nodulated-root respiration of N2\u0026ndash;Fixing common-bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.)? Journal of plant physiology. 2012;169(11):1084-9.\u003c/li\u003e\n\u003cli\u003eBenner JW, Vitousek PM. Cyanolichens: a link between the phosphorus and nitrogen cycles in a Hawaiian montane forest. Journal of Tropical Ecology. 2012;28(1):73-81.\u003c/li\u003e\n\u003cli\u003eM\u0026iacute;guez-Montero M, Valentine A, P\u0026eacute;rez-Fern\u0026aacute;ndez M. Regulatory effect of phosphorus and nitrogen on nodulation and plant performance of leguminous shrubs. AoB Plants. 2020;12(1):plz047.\u003c/li\u003e\n\u003cli\u003eHuang Y, Gao X, Nan Z, Zhang Z. Potential value of the common vetch (Vicia sativa L.) as an animal feedstuff: a review. Journal of animal physiology and animal nutrition. 2017;101(5):807-23.\u003c/li\u003e\n\u003cli\u003eWeerasekara CS, Udawatta RP, Gantzer CJ, Kremer RJ, Jose S, Veum KS. Effects of cover crops on soil quality: selected chemical and biological parameters. Communications in Soil Science and Plant Analysis. 2017;48(17):2074-82.\u003c/li\u003e\n\u003cli\u003eZhou X, Liu X, Rui Y, Chen C, Wu H, Xu Z. Symbiotic nitrogen fixation and soil N availability under legume crops in an arid environment. Journal of Soils and Sediments. 2011;11:762-70.\u003c/li\u003e\n\u003cli\u003eShennan C. Cover crops, nitrogen cycling, and soil properties in semi-irrigated vegetable production systems. HortScience. 1992;27(7):749-54.\u003c/li\u003e\n\u003cli\u003eDinnes DL, Karlen DL, Jaynes DB, Kaspar TC, Hatfield JL, Colvin TS, et al. Nitrogen management strategies to reduce nitrate leaching in tile‐drained Midwestern soils. Agronomy journal. 2002;94(1):153-71.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Small-scale sugarcane plantations, nutrient-deficient, Vicia sativa, Vicia villosa, cover crops, plant growth-promoting rhizobacteria, soil nitrogen nutrition, soil pH","lastPublishedDoi":"10.21203/rs.3.rs-4621168/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4621168/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eVicia sativa\u003c/em\u003e and \u003cem\u003eVicia villosa\u003c/em\u003e are nitrogen (N) fixing legumes commonly used as forage and cover crops due to their ability to enhance N fixation, soil N contributions, and enzyme activities in nutrient-deficient soils. Using \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e as cover crops can potentially improve nutrient cycling in nutrient-deficient sugarcane plantations owned by small-scale growers (SSGs) in KwaZulu-Natal, South Africa. This study investigated the chemical and biological inputs of \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e in nutrient-deficient sugarcane plantation soils. The nutrient concentration, N and phosphorus (P) cycling bacteria, and extracellular enzyme activities of soils collected from five small-scale sugarcane plantations were determined pre-planting and post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e harvest. Post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e soils had higher pH levels than pre-planting soils across all plantation soils. The number of plant growth-promoting rhizobacteria (PGPR) isolated from soils post-\u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e harvest increased across all plantation soils. The \u003cem\u003eArthrobacter\u003c/em\u003e, \u003cem\u003eBurkholderia\u003c/em\u003e and \u003cem\u003eParaburkholderia Pseudomonas\u003c/em\u003e were the most dominant genera isolated from post-harvest soils. The number of P-solubilising bacteria increased, increasing acid phosphatase activities. The findings of this study reveal that \u003cem\u003eV. sativa\u003c/em\u003e and \u003cem\u003eV. villosa\u003c/em\u003e increase PGPR, pH and enzyme activities in soils, making them sustainable options as cover crops for nutrient-deficient sugarcane plantation soils owned by SSGs.\u003c/p\u003e","manuscriptTitle":"Vicia sativa and Vicia villosa enhance soil microbial composition, enzyme activities, and chemical properties in nutrient-deficient small-scale sugarcane plantation soils","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 11:56:11","doi":"10.21203/rs.3.rs-4621168/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6d3bd0a7-a78d-47cc-bfce-5225ea112da5","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-23T03:29:21+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-22 11:56:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4621168","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4621168","identity":"rs-4621168","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}