First report of Pichia bruneiensis in spontaneous fermentation in sugarcane juice for artisanal liquor (aguardiente) in the Ecuadorian Amazon

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Native microbiota drives spontaneous fermentation in artisanal aguardiente in the Ecuadorian Amazon, an occurrence that has received little attention from a microbiological perspective. Juice samples were collected at three stages (0, 48, and 96 h), and three yeast morphotypes (Y01, Y02, and Y03) were isolated. A reduction in diversity occurred towards the final phase, where Y01 prevailed. Cell viability, evaluated by gentian violet staining, was higher in Y01, suggesting better adaptation to fermentative stress. Selective culture techniques, biochemical assays, and DNA sequencing were applied, resulting in a ≥99% match with Pichia bruneiensis. This is the first evidence of the species’ participation in these fermentations, providing information on microbial biodiversity in Amazonian aguardiente and Amazonian distillates’ biotechnological potential. The species is ethanol-tolerant and metabolically versatile and can generate differential aromatic compounds, making it a promising native starter culture that could improve the product, reinforce local microbial identity, and support valorization strategies.
Full text 81,247 characters · extracted from preprint-html · click to expand
First report of Pichia bruneiensis in spontaneous fermentation in sugarcane juice for artisanal liquor (aguardiente) in the Ecuadorian Amazon | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article First report of Pichia bruneiensis in spontaneous fermentation in sugarcane juice for artisanal liquor (aguardiente) in the Ecuadorian Amazon Marcos David Landívar Valverde, Mayra Chiriboga Ruilova, Estela Guardado Yordi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8348587/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Native microbiota drives spontaneous fermentation in artisanal aguardiente in the Ecuadorian Amazon, an occurrence that has received little attention from a microbiological perspective. Juice samples were collected at three stages (0, 48, and 96 h), and three yeast morphotypes (Y01, Y02, and Y03) were isolated. A reduction in diversity occurred towards the final phase, where Y01 prevailed. Cell viability, evaluated by gentian violet staining, was higher in Y01, suggesting better adaptation to fermentative stress. Selective culture techniques, biochemical assays, and DNA sequencing were applied, resulting in a ≥99% match with Pichia bruneiensis. This is the first evidence of the species’ participation in these fermentations, providing information on microbial biodiversity in Amazonian aguardiente and Amazonian distillates’ biotechnological potential. The species is ethanol-tolerant and metabolically versatile and can generate differential aromatic compounds, making it a promising native starter culture that could improve the product, reinforce local microbial identity, and support valorization strategies. isolation yeast Pichia native microbiota artisanal aguardiente Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Artisanal aguardiente (sugarcane liquor) is a traditional product produced from sugarcane in the Ecuadorian Amazon, particularly in the province of Pastaza [1]. This area contains about 4,500 ha of sugarcane cultivation, equivalent to 55% of the total planted in the Ecuadorian Amazon [2]. In addition, there are about twenty establishments dedicated to the production of artisanal aguardiente [3], which use empirical knowledge passed down through generations. The artisanal production of Amazonian aguardiente is characterized, from a technical point of view, by a process of spontaneous and uncontrolled fermentation of the sugarcane juice and its subsequent distillation. During fermentation, the sugars present in the cane juice are transformed into ethyl alcohol. For this purpose, the fresh juice is left to stand for approximately five days, allowing the process to occur naturally under the environmental conditions of the region, without the addition of commercial starter cultures [4]. These spontaneous fermentations are fundamental, as they allow the transformation of sugarcane juice into alcohol thanks to a complex microbial community, in which wild yeasts play a central role [5]. These yeasts, which are not domesticated, contribute metabolic diversity and are responsible for generating unique flavor and aroma profiles in the final product [6]. The composition and dynamics of wild yeasts are determined by the origin of the raw material, local practices, and the production environment. They are responsible for contributing the final product’s characteristic sensory profiles. Within this group, Pichia spp. stand out for their ability to adapt to variable conditions and their contribution to the formation of aromatic compounds that can improve the sensory quality of fermented beverages [7]. The use of wild yeasts has now been pushed to the background and, instead, alcohol production relies on the use of highly domesticated yeast strains, mainly Saccharomyces cerevisiae, S. pastorianus, and S. bayanus [8] . This situation is typical in large-scale productions, limiting the generation of complex and differentiated sensory profiles provided by the wild yeasts present in spontaneous fermentations. It is interesting to note that alcoholic beverages such as wine, beer, and even distilled beverages such as whiskey or vodka have their origins in spontaneous fermentation processes conducted by native microbiota [9]. Saccharomyces yeasts, for example, are known to offer technological advantages, such as ease of handling, high fermentation efficiency [10], ethanol tolerance, and predictable metabolic profiles [11] However, several studies have warned that their exclusive use can restrict aromatic diversity, induce undesired sensory homogeneity, and limit the distinctive attributes associated with the microbial terroir (or microbial identity of origin) of fermented beverages [12]. In the Ecuadorian Amazon, the social importance of preserving artisanal productions is recognized, as they help to strengthen cultural identity, the intergenerational transmission of knowledge, community cohesion, and the generation of sustainable livelihoods for local families. This, together with the growing need for less environmental impact and the demand for quality, safety, and sustainability, requires the incorporation of environmental and technical evaluations in traditional agrifood production. Therefore, in the artisanal distilleries of the Ecuadorian Amazon, aguardiente production has been the subject of several studies focused mainly on technical-environmental analyses [13]. This has included waste management, energy efficiency, and environmental impact reduction, as well as technical improvement through cleaner production strategies. These research projects have identified problems such as significant losses of raw material and energy, as well as the absence of systematic operational controls [4]. However, the spontaneous fermentation stage (a central element in defining the sensory profile and preserving the product’s cultural identity) has not been addressed from a microbiological perspective. This knowledge gap raises the need to study the wild yeasts involved in this process, with a view to their isolation and identification as a basis for future biotechnological applications in native starter cultures. Thus, the purpose of this study was to isolate and identify wild yeasts present in the spontaneous fermentation of sugarcane juice, with a view to their application as native starter cultures. RESULTS Sample Collection, Isolation and Colony Selection and Pure Cultures of Yeasts Yeast-like colonies were observed in the three samples (SS1, SS2, SS3), indicating the presence of an active microbial community since the onset of fermentation. A reduction in colony morphological diversity was observed at the final stage of the process. Three yeast colony morphotypes (Y01, Y02, Y03) were identified based on macroscopic differences in color, shape, margin, and elevation (Table 2). All morphotypes appeared in SS1 and SS2, while only Y01 remained detectable in SS3 (96 h). Table 2. Morphological characterization of the yeast isolates Colony ID Macroscopic Morphology Microscopic Morphology Violet Staining SS1 (0 h) SS2 (48 h) SS3 (96 h) Y01 Creamy-white, slightly wrinkled surface, regular border Ovoid cells, multilateral budding, no pseudomycelium Low + + + Y02 Opaque white, rough surface, irregular border Apiculate cells, polar budding, no pseudomycelium High + + - Y03 Bright white, moist, well-defined circular border Ellipsoidal cells, some with pseudomycelium High + + - Notes: Affinity to crystal violet staining was classified as high (≥80% of cells stained intensely), medium (40–79%), or low (<40%) by microscopic observation (1,000x). The presence of growth at each time was recorded as “+” when typical colony formation was observed on solid medium after seeding and incubation at 28°C for 48 h, and as “-” when no growth was evident. Gentian violet staining showed low dye retention in isolate Y01, while isolates Y02 and Y03 displayed high dye retention (Fig. 1). Identification of Isolates by API 20C AUX and Taxonomic Identification with ITS Sequencing Isolate Y01 was selected for taxonomic identification due to its persistence and viability at 96 hours. The API 20C AUX test revealed a carbohydrate assimilation profile compatible with members of Pichia spp. Y01 assimilated glucose, fructose, sucrose, cellobiose, trehalose, and showed variable assimilation of maltose and sorbitol (Table 3). Table 3. Carbohydrate assimilation results from the API 20C AUX assay. Nº Substrate (Carbohydrate) Isolate Y01 Pichia spp. * Saccharomyces cerevisiae* 1 Glycerol + + + 2 Erythritol - - - 3 D-Xylose + + - 4 L-Arabinose - - - 5 Ribose + ± - 6 D-Glucose + + + 7 D-Fructose + + + 8 Galactose + + + 9 Sucrose + + + 10 Maltose ± ± + 11 Lactose - - - 12 Trehalose + + + 13 Cellobiose + + - 14 Inositol - - - 15 Sorbitol + + - 16 Methyl-α-D-glucopyranoside + + + 17 N-Acetyl-glucosamine ± ± - 18 Arbutin ± + - 19 Salicin ± + - 20 D-Glucuronate - - - Notes: “+” means positive growth/assimilation, “±” means weak/limited assimilation, and “-” means it does not assimilate substrate.* Reference taken from [14]. The read generated from the ITS1 primer yielded a sequence of 423 base pairs, while the read with the ITS4 primer produced 425 base pairs, with clear signals in all four channels (G, A, T, and C). Both sequences were manually assembled by alignment of their overlapping region, yielding a consensus sequence of 434 bp, which corresponds to the ITS1-5.8S-ITS2 region (Fig. 2). This sequence was recorded in FASTA format and compared against the GenBank database using the BLAST tool. The analysis showed a high identity (≥99%) with P. bruneiensis . DISCUSSION The results reveal active microbial dynamics during spontaneous sugarcane juice fermentation, where three yeast types were detected at the beginning and middle stages, and only one persisted at the final stage. This behavior reflects a commonly reported pattern in spontaneous fermentations of fruit and sugarcane juice, in which initial diversity declines due to increasing ethanol concentration, oxygen depletion, and nutrient exhaustion [5,14]. The disappearance of isolates Y02 and Y03 at the final stage aligns with observations in other spontaneous fermentation systems [7]. The gentian violet staining results reinforce these dynamics. Yeasts with intact metabolic activity typically exclude or reduce dye retention, while declining or dead cells retain more color [15]. This behavior was seen in Y02 and Y03, whereas Y01 showed low retention and maintained viability up to 96 hours, suggesting greater tolerance to fermentative stress. BLAST analysis confirmed the identity of isolate Y01 as P. bruneiensis . Although originally isolated from flowers in Borneo [19], this species has been reported in spontaneous fermentation environments such as wine, cider, and some dairy products with probiotic potential [17]. However, this is the first report of its involvement in the spontaneous fermentation of sugarcane juice for artisanal aguardiente production, making this finding novel within the context of Amazonian fermented beverages. Species of the genus Pichia are characterized by metabolic versatility, allowing them to assimilate sugars such as glucose, fructose, mannose, and cellobiose [20], as well as by their tolerance to high ethanol levels and osmotic stress [21]. They are also known to contribute to the sensory profile of fermented beverages through production of esters and aromatic compounds [22], and their biofilm-forming ability can influence the fermentation dynamics and the organoleptic properties of the final product [23]. Several studies describe how Pichia spp. produce secondary metabolites, such as esters, higher alcohols, and organic acids, that significantly impact the aroma and flavor of fermented beverages [24]. Positive effects on sensory quality have been documented in cachaça production [25], and some strains can even reduce undesirable compounds such as higher alcohols or specific volatile esters [26,27]. These traits may be applicable to sugarcane juice fermentation due to similar process conditions. What is more, phylogenetically similar species, such as Pichia fermentans , P. kudriavzevii , and P. kluyver i, have been widely used to improve the organoleptic properties of wine, beer, and other alcoholic beverages [15]. This potential suggests that P. bruneiensis could play a similar role in cane juice fermentation and artisanal spirit quality. The genus Pichia has gained special attention for its metabolic versatility, its ability to tolerate adverse conditions (for instance, high ethanol concentrations and osmotic stress), and its ability to produce aromatic compounds of enological interest such as increased fruit esters (e.g., isoamyl acetate and 2-phenylethyl acetate) and higher alcohols, all relevant in the sensory quality of distilled and fermented beverages (Liu et al., 2024). These characteristics position it as a promising candidate for uncontrolled spontaneous fermentation processes, such as those that occur in the production of artisanal spirits. Studies such as that of [16] and [17] document the participation of Pichia spp. in the production of spirits such as cachaça, mezcal and tequila, which also stand out for their low methanol production. These attributes make P. bruneiensis an interesting candidate as a native starter culture adapted to the local conditions of the Ecuadorian Amazon. The systematic study of microbial communities associated with traditional fermentations is important to conserve functional biodiversity, favor innovation in culturally significant fermented food and drink, and promote food technological sovereignty based on local knowledge [18]. Thus, the isolation for the first time of P. bruneiensis in spontaneous fermentations of sugarcane juice for the production of artisanal aguardiente is a novel finding, which expands knowledge about the microbial diversity associated with this traditional process and opens the possibility of exploring its use as a native starter culture adapted to the conditions of the Ecuadorian Amazon. Fig. 3 summarizes the strategic benefits derived from the use of an indigenous strain as a starter culture in the spontaneous fermentation of sugarcane juice for artisanal aguardiente. The isolation and identification of P. bruneiensis represent an advance in our knowledge of native microbiota. Moreover, it opens up concrete possibilities for the preservation of the product’s sensory and cultural identity, maintaining the characteristic organoleptic attributes of the Amazonian aguardiente and reinforcing the concept of “microbial terroir” described in traditional fermentations [12]. From an operational point of view, its application as a starter culture is expected to offer technological and process advantages, optimizing fermentation kinetics and reducing variability between batches. These effects translate into improved quality and stability, ensuring chemical and sensory consistency, a key factor for recognition in specialized markets. Likewise, having a well-characterized native starter increases competitiveness and business projection, facilitating access to high-quality niches and supporting protection strategies such as designation of origin. Finally, the use of this microbial resource would expand biotechnological potential, facilitating the development of new distillates, co-fermentations with other yeasts, and the diversification of products based on Amazonian microbial biodiversity. The potential applications illustrated in Fig. 3 and described above correspond to prospective scenarios that require further evaluation. Within the scope of the present study, the detection of Pichia bruneiensis reinforces the importance of documenting microbial biodiversity associated with traditional fermentation processes developed in small-scale agroindustrial settings in poorly studied regions. CONCLUSIONS This study reports, for the first time, the presence of Pichia bruneiensis in the spontaneous fermentation of sugarcane juice used for the artisanal production of aguardiente in the Ecuadorian Amazon. Yeasts were isolated at different stages of the fermentation process and identified through morphological analysis, biochemical tests, and ITS sequencing. Sampling throughout fermentation revealed a reduction in yeast diversity, with P. bruneiensis persisting until the final stage. This finding expands current knowledge of the microbial biodiversity associated with traditional Amazonian fermentations and provides a baseline for future studies focused on the functional characterization of native yeasts. However, the results are limited to observations obtained under artisanal and spontaneous fermentation conditions, without functional assays or controlled fermentations that would allow the metabolic role or technological potential of the identified species to be established. These limitations highlight the need for further research aimed at the functional characterization of native yeasts involved in artisanal agroindustrial fermentation processes in the Amazon region. Data Availability The dataset generated during the current study, consisting of the ITS rDNA sequence of Pichia bruneiensis isolate Y01, has been deposited in the GenBank database (NCBI) under accession number PX741098. The sequence will be publicly available upon release by GenBank or at the time of publication. During peer review, access to the sequence can be provided by the corresponding author upon reasonable request. METHODS 2.1 Materials The sugarcane juice samples were collected using sterile flasks (500 mL) at an artisanal aguardiente distillery located in the parish of Teniente Hugo Ortiz, Pastaza Province (Ecuador). The following reagents were used for the culture media: potato dextrose agar (Difco®), chloramphenicol (Ecuaquimica®), sterile distilled water, and gentian violet (Novachem®). For biochemical identification assays, the API 20C AUX commercial system (bioMérieux®) was used. DNA sequencing was performed using the Sanger method with primers purchased from Macrogen®, namely ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). 2.2 Sample Collection Sugarcane juice samples were collected at three stages of the artisanal fermentation process: at the moment when the fresh juice entered the fermentation tank (time 0 h), at 48 hours, and at 96 hours (Table 1). This sampling at different stages was carried out to evaluate the microbial dynamics throughout the spontaneous fermentation, taking as a reference the methodology reported by [19]. As a negative control, a sample of fresh sugarcane juice was collected and sterilized at 121 °C for 15 minutes. The samples were transported under refrigeration (4°C) to the Biology Laboratory at Universidad Estatal Amazónica, where they were processed in the shortest possible time to minimize microbial alterations, as suggested by [19]. Table 1. Coding of the sugarcane juice samples Code Description CS1 Fresh and sterilized cane juice (negative control) SS1 Sample taken at the beginning of fermentation (Time 0 h) SS2 Sample taken at 48 hours of fermentation (Time +48 h) SS3 Sample taken at 96 hours of fermentation (Time +96 h) 2.3 Isolation of Yeasts Serial dilutions of each sample were performed in sterile distilled water up to 10 - ⁵, taking [20] as a reference. 300 µL of each dilution was seeded in triplicate in Petri dishes with Potato Dextrose Agar (PDA) supplemented with 25 mg/L chloramphenicol to inhibit bacterial growth, using the protocols for yeast isolation described by [14] as a reference. The plates were incubated at 25°C for 72 hours. 2.3.1 Colony Selection and Pure Cultures The colonies developed were selected based on morphological characteristics compatible with yeasts, such as shape, color, margin, and elevation. The colonies presumably corresponding to yeasts were reseeded in PDA supplemented with chloramphenicol to obtain pure cultures, taking as a reference what [21] described. Simple staining with gentian violet was performed for microscopic observation under 1,000x magnification with oil immersion [22]. 2.3.2 Identification of Isolates The initial identification was performed with the API 20C AUX system (bioMérieux®), which allows characterization of yeast species based on their carbohydrate assimilation profile, as reported by [14]. Taxonomic confirmation was performed by sequencing the ITS region of ribosomal DNA, amplified by PCR with primers ITS1 and ITS4 [23]. The amplification products were purified and sequenced using Sanger sequencing [24]. The sequence analysis was performed by comparison with the GenBank® database using the Basic Local Alignment Search Tool (BLAST) algorithm from NCBI. Declarations Conflict of interest: The authors declare no conflict of interest Funding: This research received no external funding. References Abreu-Naranjo, R., Yordi, E. G., Radice, M., Scalvenzi, L. & Pérez-Martínez, A. Preliminary Study Regarding the Optimisation of the Accelerated Ageing of Sugar Cane Spirit by Applying Ultrasound-Assisted Extraction and White Oak Chips (Quercus alba). Food Anal Methods 16, 1120–1130 (2023). Carvajal-Padilla, V. P., Ambuludi-Paredes, R. R., Chele-Yumbo, E. A., Sarduy Pereira, L. B. & Diéguez-Santana, K. Alternativas de producción más limpias para la destilería “Puro Puyo”, Pastaza, Ecuador. I+D Tecnológico 17, 5–13 (2021). GADPPz. Plan de Desarrollo y Ordenamiento Territorial de la Provincia de Pastaza al Año 2025. https://www.pastaza.gob.ec/planificacion/pdot_provincial_actualizacion_2017.pdf (2017). Panimboza-Ojeda, A. P., Soto-Cabrera, A. I., Cuyanquillo-Barrionuevo, J. X., Pérez-Martínez, A. & Diéguez-Santana, K. Propuesta para la producción más limpia en destilerías artesanales. Revista U.D.C.A Actualidad & Divulgación Científica 24, (2021). Steensels, J. & Verstrepen, K. J. Taming Wild Yeast: Potential of Conventional and Nonconventional Yeasts in Industrial Fermentations. Annu Rev Microbiol 68, 61–80 (2014). Portugal, C. B., de Silva, A. P., Bortoletto, A. M. & Alcarde, A. R. How native yeasts may influence the chemical profile of the Brazilian spirit, cachaça? Food Research International 91, 18–25 (2017). Molinet, J. & Cubillos, F. A. Wild Yeast for the Future: Exploring the Use of Wild Strains for Wine and Beer Fermentation. Front Genet 11, (2020). Bruner, J. & Fox, G. Novel Non-Cerevisiae Saccharomyces Yeast Species Used in Beer and Alcoholic Beverage Fermentations. Fermentation 6, 116 (2020). Maicas, S. The Role of Yeasts in Fermentation Processes. Microorganisms 8, 1142 (2020). Zhu, Z. et al. Utilization efficiency of Ehrlich pathway-related amino acid affected higher alcohol acetate production of non-Saccharomyces yeasts during alcoholic fermentation. Food Biosci 61, 104963 (2024). Shi, S., Chen, Y. & Nielsen, J. Metabolic Engineering of Yeast. Annu Rev Biophys 54, 101–120 (2025). Sun, W. et al. Screening and characterization of indigenous non-Saccharomyces cerevisiae with high enzyme activity for kiwifruit wine production. Food Chem 440, 138309 (2024). Ilibay-Granda, C. G., González-Morales, B. D., Muñoz-Ganan, R. D., Sarduy-Pereira, L. B. & Santana, K. D. Estrategia de producción más limpia para la destilería de alcohol artesanal “San Vicente”, Pastaza, Ecuador. BISTUA REVISTA DE LA FACULTAD DE CIENCIAS BASICAS 19, 24–30 (2023). Kurtzman, C. P., Fell, J. W., Boekhout, T. & Robert, V. Methods for Isolation, Phenotypic Characterization and Maintenance of Yeasts. in The Yeasts 87–110 (Elsevier, 2011). doi:10.1016/B978-0-444-52149-1.00007-0. Santos, S. T. dos, Paz, M. F. da & Altemio, Â. D. C. Evaluation of two brazilian native yeast strains (Pichia kudriavzevii) in craft beer. Research, Society and Development 11, e17311124783 (2022). Gschaedler, A. Contribution of non-conventional yeasts in alcoholic beverages. Curr Opin Food Sci 13, 73–77 (2017). Varela, C. The impact of non-Saccharomyces yeasts in the production of alcoholic beverages. Appl Microbiol Biotechnol 100, 9861–9874 (2016). Hernández-Velázquez, R. et al. The future is fermented: Microbial biodiversity of fermented foods is a critical resource for food innovation and human health. Trends Food Sci Technol 150, 104569 (2024). Oenning Da Silva, R., Batistote, M. & Cereda, M. P. Wild strains of fermenting yeast isolated of sugar cane juice from an alcohol distillery from Mato Grosso, Brazil. J. Biotec. Biodivers. v 2, 22–27 (2011). Martins, S. C. S., Vaz, F. L. & Martins, C. M. Isolamento, caracterização e identificação de leveduras killer de caldo de cana de açúcar. Semin Cienc Agrar 36, 3123 (2015). Oliveira, V. A. et al. Biochemical and molecular characterization of Saccharomyces cerevisiae strains obtained from sugar-cane juice fermentations and their impact in Cachaça production. Appl Environ Microbiol 74, 693–701 (2008). Smart, K. A., Chambers, K. M., Lambert, I., Jenkins, C. & Smart, C. A. Use of Methylene Violet Staining Procedures to Determine Yeast Viability and Vitality. Journal of the American Society of Brewing Chemists 57, 18–23 (1999). Manter, D. K. & Vivanco, J. M. Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. J Microbiol Methods 71, 7–14 (2007). Sting, R., Eisenberg, T. & Hrubenja, M. Rapid and reasonable molecular identification of bacteria and fungi in microbiological diagnostics using rapid real-time PCR and Sanger sequencing. J Microbiol Methods 159, 148–156 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8348587","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":567407635,"identity":"e4aedd79-92c4-4870-9d9f-f16a81b889d5","order_by":0,"name":"Marcos David Landívar Valverde","email":"","orcid":"","institution":"Universidad Estatal Amazónica","correspondingAuthor":false,"prefix":"","firstName":"Marcos","middleName":"David Landívar","lastName":"Valverde","suffix":""},{"id":567407636,"identity":"8e681e94-9e4c-4149-8863-31a4239efd84","order_by":1,"name":"Mayra Chiriboga Ruilova","email":"","orcid":"","institution":"Universidad Estatal Amazónica","correspondingAuthor":false,"prefix":"","firstName":"Mayra","middleName":"Chiriboga","lastName":"Ruilova","suffix":""},{"id":567407637,"identity":"4451dfe2-5ea9-4604-9ffd-2a38fc5dfe9e","order_by":2,"name":"Estela Guardado Yordi","email":"","orcid":"","institution":"Universidad Estatal Amazónica","correspondingAuthor":false,"prefix":"","firstName":"Estela","middleName":"Guardado","lastName":"Yordi","suffix":""},{"id":567407638,"identity":"4b5103fc-f999-49b9-bc9c-af1153d2d181","order_by":3,"name":"Amaury Pérez-Martínez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBADOQjFRoIWY9K1JDYQrYV/2tmDjysq6tI3HG9+wPCh7DADP/sB/FokbuclG545w5a74cwxA8YZ5w4zSPYkELDmdo6ZZGMbT+6GGwkGzLxthxkMbhDQIX87x/xn4z+JdIP7zz8w/wVqsSekxQBoC2Njg0GCwQ0eA2ZGkC0SBLQYAv0i2XAswXDmmZyCgz3n0nkkzhDwi9zt3IMfG2rq5PmOH9/44EeZtRx/+wEC1jDwIJgHULnEaBkFo2AUjIJRgBUAAO2XQ+ruRTfQAAAAAElFTkSuQmCC","orcid":"","institution":"Universidad Estatal Amazónica","correspondingAuthor":true,"prefix":"","firstName":"Amaury","middleName":"","lastName":"Pérez-Martínez","suffix":""}],"badges":[],"createdAt":"2025-12-12 19:38:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8348587/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8348587/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99632012,"identity":"c7a2b711-d531-4822-ad64-6ac150266c83","added_by":"auto","created_at":"2026-01-06 16:10:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":442210,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of crystal violet staining between isolate Y01 (A) and isolates Y02 (B) and Y03 (C).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8348587/v1/3f47122e2f02a708bd921598.png"},{"id":99632013,"identity":"9f96b1ad-2ee3-4046-a93e-efeda7504e1e","added_by":"auto","created_at":"2026-01-06 16:10:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":194832,"visible":true,"origin":"","legend":"\u003cp\u003eConsensus sequence of isolate Y01 (\u003cem\u003eP. bruneiensis\u003c/em\u003e).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8348587/v1/0da7746398a58b1a9294d30f.png"},{"id":99631997,"identity":"2bc94bee-fc75-4429-a5f6-6bce4ff5376f","added_by":"auto","created_at":"2026-01-06 16:09:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":51610,"visible":true,"origin":"","legend":"\u003cp\u003eProjected valorization of Amazonian artisanal aguardiente using a native strain as a starter culture.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8348587/v1/4d207152b7b3ad4e210c1cab.png"},{"id":99793838,"identity":"ccd411af-0e14-4c19-82bb-c87e45f3e231","added_by":"auto","created_at":"2026-01-08 13:32:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1421561,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8348587/v1/42d87043-b176-4139-8d49-266b7a8b721d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"First report of Pichia bruneiensis in spontaneous fermentation in sugarcane juice for artisanal liquor (aguardiente) in the Ecuadorian Amazon","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eArtisanal \u003cem\u003eaguardiente\u003c/em\u003e (sugarcane liquor) is a traditional product produced from sugarcane in the Ecuadorian Amazon, particularly in the province of Pastaza [1]. This area contains about 4,500 ha of sugarcane cultivation, equivalent to 55% of the total planted in the Ecuadorian Amazon [2]. In addition, there are about twenty establishments dedicated to the production of artisanal aguardiente [3], which use empirical knowledge passed down through generations.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe artisanal production of Amazonian aguardiente is characterized, from a technical point of view, by a process of spontaneous and uncontrolled fermentation of the sugarcane juice and its subsequent distillation. During fermentation, the sugars present in the cane juice are transformed into ethyl alcohol. For this purpose, the fresh juice is left to stand for approximately five days, allowing the process to occur naturally under the environmental conditions of the region, without the addition of commercial starter cultures [4].\u003c/p\u003e\n\u003cp\u003eThese spontaneous fermentations are fundamental, as they allow the transformation of sugarcane juice into alcohol thanks to a complex microbial community, in which wild yeasts play a central role [5]. These yeasts, which are not domesticated, contribute metabolic diversity and are responsible for generating unique flavor and aroma profiles in the final product [6]. The composition and dynamics of wild yeasts are determined by the origin of the raw material, local practices, and the production environment. They are responsible for contributing the final product’s characteristic sensory profiles. Within this group, \u003cem\u003ePichia\u003c/em\u003e spp. stand out for their ability to adapt to variable conditions and their contribution to the formation of aromatic compounds that can improve the sensory quality of fermented beverages [7].\u003c/p\u003e\n\u003cp\u003eThe use of wild yeasts has now been pushed to the background and, instead, alcohol production relies on the use of highly domesticated yeast strains, mainly \u003cem\u003eSaccharomyces cerevisiae, S. pastorianus,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;S. bayanus [8]\u003c/em\u003e. This situation is typical in large-scale productions, limiting the generation of complex and differentiated sensory profiles provided by the wild yeasts present in spontaneous fermentations. It is interesting to note that alcoholic beverages such as wine, beer, and even distilled beverages such as whiskey or vodka have their origins in spontaneous fermentation processes conducted by native microbiota [9].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSaccharomyces\u003c/em\u003e yeasts, for example, are known to offer technological advantages, such as ease of handling, high fermentation efficiency [10], ethanol tolerance, and predictable metabolic profiles [11]\u0026nbsp; However, several studies have warned that their exclusive use can restrict aromatic diversity, induce undesired sensory homogeneity, and limit the distinctive attributes associated with the microbial terroir (or microbial identity of origin) of fermented beverages [12].\u003c/p\u003e\n\u003cp\u003eIn the Ecuadorian Amazon, the social importance of preserving artisanal productions is recognized, as they help to strengthen cultural identity, the intergenerational transmission of knowledge, community cohesion, and the generation of sustainable livelihoods for local families. This, together with the growing need for less environmental impact and the demand for quality, safety, and sustainability, requires the incorporation of environmental and technical evaluations in traditional agrifood production. Therefore, in the artisanal distilleries of the Ecuadorian Amazon, aguardiente production has been the subject of several studies focused mainly on technical-environmental analyses [13]. This has included waste management, energy efficiency, and environmental impact reduction, as well as technical improvement through cleaner production strategies. These research projects have identified problems such as significant losses of raw material and energy, as well as the absence of systematic operational controls [4].\u003c/p\u003e\n\u003cp\u003eHowever, the spontaneous fermentation stage (a central element in defining the sensory profile and preserving the product’s cultural identity) has not been addressed from a microbiological perspective. This knowledge gap raises the need to study the wild yeasts involved in this process, with a view to their isolation and identification as a basis for future biotechnological applications in native starter cultures. Thus, the purpose of this study was to isolate and identify wild yeasts present in the spontaneous fermentation of sugarcane juice, with a view to their application as native starter cultures.\u0026nbsp;\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eSample Collection, Isolation and Colony Selection and Pure Cultures of Yeasts\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYeast-like colonies were observed in the three samples (SS1, SS2, SS3), indicating the presence of an active microbial community since the onset of fermentation. A reduction in colony morphological diversity was observed at the final stage of the process.\u003c/p\u003e\n\u003cp\u003eThree yeast colony morphotypes (Y01, Y02, Y03) were identified based on macroscopic differences in color, shape, margin, and elevation (Table 2). All morphotypes appeared in SS1 and SS2, while only Y01 remained detectable in SS3 (96 h).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Morphological characterization of the yeast isolates\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"626\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eColony ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMacroscopic Morphology\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMicroscopic Morphology\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eViolet Staining\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSS1 (0 h)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSS2 (48 h)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSS3 (96 h)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003eY01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003eCreamy-white, slightly wrinkled surface, regular border\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003eOvoid cells, multilateral budding, no pseudomycelium\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79px;\"\u003e\n \u003cp\u003eLow\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003eY02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003eOpaque white, rough surface, irregular border\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003eApiculate cells, polar budding, no pseudomycelium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79px;\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003eY03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 142px;\"\u003e\n \u003cp\u003eBright white, moist, well-defined circular border\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 121px;\"\u003e\n \u003cp\u003eEllipsoidal cells, some with pseudomycelium\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79px;\"\u003e\n \u003cp\u003eHigh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 70px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNotes: Affinity to crystal violet staining was classified as high (\u0026ge;80% of cells stained intensely), medium (40\u0026ndash;79%), or low (\u0026lt;40%) by microscopic observation (1,000x). The presence of growth at each time was recorded as \u0026ldquo;+\u0026rdquo; when typical colony formation was observed on solid medium after seeding and incubation at 28\u0026deg;C for 48 h, and as \u0026ldquo;-\u0026rdquo; when no growth was evident.\u003c/p\u003e\n\u003cp\u003eGentian violet staining showed low dye retention in isolate Y01, while isolates Y02 and Y03 displayed high dye retention (Fig. 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIdentification of Isolates by API 20C AUX and Taxonomic Identification with ITS Sequencing\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIsolate Y01 was selected for taxonomic identification due to its persistence and viability at 96 hours. The API 20C AUX test revealed a carbohydrate assimilation profile compatible with members of Pichia spp. Y01 assimilated glucose, fructose, sucrose, cellobiose, trehalose, and showed variable assimilation of maltose and sorbitol (Table 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e Carbohydrate assimilation results from the API 20C AUX assay.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"588\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eN\u0026ordm;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 189px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSubstrate (Carbohydrate)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eIsolate Y01\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ePichia\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003espp.\u003cem\u003e*\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eSaccharomyces cerevisiae*\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eGlycerol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eErythritol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eD-Xylose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eL-Arabinose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eRibose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eD-Glucose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eD-Fructose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eGalactose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e9\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSucrose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eMaltose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e11\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eLactose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e12\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eTrehalose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e13\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eCellobiose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e14\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eInositol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e15\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSorbitol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e16\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eMethyl-\u0026alpha;-D-glucopyranoside\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e17\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eN-Acetyl-glucosamine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e18\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eArbutin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e19\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSalicin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e\u0026plusmn;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 35px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eD-Glucuronate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 100px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 96px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 168px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNotes: \u0026ldquo;+\u0026rdquo; means positive growth/assimilation, \u0026ldquo;\u0026plusmn;\u0026rdquo; means weak/limited assimilation, and \u0026ldquo;-\u0026rdquo; means it does not assimilate substrate.* Reference taken from [14].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe read generated from the ITS1 primer yielded a sequence of 423 base pairs, while the read with the ITS4 primer produced 425 base pairs, with clear signals in all four channels (G, A, T, and C). Both sequences were manually assembled by alignment of their overlapping region, yielding a consensus sequence of 434 bp, which corresponds to the ITS1-5.8S-ITS2 region (Fig. 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis sequence was recorded in FASTA format and compared against the GenBank database using the BLAST tool. The analysis showed a high identity (\u0026ge;99%) with \u003cem\u003eP. bruneiensis\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe results reveal active microbial dynamics during spontaneous sugarcane juice fermentation, where three yeast types were detected at the beginning and middle stages, and only one persisted at the final stage. This behavior reflects a commonly reported pattern in spontaneous fermentations of fruit and sugarcane juice, in which initial diversity declines due to increasing ethanol concentration, oxygen depletion, and nutrient exhaustion [5,14]. The disappearance of isolates Y02 and Y03 at the final stage aligns with observations in other spontaneous fermentation systems [7].\u003c/p\u003e\n\u003cp\u003eThe gentian violet staining results reinforce these dynamics. Yeasts with intact metabolic activity typically exclude or reduce dye retention, while declining or dead cells retain more color [15]. This behavior was seen in Y02 and Y03, whereas Y01 showed low retention and maintained viability up to 96 hours, suggesting greater tolerance to fermentative stress.\u003c/p\u003e\n\u003cp\u003eBLAST analysis confirmed the identity of isolate Y01 as \u003cem\u003eP. bruneiensis\u003c/em\u003e. Although originally isolated from flowers in Borneo [19], this species has been reported in spontaneous fermentation environments such as wine, cider, and some dairy products with probiotic potential [17]. However, this is the first report of its involvement in the spontaneous fermentation of sugarcane juice for artisanal aguardiente production, making this finding novel within the context of Amazonian fermented beverages.\u003c/p\u003e\n\u003cp\u003eSpecies of the genus Pichia are characterized by metabolic versatility, allowing them to assimilate sugars such as glucose, fructose, mannose, and cellobiose [20], as well as by their tolerance to high ethanol levels and osmotic stress [21]. They are also known to contribute to the sensory profile of fermented beverages through production of esters and aromatic compounds [22], and their biofilm-forming ability can influence the fermentation dynamics and the organoleptic properties of the final product [23].\u003c/p\u003e\n\u003cp\u003eSeveral studies describe how Pichia spp. produce secondary metabolites, such as esters, higher alcohols, and organic acids, that significantly impact the aroma and flavor of fermented beverages [24]. Positive effects on sensory quality have been documented in cacha\u0026ccedil;a production [25], and some strains can even reduce undesirable compounds such as higher alcohols or specific volatile esters [26,27]. These traits may be applicable to sugarcane juice fermentation due to similar process conditions.\u003c/p\u003e\n\u003cp\u003eWhat is more, phylogenetically similar species, such as \u003cem\u003ePichia fermentans\u003c/em\u003e, \u003cem\u003eP. kudriavzevii\u003c/em\u003e, and \u003cem\u003eP. kluyver\u003c/em\u003ei, have been widely used to improve the organoleptic properties of wine, beer, and other alcoholic beverages [15]. This potential suggests that \u003cem\u003eP. bruneiensis\u003c/em\u003e could play a similar role in cane juice fermentation and artisanal spirit quality.\u003c/p\u003e\n\u003cp\u003eThe genus Pichia has gained special attention for its metabolic versatility, its ability to tolerate adverse conditions (for instance, high ethanol concentrations and osmotic stress), and its ability to produce aromatic compounds of enological interest such as increased fruit esters (e.g., isoamyl acetate and 2-phenylethyl acetate) and higher alcohols, all relevant in the sensory quality of distilled and fermented beverages (Liu et al., 2024). These characteristics position it as a promising candidate for uncontrolled spontaneous fermentation processes, such as those that occur in the production of artisanal spirits.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStudies such as that of [16] and [17] document the participation of Pichia spp. in the production of spirits such as cacha\u0026ccedil;a, mezcal and tequila, which also stand out for their low methanol production. These attributes make \u003cem\u003eP. bruneiensis\u003c/em\u003e an interesting candidate as a native starter culture adapted to the local conditions of the Ecuadorian Amazon.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe systematic study of microbial communities associated with traditional fermentations is important to conserve functional biodiversity, favor innovation in culturally significant fermented food and drink, and promote food technological sovereignty based on local knowledge [18]. Thus, the isolation for the first time of \u003cem\u003eP. bruneiensis\u0026nbsp;\u003c/em\u003ein spontaneous fermentations of sugarcane juice for the production of artisanal aguardiente is a novel finding, which expands knowledge about the microbial diversity associated with this traditional process and opens the possibility of exploring its use as a native starter culture adapted to the conditions of the Ecuadorian Amazon.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFig. 3 summarizes the strategic benefits derived from the use of an indigenous strain as a starter culture in the spontaneous fermentation of sugarcane juice for artisanal aguardiente. The isolation and identification of \u003cem\u003eP. bruneiensis\u003c/em\u003e represent an advance in our knowledge of native microbiota. Moreover, it opens up concrete possibilities for the preservation of the product\u0026rsquo;s sensory and cultural identity, maintaining the characteristic organoleptic attributes of the Amazonian aguardiente and reinforcing the concept of \u0026ldquo;microbial terroir\u0026rdquo; described in traditional fermentations [12].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFrom an operational point of view, its application as a starter culture is expected to offer technological and process advantages, optimizing fermentation kinetics and reducing variability between batches. These effects translate into improved quality and stability, ensuring chemical and sensory consistency, a key factor for recognition in specialized markets. Likewise, having a well-characterized native starter increases competitiveness and business projection, facilitating access to high-quality niches and supporting protection strategies such as designation of origin. Finally, the use of this microbial resource would expand biotechnological potential, facilitating the development of new distillates, co-fermentations with other yeasts, and the diversification of products based on Amazonian microbial biodiversity.\u003c/p\u003e\n\u003cp\u003eThe potential applications illustrated in Fig. 3 and described above correspond to prospective scenarios that require further evaluation. Within the scope of the present study, the detection of \u003cem\u003ePichia bruneiensis\u003c/em\u003e reinforces the importance of documenting microbial biodiversity associated with traditional fermentation processes developed in small-scale agroindustrial settings in poorly studied regions.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eThis study reports, for the first time, the presence of \u003cem\u003ePichia bruneiensis\u003c/em\u003e in the spontaneous fermentation of sugarcane juice used for the artisanal production of \u003cem\u003eaguardiente\u003c/em\u003e in the Ecuadorian Amazon. Yeasts were isolated at different stages of the fermentation process and identified through morphological analysis, biochemical tests, and ITS sequencing. Sampling throughout fermentation revealed a reduction in yeast diversity, with \u003cem\u003eP. bruneiensis\u0026nbsp;\u003c/em\u003epersisting until the final stage.\u003c/p\u003e\n\u003cp\u003eThis finding expands current knowledge of the microbial biodiversity associated with traditional Amazonian fermentations and provides a baseline for future studies focused on the functional characterization of native yeasts.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHowever, the results are limited to observations obtained under artisanal and spontaneous fermentation conditions, without functional assays or controlled fermentations that would allow the metabolic role or technological potential of the identified species to be established. These limitations highlight the need for further research aimed at the functional characterization of native yeasts involved in artisanal agroindustrial fermentation processes in the Amazon region.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe dataset generated during the current study, consisting of the ITS rDNA sequence of \u003cem\u003ePichia bruneiensis\u003c/em\u003e isolate Y01, has been deposited in the GenBank database (NCBI) under accession number PX741098. The sequence will be publicly available upon release by GenBank or at the time of publication. During peer review, access to the sequence can be provided by the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cstrong\u003e2.1 \u003cem\u003eMaterials\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sugarcane juice samples were collected using sterile flasks (500 mL) at an artisanal aguardiente distillery located in the parish of Teniente Hugo Ortiz, Pastaza Province (Ecuador). The following reagents were used for the culture media: potato dextrose agar (Difco\u0026reg;), chloramphenicol (Ecuaquimica\u0026reg;), sterile distilled water, and gentian violet (Novachem\u0026reg;). For biochemical identification assays, the API 20C AUX commercial system (bioM\u0026eacute;rieux\u0026reg;) was used. DNA sequencing was performed using the Sanger method with primers purchased from Macrogen\u0026reg;, namely ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.2 Sample Collection\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSugarcane juice samples were collected at three stages of the artisanal fermentation process: at the moment when the fresh juice entered the fermentation tank (time 0 h), at 48 hours, and at 96 hours (Table 1). This sampling at different stages was carried out to evaluate the microbial dynamics throughout the spontaneous fermentation, taking as a reference the methodology reported by [19].\u0026nbsp;As a negative control, a sample of fresh sugarcane juice was collected and sterilized at 121 \u0026deg;C for 15 minutes. The samples were transported under refrigeration (4\u0026deg;C) to the Biology Laboratory at Universidad Estatal Amaz\u0026oacute;nica, where they were processed in the shortest possible time to minimize microbial alterations, as suggested by [19].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Coding of the sugarcane juice samples\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCode\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFresh and sterilized cane juice (negative control)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSample taken at the beginning of fermentation (Time 0 h)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSS2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSample taken at 48 hours of fermentation (Time +48 h)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSS3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSample taken at 96 hours of fermentation (Time +96 h)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.3 Isolation of Yeasts\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerial dilutions of each sample were performed in sterile distilled water up to 10\u003csup\u003e-\u003c/sup\u003e⁵, taking\u0026nbsp;[20] as a reference. 300 \u0026micro;L of each dilution was seeded in triplicate in Petri dishes with Potato Dextrose Agar (PDA) supplemented with 25 mg/L chloramphenicol to inhibit bacterial growth, using the protocols for yeast isolation described by \u0026nbsp;[14] as a reference. The plates were incubated at 25\u0026deg;C for 72 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.3.1 Colony Selection and Pure Cultures\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe colonies developed were selected based on morphological characteristics compatible with yeasts, such as shape, color, margin, and elevation. The colonies presumably corresponding to yeasts were reseeded in PDA supplemented with chloramphenicol to obtain pure cultures, taking as a reference what [21]\u0026nbsp;described. Simple staining with gentian violet was performed for microscopic observation under 1,000x magnification with oil immersion [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.3.2 Identification of Isolates\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe initial identification was performed with the API 20C AUX system (bioM\u0026eacute;rieux\u0026reg;), which allows characterization of yeast species based on their carbohydrate assimilation profile, as reported by [14]. Taxonomic confirmation was performed by sequencing the ITS region of ribosomal DNA, amplified by PCR with primers ITS1 and ITS4 [23]. The amplification products were purified and sequenced using Sanger sequencing [24]. The sequence analysis was performed by comparison with the GenBank\u0026reg; database using the Basic Local Alignment Search Tool (BLAST) algorithm from NCBI.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no external funding.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbreu-Naranjo, R., Yordi, E. G., Radice, M., Scalvenzi, L. \u0026amp; P\u0026eacute;rez-Mart\u0026iacute;nez, A. Preliminary Study Regarding the Optimisation of the Accelerated Ageing of Sugar Cane Spirit by Applying Ultrasound-Assisted Extraction and White Oak Chips (Quercus alba). \u003cem\u003eFood Anal Methods\u003c/em\u003e 16, 1120\u0026ndash;1130 (2023).\u003c/li\u003e\n\u003cli\u003eCarvajal-Padilla, V. P., Ambuludi-Paredes, R. R., Chele-Yumbo, E. A., Sarduy Pereira, L. B. \u0026amp; Di\u0026eacute;guez-Santana, K. Alternativas de producci\u0026oacute;n m\u0026aacute;s limpias para la destiler\u0026iacute;a \u0026ldquo;Puro Puyo\u0026rdquo;, Pastaza, Ecuador. \u003cem\u003eI+D Tecnol\u0026oacute;gico\u003c/em\u003e 17, 5\u0026ndash;13 (2021).\u003c/li\u003e\n\u003cli\u003eGADPPz. Plan de Desarrollo y Ordenamiento Territorial de la Provincia de Pastaza al A\u0026ntilde;o 2025. https://www.pastaza.gob.ec/planificacion/pdot_provincial_actualizacion_2017.pdf (2017).\u003c/li\u003e\n\u003cli\u003ePanimboza-Ojeda, A. P., Soto-Cabrera, A. I., Cuyanquillo-Barrionuevo, J. X., P\u0026eacute;rez-Mart\u0026iacute;nez, A. \u0026amp; Di\u0026eacute;guez-Santana, K. Propuesta para la producci\u0026oacute;n m\u0026aacute;s limpia en destiler\u0026iacute;as artesanales. \u003cem\u003eRevista U.D.C.A Actualidad \u0026amp; Divulgaci\u0026oacute;n Cient\u0026iacute;fica\u003c/em\u003e 24, (2021).\u003c/li\u003e\n\u003cli\u003eSteensels, J. \u0026amp; Verstrepen, K. J. Taming Wild Yeast: Potential of Conventional and Nonconventional Yeasts in Industrial Fermentations. \u003cem\u003eAnnu Rev Microbiol\u003c/em\u003e 68, 61\u0026ndash;80 (2014).\u003c/li\u003e\n\u003cli\u003ePortugal, C. B., de Silva, A. P., Bortoletto, A. M. \u0026amp; Alcarde, A. R. How native yeasts may influence the chemical profile of the Brazilian spirit, cacha\u0026ccedil;a? \u003cem\u003eFood Research International\u003c/em\u003e 91, 18\u0026ndash;25 (2017).\u003c/li\u003e\n\u003cli\u003eMolinet, J. \u0026amp; Cubillos, F. A. Wild Yeast for the Future: Exploring the Use of Wild Strains for Wine and Beer Fermentation. \u003cem\u003eFront Genet\u003c/em\u003e 11, (2020).\u003c/li\u003e\n\u003cli\u003eBruner, J. \u0026amp; Fox, G. Novel Non-Cerevisiae Saccharomyces Yeast Species Used in Beer and Alcoholic Beverage Fermentations. \u003cem\u003eFermentation\u003c/em\u003e 6, 116 (2020).\u003c/li\u003e\n\u003cli\u003eMaicas, S. The Role of Yeasts in Fermentation Processes. \u003cem\u003eMicroorganisms\u003c/em\u003e 8, 1142 (2020).\u003c/li\u003e\n\u003cli\u003eZhu, Z. \u003cem\u003eet al.\u003c/em\u003e Utilization efficiency of Ehrlich pathway-related amino acid affected higher alcohol acetate production of non-Saccharomyces yeasts during alcoholic fermentation. \u003cem\u003eFood Biosci\u003c/em\u003e 61, 104963 (2024).\u003c/li\u003e\n\u003cli\u003eShi, S., Chen, Y. \u0026amp; Nielsen, J. Metabolic Engineering of Yeast. \u003cem\u003eAnnu Rev Biophys\u003c/em\u003e 54, 101\u0026ndash;120 (2025).\u003c/li\u003e\n\u003cli\u003eSun, W. \u003cem\u003eet al.\u003c/em\u003e Screening and characterization of indigenous non-Saccharomyces cerevisiae with high enzyme activity for kiwifruit wine production. \u003cem\u003eFood Chem\u003c/em\u003e 440, 138309 (2024).\u003c/li\u003e\n\u003cli\u003eIlibay-Granda, C. G., Gonz\u0026aacute;lez-Morales, B. D., Mu\u0026ntilde;oz-Ganan, R. D., Sarduy-Pereira, L. B. \u0026amp; Santana, K. D. Estrategia de producci\u0026oacute;n m\u0026aacute;s limpia para la destiler\u0026iacute;a de alcohol artesanal \u0026ldquo;San Vicente\u0026rdquo;, Pastaza, Ecuador. \u003cem\u003eBISTUA REVISTA DE LA FACULTAD DE CIENCIAS BASICAS\u003c/em\u003e 19, 24\u0026ndash;30 (2023).\u003c/li\u003e\n\u003cli\u003eKurtzman, C. P., Fell, J. W., Boekhout, T. \u0026amp; Robert, V. Methods for Isolation, Phenotypic Characterization and Maintenance of Yeasts. in \u003cem\u003eThe Yeasts\u003c/em\u003e 87\u0026ndash;110 (Elsevier, 2011). doi:10.1016/B978-0-444-52149-1.00007-0.\u003c/li\u003e\n\u003cli\u003eSantos, S. T. dos, Paz, M. F. da \u0026amp; Altemio, \u0026Acirc;. D. C. Evaluation of two brazilian native yeast strains (Pichia kudriavzevii) in craft beer. \u003cem\u003eResearch, Society and Development\u003c/em\u003e 11, e17311124783 (2022).\u003c/li\u003e\n\u003cli\u003eGschaedler, A. Contribution of non-conventional yeasts in alcoholic beverages. \u003cem\u003eCurr Opin Food Sci\u003c/em\u003e 13, 73\u0026ndash;77 (2017).\u003c/li\u003e\n\u003cli\u003eVarela, C. The impact of non-Saccharomyces yeasts in the production of alcoholic beverages. \u003cem\u003eAppl Microbiol Biotechnol\u003c/em\u003e 100, 9861\u0026ndash;9874 (2016).\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-Vel\u0026aacute;zquez, R. \u003cem\u003eet al.\u003c/em\u003e The future is fermented: Microbial biodiversity of fermented foods is a critical resource for food innovation and human health. \u003cem\u003eTrends Food Sci Technol\u003c/em\u003e 150, 104569 (2024).\u003c/li\u003e\n\u003cli\u003eOenning Da Silva, R., Batistote, M. \u0026amp; Cereda, M. P. Wild strains of fermenting yeast isolated of sugar cane juice from an alcohol distillery from Mato Grosso, Brazil. \u003cem\u003eJ. Biotec. Biodivers. v\u003c/em\u003e 2, 22\u0026ndash;27 (2011).\u003c/li\u003e\n\u003cli\u003eMartins, S. C. S., Vaz, F. L. \u0026amp; Martins, C. M. Isolamento, caracteriza\u0026ccedil;\u0026atilde;o e identifica\u0026ccedil;\u0026atilde;o de leveduras killer de caldo de cana de a\u0026ccedil;\u0026uacute;car. \u003cem\u003eSemin Cienc Agrar\u003c/em\u003e 36, 3123 (2015).\u003c/li\u003e\n\u003cli\u003eOliveira, V. A. \u003cem\u003eet al.\u003c/em\u003e Biochemical and molecular characterization of Saccharomyces cerevisiae strains obtained from sugar-cane juice fermentations and their impact in Cacha\u0026ccedil;a production. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e 74, 693\u0026ndash;701 (2008).\u003c/li\u003e\n\u003cli\u003eSmart, K. A., Chambers, K. M., Lambert, I., Jenkins, C. \u0026amp; Smart, C. A. Use of Methylene Violet Staining Procedures to Determine Yeast Viability and Vitality. \u003cem\u003eJournal of the American Society of Brewing Chemists\u003c/em\u003e 57, 18\u0026ndash;23 (1999).\u003c/li\u003e\n\u003cli\u003eManter, D. K. \u0026amp; Vivanco, J. M. Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. \u003cem\u003eJ Microbiol Methods\u003c/em\u003e 71, 7\u0026ndash;14 (2007).\u003c/li\u003e\n\u003cli\u003eSting, R., Eisenberg, T. \u0026amp; Hrubenja, M. Rapid and reasonable molecular identification of bacteria and fungi in microbiological diagnostics using rapid real-time PCR and Sanger sequencing. \u003cem\u003eJ Microbiol Methods\u003c/em\u003e 159, 148\u0026ndash;156 (2019).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"isolation, yeast, Pichia, native microbiota, artisanal aguardiente","lastPublishedDoi":"10.21203/rs.3.rs-8348587/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8348587/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Native microbiota drives spontaneous fermentation in artisanal aguardiente in the Ecuadorian Amazon, an occurrence that has received little attention from a microbiological perspective. Juice samples were collected at three stages (0, 48, and 96 h), and three yeast morphotypes (Y01, Y02, and Y03) were isolated. A reduction in diversity occurred towards the final phase, where Y01 prevailed. Cell viability, evaluated by gentian violet staining, was higher in Y01, suggesting better adaptation to fermentative stress. Selective culture techniques, biochemical assays, and DNA sequencing were applied, resulting in a ≥99% match with Pichia bruneiensis. This is the first evidence of the species’ participation in these fermentations, providing information on microbial biodiversity in Amazonian aguardiente and Amazonian distillates’ biotechnological potential. The species is ethanol-tolerant and metabolically versatile and can generate differential aromatic compounds, making it a promising native starter culture that could improve the product, reinforce local microbial identity, and support valorization strategies.","manuscriptTitle":"First report of Pichia bruneiensis in spontaneous fermentation in sugarcane juice for artisanal liquor (aguardiente) in the Ecuadorian Amazon","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-06 16:09:35","doi":"10.21203/rs.3.rs-8348587/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"868853c2-8d2c-48af-89ec-d1fc8ef5764b","owner":[],"postedDate":"January 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-06T16:09:35+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-06 16:09:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8348587","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8348587","identity":"rs-8348587","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0