Development and characterization of microsatellite genetic markers for Hyalomma rufipes , a tick vector of Crimean-Congo Hemorrhagic Fever Virus

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 55,706 characters · extracted from preprint-html · click to expand
Development and characterization of microsatellite genetic markers for Hyalomma rufipes , a tick vector of Crimean-Congo Hemorrhagic Fever Virus | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL Ecology and Evolution This is a preprint and has not been peer reviewed. Data may be preliminary. 13 October 2025 V1 Latest version Share on Development and characterization of microsatellite genetic markers for Hyalomma rufipes, a tick vector of Crimean-Congo Hemorrhagic Fever Virus Authors : Hamza Ahmad , Winnifred Aool , Victor Anyango , Teddy Nakayaki , Francis Mulwa , Betty Chelangat , Julius Lutwama 0000-0002-3210-722X , … Show All … , Jonathan Kayondo , Martin Lukindu , James Mutisya , Joel Lutomiah , Lisa Hensley , Lee Cohnstaedt , Maria Onyango , and Corey L Brelsfoard 0000-0003-2030-9040 [email protected] Show Fewer Authors Info & Affiliations https://doi.org/10.22541/au.176035717.72897371/v1 Published Ecology and Evolution Version of record Peer review timeline 262 views 195 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Hyalomma rufipes is a widely distributed tick species and a competent vector of Crimean-Congo Hemorrhagic Fever Virus (CCHFV), a serious zoonotic pathogen endemic to over 30 countries. Despite the epidemiological importance of CCHFV and H. rufipes in East Africa, little is known about the genetic structure and movement of H. rufipes populations, limiting the understanding of CCHFV transmission dynamics in this region. This study developed and characterized 14 polymorphic microsatellite markers to support population genetic studies of H. rufipes . H. rufipes ticks were collected from livestock in Garissa and Isiolo counties in northern Kenya. Morphological identification was confirmed using 16S rRNA Sanger sequencing and phylogenetic analysis. Low-pass whole genome sequencing was performed on representative samples, and the Quality and Diversity of DNA (QDD) pipeline was used to identify and design microsatellite primers. Of 59,201 candidate loci, 30 were selected for initial screening; 14 loci consistently amplified and were polymorphic. These included mostly tetranucleotide repeats and showed high allelic richness and gene diversity. Several loci showed signs of null alleles, but no evidence of stuttering or allelic dropout was found. These newly developed microsatellite markers provide a valuable tool for investigating H. rufipes population dynamics and dispersal, with the ultimate goal of understanding CCHFV transmission dynamics in East Africa. Introduction Ticks are an important vector of viral, bacterial, and protozoan pathogens that affect both human and animal health (Chiuya et al., 2021; Fuente et al., 2008). Crimean-Congo Hemorrhagic Fever Virus (CCHFV) is a prevalent tick-borne virus that affects humans and is endemic in over 30 countries (Al-Abri et al., 2017). The hard tick Hyalomma rufipes is a confirmed vector of CCHFV (Al-Abri et al., 2017, Nasirian 2022; Sang et al., 2011; Addae, 2018; Nabeth et al., 2004; Zeller et al., 1997; Okely et al., 2020; Mancuso et al., 2019). Other pathogens H. rufipes is known to transmit include Rickettsia aeschlimannii and Babesia occultans (Bonnet et al., 2023). H. rufipes is a two-host tick that commonly feeds on cattle, sheep, goats, camels, and horses, while immatures feed on hares and birds (Chen et al., 2012; Walker et al., 2003). H. rufipes is found across Africa, the Middle East, and central Asia, but its range has expanded into Europe by traveling on migratory birds (Chen et al., 2012; Onyiche and MacLeod, 2023; Mwangi et al., 1985; Teel et al., 1988; Bryson et al., 2002; Hove et al., 2008; Tomassone et al., 2012; Hassan et al., 2013; Omondi et al., 2017; Chitmia-Dobler et al., 2019; Grandi et al., 2020; Shuaib et al., 2020; Springer et al., 2020). Travel and animal trade can affect pathogen spread by moving infected animals and animals with tick infestations harboring pathogens such as CCHFV. This is concerning in endemic areas such as in East Africa, as livestock have been found to be heavily infested with ticks in peri-urban areas and are often translocated in the Ugandan-Kenya cattle corridor. (Chiuya et al., 2021; Kilpatrick and Randolph 2012; Mossel et al., 2017; Nyaruaba et al., 2019; Fèvre et al., 2005; Sang et al., 2006; Fèvre et al., 2006). CCHFV infected ticks from the genus Hyalomma collected in Kenya and outbreaks of CCHFV have previously been reported (Chiuya et al., 2021; Dunster et al., 2002). However, little is known about how ticks such as H. rufipes disperse across landscapes or how populations are structured in CCHFV endemic areas of East Africa. Developing microsatellite markers for H. rufipes in this region would provide an important tool for tracking tick movement and population connectivity, and aid in the understanding of CCHFV transmission dynamics. Microsatellite markers are a genetic tool that has been used to elucidate reproductive strategies, dispersal mechanisms, population size and structure of organisms and are widely accepted for use in population genetic studies (Araya-Anchetta et al., 2015; Barbara et al., 2007; Väli et al., 2008). Microsatellite regions are repeats of two to five nucleotides and are codominant and generally highly polymorphic in natural populations (Araya-Anchetta et al., 2015). Microsatellite markers have been successfully characterized for a number of insects and arthropods, including ticks from multiple genera including: Dermacentor, Ixodes, Rhipicephalus and Hyalomma (Shults et al., 2022; Purificacion et al., 2024; Taraveau et al., 2024; Araya-Anchetta et al., 2015; Leo et al., 2012; Dharmarajan et al., 2009a; Van Houtte et al., 2013; Delaye et al., 1998; Røed et al., 2006; Fagerberg et al., 2001; Dharmarajan et al., 2009b; Mccoy and Tirard, 2000; Araya-Anchetta 2012; Chigagure et al., 2000; Cutullé et al., 2009; Koffi et al., 2006; Busch et al., 2014). While microsatellite markers are available for closely related species such as Hyalomma marginatum, no microsatellite makers have been characterized for H. rufipes (Hekimoglu et al., 2019; Hekimoglu et al., 2020). Here we utilized high throughput genome sequencing and the QDD pipeline to locate and characterize microsatellite markers for H. rufipes . The development of microsatellite makers for H. rufipes will ultimately help to inform surveillance strategies, identify high-risk transmission corridors, and support targeted disease and tick control efforts in endemic areas such as East Africa. Materials and Methods Tick Sampling Tick samples (2,335) were collected during the short rainy season between (November and December 2023). Samples were collected from Garissa (E 39.1920841, N 0.7570419) and Isiolo (E39.062222, N 0.926111) (E 39.129444, N 0.86778) in Northern Kenya. Tick samples were passively collected from different predilection sites of livestock including cattle, sheep, camels and goats using sterile forceps. The collected ticks were immersed in a labelled tube with DNA/RNA Shield reagent (Zymo research, CA, USA), and stored in liquid nitrogen for transportation. All collected ticks were transported to the Kenya Medical Research Institute (KEMRI) for morphological identification and further processing. Ticks were sorted on a chilled table under a stereo microscope (Leica M80) and morphologically identified to species level using taxonomic keys (Walker 1974). Twenty six samples from Garissa and Isiolo were identified as H. rufipes and were used to develop and characterize the identified microsatellite regions. DNA Isolation For low-pass whole genome sequencing DNA was extracted from the legs of four H. rufipes females using a DNeasy Blood and Tissue kit (QIAGEN®, Hilden, Germany) following the manufactures instructions with a few modifications. Legs of four adult female ticks were utilized to avoid host contamination since ticks were collected off of their vertebrate host and likely contained host blood. In brief, the modifications to the DNeasy isolation protocol included a 2 minute homogenization step with 2 mm Zirconia bead and a tissue homogenizer (Biospec products), followed by an extension of the tissue lysis incubation period to > 8 hours, and ending with a final elution step consisted of 100 µl of AE buffer. Using the same aforementioned protocol, DNA was also isolated from whole ticks for 16s sequencing to confirm tick species identification genotyping using the identified microsatellite regions. H. rufipes Morphological Identification Confirmation Using 16s Sanger Sequencing Morphological identification was confirmed using PCR and Sanger sequencing using previously published primers for the 16S rRNA gene (16S+1 (5’-CTG CTC AAT GAT TTT TTA AAT TGC TGT GG-3’) and 16S-1 (5’-CCG GTC TGA ACT CAG ATC AAG T-3’)] (Black and Piesman, 1994). PCR conditions consisted of a total reaction volume of 25 µl: 12.5 µl of template mastermix (Taq plus 2x 1.5mM MgCl 2 VWR LifeScience PA), 0.5 µl of forward primer (10 µM), 0.5 µl of reverse primer (10 µM), 1 µl of template DNA and 10.5 µl of molecular grade water. All PCR reactions used the following thermocycler parameters: denaturation at 95°C for 3 minutes, 34 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute. The final extension was set at 72°C for 5 minutes before a 12°C indefinite hold step. PCR amplification was confirmed using a 1.5% agarose gel and 1X TBE with 10 µl of 10,000X gel red in water (EMD Millipore, MA, USA). Successful amplifications were cleaned using ExoSAP-IT (Applied Biosystems, Waltham, MA, USA) and processed for Sanger sequencing by Genewiz (South Plainfield, NJ, USA). A 100% BLAST identification match was used to confirm the species of the tick samples. To examine the evolutionary relationships to other closely related species and to aid in confirming the identity of H. rufipes MEGA version 11 was used to build a phylogenetic tree using a 387 bp sequence of 16s rRNA. The parameters used to build the maximum likelihood tree consisted of the Tamura-Nei model and 10,000 bootstrap replicates (Tamura et al. 2021; Tamura and Nei 1993). Low-pass whole genome sequencing Two replicate samples of consisting of isolated DNA from the legs of four adult female H. rufipes were used for low-pass genome sequencing. DNA quality was checked using a Qubit prior to library preparation. The DNA was enzymatically fragmented and the library prepared using end-repair and A-tailing chemistry. Sequencing was conducted with low-pass whole genome sequencing at Genewiz using the Illumina Hiseq platform with paired end reads with 2x150 bp chemistry. (Azenta Life Sciences, Burlington MA, USA). The sequences were not trimmed since adapter clipping is irrelevant if the sequences are assembled for step one of the QDD pipeline. Microsatellite Region Detection and Primer Design PEAR was used to merge the paired-end reads of the genome into a single input file containing contigs (Zhang et al., 2014). To increase the chances of selecting microsatellite markers with polymorphism, sequences with at least eight repeats were chosen for further analysis (Bagshaw, 2017; Ananda et al., 2013). The QDD pipeline was ran on Linux as the command line version and consisted of three steps from microsatellite repeat region identification to oligonucleotide design and selection. Step one of the pipeline involved parsing the genome for microsatellites based on the QDD default parameters. The default values utilized for step were as follow: flanking region length of 200, minimum sequence length 80, and five as the minimum repeat number for microsatellite detection. Step two eliminated grouped reads, low complexity sequences, and intra-sequence repetitions to remove transposons and minisatellites (Meglécz et al., 2014). Singleton sequences were kept for primer design (Meglécz et al., 2014). Step three consisted of designing the oligonucleotide sequences for microsatellite regions by prioritizing increasing size of PCR product and best microsatellite target (Meglécz et al., 2014). The parameters were set to prioritize microsatellite targets include a pure microsatellite that lacks nanosatellites (three to four repeats of a two to six bp motif) and a lack of homopolymers (a base repeating at least five times). Default primer design parameters for Primer 3 (version 2) were utilized. Additional criteria for primer selection include picking pure microsatellites, design parameter as “A”, and lastly, with as low of a primer 3 penalty score as possible (Meglécz et al., 2014). The criteria for a primer to be designated as “A” is as follows: no homopolymer in the flanking region and primer, no other microsatellite target allowed in the region, no nanosatellites in the primer or flanking region, and the target microsatellite is not allowed to be a compound. Thirty initial loci were identified and the designed primers tested for successful amplification. PCR Conditions and Genotyping To test primer design and to amplify the selected microsatellite regions, PCR consisted of a total reaction volume of 25 µl: 12.5 µl of template mastermix (Taq plus 2x 1.5mM MgCl 2 VWR LifeScience PA), 0.5 µl of forward primer (10 µM), 0.5 µl of reverse primer (10 µM), 1 µl of template DNA and 10.5 µl of molecular grade water are the reagents per reaction. All reactions were singleplexes. All PCR reactions used the following thermocycler parameters: denaturation at 95°C for 3 minutes, 34 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute. The final extension was set at 72°C for 5 minutes before a 12°C indefinite hold step. To confirm amplification, amplicons were run on 1.5% agarose with 1X TBE and 10 µl of 10,000X GelRed in water (EMD Millipore, MA, USA). Loci with single, clear bands were kept for further analysis. Exosap-IT (Thermofisher Scientific, Waltham, MA, USA) was used to purify amplicons for fragment analysis. Fragment analysis performed by Genewiz (Azenta Life Sciences, South Plainfield, NJ, USA) with an ABI 3730 XL DNA Analyzer (Thermofisher Scientific, Waltham, MA, USA). Forward primers were labeled with 5’ ATTO™ 565, 5’ ATTO™ 550, 5’ Yakima Yellow®, and 5’ 6-FAM dyes (Table 1). Peak scanner (Thermofisher Scientific, Waltham, MA, USA) was used to analyze amplicon sizes. Population Genetics Analysis Exact tests for Hardy-Weinburg equilibrium, observed heterozygosity, and expected heterozygosity were calculated with GENEPOP (Rousset, 2008). Fstat was utilized to compute F-statistics, allelic richness, and gene diversity with default Markov chain parameters (Goudet, 2002). Microchecker was used for null allele detection, allelic dropout, and stuttering (Van Ooesterhaut et al., 2004). H. rufipes Morphological Identification Confirmation Using 16s Sanger Sequencing H. rufipes morphological identification was confirmed by sequencing a partial region of the 16s ribosomal gene. Of the five samples collected as part of this study when sequenced all form a distinct clade of H. rufipes with previously sequenced samples on Genbank (KU170517 and KU130464). However, two H. marginatum samples sequenced in previous studies also grouped in the same clade as all of the H. rufipes samples. All other Hyalomma species examined grouped in their own respective and distinct clades (Figure 1). All 16s H. rufipes sequences from this study were deposited on Genbank (accession numbers PX126103-PX126107). Microsatellite characterization By using low pass sequencing of the H. rufipes genome with an Illumina platform, we obtained 5,608,135 reads with a mean read length of 150 bp, corresponding to a 1,682 Mb genomic sequence of the H. rufipes . The raw sequence data are deposited in Genbank (project accession no. PRJNA1306167). Of the total number of reads, 162,635 contained one or more microsatellite loci (3%). Di-nucleotide repeat motifs were the most abundant microsatellites in H. rufipes making up 60% of all microsatellites (Supplementary File 1). Trinucleotide repeats were 18% and tetranucleotide repeats were 20% of all microsatellites (Supplementary File 1 ). Among the 162,635 reads containing a microsatellites primer pairs were designed for 59,201 microsatellite loci. Of these, 30 loci were selected for PCR amplification and to determine rates of polymorphism (Supplementary Table 1). Fourteen of the aforementioned 30 loci were amplified successfully and showed more than two alleles using samples from both the Garissa and Isiolo populations. Twelve out of fourteen loci identified were tetranucleotide repeats with the remaining two loci being a dinucleotide and a trinucleotide repeat (Table 1). Population genetic analysis All fourteen loci in both populations tested were observed to be polymorphic. The average number of alleles for all loci was 15.8 (Table 2). Locus 14 had the lowest allelic richness for both populations at 7.5 for Garissa and 6.1 for Isiolo (Table 2). All other loci had allelic richness higher than ten in both populations (Table 2). The loci tested had observed and expected heterozygosities ranging from 12-17 and 13.1-17.2, respectively (Table 2). Gene diversities were at 0.9 or above for twelve loci in both populations (Table 2). Table 2 shows the values for the global Hardy-Weinburg exact tests with excess heterozygosity. Locus 14 is the only locus with a p-value less than 0.05 in the Isiolo population (Table 2). The FIS values for all loci in both populations were between -0.008 and 0.216 (Table 2) indicating low to moderate levels of inbreeding. Values near zero suggest that most loci are in Hardy-Weinberg equilibrium, while the slightly positive values at some loci point to a mild heterozygote deficiency, which may result from non-random mating, population substructure, or the presence of null alleles. Null alleles were only detected in five loci. The five loci affected by null alleles were Hrms-5, Hrms-6, Hrms-11, Hrms-16, and Hrms 21. The probabilities of null alleles in those loci are 0.1174, 0.1285, 0.0864, 0.089, and 0.0941, respectively. Stuttering and dropout were not detected in any loci. Pairwise FST values between the Garissa and Isiolo populations were uniformly low across all loci (FST < 0.1), indicating minimal genetic differentiation between the two groups. This low level of population structure suggests high gene flow and genetic similarity between the Garissa and Isiolo populations. The overall pairwise FST value for both populations encompassing all loci was 0.0093, suggesting little population differentiation (Table 2). Discussion Here we discuss the development of microsatellite markers for H.rufipes , which may provide a tool for future population genetics research focused on tracking tick movement and gene flow within the Kenyan-Ugandan cattle corridor, with the goal of informing strategies to prevent Crimean-Congo Hemorrhagic Fever Virus (CCHFV) outbreaks. To the best of our knowledge, no genetic markers have previously been characterized or developed for H. rufipes . The 16s sequencing results confirmed the morphological identifications for H. rufipes , and the phylogenetic tree results were consistent with expectations. Specifically, H. rufipes is part of a species complex that includes H. marginatum and H. turanicum (Uiterwijk et al., 2021; Estrada-Peña et al., 2017; Rees et al., 2003). Low-pass Illumina sequencing yielded a large and high-quality genomic dataset for H. rufipes , from which a substantial number of microsatellite loci were identified (>10,000). Most loci exhibited high allelic richness (>10) and high gene diversity values (≥0.9 for twelve loci), suggesting that these markers are informative and suitable for assessing population structure and diversity. Locus 14 stood out with the lowest allelic richness in both populations and was the only locus to deviate significantly from Hardy–Weinberg equilibrium in Isiolo, potentially indicating locus-specific effects such as selection, genotyping error, or population-specific dynamics. Although a large set of primer pairs were designed, the final panel of 14 polymorphic loci demonstrated amplification success and high allelic diversity, making them suitable for population genetic studies. The observation that 12 of these loci were tetranucleotide repeats may reflect their higher stability and lower stutter rates compared to dinucleotides, which is advantageous for genotyping accuracy. Population genetic analyses using the microsatellite markers developed in this study suggest there is a significant level of genetic variation in both the Garissa and Isiolo populations, with a mean allelic richness majority of loci conformed to Hardy–Weinberg expectations, with only locus 14 in Isiolo showing significant deviation, possibly due to sampling effects or a small sampled population. Low to moderate F IS values suggest that inbreeding is minimal in both populations sampled, and the detection of null alleles at only a small subset of loci, without overlap between populations, indicates that genotyping artifacts are unlikely to bias the overall results. Null allele presence is common within Ixodidae (Huber et al., 2019; de Meeûs et al., 2004; Koffi et al., 2006; Noel et al., 2012; Van Houtte et al., 2013). No loci were discarded from the analysis despite some of them having null alleles as all the frequencies were less than 15% (Van Oosten et al., 2014). The only loci with null alleles present, were five, six, eleven, sixteen, and twenty-one. The null allele frequencies for these loci were approximately 12%, 13%, and 9% for locus eleven, sixteen, and twenty-one, respectively. Null alleles were only detected within either Garissa or Isiolo populations, no locus had them in both populations. Locus 14 was the only locus with a p-value of less than 0.05 suggesting it is not in Hardy-Weinburg equilibrium (Table 2). The observed low F ST values across loci, coupled with an overall F ST of 0.0093, indicate minimal population differentiation between Garissa and Isiolo, which are separated by approximately 250 km. Overall, the low levels of observed population differentiation and structure suggests there is gene flow between these geographically distinct sites, which could be driven by livestock movement within the Kenyan Ugandan cattle corridor, a well-documented route for both animal and vector dispersal (Chiuya et al., 2021; Kilpatrick and Randolph, 2012; Mossel et al., 2017; Nyaruaba et al., 2019). Genetic connectivity associated with potential tick movement has important epidemiological implications, as this could facilitate the spread and transmission of potential tick-borne pathogens such as Crimean-Congo Hemorrhagic Fever Virus (CCHFV). However, the sampling and genotyping of additional populations would be needed to further validate the hypothesis that tick movement and population connectivity is common in the Kenyan Ugandan cattle corridor. Overall, these results demonstrate that the developed microsatellite panel is an important tool for assessing H. rufipes population structure. The high genetic diversity and low differentiation observed, suggests that control measures targeting tick populations and/or disease control in one location are unlikely to be effective without considering regional-scale livestock movement and tick dispersal and migration. Future studies incorporating broader geographic sampling and temporal monitoring will be essential to better understand the connectivity patterns of H. rufipes and their implications for tick-borne disease spread in East Africa. Table 1: Microsatellite primer sequences, repeat motif and count, product size range, and annealing temperature for the 14 polymorphic microsatellite loci select for H. rufipes. Hrms-4 1 ACATCAGCAACACAACGCAC GGAGCCTACATAATGCGCCT ((AAAC) 13 168-344 55° C Hrms-5 2 TTACGCTCACAGTGACACCC ATCGCGTGGCTACCTATGTG ((AGAT) 21 220-392 55° C Hrms-6 1 AAGCGATGGCAGTGTCGTTA AACGTGACGCAGCAAGTTTC ((AGAT) 10 212-360 55° C Hrms-7 3 GGTCGTGTCAGCCAACCATA GCCGTCAAACAAGGTGTCAC ((AGAT) 13 160-220 55° C Hrms-8 4 CGCCAACATCAGCAACACAA AGGAGCCTACATAATGCGCC ((AAAC) 13 160-280 55° C Hrms-9 2 CAGCCGAGTACGATGTCCTC TGACACCAGTGGCGGTATTC ((AGAT) 11 196-352 55° C Hrms-10 3 AACGGTGAGATGCATGGGTT GCAAGTTTCAACGAACGCCT ((AGAT) 9 180-328 55° C Hrms-11 1 ATAGCGCACAGTACTCGAGC AAAGCGGTGGATGCCTGTTA ((AAT) 13 141-345 55° C Hrms-13 4 TCTAGCAGGGCTCAGGCTAA ACCATTCGACCCTGCTTGAG ((AAAG) 8 136-244 55° C Hrms-14 3 ATGGCTGTAGCGATGGTACG ACAACAGCTCCATTCTCCGG ((AG) 9 112-150 55° C Hrms-16 2 GCGCCCTTCTCCTAACCTTT CGAACCCACCTTCTTCGACA ((AAAT) 13 168-272 55° C Hrms-21 4 AAGCGGAGTTCCCTAACACG TAAGCTCGAACACGCTGGTT ((AAAG) 8 140-220 55° C Hrms-24 2 AAGCGGAGTTCCCTAACACG GCAGTGGTATATCGCTGGCT ((AAAG) 8 160-256 55° C Hrms-28 4 GGTCGTGTCAGCCAACCATA GGGTTAACCGGTGTGGCATA ((AGAT) 13 160-260 55° C Primer sequences of all microsatellite loci. 1 is 5’ ATTO™ 565, 2 is ATTO™ 550, 3 is Yakima Yellow, 4 is 5’ 6-FAM. Forward primers were labeled with these dyes. Table 2: Characterization of 14 microsatellite loci for H. rufipes from Garissa and Isiolo populations in Kenya. N N all H e H o F IS A rich G D F ST Garissa vs Isiolo HW Hrms-4 18 16 16.9 16 0.052 14.4 0.94 0.005 0.85 Hrms-5 18 15 15.8 14 0.115 13.7 0.93 -0.008 0.97 Hrms-6 18 14 16.6 12 0.283 12.7 0.93 0.089 0.99 Hrms-7 18 15 16.9 17 -0.007 13.7 0.94 0.004 0.44 Hrms-8 18 15 15.7 14 0.111 13.9 0.93 0.016 0.98 Hrms-9 18 17 16.2 15 0.075 15.6 0.95 -0.001 0.95 Hrms-10 18 16 16 14 0.128 14.7 0.95 0.004 0.89 Hrms-11 16 17 14.9 13 0.131 15.7 0.94 0.006 0.97 Hrms-13 18 21 17.3 17 0.017 18.1 0.96 -0.006 0.68 Hrms-14 18 8 13.9 14 -0.008 7.5 0.77 0.005 0.45 Hrms-16 18 13 14.6 14 0.045 12.2 0.92 0.001 0.64 Hrms-21 18 15 16.5 13 0.216 13.3 0.92 0.011 1.0 Hrms-24 17 15 15.1 15 0.009 14.3 0.95 0.012 0.86 Hrms-28 18 12 15.8 16 -0.016 11.4 0.93 -0.006 0.49 Total 17.79 14.93 15.9 14.57 0.08 13.7 0.93 0.0093 0.80 Isiolo Hrms-4 17 20 16.4 15 0.086 18.0 0.97 - 0.90 Hrms-5 17 17 16.1 12 0.262 15.5 0.96 - 1.0 Hrms-6 17 13 12.2 13 -0.067 11.4 0.72 - 0.28 Hrms-7 17 16 15.5 14 0.102 14.6 0.92 - 0.97 Hrms-8 18 18 17.1 15 0.128 16.0 0.96 - 0.98 Hrms-9 18 21 16.5 15 0.094 18.9 0.97 - 1.0 Hrms-10 18 20 16.2 16 0.01 17.6 0.95 - 0.85 Hrms-11 17 18 16.2 13 0.203 16.3 0.96 - 1.0 Hrms-13 18 19 17.1 17 0.007 16.4 0.95 - 0.76 Hrms-14 18 7 12.0 17 -0.431 6.1 0.66 - 0.0004 Hrms-16 18 16 15.2 12 0.214 15.2 0.95 - 1.0 Hrms-21 18 18 16.6 16 0.035 15.2 0.92 - 0.73 Hrms-24 16 15 13.2 12 0.093 15.0 0.95 - 0.64 Hrms-28 18 16 16.7 16 0.046 14.6 0.93 - 0.89 Total 17.5 16.7 15.5 14.5 0.0559 15.0 0.91 - 0.79 N all is the number of alleles, H e is the expected heterozygosity, H o is the observed heterozygosity, F IS is the inbreeding coefficient, A rich is the allelic richness which measures number of alleles independent of sample size and G D is gene diversity. HW are p-values from the Hardy-Weinburg exact tests for excess heterozygosity. not-yet-known not-yet-known not-yet-known unknown Figure 1 Figure captions Figure 1. Maximum-likelihood phylogenetic tree based on a segment of the16S gene for the H. rufipes identified in this study. Bootstrap values are shown next to nodes on the tree. The scale bar at the bottom of the figure shows the evolutionary distance. The H. rufipes 16s sequences from this study are indicated by the orange shading. The tick Rhipicephalus microplus was used as an outgroup for the tree. Genebank accession numbers are listed before the genus and species names in the tree. References Addae, C. A. 2018. “Detection of Crimean-Congo Haemorrhagic Fever Virus (CCHFV) in Ticks Collected from Livestock in Ghana.” Thesis, University of Ghana. https://ugspace.ug.edu.gh/home. Al-Abri, Seif S., Idris Al Abaidani, Mehdi Fazlalipour, Ehsan Mostafavi, Hakan Leblebicioglu, Natalia Pshenichnaya, Ziad A. Memish, et al. 2017. “Current Status of Crimean-Congo Haemorrhagic Fever in the World Health Organization Eastern Mediterranean Region: Issues, Challenges, and Future Directions.” International Journal of Infectious Diseases 58, no. May (May): 82–89. https://doi.org/10.1016/j.ijid.2017.02.018. Ananda, Guruprasad, Erin Walsh, Kimberly D. Jacob, Maria Krasilnikova, Kristin A. Eckert, Francesca Chiaromonte, and Kateryna D. Makova. 2013. “Distinct Mutational Behaviors Differentiate Short Tandem Repeats from Microsatellites in the Human Genome.” Genome Biology and Evolution 5, no. 3 (March): 606–20. https://doi.org/10.1093/gbe/evs116. Araya-Anchetta, Ana. 2012. “A Study of Macro and Micro-Evolutionary Factors Determining Population Genetics in Ticks.” Dissertation, Flagstaff: Northern Arizona University. Araya-Anchetta, Ana, Joseph D. Busch, Glen A. Scoles, and David M. Wagner. 2015. “Thirty Years of Tick Population Genetics: A Comprehensive Review.” Infection, Genetics and Evolution 29, no. January (January): 164–79. https://doi.org/10.1016/j.meegid.2014.11.008. Bagshaw, Andrew T.M. 2017. “Functional Mechanisms of Microsatellite DNA in Eukaryotic Genomes.” Genome Biology and Evolution 9, no. 9 (September): 2428–43. https://doi.org/10.1093/gbe/evx164. Barbará, Thelma, Clarisse Palma-Silva, Gecele M. Paggi, Fernanda Bered, Michael F. Fay, and Christian Lexer. 2007. “Cross-Species Transfer of Nuclear Microsatellite Markers: Potential and Limitations.” Molecular Ecology 16, no. 18: 3759–67. https://doi.org/10.1111/j.1365-294X.2007.03439.x. Black, W C, and J Piesman. 1994. “Phylogeny of Hard- and Soft-Tick Taxa (Acari: Ixodida) Based on Mitochondrial 16S rDNA Sequences.” Proceedings of the National Academy of Sciences of the United States of America 91, no. 21 (October): 10034–38. https://doi.org/10.1073/pnas.91.21.10034. Bonnet, Sarah I., Stéphane Bertagnoli, Alessandra Falchi, Julie Figoni, Johanna Fite, Thierry Hoch, Elsa Quillery, et al. 2023. “An Update of Evidence for Pathogen Transmission by Ticks of the Genus Hyalomma .” Pathogens 12, no. 4 (March): 513. https://doi.org/10.3390/pathogens12040513. Bryson, N. R., G. A. Tice, I. G. Horak, C. G. Stewart, and B. A. J. du Plessis. 2002. “Ixodid Ticks on Indigenous Goats Owned by Small-Scale Farmers in Four Communal Grazing Areas in South Africa.” Journal of the South African Veterinary Association 73, no. 1 (July): 26–30. https://doi.org/10.4102/jsava.v73i1.544. Busch, Joseph D., Nathan E. Stone, Roxanne Nottingham, Ana Araya-Anchetta, Jillian Lewis, Christian Hochhalter, John R. Giles, et al. 2014. “Widespread Movement of Invasive Cattle Fever Ticks ( Rhipicephalus microplus ) in Southern Texas Leads to Shared Local Infestations on Cattle and Deer.” Parasites & Vectors 7, no. 1 (April): 188. https://doi.org/10.1186/1756-3305-7-188. Chen, Ze, Youquan Li, Zhijie Liu, Jifei Yang, and Hong Yin. 2012. “The Life Cycle of Hyalomma rufipes (Acari: Ixodidae) under Laboratory Conditions.” Experimental and Applied Acarology 56, no. 1 (January): 85–92. https://doi.org/10.1007/s10493-011-9490-0. Chigagure, Noel N., Glenn D. Baxter, and Stephen C. Barker. 2000. “Microsatellite Loci of the Cattle Tick Boophilus microplus (Acari: Ixodidae).” Experimental & Applied Acarology 24, no. 12 (December): 951–56. https://doi.org/10.1023/A:1010732024895. Chitimia-Dobler, Lidia, Sabine Schaper, Ramona Rieß, Karin Bitterwolf, Dimitrios Frangoulidis, Malena Bestehorn, Andrea Springer et al. 2019.”Imported Hyalomma ticks in Germany in 2018.” Parasites & vectors 12, 134. Chiuya, Tatenda, Daniel K. Masiga, Laura C. Falzon, Armanda D. S. Bastos, Eric M. Fèvre, and Jandouwe Villinger. 2021. “Tick-Borne Pathogens, Including Crimean-Congo Haemorrhagic Fever Virus, at Livestock Markets and Slaughterhouses in Western Kenya.” Transboundary and Emerging Diseases 68, no. 4 (July): 2429–45. https://doi.org/10.1111/tbed.13911. Cutullé, C., N. N. Jonsson, and J. Seddon. 2009. “Population Structure of Australian Isolates of the Cattle Tick Rhipicephalus ( Boophilus ) microplus .” Veterinary Parasitology 161, no. 3–4: 283–91. https://doi.org/10.1016/j.vetpar.2009.01.005. De Meeûs, Thierry, Pierre-François Humair, Christoph Grunau, Christelle Delaye, and François Renaud. 2004. “Non-Mendelian Transmission of Alleles at Microsatellite Loci: An Example in Ixodes ricinus , the Vector of Lyme Disease.” International Journal for Parasitology 34, no. 8 (July): 943–50. https://doi.org/10.1016/j.ijpara.2004.04.006. Delaye, C., A. Aeschlimann, F. Renaud, B. Rosenthal, and T. De Meeûs. 1998. “Isolation and Characterization of Microsatellite Markers in the Ixodes ricinus Complex (Acari: Ixodidae).” Molecular Ecology 7, no. 3 (March): 360–61. Dharmarajan, Guha, Jennifer A. Fike, James C. Beasley, and Olin E. Rhodes Jr. 2009a. “Development and Characterization of 12 Polymorphic Microsatellite Loci in the American Dog Tick ( Dermacentor variabilis ).” Molecular Ecology Resources 9, no. 1: 131–33. https://doi.org/10.1111/j.1755-0998.2008.02313.x. Dharmarajan, Guha, Jennifer A. Fike, James C. Beasley, and Olin E. Rhodes Jr. 2009b. “Development and Characterization of 14 Polymorphic Microsatellite Loci in the Raccoon Tick ( Ixodes texanus ).” Molecular Ecology Resources 9, no. 1: 296–98. https://doi.org/10.1111/j.1755-0998.2008.02314.x. Dunster, Lee, Manuela Dunster, Victor Ofula, Dunston Beti, Femke Kazooba-Voskamp, Felicity Burt, Robert Swanepoel, and Kevin M. DeCock. 2002. “First Documentation of Human Crimean-Congo Hemorrhagic Fever, Kenya.” Emerging Infectious Diseases 8, no. 9 (September): 1005–6. https://doi.org/10.3201/eid0809.010510. Estrada-Peña, Agustín, Miriam Pfäffle, Gad Baneth, Gabriela Kleinerman, and Trevor N. Petney. 2017. “Ixodoidea of the Western Palaearctic: A Review of Available Literature for Identification of Species.” Ticks and Tick-Borne Diseases 8, no. 4 (June): 512–25. https://doi.org/10.1016/j.ttbdis.2017.02.013. Fagerberg, A. J., R. E. Fulton, and W. C. Black Iv. 2001. “Microsatellite Loci Are Not Abundant in All Arthropod Genomes: Analyses in the Hard Tick, Ixodes scapularis and the Yellow Fever Mosquito, Aedes aegypti .” Insect Molecular Biology 10, no. 3: 225–36. https://doi.org/10.1046/j.1365-2583.2001.00260.x. Fèvre, E. M., K. Picozzi, J. Fyfe, C. Waiswa, M. Odiit, P. G. Coleman, and S. C. Welburn. 2005. “A Burgeoning Epidemic of Sleeping Sickness in Uganda.” The Lancet 366, no. 9487 (August): 745–47. https://doi.org/10.1016/S0140-6736(05)67179-6. Fèvre, Eric M., Barend M. de C. Bronsvoort, Katie A. Hamilton, and Sarah Cleaveland. 2006. “Animal Movements and the Spread of Infectious Diseases.” Trends in Microbiology 14, no. 3 (March): 125–31. https://doi.org/10.1016/j.tim.2006.01.004. Fuente, Jose de la, Katherine M. Kocan, Consuelo Almazan, and Edmour F. Blouin. 2008. “Targeting the Tick-Pathogen Interface for Novel Control Strategies.” Frontiers in Bioscience-Landmark 13, no. 18 (May): 6947–56. https://doi.org/10.2741/3201. Goudet, Jerome. 2002. “FSTAT, a Program to Estimate and Test Gene Diversities and Fixation Indices, Version 2.9.3.2.” Availible from: http://www2.unil.ch/popgen/softwares/fstat.htm. Grandi, G., Chitimia-Dobler, L., Choklikitumnuey, P., Strube, C., Springer, A., Albihn, A., … & Omazic, A. (2020). “First records of adult Hyalomma marginatum and H. rufipes ticks (Acari: Ixodidae) in Sweden”. Ticks and tick-borne diseases , 11 (3), 101403. Hassan, Ahmed Abdulkadir, Abdalla Mohamed Ibrahim, Rabab Haroon Mohamed, and Hussein Haji Aden. 2013. “Preliminary Assessment of Goat Piroplasmosis in Benadir Region, Somalia.” Open Journal of Veterinary Medicine 3, no. October (October): 273–76. https://doi.org/10.4236/ojvm.2013.36044. Hekimoglu, Olcay, Ibrahim Baris, and Nurdan Ozer. 2019. “Development and Characterization of Five Microsatellite Loci for the Hard Tick Hyalomma marginatum (Acari: Ixodidae), through next-Generation Sequencing.” Systematic and Applied Acarology , November (November), 1988–94. https://doi.org/10.11158/saa.24.11.2. Hekimoglu, Olcay, Arda Cem Kuyucu, and Nurdan Ozer. 2020. “Preliminary Investigation on the Genetic Diversity and Population Structure of Hyalomma marginatum (Acari: Ixodidae) in Turkey.” Systematic and Applied Acarology 25, no. 10 (October): 1867–82. https://doi.org/10.11158/saa.25.10.10. Hove, T., R. Mukandi, M. Bere, I. G. Horak, and A. A. Latif. 2008. “Ixodid Ticks Infesting Domestic Goats in Communal Land Areas of Zimbabwe.” Journal of the South African Veterinary Association 79, no. 3 (May): 116–20. https://doi.org/10.4102/jsava.v79i3.257. Huber, K., S. Jacquet, R. Rivallan, H. Adakal, N. Vachiery, A. M. Risterucci, and C. Chevillon. 2019. “Low Effective Population Sizes in Amblyomma variegatum, the Tropical Bont Tick.” Ticks and Tick-Borne Diseases 10, no. 1: 93–99. https://doi.org/10.1016/j.ttbdis.2018.08.019. Kilpatrick, A. Marm, and Sarah E. Randolph. 2012. “Drivers, Dynamics, and Control of Emerging Vector-Borne Zoonotic Diseases.” The Lancet 380, no. 9857 (December): 1946–55. https://doi.org/10.1016/S0140-6736(12)61151-9. Koffi, Brou Basile, Ange Marie Risterucci, Dominique Joulia, Patrick Durand, Nicolas Barré, Thierry De Meeûs, and Christine Chevillon. 2006. “Characterization of Polymorphic Microsatellite Loci within a Young Boophilus microplus Metapopulation.” Molecular Ecology Notes 6, no. 2: 502–4. https://doi.org/10.1111/j.1471-8286.2006.01295.x. Leo, S. S. T., C. S. Davis, and F. A. H. Sperling. 2012. “Characterization of 14 Microsatellite Loci Developed for Dermacentor albipictus and Cross-Species Amplification in D. andersoni and D. variabilis (Acari: Ixodidae).” Conservation Genetics Resources 4, no. 2 (June): 379–82. https://doi.org/10.1007/s12686-011-9553-x. Mancuso, Elisa, Luciano Toma, Andrea Polci, Silvio G. d’Alessio, Marco Di Luca, Massimiliano Orsini, Marco Di Domenico, et al. 2019. “Crimean-Congo Hemorrhagic Fever Virus Genome in Tick from Migratory Bird, Italy.” Emerging Infectious Diseases 25, no. 7: 1418–20. https://doi.org/10.3201/eid2507.181345. Mccoy, Karen D., and Claire Tirard. 2000. “Isolation and Characterization of Microsatellites in the Seabird Ectoparasite Ixodes uriae .” Molecular Ecology 9, no. 12: 2212–13. https://doi.org/10.1046/j.1365-294X.2000.105330.x. Meglécz, Emese, Nicolas Pech, André Gilles, Vincent Dubut, Pascal Hingamp, Aurélie Trilles, Rémi Grenier, and Jean-François Martin. 2014. “QDD Version 3.1: A User-Friendly Computer Program for Microsatellite Selection and Primer Design Revisited: Experimental Validation of Variables Determining Genotyping Success Rate.” Molecular Ecology Resources 14, no. 6: 1302–13. https://doi.org/10.1111/1755-0998.12271. Mossel, Eric C., Mary B. Crabtree, John-Paul Mutebi, Julius J. Lutwama, Erin M. Borland, Ann M. Powers, and Barry R. Miller. 2017. “Arboviruses Isolated From Mosquitoes Collected in Uganda, 2008–2012.” Journal of Medical Entomology 54, no. 5 (September): 1403–9. https://doi.org/10.1093/jme/tjx120. Mwangi, E. N., P. D. Sayer, J. C. Njanja, and J. F. Bell. 1985. “Tick Survey on Goats and Sheep in Kenya.” Tropical Animal Health and Production 17, no. 2 (June): 102–6. https://doi.org/10.1007/BF02360782. Nabeth, Pierre, Dah Ould Cheikh, Baidy Lo, Ousmane Faye, Idoumou Ould Mohamed Vall, Mbayame Niang, Bocar Wague, et al. 2004. “Crimean-Congo Hemorrhagic Fever, Mauritania.” Emerging Infectious Diseases 10, no. 12: 2143–49. https://doi.org/10.3201/eid1012.040535. Nasirian, Hassan. 2022. “Ticks Infected with Crimean-Congo Hemorrhagic Fever Virus (CCHFV): A Decision Approach Systematic Review and Meta-Analysis Regarding Their Role as Vectors.” Travel Medicine and Infectious Disease 47: 102309. https://doi.org/10.1016/j.tmaid.2022.102309. Noel, V., E. Leger, E. Gomez-Diaz, A.-M. Risterucci, and K. D. McCoy. 2012. “Isolation and Characterization of New Polymorphic Microsatellite Markers for the Tick Ixodes ricinus (Acari, Ixodidae).” Acarologia 52, no. 2 (June): 123–28. https://doi.org/10.1051/acarologia/20122041. Nyaruaba, Raphael, Mwaliko,Caroline, Mwau,Matilu, Mousa,Samar, and Hongping and Wei. 2019. “Arboviruses in the East African Community Partner States: A Review of Medically Important Mosquito-Borne Arboviruses.” Pathogens and Global Health 113, no. 5 (July): 209–28. https://doi.org/10.1080/20477724.2019.1678939. Okely, Mohammed, Rabia Anan, Sohair Gad-Allah, and Abdallah M. Samy. 2020. “Mapping the Environmental Suitability of Etiological Agent and Tick Vectors of Crimean-Congo Hemorrhagic Fever.” Acta Tropica 203: 105319. https://doi.org/10.1016/j.actatropica.2019.105319. Omondi, David, Daniel K. Masiga, Burtram C. Fielding, Edward Kariuki, Yvonne Ukamaka Ajamma, Micky M. Mwamuye, Daniel O. Ouso, and Jandouwe Villinger. 2017. “Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya.” Frontiers in Veterinary Science 4. https://doi.org/10.3389/fvets.2017.00073. Onyiche, ThankGod E., and Ewan Thomas MacLeod. 2023. “Hard Ticks (Acari: Ixodidae) and Tick-Borne Diseases of Sheep and Goats in Africa: A Review.” Ticks and Tick-Borne Diseases 14, no. 6 (November): 102232. https://doi.org/10.1016/j.ttbdis.2023.102232. Purificacion, Marynold, Roslina Binti Mohd Shah, Thierry De Meeûs, Saripah Binti Bakar, Anisah Bintil Savantil, Meriam Mohd Yusof, Divina Amalin, et al. 2024. “Development and Characterization of Microsatellite Markers for Population Genetics of the Cocoa Pod Borer Conopomorpha cramerella (Snellen) (Lepidoptera: Gracillaridae).” PLOS ONE 19, no. 4 (April): e0297662. https://doi.org/10.1371/journal.pone.0297662. Rees, David J, Maurizio Dioli, and Lawrence R Kirkendall. 2003. “Molecules and Morphology: Evidence for Cryptic Hybridization in African Hyalomma (Acari: Ixodidae).” Molecular Phylogenetics and Evolution 27, no. 1 (April): 131–42. https://doi.org/10.1016/S1055-7903(02)00374-3. Røed, Knut H., Gunnar Hasle, V. Midthjell, Grethe Skretting, and Hans P. Leinaas. 2006. “Identification and Characterization of 17 Microsatellite Primers for the Tick, Ixodes ricinus , Using Enriched Genomic Libraries.” Molecular Ecology Notes 6, no. 4: 1165–67. https://doi.org/10.1111/j.1471-8286.2006.01475.x. Rousset, François. 2008. “Genepop’007: A Complete Re-Implementation of the Genepop Software for Windows and Linux.” Molecular Ecology Resources 8, no. 1: 103–6. https://doi.org/10.1111/j.1471-8286.2007.01931.x. Sang, Rosemary, Joel Lutomiah, Hellen Koka, Albina Makio, Edith Chepkorir, Caroline Ochieng, Santos Yalwala, et al. 2011. “Crimean-Congo Hemorrhagic Fever Virus in Hyalommid Ticks, Northeastern Kenya.” Emerging Infectious Diseases 17, no. 8: 1502–5. https://doi.org/10.3201/eid1708.102064. Sang, Rosemary, Clayton Onyango, John Gachoya, Ernest Mabinda, Samson Konongoi, Victor Ofula, Lee Dunster, et al. 2006. “Tickborne Arbovirus Surveillance in Market Livestock, Nairobi, Kenya.” Emerging Infectious Diseases 12, no. 7 (July): 1074–80. https://doi.org/10.3201/eid1207.060253. Shuaib, Yassir Adam, Ahmed Muhammed-Ahmed Wd Elhag, Yassir Abakar Brima, Mohamed Abdalsalam Abdalla, Amel Omer Bakiet, Saad El-Tiab Mohmed-Noor, Giulia Lemhöfer, et al. 2020. “Ixodid Tick Species and Two Tick-Borne Pathogens in Three Areas in the Sudan.” Parasitology Research 119, no. 2 (February): 385–94. https://doi.org/10.1007/s00436-019-06458-9. Shults, Phillip, Megan Moran, Alexander J. Blumenfeld, Edward L. Vargo, Lee W. Cohnstaedt, and Pierre-Andre Eyer. 2022. “Development of Microsatellite Markers for Population Genetics of Biting Midges and a Potential Tool for Species Identification of Culicoides sonorensis Wirth & Jones.” Parasites & Vectors 15, no. 1 (March): 69. https://doi.org/10.1186/s13071-022-05189-8. Springer, Andrea, Yassir Adam Shuaib, Makarim Habib Isaa, Malaz Isam-Eldin Ezz-Eldin, Abdinasir Yusuf Osman, Idris Ahmed Yagoub, Mohamed Abdalsalam Abdalla, et al. 2020. “Tick Fauna and Associated Rickettsia , Theileria , and Babesia Spp. in Domestic Animals in Sudan (North Kordofan and Kassala States).” Microorganisms 8, no. 12. https://doi.org/10.3390/microorganisms8121969. Tamura, Koichiro, and Masatoshi Nei. 1993. “Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees.” Molecular Biology and Evolution 10, no. 3: 512–26. https://doi.org/10.1093/oxfordjournals.molbev.a040023. Tamura, Koichiro, Glen Stecher, and Sudhir Kumar. 2021. “MEGA11: Molecular Evolutionary Genetics Analysis Version 11.” Edited by Fabia Ursula Battistuzzi. Molecular Biology and Evolution 38, no. 7 (July): 3022–27. https://doi.org/10.1093/molbev/msab120. Taraveau, Florian, David Bru, Carlos João Quembo, and Hélène Jourdan-Pineau. 2024. “Development of Microsatellite Markers for the Soft Tick Ornithodoros phacochoerus .” Parasites & Vectors 17, no. 1 (July): 301. https://doi.org/10.1186/s13071-024-06382-7. Teel, P. D., D. E. Bay, and P. A. Ajidagba. 1988. “Ecology, Distribution and Host Relationships of Ticks (Acari: Ixodidae) Infesting Livestock in Mali.” Bulletin of Entomological Research 78, no. 3 (September): 407–24. https://doi.org/10.1017/S0007485300013183. Tomassone, Laura, E. Grego, G. Callà, P. Rodighiero, G. Pressi, S. Gebre, B. Zeleke, and D. De Meneghi. 2012. “Ticks and Tick-Borne Pathogens in Livestock from Nomadic Herds in the Somali Region, Ethiopia.” Experimental and Applied Acarology 56, no. 4 (April): 391–401. https://doi.org/10.1007/s10493-012-9528-y. Uiterwijk, Mathilde, Adolfo Ibáñez-Justicia, Bart van de Vossenberg, Frans Jacobs, Paul Overgaauw, Rolf Nijsse, Charlotte Dabekaussen, Arjan Stroo, and Hein Sprong. 2021. “Imported Hyalomma Ticks in the Netherlands 2018–2020.” Parasites & Vectors 14, no. 1 (May): 244. https://doi.org/10.1186/s13071-021-04738-x. Väli, Ülo, Annika Einarsson, Lisette Waits, and Hans Ellegren. 2008. “To What Extent Do Microsatellite Markers Reflect Genome-Wide Genetic Diversity in Natural Populations?” Molecular Ecology 17, no. 17: 3808–17. https://doi.org/10.1111/j.1365-294X.2008.03876.x. Van Houtte, N., A. R. Van Oosten, K. Jordaens, E. Matthysen, T. Backeljau, and D. J. A. Heylen. 2013. “Isolation and Characterization of Ten Polymorphic Microsatellite Loci in Ixodes arboricola , and Cross-Amplification in Three Other Ixodes Species.” Experimental and Applied Acarology 61, no. 3 (November): 327–36. https://doi.org/10.1007/s10493-013-9702-x. Van Oosten, A. R., D. J. A. Heylen, K. Jordaens, T. Backeljau, and E. Matthysen. 2014. “Population Genetic Structure of the Tree-Hole Tick Ixodes arboricola (Acari: Ixodidae) at Different Spatial Scales.” Heredity 113 (5): 408–15. https://doi.org/10.1038/hdy.2014.41. Van Oosterhout, Cock, William F. Hutchinson, Derek P. M. Wills, and Peter Shipley. 2004. “Micro-Checker: Software for Identifying and Correcting Genotyping Errors in Microsatellite Data.” Molecular Ecology Notes 4, no. 3: 535–38. https://doi.org/10.1111/j.1471-8286.2004.00684.x. Walker, Jane. 1974. The Ixodid Ticks of Kenya: A Review of Present Knowledge of Their Hosts and Distribution . Commonwealth Institute of Entomology. Zeller, Herve G., Jean-Paul Cornet, Aichatou Diop, and Jean-Louis Camicas. 1997. “Crimean—Congo Hemorrhagic Fever in Ticks (Acari: Ixodidae) and Ruminants: Field Observations of an Epizootic in Bandia, Senegal (1989–1992).” Journal of Medical Entomology 34, no. 5 (September): 511–16. https://doi.org/10.1093/jmedent/34.5.511. Zhang, Jiajie, Kassian Kobert, Tomáš Flouri, and Alexandros Stamatakis. 2014. “PEAR: A Fast and Accurate Illumina Paired-End reAd mergeR.” Bioinformatics 30, no. 5 (March): 614–20. https://doi.org/10.1093/bioinformatics/btt593. Statements and Declarations Funding This work was supported by a United States Department of Agriculture Cooperative Agreement (Agreement number: 58-3022-2-023). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions Hamza Ahmad : Investigation (lead); formal analysis (lead); writing – original draft preparation (lead); writing – review and editing (equal); Formal analysis (equal); Visualization (equal). Winnifred Aool : Investigation (supporting). Victor Anayango : Investigation (supporting). Teddy M Nakayaki : Investigation (supporting). F Mulwa : Investigation (supporting). B Chelangat : Investigation (supporting). Julius J Lutwama : Investigation (supporting). Jonathan K Kayondo : Investigation (supporting). Martin Lukindu : Investigation (supporting), writing – review and editing (supporting); Supervision (supporting); Resources (supporting). James Mutisya : Investigation (supporting). Joel Lutomiah : Supervision (supporting); Resources (supporting). Lisa E Hensley : Project administration (supporting); Funding acquisition (equal). Lee W Cohnstaedt : Project administration (supporting); writing – review and editing (supporting). Maria G Onyango : Funding acquisition (equal); Conceptualization (supporting); Formal analysis (supporting); writing – review and editing (supporting). Corey L Brelsfoard : Investigation (supporting); Conceptualization (lead); Funding acquisition (equal); Resources (lead); Supervision (lead); Visualization (equal); Methodology (lead); Formal analysis (equal); writing – review and editing (equal). Data Availability The that supports the findings of this study are available in the supplementary material of this article and are available on Genbank [accession numbers KU170517 and KU130464; PX126103-PX126107]. Ethics Approval This study was performed with approval from the Texas Tech University Institutional Biosafety Committee (IBC-2023-1041). Tick sample collection was carried out with approvals from the Uganda Virus Research Institute (UVRI, Ref. no. GC/127/949), the Uganda National Council for Science and Technology (UNCST, Ref. no. A296ES), the Kenya Medical Research Institute (KEMRI) Scientific Ethics Review Unit (SERU), Ref. no. 4684), and the National Commission for Science and Innovation (NACOSTI, Ref. no. 875261). Consent to Participate No human subjects were used in this research. Consent to Publish No personal data was included in this study. Supplementary Material File (figure 1.tif) Download 1.58 MB File (image1.tif) Download 1.58 MB Information & Authors Information Version history V1 Version 1 13 October 2025 Peer review timeline Published Ecology and Evolution Version of Record 5 Feb 2026 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Collection Ecology and Evolution Keywords genetics invertebrate molecular genetics terrestrial Authors Affiliations Hamza Ahmad Texas Tech University System View all articles by this author Winnifred Aool Texas Tech University System View all articles by this author Victor Anyango Texas Tech University System View all articles by this author Teddy Nakayaki Uganda Virus Research Institute View all articles by this author Francis Mulwa Kenya Medical Research Institute View all articles by this author Betty Chelangat Kenya Medical Research Institute View all articles by this author Julius Lutwama 0000-0002-3210-722X Uganda Virus Research Institute View all articles by this author Jonathan Kayondo Uganda Virus Research Institute View all articles by this author Martin Lukindu Uganda Virus Research Institute View all articles by this author James Mutisya Kenya Medical Research Institute View all articles by this author Joel Lutomiah Kenya Medical Research Institute View all articles by this author Lisa Hensley USDA ARS View all articles by this author Lee Cohnstaedt USDA ARS View all articles by this author Maria Onyango Texas Tech University System View all articles by this author Corey L Brelsfoard 0000-0003-2030-9040 [email protected] Texas Tech University System View all articles by this author Metrics & Citations Metrics Article Usage 262 views 195 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Hamza Ahmad, Winnifred Aool, Victor Anyango, et al. Development and characterization of microsatellite genetic markers for Hyalomma rufipes , a tick vector of Crimean-Congo Hemorrhagic Fever Virus. Authorea . 13 October 2025. DOI: https://doi.org/10.22541/au.176035717.72897371/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.176035717.72897371/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe9f32b9f0e52ad',t:'MTc3OTI2NTUxNw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0