Full text
112,409 characters
· extracted from
preprint-html
· click to expand
RPGR regulates motile cilia by interfering with actin dynamics | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results RPGR regulates motile cilia by interfering with actin dynamics Yang Wu , Erika Tavares , Binrun Liang , Wallace Wee , Vito Mennella , Hanchao Feng , Jiaying Cao , Jiayi Zheng , Mu He , Kirk Stephenson , Liran Hanan , Janice Min Li , Sharon D Dell , Elise Heon , Zhen Liu doi: https://doi.org/10.1101/2025.03.13.643176 Yang Wu 1 Department of Life Science, The Hong Kong University of Science and Technology , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Erika Tavares 2 Genetics & Genome Biology Program, The Hospital for Sick Children , Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Binrun Liang 1 Department of Life Science, The Hong Kong University of Science and Technology , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Wallace Wee 3 Child Health Evaluative Sciences, The Hospital for Sick Children , Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Vito Mennella 4 MRC Toxicology Unit, University of Cambridge , The United Kingdom Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hanchao Feng 1 Department of Life Science, The Hong Kong University of Science and Technology , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiaying Cao 1 Department of Life Science, The Hong Kong University of Science and Technology , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiayi Zheng 5 School of Biomedical Sciences, The University of Hong Kong , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mu He 5 School of Biomedical Sciences, The University of Hong Kong , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kirk Stephenson 6 Department of Ophthalmology and Vision Sciences, The Hospital for Sick Children, University of Toronto , Toronto, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Liran Hanan 6 Department of Ophthalmology and Vision Sciences, The Hospital for Sick Children, University of Toronto , Toronto, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Janice Min Li 2 Genetics & Genome Biology Program, The Hospital for Sick Children , Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sharon D Dell 3 Child Health Evaluative Sciences, The Hospital for Sick Children , Canada 7 Division of Respiratory Medicine, BC Children’s Hospital, The University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: zhenliu{at}ust.hk elise.heon{at}sickkids.ca sharon.dell{at}bcchr.ca Elise Heon 2 Genetics & Genome Biology Program, The Hospital for Sick Children , Canada 6 Department of Ophthalmology and Vision Sciences, The Hospital for Sick Children, University of Toronto , Toronto, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: zhenliu{at}ust.hk elise.heon{at}sickkids.ca sharon.dell{at}bcchr.ca Zhen Liu 1 Department of Life Science, The Hong Kong University of Science and Technology , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: zhenliu{at}ust.hk elise.heon{at}sickkids.ca sharon.dell{at}bcchr.ca Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Cilia are highly conserved cellular organelles extruding from the surface of cell types carrying either sensory (signaling) or motile functions. These include photoreceptor cells and airway epithelia, where they function in light sensation and mucociliary clearance respectively. Retinitis pigmentosa GTPase regulator ( RPGR ) variants affect both photoreceptor sensory cilia and airway motile cilia, leading to retinitis pigmentosa (RP) and in some cases, primary ciliary dyskinesia (PCD), both debilitating conditions. Not all patients develop PCD and it is unclear which RPGR variants predispose patients to PCD and why this happens. In this study, using nasal biopsy samples of patients with RPGR -related RP, we leverage 2D organoid cell culturing, super-resolution microscopy, and live cell imaging to characterize the multiciliated cells from patients with different RPGR variants, healthy human nasal and bronchial multiciliated cells with CRISPR-modified RPGR function. We demonstrate for the first time that multiciliated cells with RPGR variants may have reduced ciliation, shorter cilia, significantly impaired cilia beat, or cilia beat incoordination, which could lead to defective mucociliary clearance and lung disease. In addition, we show the regulation of motile cilia by RPGR involves F-actin, as evidenced by temporarily reduced Gelsolin and undissolved condensed actin meshwork at the apical surface of RPGR-deficient multiciliated cells. In support, we show that the motile cilia defect can be ameliorated by treating with the actin polymerization inhibitor Latrunculin A. Though PCD was observed only in patients with variants that affect both main isoforms ( RPGR 1-19 and RPGR ORF15 ), patients with variants affecting only RPGR ORF15 also showed cilia and airway anomalies. Though all RPGR variants affected motile cilia in one way or another, RPGR loss of function variants affecting both isoforms are associated with more severe cilia and systemic phenotypes, the mechanisms of which involve the accumulation of apical F-actin. One Sentence Summary: Loss of RPGR, through the mechanism of apical F-actin accumulation in airway multiciliated cells, leads to reduced ciliation with short cilia that have an impaired beat, leading to defective mucociliary clearance. INTRODUCTION Cilia are highly conserved organelles protruding from the cell surface and are essential for cellular sensing, signaling, or motility ( 1 , 2 ). Cilia can be generally classified into motile cilia or sensory (primary) cilia ( 3 ), based on their structure and whether they beat or not ( Fig.1A ). Motile cilia align along the surface of the respiratory tract, ependyma, and fallopian tube, beat in synchrony and function in airway mucociliary clearance, cerebral fluid circulation, and egg delivery ( 1 ). The sensory cilia are solitary and appear on nearly all cells, receiving environmental stimuli and eliciting signaling pathways such as the Hedgehog signaling ( 4 ). One example of primary cilia is the photoreceptor outer segment, a specialized sensory cilium dedicated to phototransduction ( 5 ). Download figure Open in new tab Fig. 1. Multiciliated nasal cells (MCCs) with pathological RPGR variants present with short cilia, and decreased ciliation level. (A) Cartoon showing RPGR as the causative gene for RP and PCD as well as the focus of this study. (B) Distributions of RPGR variants of the 32 patients with RP participating in this study. Red indicates variants that affect both isoforms and correspond to loss of function or splicing; pink correspond to variants with missense effect; and purple correspond to loss of function variants affecting only RPGR ORF15 . Variants of case # 9 and 15 are predicted to be missense and affect splicing. (C) The proposed workflow for studying nasal cilia structure and function related to RPGR variants. (D) Immunostaining of human nasal cells of controls and patients with RPGR variants. RPGR antibodies (green) and acetylated tubulin antibodies (red) staining showed reduced cilia length in certain MCCs of RP patients. (E) Cilia length measurements for the nasal MCCs from both controls and RP patients spread on the coverslips. the red star means the individuals with PCD. n>7 cells per sample. (F) Cilia length measurements for the MCCs from both controls and RP patients cultured at air-liquid interface for 8 weeks. n>6 cells per sample. (G) Immunostaining of basal body marker Poc1b and cilia marker acetylated tubulin showed reduced ciliation in the MCCs of a RP patient with RPGR damaging variant (#2, c.901delT;p.(Ser301Leufs*9)). (H) The number of basal bodies was unchanged for most MCCs bearing damaging variants. (I) Ciliation was reduced for the MCCs bearing pathological RPGR variants in either the ORF region or non-ORF15 region. n>6 cells per sample. All data are presented as average ± SEM. n.s., no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-tailed t-test (E, F, H, I). Conditions due to defective function, development, or maintenance of cilia are collectively referred to as ciliopathies. Primary ciliary dyskinesia (PCD) is an important motile ciliopathy ( 6 , 7 ), affecting ∼1:7,500 people worldwide ( 8 ). Major features of PCD include oto-sino-pulmonary diseases which can be life-threatening because of deterioration of lung capacity. Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by degeneration of photoreceptors, leading to night blindness, tunnel vision, and finally sight loss ( 9 ). The incidence rate of RP ranges between 1 in 2,500-7,000 ( 10 ). Variants in genes associated with primary cilia can also cause RP ( 11 ). Deleterious variants involving the Retinitis pigmentosa GTPase regulator ( RPGR ) gene account for ∼70% of X-linked RP ( 12 – 14 ) and are also a known cause of X-linked PCD ( 15 ). RPGR is expressed in both sensory and motile cilia ( 16 , 17 ). As a result, patients with RPGR deleterious variants could present both motile and sensory ciliopathy phenotypes ( Fig. 1A ). RPGR is expressed in two major isoforms ( Fig. 1B ) ( 18 – 21 ), one is constitutively expressed in multiple organs and cell types (NM_000328.3; RPGR ex1-19 ) and the other has a restricted expression pattern that includes the retina (NM_001034853.2; RPGR ORF15 ). RPGR ex1-19 has 19 exons of which RPGR ORF15 shares exon 1-14 ( 18 , 22 – 25 ). RPGR ORF15 is an X-linked RP mutational hotspot and is predominantly expressed in the retina, while RPGR ex1-19 is ubiquitously expressed and was initially regarded as the sole isoform in airway multiciliated cells (MCCs) ( 17 , 18 ). In the retina, RPGR contributes to outer segment membrane disk renewal and variants involving both RPGR ex1-19 and RPGR ORF15 contribute to early onset RP ( 26 ). However, RPGR’s role in motile cilia remains unclear. While most PCD causative genes encode either axoneme components, dynein arm docking/assembly factors, or transcription factors governing the multiciliogenesis program, RPGR is different and maybe involved in ciliary transport ( 27 – 30 ). The gold standard for confirming PCD diagnosis is either ciliary structural defects detected by TEM and/or biallelic mutations in the known PCD genes detected by DNA sequencing. However, this standard cannot diagnose all PCD cases including RPGR variants as RPGR variants could be of unknown significance and don’t usually lead to TEM changes ( 31 , 32 ). There have been clinical reports showing that variants in RPGR cause PCD ( 15 , 19 , 33 , 34 ) (Table S1, https://www.ncbi.nlm.nih.gov/clinvar ) and that these patients showed static cilia, impaired cilia beat, or disrupted beat coordination ( 33 ). However, these were mostly case studies based on a limited number of patients. Which variants predispose patients to PCD and how RPGR regulates motile cilia properties is still unclear. This knowledge gap can delay the clinical diagnosis of PCD until damage occurs and pulmonary function is affected, which can affect patient outcomes. Using super-resolution microscopy and live cell cilia analysis of patient samples, we observed that patients with RPGR pathological variants (variants before exon 14 will be referred to as RPGR variants) presented sparse, short, and mostly static motile cilia in human nasal epithelial cells (HNCs). These phenotypes were recapitulated in CRISPR-mediated RPGR KO MCCs. For RPGR ORF15 variants, while nasal cilia length was not different from healthy controls, they were sparser and grew slower for MCCs cultured at the air-liquid interface. For the cilia beating of MCCs bearing RPGR ORF15 variants, most cilia exhibited decreased motility, but the beat amplitude and waveform were all abnormal and the beat coordination within and between cells was disrupted. Investigating the mechanisms underlying how RPGR regulates motile cilia revealed its role in regulating F-actin dynamics. At the apical surface of MCCs with RPGR loss of function variants, a condensed actin meshwork accumulates, preventing some cilia from extruding from the surface, and restricting cilia movement on the cell surface. The actin meshwork is possibly caused by a temporarily reduced level of Gelsolin at the apical surface. To examine whether the phenotype was specific to F-actin changes, we treated MCCs bearing RPGR variants with Latrunculin A, an actin polymerization inhibitor, and found that, similar to sensory cilia in RPE-1 cells, cilia length and ciliation defect could be ameliorated, and cilia beat could be partially restored. To summarize, using a cohort of 32 patients (Table S1) with variants in RPGR and RPGR ORF15 , we provide the first mechanistic study of RPGR’s function in the respiratory system. We found that although symptoms of PCD are more prevalent with RPGR variants, cilia anomalies are seen in both isoforms, and patients with RPGR ORF15 variants have some respiratory findings, though not characteristic of PCD (Table S2). The more severe cilia phenotypes were associated with RPGR loss of function variants. This work also reveals a different role of RPGR compared to other PCD causative genes: RPGR tunes F-actin dynamics at the apical surface to control multiciliogenesis and to regulate cilia beat machinery. The methods reported here can be translated clinically to identify individuals at risk of mucociliary clearance defects and improve patient outcomes with appropriate management. RESULTS Patient characterization We recruited a cohort of 32 RP patients with a wide range of RPGR variants including one female with retinal degeneration (case 21) ( Fig. 1C , Table S1), and six healthy volunteers. All patients were recruited through eye clinics and had retinal degeneration. Fresh nasal cilia were available in 29 cases for cilia analysis. The mean age at the time of nasal cilia biopsy was 30 years (range 8-63 years). The pathogenicity of the variants identified was validated using available pathogenicity and conservation predictive algorithms, allele frequency databases, and splicing assays ( 35 – 40 ) (Table S1, Fig.S1). Variants affecting both isoforms were found in 16 patients: 8 were considered loss of function (RPGR LOF), 5 were missense resulting in an in-frame deletion (RPGR in frame deletion), two had missense variants with loss of transcript due to incomplete splicing (RPGR missense splicing), and one had a missense (RPGR missense). Loss of function variants affecting the RPGRORF15 isoform accounted for the remaining 16 patients (Table S1). Respiratory manifestations of PCD include neonatal respiratory distress, chronic nasal congestion, chronic cough and wheezing, sinusitis, bronchitis, pneumonia, and/or otitis media. Clinical assessments of PCD patients show obstructive lung disease by lung function test, bronchiectasis by chest CT, chronic abnormalities by chest radiograph, and/or a low exhaled nitric oxide level (< 77 nL/min). Of the 32 patients in this study, 6 were highly suspicious of PCD (severe respiratory changes with reduced nNO and/or chest X-ray/CT anomalies), all of which had RPGR variants. Of the 32 patients recruited, 19 out of 31 had sinus diseases, 15 out of 30 had lower airway diseases, and 19 patients presented ear issues including hearing loss, and/or otitis media (Table S2). For the clinical tests, 9 out of 28 patients had obstructive lung functions and 11 out of 27 patients had Chest X-ray and/or CT anomalies. Of the 16 cases carrying ORF15 variants, 5 had sinus diseases, 4 had lower airway diseases, 8 had hearing issues including 2 with hearing loss. Clinical tests suggested 2 had obstructive airway diseases and 3 had abnormal chest radiographs. Patients with pathological RPGR variants show cilia defects Fresh MCCs isolated from 6 healthy volunteers and 29 RP patients were immunostained with RPGR antibodies and antibodies targeting the cilia marker acetylated tubulin for either 3D-SIM or Confocal microscopy imaging. RPGR was absent from most patients with variants that affect both isoforms but was properly localized in the cells bearing RPGR ORF15 variants ( Fig. 1D ). Cilia length measurements showed that for most patients with RPGR loss of function and in frame deletion variants, cilia are significantly shorter (p < 0.0001, N=11) while patients with RPGR ORF15 variants (n.s., N=14) displayed normal cilia length ( Fig. 1E ). This suggests that overall RPGR is important for motile cilia growth or length regulation. Interestingly, in a female patient (Case #21) with severe RP due to RPGR variant (c.122C>A; p. (Ser41*), around half of her MCCs did not express RPGR and presented short cilia because of unfavorable X-inactivation (Fig. S2A). Thus, within the same biological background, the cells with shorter cilia were the ones lacking RPGR. Because fresh nasal cells might be subject to infections and other environmental stressors, we re-differentiated the isolated basal cells on the air-liquid interface (ALI) for further assessment. Such differentiated cells were available for 18 cases. We measured the cilia length for the differentiated cells at 4 weeks (Fig. S2B) and 8 weeks ( Fig. 1F ) using the signal of acetylated tubulin. Six of nine patients (66%) with variants in RPGR and 8 out of 9 patients with RPGR ORF15 variants have significantly shorter motile cilia than control individuals (p<0.0001 and 0.05 respectively). The shorter cilia length from MCCs bearing RPGR ORF15 variants suggests that RPGR ORF15 may be important for the growth of cilia. The ALI cell culture also allowed us to quantify the ciliation level defined by the number of cilia divided by the number of basal bodies per MCC ( Fig. 1G-I ). For patients with either RPGR (p<0.0001, N=9) or RPGR ORF15 (8/9, p<0.05, N=9) variants, the ciliation level was significantly lower than healthy controls ( Fig. 1I ). Altogether, our characterization of the MCCs of patients with a wide variety of pathogenic and likely pathogenic RPGR variants shows that disruption of RPGR function may lead to reduced ciliation (8/9 for RPGR variants and 8/9 for RPGR ORF15 variants) and shortened cilia length(13/14 for RPGR variants and 7/14 for RPGR ORF15 variants, nasal cilia). Damaging RPGR variants affect cilia beat To investigate how RPGR regulates cilia motility, cilia beating was measured on MCCs re-differentiated at ALI (8 weeks). We stained the whole filter with wheat germ agglutinin (WGA)-Alexa 488 to mark the highly glycosylated motile cilia ( 41 , 42 ) and used a method developed for automatic high throughput measurement for each entire field of view to avoid observation bias ( Fig. 2A ). The frequency of pixel signal fluctuation of the collected cilia beat video was used to first represent the overall motility information in the field of interest ( Fig. 2B and S3). For healthy control cells, motile cilia beat had a distinguishable power stroke, recovery stroke as well as synchronization of metachronal wave (Video S1). On the contrary, MCCs from RP patients showed noticeable heterogeneity in those features, between patients as well as among cells of the same patient (Video S1). To quantify the differences, we first measured the cilia beat frequency for individual cells from patients with different RPGR variants. Most motile cilia of patients with RPGR variants were static or showed restricted beat (7/9), while for some cases (#15, 11), a mixture of slow and fast beat cilia was observed ( Fig. 2C ). For patients with variants in the RPGR ORF15 , in most cases (8/9), cilia beat frequency decreased significantly ( Fig. 2C ). For cilia beat waveform, besides the normal cilia beat, four different types of beat phenotypes could be identified: 1) static cilia; 2) restricted cilia beat; 3) large cilia beat amplitude with a loss of power and recovery stroke pattern; 4) cilia beat in rotationary and/or uncoordinated manner ( Fig. 2D ). We quantified the percentage of cells with different cilia beat modes. While most cells with RPGR variants (7/9) had static cilia or restricted cilia beat, cells with RPGR ORF15 variants showed better cilia beat (8/9, 1 has normal cilia beat) but they either lost the waveform or coordination ( Fig. 2E ). Download figure Open in new tab Fig. 2. Multiciliated Cells (MCCs) with pathological RPGR variants showed impaired and uncoordinated cilia beat. (A) A cartoon showing labelling motile cilia with WGA-Alexa 488. (B) Pixel frequency map shows cilia beat impairment in the MCC with RPGR pathological variants. Scale bar, 10 μm. (C) Characterization of cilia beat frequency for all RP patients in this study. n>15 cells per sample. (D) Different cilia beat modes identified in RPGR loss of function MCCs. (E) Characterization of cilia beat waveform distributions for all RP patients in this study. n>16 cells per sample. (F) A cartoon showing labeling Poc1B and Centriolin to assess rotational polarity and its disruption in MCCs bearing RPGR pathological variants. (G) Immunostaining shows rotational polarity in healthy control cells and its disruption for one patient with pathological RPGR mutation. (H) Characterization of rotational polarity for all RP patients in this study. n>9 cells per sample. (I) Single-cell RNA seq revealed the expression of RPGR mRNAs and its different isoforms in airway epithelial cells. (J) RT-PCR showed the expression of the ORF15 isoform in human airway epithelial cells (HNC cultured at ALI for > 8 weeks). All data are presented as average ± SEM. The center, upper and lower lines represent the median, upper, and lower quartiles, respectively (C, H). n.s. no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-tailed t-test (C, E, H). To quantitatively compare beat coordination, we used a 3D-SIM based method we previously developed to examine the rotational polarity of the basal foot ( Fig. 2F and 2G ), an appendage structure localized at the base of each cilium ( 43 – 46 ). In healthy MCCs, all basal feet point towards the direction of the cilia beat, a phenomenon called rotational polarity ( Fig. 2F ), which is disrupted in PCD patients because of defective cilia beat ( 46 ). The rotational polarity was disrupted in both cells with RPGR (9/9) and RPGR ORF15 (9/9) variants ( Fig. 2H ). Taken together, damaging variants in RPGR and RPGR ORF15 affect airway MCC cilia beat frequency (9/9, 8/9 for RPGR and RPGR ORF15 respectively), waveform (9/9, 9/9), and coordination (9/9, 9/9). RPGR -RP patients with severe PCD symptoms demonstrate severe cilia defects Patients with severe clinical respiratory PCD symptoms tend to have RPGR loss of function variants or in frame deletions and demonstrate more severe cilia defects. Clinical features of cases # 9, 10, 11, 20, 25, and 26 met the diagnostic criteria of PCD, and all showed shortened nasal cilia length ( Fig. 1E ). We successfully re-differentiated cells from cases # 9, 11, and 26, and found all showed reduced cilia length and ciliation except for the ciliation of differentiated MCCs from case #11 was not affected ( Fig. 1F and 1I ). Cilia beat analysis of MCCs from those three cases showed that most MCCs presented static cilia or restricted cilia beat, and the rotational polarity was disrupted in all ( Fig. 2C , 2E , and 2H , Table S2). Despite cases #10& 11 (relatives), 23& 24 (relatives) bearing the same variant leading to alternative splicing (c.934G>T; p.(Glu260_Thr311del)), cases #10, 11 presented with a clinical PCD phenotype and shorter nasal cilia length, while cases #23 & 24 had shorter cilia but longer than #10,11, in addition to milder respiratory symptoms ( Fig. 1E ). This suggests multifactorial influences in the development of PCD. However, the ALI cells from case #23 showed all cilia phenotypes and he had abnormal respiratory features and hearing loss (Table S2), suggesting this variant does predispose him to motile cilia dysfunction. Though most RPGR RP patients showed motile cilia defects, only a population presented with clearly an abnormal respiratory phenotype, and 6 with a strong PCD phenotype (6/32), all had variants affecting both isoforms. However, in some cases of patients with RPGR ORF15 variants, abnormal cilia, and abnormal respiratory phenotype were observed, suggesting these patients are not immune to respiratory illnesses caused by cilia defects ( Fig.1 and 2 , and Table S2). Our data provides insight into which RP patients have a high risk of PCD or any respiratory illnesses. RPGR ORF15 isoform is expressed in airway MCCs More severe motile cilia defects are seen in patients with variants that disrupt both isoforms ( Fig. 1 and Fig. 2 ). Though the RPGR ex1-19 isoform was once regarded as the sole isoform in airway MCCs ( 17 ), we first showed that cells from patients with RPGR ORF15 variants also present with cilia defects ( Fig. 1E , 1F , and 1I ), though the respiratory phenotypes were less severe (Table. S2). To verify if the RPGR ORF15 isoform is expressed in MCCs, we first examined the single-cell sequencing data of fetus trachea generated in a previous study by He, et al ( 47 ). All RPGR isoforms were first treated as a single gene. At the mRNA level, compared to other cell types, RPGR was mainly expressed in the MCC progenitors (Foxn4 expressing) and mature MCCs ( Fig. 2I ). We next separated different isoforms and performed isoform-specific expression analysis. The result for the first time showed that the expression levels of the RPGR ORF15 isoform were comparable to the most expressed RPGR ex1-19 isoform, now confirming that RPGR ORF15 can be expressed in airway cells. The expression of the RPGR ORF15 isoform was upregulated during the early stage of multiciliogenesis ( Fig. 2I ), indicating its role in cilia formation. To further examine the expression of RPGR ORF15 isoform in MCCs, we performed RT-PCR of the total mRNA transcripts extracted from healthy controls and RPGR KO HNCs. The results further support that RPGR ORF15 is expressed in airway cells ( Fig. 2J and S4), consolidating the single-cell sequencing data. RPGR KO MCCs present sparse short motile cilia To determine the RPGR specificity of our findings in patient cells, we generated RPGR KO MCCs by CRISPR-mediated genomic perturbation. In brief, either healthy human nasal or bronchial basal cells were edited through infection of lentivirus expressing Cas9 and RPGR gRNAs, selected by puromycin, and differentiated at the air-liquid interface into airway MCCs ( Fig. 3A ). We optimized the protocol by adding ROCK inhibitor Y27632 ( 48 , 49 ), and irradiated fibroblast cells ( 50 – 52 ), known to enhance basal cell growth while maintaining their differentiation potential. We adopted two gRNAs reported by Zhang, et al. ( Fig. 3B ) ( 53 ), and a combination of these two gRNAs targets exons 2-4 and disrupts the RCC1 domain of both isoforms ( Fig. 3C ). Using this optimized protocol, we successfully generated RPGR KO MCCs evidenced by DNA gel electrophoresis and Sanger sequencing: the percentage of cells in which dual gRNAs worked reached 92.3% and the total KO efficiency was ∼99% ( Fig. 3C and 3D ). Immunostaining showed a complete absence of RPGR compared to the control ( Fig. 3D ). We further characterized the cilia properties for all 5 biological replicates, including 2 human nasal cell (HNC) and 3 human bronchial epithelial cell (HBEC) samples, showing that cilia length was affected in all ( Fig. 3E and 3F ). Quantification of the ciliation level of MCCs showed that, while basal body number was unaffected, ciliation was significantly decreased ( Fig. 3E , 3G , and S2C), which suggests that RPGR regulates ciliation but not basal body amplification or docking. Download figure Open in new tab Fig. 3. RPGR Knockout(KO) Multiciliated cells (MCCs) presented sparse and short motile cilia. (A) Workflow of generating RPGR KO MCCs. (B) The location of guide RNAs and the expected genome edits. (C) DNA gel and Sanger sequencing showed high efficiency of RPGR KO in MCCs. (D) Immunostaining of MCCs with RPGR antibody showed complete RPGR removal in RPGR CRISPR KO MCCs. (E) Immunostaining with POC1B and acetylated tubulin antibodies showed the reduction of ciliation length and ciliation for RPGR KO HBEC/HNC cells. Scale bar 5 μm. (F) Cilia length was significantly disrupted in all 5 biological replicates. n>7 cells per sample. (G) Ciliation was severely affected for all 5 RPGR KO biological replicates. n>7 cells per sample. All data are presented as average ± SEM. n.s. no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-way repeated ANOVA followed by Sidak’s post hoc test (F, G). Taken altogether, RPGR CRISPR KO airway cells had shortened cilia and reduced ciliation levels, recapitulating the cellular phenotypes seen in the patients. RPGR KO MCCs present static cilia and/or abnormal cilia motility Live cell imaging of RPGR KO MCCs ( Fig. 4C ) showed the majority of the cells (68%, N=4) had static cilia, in 4 of 5 biological replicates ( Fig. 4B upper and middle, Video S2), leading to disrupted mucociliary clearance (Video S3). We identified large heterogeneity within and among different biological replicates ( Fig. 4C ). A quantification of cilia beat frequency of the MCCs showed results consistent with patient data. Analysis of the cilia beat waveform, in 4 out of 5 replicates, showed the static cilia were predominant while for the 5 th replicate, although most cilia could beat with a normal frequency compared to the control (n.s., 2 technical replicates), both the waveform and beat coordination were abnormal ( Fig. 4D ). Download figure Open in new tab Fig. 4. RPGR KO MCCs presented with limited motility and defective rotational and planar polarity. (A, B) Pixel frequency map shows control MCC cilia beat and its impairment in RPGR KO MCCs. (C, D) Characterization of cilia beat frequency and beat mode changes for 5 biological replicates in this study. n>27 cells per sample. (E) Immunostaining showed rotational polarity in control cell and its disruption for RPGR KO MCCs. (F) Rotational polarity was disrupted for all RPGR KO samples in this study (N=4). n>13 cells per sample. (G-I) Vangl1 mislocalization for MCCs from an HBEC RPGR CRISPR KO sample and comparison to an RP patient sample suggesting loss of planar polarity. Scale bar, 5 μm. All data are presented as average ± SEM. The center, upper and lower lines represent the median, upper, and lower quartiles, respectively (C, F). n.s. no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-tailed t-test (D), or two-way repeated ANOVA followed by Sidak’s post hoc test (C, F). The rotational polarity assessment of RPGR KO cells showed a drastic disruption of beat coordination ( Fig. 4E and 4F ). As previous studies suggested the disruption of planar cell polarity (PCP) for patient cells bearing RPGR variants ( 54 , 55 ), we stained the ALI filters with antibodies targeting the planar polarity protein Vangl1 ( 56 , 57 ). For control cells, Vangl1 was specifically enriched to one side of the MCCs. For either RPGR KO HNC, HBEC cells, or patient cells with either RPGR or RPGR ORF15 variants, the asymmetrical distribution of Vangl1 was largely lost, also suggesting planar polarity disruption ( Fig. 4G-I and S2D). To summarize, RPGR defects caused by CRISPR perturbation lead to either static cilia or cilia with altered motility, disrupting both planar and rotational polarity. RPGR locates to the transition zone (TZ) and cilia and its loss does not affect the integrity of the TZ or the localization of axoneme dyneins To inspect how RPGR regulates motile cilia, we first examined RPGR subcellular localization by 3D-SIM. We stained airway MCCs from controls with a validated RPGR antibody. 3D-SIM provides ∼120 nm resolution ( 58 – 60 ) and showed clear transition zone distribution of RPGR by colocalization with transition zone marker RPGRIP1L as well as a weak signal in cilia ( Fig. 5A ). We further employed STORM ( 61 – 63 ), which provides ∼20 nm resolution, to examine the distribution of RPGR and found that it formed a dotted ring pattern at the transition zone for each cilium ( Fig. 5B ) as well as cilia localized puncta. Download figure Open in new tab Fig. 5. RPGR mainly locates to the transition zone (TZ) and cilia and the exclusive distribution of RPGR and F-actin. (A) 3D-SIM showed RPGR mainly locates to the TZ of motile cilia. Scale bar, 5 μm. (B) STORM showed RPGR presents dotted ring structure at the transition zone and puncta along cilia. Scale bar, 5 μm and 200 nm for the insert. (C) The exclusive distribution of RPGR (green) and F-actin (Phalloidin-Alexa 647 labeled magenta) in the MCCs cultured on ALI for 4 weeks: when RPGR was highly expressed, F-actin signal is weaker and vice versa. The transition zone (TZ) is a diffusion barrier between the cilia lumen and cytoplasm, allowing selective cargo entry and exit of cilia ( 64 ). The subcellular localization of RPGR and its interaction with transition zone components suggests that it might be involved in ciliary transportation and cilia composition maintenance. Since most cilia of RPGR LOF cells are static, we wondered if the axoneme outer dynein arms (ODA) and inner dynein arms (IDA) are intact. In patient samples with either RPGR ORF15 or RPGR variants, ODA marker DNAH5 and IDA marker DNALI1 showed proper localization (Fig. S5A and S5B), consistent with the normal TEM results (Fig. S5C) ( 65 ). Knowing that RPGR interacts with transition zone components RPGRIP1L, CEP290, and NPHP4 ( 66 , 67 ), we assessed if the loss of RPGR affects the localization of these proteins at the TZ. By staining the RPGR KO MCCs with corresponding antibodies, we found that loss of RPGR does not affect the distribution of these transition zone components (Fig. S5D). To assess if RPGR loss affects the organization of TZ, we stained other TZ components such as AHI1, MKS1, MKS3, and CC2D2A and found they were all properly localized (Fig. S5E), suggesting that RPGR is dispensable for the integrity of transition zone. RPGR KO MCCs form condensed actin meshwork RPGR has been reported to regulate F-actin polymerization ( 68 , 69 ) and loss of RPGR in hTERT-RPE1 cells induces the formation of actin bundles ( 68 ). Using an RPGR KO mouse model, Roly, et al. suggested that RPGR regulates photoreceptor ciliary tip actin dynamics, affecting outer segment membrane turnover ( 26 , 70 ). To investigate if RPGR also regulates actin organization in MCCs, we first looked at the relative distribution of F-actin and RPGR: In ALI 3-week MCCs, when RPGR was highly expressed, Phalloidin-Alexa647 labeled F-actin signal was weaker and vice versa ( Fig. 5C ). Evaluation of the distribution of F-actin in MCCs using 3D-SIM showed that actin demonstrates dynamic distribution at different stages of multiciliogenesis ( Fig. 6A ): at ALI 4 weeks, the apical surface actin forms a dense actin meshwork ( Fig. 6a left), which is critical for basal body docking ( 71 , 72 ). After ALI 8 weeks, the apical actin meshwork dissolves and the actin patches concentrate at the base of cilia where filamentous F-actin bundles can be readily observed ( Fig. 6A right). The filamentous F-actin is supposed to align basal bodies to synchronize cilia beat coordination ( 72 , 73 ). At ALI 8 weeks, 3D-SIM imaging of RPGR KO MCCs showed that the apical actin network did not dissolve, which affected the extrusion of the cilia ( Fig. 6B ). Quantification of the percentage of apical surface covered by F-actin showed that for all 4 biological replicates, the RPGR KO cell surface F-actin portion was significantly larger than controls at ALI 8 week ( Fig. 6C ). To gain further insights into the organization of actin, we applied STORM imaging of Phalloidin-Alexa 647 labelled MCCs and found that for control cells at ALI 8 weeks, the F-actin appeared as bright puncta while for RPGR KO MCCs the F-actin appeared as a meshwork covering the apical surface ( Fig. 6D ). Download figure Open in new tab Fig. 6. Mature RPGR loss of function MCCs present condensed actin meshwork at the apical surface that doesn’t dissolve. (A) The different distribution of F-actin at different stages of MCCs: For ALI 4-week samples, F-actin forms dense meshwork at the apical surface; in mature multiciliated cells (8 weeks), F-actin forms puncta at the cilia base connecting into strips, which is important for cilia beat coordination. The zoomed-in image shows the actin meshwork (left) and actin puncta (right) respectively. (B) The F-actin meshwork for RPGR KO mature MCCs: Instead of forming puncta distributions, F-actin maintains the meshwork that fails to dissolve, similar to 4-week samples. The zoomed-in image shows the actin puncta (left) and actin meshwork (right) respectively. (C) The apical surface is covered with more percentage of F-actin in RPGR KO HNCs or HBECs. (D) STORM imaging of the apical F-actin in both RPGR KO cells and healthy control cells. (E) The MCCs from patients bearing RPGR pathological variants, present with an apical surface that is covered with undissolved F-actin meshwork, similar to RPGR KO model. (F) STED imaging of the apical F-actin in both RP patient cells with RPGR pathological variants and healthy control cells. G, H) Apical Gelsolin was diminished in 4-week RPGR KO MCCs. (G) Apical gelsolin was similarly decreased for RPGR KO HBEC MCCs. (H) Apical gelsolin was decreased for the MCCs from RP patients with RPGR pathological variants. All data are presented as average ± SEM. n.s. no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-way repeated ANOVA followed by Sidak’s post hoc test (C). Analysis of MCCs from RP patients showed results mostly consistent with that observed in RPGR KO cells. For most patients with loss of function variants in RPGR (N=6/10) or RPGR ORF15 (N=6/9), the apical actin meshwork in 8-week MCCs could be readily discerned ( Fig. 6E and S5A) and STED −50 nm resolution-imaging of F-actin in patient #9 further supported our findings ( Fig 6F ). However, in some patients (#2, 4, 11, 19, 29, and 31), the F-actin accumulation seemed to be milder/normal (n=3/10 for RPGR variants and n=3/9 for RPGR ORF15 variants ) (Fig. S6B). Cases 4, 19, and 29 are RPGR ORF15 variants, and # 19 and # 29 had normal lung assessments. Case 11 ( RPGR ) was 14 years of age at the time of assessments, though he had PCD, the ocular phenotype was not advanced, as expected for that age. However, Case 2 ( RPGR) only had a mild airway anomaly assessment, a milder eye phenotype than expected for his age, and showed no F-actin changes. This patient retained decent visual acuity (20/60, Table S2) for 36 years of age. Case 31( RPGR ) had a normal lung assessment. Of the cilia phenotypes studied, 12 of 19 patients had F-actin changes (Table S3) while this involved (6/9) of those with ORF15 variants. The variability observed is clearly not solely genetically driven as frameshift variants lead to milder phenotypes (Case #2) and siblings of similar age have different phenotype severity (Cases #23 and #24). In photoreceptor and hTERT-RPE1 cells, RPGR regulates actin dynamics through interaction with Gelsolin and Cofilin ( 26 , 70 ). Staining for Gelsolin for both 4-week control and RPGR KO MCCs showed that in both RPGR KO HNCs and HBECs (N=5), the cell surface, the layer where F-actin mainly locates, had temporarily diminished Gelsolin signal, suggesting that RPGR might regulate F-actin dynamics through locating Gelsolin ( Fig. 6G and S7A). Gelsolin exists in active and non-active forms and it is the active Gelsolin that binds to F-actin ( 74 , 75 ). Reduction of Gelsolin binding to F-actin in RPGR KO MCCs suggests that RPGR might be involved in Gelsolin activation. We further examined the distribution of Gelsolin in MCCs bearing different RPGR variants (Cases #9, #11, #15, #16, #23, and #30, 6/6) and found a consistent decrease of the Gelsolin that colocalized with the surface F-actin ( Fig. 6H and S7B). In summary, RPGR regulates Gelsolin distribution spatiotemporally, and RPGR KO MCCs and MCCs with RPGR pathological variants maintained an actin meshwork that did not dissolve ( Fig. 7I ). Download figure Open in new tab Fig. 7. Latrunculin A (LatA) treatment ameliorated the motile cilia defect caused by RPGR loss of function in both RPGR KO model and RP patients MCCs. (A, B) The ciliation and cilia length anomalies in RPGR KO MCCs were ameliorated by LatA treatment. (A) Cilia were stained with acetylated antibodies (green) and the cell boundary was labelled with Phalloidin (magenta). The images showed the reduction of ciliation and cilia length in RPGR KO MCCs (middle) and the rescued phenotypes after LatA treatment (right); (B) Image quantification showed the improvement of cilia length and ciliation for 2 RPGR KO biological replicates; (C-E) The HNC cilia beat anomalies in RPGR loss of function MCCs were partially rescued by LatA treatment. (C) Cilia were stained with WGA-488 (upper) for cilia beat observation and the lower panel is the corresponding pixel signal fluctuation frequencies. The images showed a reduction in cilia beat in RPGR KO MCCs (middle) and increased frequency after LatA treatment (right). (D) Quantitative analysis showed the cilia frequency changed before and after LatA treatment. (E) Cilia beat waveform was improved after LatA treatment; (F-H) The ciliation, cilia length, and cilia beat properties in MCCs from patients with RPGR pathological variants (#9: c.127G>A, p.(Gly43Arg), #11: c.934G>T,p.(Glu260_Thr311del)) was alleviated by LatA treatment. (F) Cilia length (left) and ciliation level (right), (G) Cilia beat frequency, (H) Cilia waveform; (I) The proposed model of this study: RPGR regulates F-actin through temporarily recruiting/activating Gelsolin. Without RPGR, F-actin meshwork accumulates at the MCC apical surface, preventing ciliation, cilia elongation, and cilia beat is severely impaired. All data are presented as average ± SEM. The center, upper, and lower lines represent the median, upper, and lower quartiles, respectively (F, I). n.s., no significance, *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.0001 by two-tailed t-test (B, D, F, G, H, I, J). Motile cilia anomalies caused by RPGR variants are improved with Latrunculin A If RPGR truly regulates motile cilia through F-actin, treatment with actin polymerization inhibitors such as Latrunculin A (LatA) ( 74 , 76 ) should rescue or ameliorate the phenotype. Because previous studies showed that overexpression of active Gelsolin can rescue the ciliation issue in RPGR KD hTERT-RPE1 cells ( 70 ), we first worked on hTERT-RPE1 for its short turnaround time. From our RPGR KO hTERT-RPE1 cell pool, we found the ciliation and cilia length defects were consistent with previous studies ( 53 ) and our motile cilia data (Fig. S8A,B and C). Treatment of hTERT-RPE1 control and RPGR KO cells with 0.2 μM LatA for 24 hours led to 47.4 ± 2.0 (n=3) % ciliation of control cells and 50.2 ± 3.6 (n=3) % ciliation of the RPGR KO cells (Fig. S8D and E). The cilia length of control cells reached 4.3 ± 0.4 μm (n=3) while the RPGR KO cells had a mean cilia length of 3.9 ± 0.3 μm (n=3) (Fig. S8D and S8E), which was not significant compared to controls. This suggests that LatA can rescue the cilia phenotype caused by loss of RPGR and that RPGR works upstream of actin in cilia regulation. We also applied LatA on the patient-derived fibroblast cells from RP patients #9 and #12 that have cilia defects (Fig. S8F and S8G) and found that LatA treatment partially rescued the phenotypes (Fig. S8H and S8I). To investigate if LatA treatment could rescue motile cilia, we applied 0.1 μM LatA on ALI cultured RPGR KO MCCs starting from the 2 nd week and observed cilia properties at the 5 th week as RPGR strongly expresses during the early stage ( Fig. 2I , S9A, S9B, and S9C). The cilia length and ciliation were partially rescued (N=2, Fig. 7A and 7B ). Since F-actin is also required for basal body alignment, we reason that longtime LatA treatment might also affect cilia beat, we thus evaluated the cilia beat after 2-week LatA treatment. For RPGR KO cells, which most had static cilia, showed that after LatA treatment the percentage of cells with static cilia decreased and the percentage of cells with normal or rigid cilia beat increased significantly (N=2, Fig. 7C-E , Video S4), suggesting that actin depolymerization could indeed ameliorate the phenotypes caused by RPGR defect. The evaluation of LatA treatment on patient cells bearing pathological RPGR variants (#9 and 11, with PCD) showed results consistent with the improvement observed in RPGR KO cells ( Fig. 7F-H , Video S5). In summary, the structural anomalies and motile cilia dysfunctions caused by RPGR variants can be partially rescued by LatA treatment. DISCUSSION In this study, we investigated the mechanisms by which RPGR defects affect motile cilia functions. By characterizing the cilia from 28 patients with a wide range of RPGR variants and that of RPGR KO MCCs using advanced microscopy, we first reveal that RPGR regulates ciliation, cilia length, and cilia beat properties in airway MCCs. Our results suggest that these changes might be caused by the reduction of active Gelsolin at the apical surface, resulting in the failure of actin meshwork clearance. Treatment with LatA ameliorated all cilia phenotypes ( Fig. 7 ). This is the first mechanistic study of RPGR’s role in cilia motility. It reveals a new mechanism for PCD and complements current studies of RPGR in photoreceptors and hTERT-RPE1 cells. PCD remains an underdiagnosed disorder of the motile cilia which affects airway health outcome( 77 , 78 ). A delayed diagnosis can lead to patients’ lungs deteriorating, even to lung transplantation or death ( 8 ). Patients with RPGR variants are usually referred to eye clinics because they have RP while their respiratory symptoms can be mild and undiagnosed. RPGR has long been recognized as a PCD causative gene, but the diagnosis of RPGR -PCD can be challenging and certainly under-recognized as the cilia phenotype can be different than other causes of PCD. PCD caused by defects in other proteins may be diagnosed by demonstrating classic cilia ultrastructural defects by transmission electron microscopy (TEM), such as missing outer and/or inner dynein arms. However, RPGR defects do not result in classic ciliary ultrastructural defects ( 31 ), therefore in these cases, TEM is not useful in diagnosing PCD in RP patients. Undiagnosed PCD patients were identified through this study. This work clearly highlights how RPGR variants affect various cilia properties, which could possibly be applied for RPGR -PCD diagnosis. We showed that cilia length, motility, and rotational polarity were abnormal even when the patient’s respiratory phenotype was mild or normal. Importantly, this study shows how different RPGR variants contribute to impaired mucociliary clearance, as well as airway pathology. The variants affecting both isoforms appear to be associated with a stronger clinical phenotype however we have shown that all RPGR variants affect cilia health. There was variability in clinical outcomes even in patients carrying the same RPGR variant. This could possibly be explained by different environmental factors or genetic backgrounds and interactions. Unlike the early studies suggesting that RPGR ex1-19 was the sole isoform in airway MCCs, we showed that the RPGR ORF15 isoform is expressed in MCCs and that variants in RPGR ORF15 could affect cilia health, explaining the respiratory signs and symptoms observed in some RPGR ORF15 variant carriers. We found that RPGR in MCCs localizes both to TZ and cilia. Since the C terminal of the canonical RPGR is prenylated ( 69 ), the cilia distribution of RPGR should be associated with the cilia membrane, which is different from most PCD causative genes. Consistently, we did not identify changes in DNAH5 and DNALI1 distributions. Surprisingly, we did not find localization changes for either RPGR interacting proteins or transition zone components. Our work revealed that actin turnover appears to play a central role in the regulation of motile cilia by RPGR ( Fig. 7K ). In control cells, F-actin first forms an apical meshwork, which is presumably important for basal body docking and thus ciliation. The apical meshwork later dissembles and forms actin paths under basal bodies or bundles aligning basal bodies for cilia stabilization and beat synchronization. Though previous studies in Xenopus suggested a two-layer of actin existing on the surface of the MCCs ( 76 , 79 ), we only identified one, which may reflect organism differences, or that our staining lacks a good basal body reference marker. Unlike control cells, mature RPGR LOF MCCs retained the condensed meshwork which restricts ciliation and cilia elongation, and limits cilia beat. This phenotype likely relates to the reduced level of active Gelsolin observed at the apical surface, which is most obvious for 4-week MCCs. Cofilin is also involved in the regulation of F-actin by RPGR ( 70 ). We could not explore its role further due to the poor performance of the antibody. Treatment with LatA partially rescued ciliation and cilia length and improved the cilia beat defect. Because of the toxicity of LatA, we were not able to further enhance the LatA treatment. Phalloidin staining of the F-actin suggests although the actin meshwork signal was weakened after LatA treatment, the actin meshwork still existed (data not shown). Another possibility is that mature MCCs also need actin bundles for cilia beat. LatA treatment might prevent the actin bundle formation so full rescue of cilia beat may not be possible. In photoreceptor connecting cilia, RPGR regulates membrane turnover through actin, key to the stability of this transport system ( 26 , 70 ). Here we show that RPGR also relies on actin to regulate motile cilia in MCCs. Our study reveals that RPGR utilizes the same pathway to realize different outcomes in different cell types. Disruption of rotational but not planar polarity is a common feature of PCD and has been proposed to aid PCD diagnosis ( 46 , 80 , 81 ). Our study here finds that loss of RPGR affects both planar and rotational polarity. RPGR has been reported to be associated with the PCP pathway by affecting the Dvl through the proteasome in hTERT-RPE1 cells ( 55 ). This is the first study showing the loss of Vangl1 at the cell junctions. Since the downstream of the PCP pathway involves actin dynamics, we speculate that the PCP pathway might also be involved in the regulation of actin polymerization by RPGR. However, it is unclear how RPGR regulates the distribution/expression of Vangl1. Because of the lack of other reliable PCP antibodies, we did not further explore this question. The study has several limitations in addition to patient recruitment for a rare disease during the COVID-19 pandemic: heterogeneous RPGR KO cell pools were generated rather than a homogenous cell line, which could contribute to the heterogeneity of the cilia beat in RPGR KO MCCs; Our study was also limited to human cell ex vivo models and it needs further in vivo investigation for mechanistic studies such as using mouse model, however, the mouse PCD phenotype is usually mild regarding respiratory symptoms ( 80 , 82 – 84 ); Although we identified a role of F-actin turnover in the pathogenesis of RPGR -PCD, we cannot exclude the role of other interacting pathways in the alteration of motile cilia phenotypes. It might be worthwhile to assess motile cilia composition changes using systematic ways such as proteomics or cryoEM ( 85 – 89 ). RPGR localizes at the TZ and cilia, but the actin meshwork forms beneath the apical cell membrane. How RPGR regulates actin dynamics spatiotemporally is worth further investigation. In summary, our work showed for the first time that RPGR ORF15 is expressed in airway MCCs, and variants in both isoforms could lead to motile cilia defects in symptomatic and asymptomatic patients. Variants in RPGR led to a more severe airway and cilia phenotype but only a few developed PCD. As this study was not longitudinal, we do not know about the progression of these observations. This study reveals the actin pathway is involved and could be manipulated to treat RPGR -PCD and opens new avenues of research for RPGR -related diseases and opportunities for improved diagnosis and patient management. Materials and methods Study design The purpose of this project is to study the mechanism of PCD caused by RPGR defects. Thirty-two RP patients were recruited and most showed different respiratory symptoms. RPGR CRISPR KO multiciliated cells were also generated to validate the cellular phenotypes observed in patient cells. Super-resolution microscopy, live cilia beat observation and drug-related rescue experiments were carried out to characterize the cellular phenotypes and to reveal the mechanism. Patient Phenotype Characterisation All patient participants had a comprehensive eye exam in addition to optical coherence tomography (OCT) imaging, kinetic visual field (Goldmann), and electroretinography when possible (Table S2). The respiratory phenotypes were characterized using PCD-specific protocols (questionnaire, natural history, nasal nitric oxide measurements (nNO), chest X-ray, spirometry, and physical exam) (Table S2). Cell collection and culturing Human nasal cells (HNC) were obtained from six healthy volunteers at HKUST and the Hospital for Sick Children (REB# HREP-2021-0268 (HKUST), 1000005895(SickKids)), and from patients with RPGR variants at the Hospital for Sick Children using cytology brushes as previously described ( 46 , 90 ). For all the measurements, the researchers were blind to the genetic information of the subjects. After nasal brushing, HNCs were collected in the pre-warmed BEBM medium (Lonza, cc-3170), washed, and subcultured until confluence. Cells were subsequently seeded on 24-transwell inserts and differentiated with PneumaCult-ALI media (Stem Cell Technologies, 05001) following the manufacturer’s protocol. HBECs were sourced from Lonza (cc2504S) and expanded and differentiated following the manufacturer’s protocol. The BEBM and PneumaCult-ALI media were supplemented with 100 μg/mL Vancomycin, 80 μg/mL Tobramycin, 50 μg/mL Gentamicin, and 1X Antibiotic-Antimycotic. HEK293T cells (gift from Ting XIE, HKUST) were cultured with high-glucose DMEM media (ThermoFisher Scientific, 11965084) supplemented with 10% fetal bovine serum and 1% streptomycin/penicillin. hTERT-RPE1 (ATCC CRL-4000) cells were cultured with DMEM/F12 media (ThermoFisher Scientific, 11320033), supplemented with 10% fetal bovine serum, 1% streptomycin/penicillin and 0.1 mg/mL hygromycin. Fetal bovine serum was removed from the medium to induce ciliation of hTERT-RPE1. Fibroblast cell lines were established at Biobank (The Hospital for Sick Children) as described. Briefly, skin biopsies of the upper arm of patients and controls were collected in sterile Alpha MEM medium (AMEM, Wisent, #310-022-CL) with 15 % fetal calf serum, and 1% streptomycin/penicillin. In a 60mm dish, biopsies were cut into small pieces and collagenase was added. Each coverslip was added to the top of each skin piece, so they keep contact with the top of the pieces to grow. The same supplemented AMEM was added and samples were incubated (37°C and 5% CO 2 ). After 1.45 hours, pieces and media with collagenase were transferred and centrifuged. The pellet was pipetted vigorously to break up the pieces and seeded on a T25 flask with the AMEM media supplemented with 15% fetal calf serum for another 3 continues days. For further expansion, purified skin fibroblasts from RP patients were cultured in MEM alpha (ThermoFisher Scientific, 12561056) with 10% fetal bovine serum. The growth medium was changed with Opti-MEM (ThermoFisher Scientific, 31985070) to induce the ciliation of skin fibroblasts. Plasmid construction and lentivirus preparation The lentiCRISPRv2 (Addgene#52961) plasmid was digested with BsmBI-v2 (NEB, R0739), and then ligated with annealed oligos. The guide sequences for RPGR KO are as follows ( 53 ): Guide 1: GTCCCTGTACATCTTTCATG and guide 2: AAAGTGAAATTAGCTGCCTG. For lentivirus packaging, HEK293T cells were cultured with high-glucose, sodium pyruvate-supplemented DMEM media (ThermoFisher Scientific, 11995073) with 10% fetal bovine serum, and transfected with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the lentiviral gRNA plasmid with the 1:10:10 mass ratio by applying PEI MAX (Polysciences, 24765) in Opti-MEM. The medium was changed the next day, and the viral supernatant was harvested 48h post-transfection, filtered with 0.45 μm filter, concentrated with PEG-it virus precipitation solution (ExCell Bio, LV810A-1), and frozen in −80 °C freezer for later use. Generation of CRISPR KO cells We generated RPGR KO pools in hTERT-RPE1 cells using lentivirus transduction at a MOI of 2 (each cell receives a copy of lentivirus expressing gRNA1 and a copy of lentivirus expressing gRNA2). The resultant KO pool was selected with puromycin treatment for 7 days. The whole genome DNA was extracted, and the KO region was amplified using designed primers (Forward: ACAAGGGGTTTGTATGGATAAA and Reverse: AAAACCCTAATTTTACTGTTGCC). The KO efficiency was evaluated by DNA gel electrophoresis and by Sanger sequencing, which was analyzed by the ICE CRISPR analysis tool (SYNTHEGO). HNC/HBEC RPGR KO pools were generated using lentivirus transduction. Low passage basal cells (P01-P02) were cultured on collagen (STEMCELL, 07001) coated 6-well plate in BEBM medium, and incubated until cells reached 30-50% confluent. For lentivirus transduction, the BEBM medium was supplemented with 15 μg/mL polybrene (Santa Cruz, sc-134220) and 20 μmol/mL HEPES (ThermoFisher Scientific, 15630080), and the lentivirus transduction was conducted at a MOI of 2. When basal cells reached ∼80% confluent, they were sub-cultured with feeder cells in DMEM medium, supplemented with 7% fetal bovine serum, 30% Ham’s F-12 nutrient mix (ThermoFisher Scientific, 11765047), 24 mg/L adenine (Sigma, 1152), 4.5 mg/L hTGF (ThermoFisher Scientific, AF-100-15), 1 μg/L hydrocortisone (StemCell, 7925), 10 mg/L insulin (Sigma, I9278), and 8.6 μg/L cholera toxin (Sigma, C8052). The feeder cells for co-culturing were generated by irradiation of puromycin-resistant NIH-3T3 cells (3000-5000 rads of gamma radiation). The resultant KO pool was selected in 1 μg/mL puromycin for 7-10 days until basal cells reached confluency, and seeded on 24-transwell inserts with a density of ∼5.0 x 10 5 cells/cm 2 . When cells reached confluency, the medium was changed to PneumaCult-ALI for differentiation. The genomic DNA was extracted from a portion of genomic edited basal cells for KO efficiency evaluation. Immunofluorescence Samples were fixed with 4% paraformaldehyde (Sigma, 158127) and 0.1% glutaraldehyde (Electron Microscopy Sciences, 16019) for 15 minutes, then reduced with 0.1% sodium borohydride (Sigma, 2643) for 6-7 minutes, and blocked with 3% bovine serum albumin (Sigma, A8806) and 0.2% Triton-X 100 in 1xPBS (pH 7.4) for 30 minutes. For methanol fixation, samples were fixed with −20°C histological grade anhydrous methanol for 30 minutes and then blocked with 3% bovine serum albumin and 0.05% Tween 20 in 1xPBS (pH 7.4) for 30 minutes. Optionally, to preserve the morphology of motile cilia, the Transwell filter samples were treated with 0.01% Triton-X 100 in 1xPBS (pH 7.4) for 1 minute before methanol fixation. Primary antibodies were incubated at 37°C for 3 hours or 4°C overnight. The antibodies used in this study were summarized in Table S4. Secondary antibodies were incubated at 37°C for 30 minutes. DAPI (1 μg/mL) was incubated at 37°C for 1 hour and Phalloidin-Alexa 647 (1: 50) was incubated at 37°C for 7 hours. All washing steps were processed with 1xPBS. Samples were mounted with 0.5% n-propyl gallate and 80% glycerol in 1xPBS, sandwiched between coverslips (25 mm, No. 1.5 H, Deckglaser) and slides, and sealed with nail polish. Live cell cilia beat observation Transwell cultured airway epithelial cells were gently rinsed with PBS to remove mucus and cell debris. The filters were then cut off the Transwell, and incubated with PneumaCult-Ex media containing 100 μg/mL wheat germ agglutinin (WGA)-Alexa 488 (ThermoFisher Scientific, W11261) at 37°C for 20 minutes. The medium was then changed to PneumaCult-Ex media. The labeled filter was put into a confocal dish (MatTek, P35G-1.5-14-C) with the sample side facing the coverslip for imaging. WGA-488 labeled samples were captured at around room temperature (23℃) under an inverted microscope and a 488nm excitation laser was used to excite the fluorophores and the cilia beat data were collected using a 100x/1.50 oil immersion objective lens. Videos were recorded at 50 frames per second (fps) for 10 seconds. For the beads propelling experiment, Transwell cultured 8-week airway epithelial cells were gently rinsed with PBS to remove mucus, and the whole filter was put onto a confocal dish with the sample side facing against the coverslip for imaging. Fluorescent beads with a diameter of 1 μm (ThermoFisher Scientific, F8821) were diluted 1:50 with 1X PBS, and the diluted beads were added to the apical surface. The propelled beads were captured at around room temperature (23℃) under an inverted microscope and a 561nm excitation laser was applied to excite the fluorescent beads, and the data were collected using a 60x/1.20 water immersion objective lens. Videos were recorded at 50 fps for 10 seconds. SIM imaging and data analysis 3D-SIM datasets were collected using a Zeiss Elyra 7 with Lattice SIM with alpha Plan-Apochromat 63x/1.46 Oil immersion objective lens and with an additional 1.6x optovar. The fluorophores were excited with 488 nm (500 mW), 561 nm (500 mW), and/or 647 nm lasers (500 mW) tuned to 0.5-10% power through the ZEN software. For each image field, grid excitation patterns were applied on the sample plane and collected for thirteen phases. The fluorescence was collected by the objective and filtered by proper band pass mirrors before reaching the camera. Two PCO edge sCMOS cameras were used to acquire a 5-10 μm thick Z stack with 100 nm per slice. The raw data was reconstructed using the SIM module of ZEN Software. Channel alignment was conducted using a calibrated file generated by Tetraspec beads (ThermoFisher Scientific, T7279). Maximum-intensity projection images were produced for subsequent analysis. Cilia length measurement Side-view multiciliated cells on the maximum intensity projection images were chosen for measurements. The cilia length was obtained by measuring the distance from the cilia tip to the base using the free drawer tool of Zeiss ZEN. The average length of 10 cilia within one cell was defined as the cilia length of each MCC. Ciliation level The ALI filter samples were fixed with methanol and stained as above described with antibodies against acetylated tubulin and POC1B. For each cell, the number of cilia and basal bodies were manually counted using the software Fiji ImageJ, and the ratio of the total number of cilia to the total number of basal bodies was calculated as the ciliation level. Rotational polarity analysis 8-week filter samples were fixed with methanol as above described, basal bodies were stained with POC1B antibodies and basal feet were stained with Centriolin antibodies. Samples were observed with 3D-SIM and the maximum intensity projection (MIP) of the reconstructed images was exported as ome.tiff (8 bit) for rotational polarity analysis in MATLAB ( 46 ). Briefly, binary images were first generated by applying a threshold for two channels. Individual basal body and basal foot were identified in the binary images, paired by pairwise nearest neighbour search, and filtered with a 600 nm cutoff. The basal body-basal foot pairs within one cell were determined by manually defining the contour of the cell with the MATLAB free drawing tool. The direction of each pair was the direction from the center of the basal body to the center of the basal foot. The cilia beat coordination in one cell was represented by the aligned vector length –an average of all basal body basal foot direction within one cell-with value close to 1 meaning full coordination and 0 meaning no coordination. STORM imaging and data analysis For RPGR STORM imaging, cell suspensions were generated by digesting the filter samples with 0.025% Trypsin and resuspending disassociated cells in PneumaCult-Ex media. The cells were then spread and dried on coverslips (25 mm, No. 1.5 H, Deckglaser). The cells were immunostained with primary antibodies against RPGR (1:100 dilution), and then labeled with goat anti rabbit F(ab’)2 Alexa 647 (ThermoFisher Scientific, A21237). For actin STORM data, the filter sample was fixed with PFA and GA, and then labeled with Phalloidin-Alexa 647. The labeled sample was mounted with imaging buffer. The imaging buffer contains 50 mM Tris (pH 8.0), 10 mM NaCl and 10% Glucose, and is supplied with 50 mM β-mercaptoethanol (Sigma, 2661), 56 mg/mL Glucose oxidase (Sigma, 3231), and 17 mg/mL Catalase (Sigma, C9322). Concaved slides were used and an imaging buffer was added between coverslip and slide. The slide was sealed with nail polish. The labeled samples were imaged with an Abbelight SAFe360 setup with 100x/1.50 Oil immersion objective lens, and the 647 excitation laser (500 mW) power was set at 10% to collect the conventional image, and with 100% to switch the fluorophores to dark state and for STORM imaging. The 405 laser (100 mW) power was manually adjusted from 0 to 100% for fluorophores activation. The exposure time was set to 20-50 ms and 60,000∼200,000 frames were collected by a sCMOS Hamamatsu ORCA Fusion camera. Acquired STORM data was then processed by the Abbelight NEO Analysis software for Gaussian fitting. Briefly, after background estimation and removal, the detected molecules were fitted, and the corresponding lateral and axial positions of each activated fluorescent molecule were extracted. Then the super-resolution image was reconstructed based on the coordinates after drift-correction by cross-correlation. The precision was averaged from the localization precisions for all the single molecule events, and the resolution was around 20 nm. STED imaging and data analysis For Phalloidin STED imaging, the Phalloidin-Alexa 647 labeled filter samples were observed using the STEDYCON (Abberior) Super-Resolution Microscope with 100x/1.4 Oil immersion objective lens, and the ultra-short pulse red laser (800 μW) excitation power was set at 1%, and the 775 nm depletion laser (1.2 W) power was set at 20% to collect the STED datasets. Acquired STED data was then deconvoluted by the Huygens Professional Software. Latrunculin A rescue experiment hTERT-RPE1 control and RPGR KO cells were seeded on coverslips (25 mm diameter, thickness #1.5) with a density of 2.1 x 10 4 cells/cm 2, and 6 hours after cell seeding, the DMEM/F12 growth media was supplemented with 0.2 μM Latrunculin A (Santa Cruz, sc-202691) for another 24 hours. The control cells were treated with DMSO. Samples were then immunostained as described above with antibodies against acetylated tubulin, ARL13B, and DAPI. Skin fibroblast cell Latrunculin A treatment was the same as hTERT-RPE1 cells. Airway basal cells were seeded on Transwell supports and differentiated at the air-liquid interface for 2 weeks and switched to ALI medium containing 0.1 μM Latrunculin A for another 2∼3 weeks. After 2 weeks of treatment, samples were collected for cilia beat analysis. After treatment for 3 weeks, cells were harvested to measure ciliation and cilia length. Cilia beat analysis Cilia beat leads to oscillation of signal intensity over time at cilia localized pixels. The contour of the ciliated cells was defined by applying intensity threshold (set as the mean of the whole plot) to the maximum intensity projection plot and a Gauss smoothing. The frequency of oscillations for every pixel of the recording was analyzed by computing the Fourier transform of the corresponding intensity changes over time using the MATLAB fast Fourier transform function (fft()). For each pixel, cilia beat frequency (CBF) was calculated as the frequency where the absolute value of the Fourier transform was maximal. This resulted in a scaled spatial CBF map. To reduce background signal fluctuation noise, we listed all connected pixels in the frequency map using the bwconncomp() function and removed regions with fewer than 144 pixels ( 91 , 92 ). Similarly, we defined regions of interest (ROIs) where the intensity change could reflect the single cell cilia beat frequency manually using the ImageJ plugin ROI Manager. The ROI sizes are variable depending on the actual cell size. Similar FFT process was performed in R to generate the CBFs. For samples with less ciliated cells, we tried to take all cells into account and randomly picked >30 cells in highly ciliated samples. For cilia beat mode analysis, the end-on-view WGA-488 labeled cilia beat videos were analyzed manually. Except the normal beating, four other different types of beat mode can be identified: 1) static cilia; 2) minuscule beat which means cilia beat is restricted with pretty low CBF; 3) tremendous beat which means that cilia beat amplitude is large but there is a loss of power and recovery stroke; 4) uncoordinated beat which means cilia beat in rotationary or/and uncoordinated manner. For each ROI, the cell number for each beat mode was counted, and the ratio was calculated by dividing cell number for each beat mode by the total cell number. Single cell sequencing and data analysis We customized the alignment reference by removing the gene-level annotation for the RPGR gene from the GRCh38 human genome reference obtained from ENSEMBL, and designating each RPGR transcript isoform as an independent gene. A new genome reference was then constructed using Cell Ranger (v7.0.0) ( 93 ) (the code for this customization is available at https://github.com/Jiayi-Zheng/Build-Gene-Isoform-Reference-for-10X ). Sequence alignment was subsequently performed on a previously published human fetal tracheal scRNA-seq dataset (gestation week 21) ( 47 ). The dataset was processed and further divided to exclude non-epithelial cells with Seurat (v5.0.0), and VlnPlot() was used to visualize the raw count distribution of RPGR transcripts across various cell types. RNA extraction and RT-PCR The total RNA of cultured human airway MCCs was extracted and reverse-transcribed according to the manufacturer’s protocol (Vazyme, RC112, and R412). The obtained cDNA was then amplified using the forward primer: CAGATGAGGAAGTAGAGATCCCAGAG and reverse primer ( 94 ): CTCTCCTTCCTCCTTTTCAC. The obtained product was assessed by DNA gel electrophoresis and Sanger sequencing. The amplified band with primers of GAPDH was applied as the loading control. TEM Human nasal cells were scaped and fixed in 2% glutaraldehyde diluted in 100 mM sodium cacodylate, dehydrated with 200 mM D-sucrose dissolved in 100 mM sodium cacodylate. The samples were post-fixed with 1% OsO4, dehydrated with the graded ethanol, and finally embedded in resin. Samples were sliced to a thickness of ∼90 nm and imaged with the FEI Tecnai 20 TEM. Statistical analysis The details of the statistics in this study are specified in the main text, figures, and/or figure legends. Supplementary Materials Supplementary figures Fig.S1. Validation of the predicted RPGR variants. Fig.S2. MCCs with RPGR defect presented reduced cilia length and disrupted planar polarity. Fig.S3. Workflow of single-cell cilia beat frequency analysis. Fig.S4. Validation of the expression of RPGR ORF15 isoform in human airway MCCs. Fig.S5. RPGR defect doesn’t affect transition zone and axoneme ODAs/IDAs components. Fig.S6. Apical F-actin meshwork accumulated in the MCCs from RP patients with pathological RPGR variants. Fig.S7. RPGR defect leads to diminished apical Gelsolin. Fig.S8. Cilia issues for RPGR KO hTERT-RPE1 can be rescued with LatA treatment. Fig.S9. RPGR expression at different developmental stages and the timeline for the LatA rescue experiment. Fig.S10. LatA treatment partially rescued the affected MCCs with pathological RPGR variants. Supplementary tables Table S1. (1) List of patients involved in this study with the disease-associated RPGR variants. (2) Disease-associated RPGR variants in the patient cohort. Legend: gDNA: genomic DNA position of variant; ClinVar: database of reported variant with associated phenotype; ACMG: American College of Medical Geneticists variant classification system; GnomAD: control database; Revel, SIFT, MutScore, PhiloP, Splice AI and Pangolin: publicly available software used to determine the pathogenicity of variants. Table S2. (1) Summary of the airway assessments. Legend and abbreviations: Age is in years, NNO: nasal nitric oxide measurements, CXR: chest X-ray, CT: computed tomography. (2) Summary of the eye phenotypes. Legend and abbreviations: Age in years at the time of test; BCVA: best corrected visual acuity; OD: right eye, OS: left eye, refraction is in diopters; ERG: electroretinogram; RCD: rod-cone dystrophy, when the cases are advanced it is hard to determine; GVF: Goldmann visual field width in degrees (normal width is 120 degrees); HRR: color vision test, result out of 6 plates; CRT: central retinal thickness measured in µm. Table S3. Summary of all the patients’ cilia characteristics in this study. Table S4. List of antibodies used in this study. Movie S1. Cilia beat video for MCCs from healthy control, #9, and #28. Movie S2. Cilia beat video for control and RPGR KO MCCs (3 biological replicates) Movie S3. Defective mucociliary clearance in RPGR KO MCCs revealed by the beads propelling experiment Movie S4. Cilia beat video for control and RPGR KO MCCs treated with DMSO and LatA Movie S5. Cilia beat video for healthy control, #9 MCCs with DMSO treatment, #9 MCCs with LatA treatment, #11 MCCs with DMSO, and #11 MCCs treated with LatA Funding This work is supported by the General Research Fund (GRF) from the Research Grants Council of Hong Kong (16100823, 26101022) to Z. L. and Z.L.’s startup fund, Canadian Institutes of Health Research (CIHR) project grant (FRN 156154), and the Henry Brent Chair in Innovative Pediatric Ophthalmology grant to E.H. and CIHR project grant (FRN 156154) to S.D. Author contributions Y.W., Z.L. designed the experiments and Y.W. performed most experiments. S.D., W.W., and E.H. evaluated the clinical phenotypes and provided the patient samples. E.T., J.M.L. collected the patient samples, performed immunostaining of the fresh nasal cells, and collected the confocal images. B.L. developed methods and analyzed the cilia beat data. J.C. generated the RPGR KO hTERT-RPE1 cells. V.M. and H.F. participated in the early studies of the project. Y.W. and Z.L. wrote the manuscript. Z.L., S.D., E. H, and E.T., revised the manuscript. Competing interests We declare no conflicts of interest. Data and materials availability All data related to this project are present in the paper or the Supplementary Materials. Acknowledgment We thank the patients and their families involved in this study and the healthcare providers. We thank Ting XIE (HKUST) and Shuhuai YAO (HKUST) for sharing cell lines, Randy Yat Choi POON (HKUST) for sharing Caesium 137 gamma radiator, and the Biosciences Central Research Facility (HKUST) for providing the super-resolution microscopy of Zeiss Elyra 7 with Lattice SIM, and the Biosciences Central Research Facility (HKUST-GZ) for providing the STEDYCON STED Super-Resolution Microscope. We also thank students and technicians who contributed to this study’s smaller portions: Alexandra Albulesco, Dan Eddy, Tuo Zhang, Quynh P.H Nguyen, and Alexa Fitzpatrick. References and Notes 1. ↵ N. Spassky , A. Meunier , The development and functions of multiciliated epithelia . Nat Rev Mol Cell Biol 18 , 423 – 436 ( 2017 ). OpenUrl CrossRef PubMed 2. ↵ J. Wallmeier , K. G. Nielsen , C. E. Kuehni , J. S. Lucas , M. W. Leigh , M. A. Zariwala , H. Omran , Motile ciliopathies . Nat Rev Dis Primers 6 , 77 ( 2020 ). OpenUrl CrossRef PubMed 3. ↵ H. M. Mitchison , E. M. Valente , Motile and non-motile cilia in human pathology: from function to phenotypes . , doi: 10.1002/path.4843 . OpenUrl CrossRef PubMed 4. ↵ P. Mill , S. T. Christensen , L. B. Pedersen , Primary cilia as dynamic and diverse signalling hubs in development and disease . Nat Rev Genet 24 , 421 – 441 ( 2023 ). OpenUrl CrossRef PubMed 5. ↵ H. May-Simera , K. Nagel-Wolfrum , U. Wolfrum , Cilia - The sensory antennae in the eye . Progress in Retinal and Eye Research 60 , 144 – 180 ( 2017 ). OpenUrl CrossRef PubMed 6. ↵ P. G. Noone , M. W. Leigh , A. Sannuti , S. L. Minnix , J. L. Carson , M. Hazucha , M. A. Zariwala , M. R. Knowles , Primary Ciliary Dyskinesia: Diagnostic and Phenotypic Features . Am J Respir Crit Care Med 169 , 459 – 467 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ A. Barbato , T. Frischer , C. E. Kuehni , D. Snijders , I. Azevedo , G. Baktai , L. Bartoloni , E. Eber , A. Escribano , E. Haarman , B. Hesselmar , C. Hogg , M. Jorissen , J. Lucas , K. G. Nielsen , C. O’Callaghan , H. Omran , P. Pohunek , M.-P. F. Strippoli , A. Bush , Primary ciliary dyskinesia: a consensus statement on diagnostic and treatment approaches in children . European Respiratory Journal 34 , 1264 – 1276 ( 2009 ). OpenUrl Abstract / FREE Full Text 8. ↵ C. O. Pioch , D. W. Connell , A. Shoemark , Primary Ciliary Dyskinesia and Bronchiectasis: New Data and Future Challenges . Archivos de Bronconeumología 59 , 134 – 136 ( 2023 ). OpenUrl CrossRef PubMed 9. ↵ D. T. Hartong , E. L. Berson , T. P. Dryja , Retinitis pigmentosa . The Lancet 368 , 1795 – 1809 ( 2006 ). OpenUrl CrossRef 10. ↵ N. Cross , C. Van Steen , Y. Zegaoui , A. Satherley , L. Angelillo , Retinitis Pigmentosa: Burden of Disease and Current Unmet Needs . OPTH Volume 16 , 1993 – 2010 ( 2022 ). OpenUrl 11. ↵ G. McCray , P. Griffin , P. Martinello , R. De Iongh , J. Ruddle , P. Robinson , Altered airway ciliary orientation in patients with X-linked retinitis pigmentosa . Thorax 74 , 914 – 916 ( 2019 ). OpenUrl Abstract / FREE Full Text 12. ↵ E. M. Stone , J. L. Andorf , S. S. Whitmore , A. P. DeLuca , J. C. Giacalone , L. M. Streb , T. A. Braun , R. F. Mullins , T. E. Scheetz , V. C. Sheffield , B. A. Tucker , Clinically Focused Molecular Investigation of 1000 Consecutive Families with Inherited Retinal Disease . Ophthalmology 124 , 1314 – 1331 ( 2017 ). OpenUrl CrossRef PubMed 13. D.-H. Hong , B. S. Pawlyk , J. Shang , M. A. Sandberg , E. L. Berson , T. Li , A retinitis pigmentosa GTPase regulator (RPGR)-deficient mouse model for X-linked retinitis pigmentosa (RP3) . , doi: 10.1073/pnas.97.7.3649 . OpenUrl Abstract / FREE Full Text 14. ↵ Y. Zhao , D.-H. Hong , B. Pawlyk , G. Yue , M. Adamian , M. Grynberg , A. Godzik , T. Li , The retinitis pigmentosa GTPase regulator (RPGR)-interacting protein: Subserving RPGR function and participating in disk morphogenesis . Proc. Natl. Acad. Sci. U.S.A . 100 , 3965 – 3970 ( 2003 ). OpenUrl Abstract / FREE Full Text 15. ↵ M. R. Krawczyński , M. Witt , PCD and RP: X-linked inheritance of both disorders? Pediatric Pulmonology 38 , 88 – 89 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ K. Takahashi , R. Sudharsan , W. A. Beltran , Mapping protein distribution in the canine photoreceptor sensory cilium and calyceal processes by ultrastructure expansion microscopy (2024) , doi: 10.1101/2024.06.27.600953 . OpenUrl Abstract / FREE Full Text 17. ↵ D.-H. Hong , B. Pawlyk , M. Sokolov , K. J. Strissel , J. Yang , B. Tulloch , A. F. Wright , V. Y. Arshavsky , T. Li , RPGR Isoforms in Photoreceptor Connecting Cilia and the Transitional Zone of Motile Cilia . Invest. Ophthalmol. Vis. Sci . 44 , 2413 ( 2003 ). OpenUrl Abstract / FREE Full Text 18. ↵ D.-H. Hong , B. S. Pawlyk , M. Adamian , M. A. Sandberg , T. Li , A Single , Abbreviated RPGR-ORF15 Variant Reconstitutes RPGR Function In Vivo . Invest. Ophthalmol. Vis. Sci . 46 , 435 ( 2005 ). OpenUrl Abstract / FREE Full Text 19. ↵ J. Neidhardt , E. Glaus , D. Barthelmes , C. Zeitz , J. Fleischhauer , W. Berger , Identification and characterization of a novel RPGR isoform in human retina . Hum. Mutat . 28 , 797 – 807 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 20. A. K. Ghosh , C. A. Murga-Zamalloa , L. Chan , P. F. Hitchcock , A. Swaroop , H. Khanna , Human retinopathy-associated ciliary protein retinitis pigmentosa GTPase regulator mediates cilia-dependent vertebrate development . Human Molecular Genetics 19 , 90 – 98 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 21. ↵ J. D. Ash , R. E. Anderson , M. M. LaVail , C. Bowes Rickman , J. G. Hollyfield , C. Grimm H. Khanna , in Retinal Degenerative Diseases , Advances in Experimental Medicine and Biology . J. D. Ash , R. E. Anderson , M. M. LaVail , C. Bowes Rickman , J. G. Hollyfield , C. Grimm , Eds. ( Springer International Publishing , Cham , 2018 ), vol. 1074 , pp. 521 – 538 . OpenUrl CrossRef PubMed 22. ↵ R. Kirschner , T. Rosenberg , R. Schultz-Heienbrok , S. Lenzner , S. Feil , R. Roepman , F. P. M. Cremers , H.-H. Ropers , W. Berger , RPGR Transcription Studies in Mouse and Human Tissues Reveal a Retina-Specific Isoform That Is Disrupted in a Patient With X-Linked Retinitis Pigmentosa . Human Molecular Genetics 8 , 1571 – 1578 ( 1999 ). OpenUrl CrossRef PubMed Web of Science 23. R. Vervoort , A. Lennon , A. C. Bird , B. Tulloch , R. Axton , M. G. Miano , A. Meindl , T. Meitinger , A. Ciccodicola , A. F. Wright , Mutational hot spot within a new RPGR exon in X-linked retinitis pigmentosa . Nat Genet 25 , 462 – 466 ( 2000 ). OpenUrl CrossRef PubMed Web of Science 24. S. He , S. K. Parapuram , T. W. Hurd , B. Behnam , B. Margolis , A. Swaroop , H. Khanna , Retinitis Pigmentosa GTPase Regulator (RPGR) protein isoforms in mammalian retina: Insights into X-linked Retinitis Pigmentosa and associated ciliopathies . Vision Research 48 , 366 – 376 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 25. ↵ L. Moreno-Leon , E. L. West , M. O’Hara-Wright , L. Li , R. Nair , J. He , M. Anand , B. Sahu , V. R. M. Chavali , A. J. Smith , R. R. Ali , S. G. Jacobson , A. V. Cideciyan , H. Khanna , RPGR isoform imbalance causes ciliary defects due to exon ORF15 mutations in X-linked retinitis pigmentosa (XLRP) . Human Molecular Genetics 29 , 3706 – 3716 ( 2021 ). OpenUrl CrossRef PubMed 26. ↵ R. Megaw , A. Moye , Z. Zhang , F. Newton , F. McPhie , L. C. Murphy , L. McKie , F. He , M. K. Jungnickel , A. Von Kriegsheim , P. A. Tennant , C. Brotherton , C. Gurniak , A. K. Gross , L. M. Machesky , T. G. Wensel , P. Mill , Ciliary tip actin dynamics regulate photoreceptor outer segment integrity . Nat Commun 15 , 4316 ( 2024 ). OpenUrl CrossRef PubMed 27. ↵ D. Wätzlich , I. Vetter , K. Gotthardt , M. Miertzschke , Y. Chen , A. Wittinghofer , S. Ismail , The interplay between RPGR, PDEδ and Arl2/3 regulate the ciliary targeting of farnesylated cargo . EMBO Reports 14 , 465 – 472 ( 2013 ). OpenUrl Abstract / FREE Full Text 28. A. L. Moran , L. Louzao-Martinez , D. P. Norris , D. J. M. Peters , O. E. Blacque , Transport and barrier mechanisms that regulate ciliary compartmentalization and ciliopathies . Nat Rev Nephrol 20 , 83 – 100 ( 2024 ). OpenUrl CrossRef PubMed 29. H. Khanna , Photoreceptor Sensory Cilium: Traversing the Ciliary Gate . Cells 4 , 674 – 686 ( 2015 ). OpenUrl CrossRef 30. ↵ de la Camara , C.MF. , Cehajic-Kapetanovic , J. , MacLaren , R.E. , in Advances in Vision Research, Volume IV , ( 2024 ). 31. ↵ A. J. Shapiro , M. W. Leigh , Value of transmission electron microscopy for primary ciliary dyskinesia diagnosis in the era of molecular medicine: Genetic defects with normal and non-diagnostic ciliary ultrastructure . Ultrastructural Pathology 41 , 373 – 385 ( 2017 ). OpenUrl CrossRef PubMed 32. ↵ J. S. Lucas , A. Barbato , S. A. Collins , M. Goutaki , L. Behan , D. Caudri , S. Dell , E. Eber , E. Escudier , R. A. Hirst , C. Hogg , M. Jorissen , P. Latzin , M. Legendre , M. W. Leigh , F. Midulla , K. G. Nielsen , H. Omran , J.-F. Papon , P. Pohunek , B. Redfern , D. Rigau , B. Rindlisbacher , F. Santamaria , A. Shoemark , D. Snijders , T. Tonia , A. Titieni , W. T. Walker , C. Werner , A. Bush , C. E. Kuehni , European Respiratory Society guidelines for the diagnosis of primary ciliary dyskinesia . Eur Respir J 49 , 1601090 ( 2017 ). OpenUrl Abstract / FREE Full Text 33. ↵ A. Moore , RPGR is mutated in patients with a complex X linked phenotype combining primary ciliary dyskinesia and retinitis pigmentosa . Journal of Medical Genetics 43 , 326 – 333 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 34. ↵ Z. Kolkova , P. Durdik , V. Holubekova , A. Durdikova , M. Jesenak , P. Banovcin , Identification of a novel RPGR mutation associated with retinitis pigmentosa and primary ciliary dyskinesia in a Slovak family: a case report . Front. Pediatr . 12 , 1339664 ( 2024 ). OpenUrl CrossRef PubMed 35. ↵ S. Richards , N. Aziz , S. Bale , D. Bick , S. Das , J. Gastier-Foster , W. W. Grody , M. Hegde , E. Lyon , E. Spector , K. Voelkerding , H. L. Rehm , Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology . Genetics in Medicine 17 , 405 – 424 ( 2015 ). OpenUrl CrossRef PubMed 36. N. M. Ioannidis , J. H. Rothstein , V. Pejaver , S. Middha , S. K. McDonnell , S. Baheti , A. Musolf , Q. Li , E. Holzinger , D. Karyadi , L. A. Cannon-Albright , C. C. Teerlink , J. L. Stanford , W. B. Isaacs , J. Xu , K. A. Cooney , E. M. Lange , J. Schleutker , J. D. Carpten , I. J. Powell , O. Cussenot , G. Cancel-Tassin , G. G. Giles , R. J. MacInnis , C. Maier , C.-L. Hsieh , F. Wiklund , W. J. Catalona , W. D. Foulkes , D. Mandal , R. A. Eeles , Z. Kote-Jarai , C. D. Bustamante , D. J. Schaid , T. Hastie , E. A. Ostrander , J. E. Bailey-Wilson , P. Radivojac , S. N. Thibodeau , A. S. Whittemore , W. Sieh , REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants . The American Journal of Human Genetics 99 , 877 – 885 ( 2016 ). OpenUrl CrossRef PubMed 37. H. Sun , G. Yu , New insights into the pathogenicity of non-synonymous variants through multi-level analysis . Sci Rep 9 , 1667 ( 2019 ). OpenUrl CrossRef PubMed 38. M. J. Landrum , S. Chitipiralla , G. R. Brown , C. Chen , B. Gu , J. Hart , D. Hoffman , W. Jang , K. Kaur , C. Liu , V. Lyoshin , Z. Maddipatla , R. Maiti , J. Mitchell , N. O’Leary , G. R. Riley , W. Shi , G. Zhou , V. Schneider , D. Maglott , J. B. Holmes , B. L. Kattman , ClinVar: improvements to accessing data . Nucleic Acids Research 48 , D835 – D844 ( 2020 ). OpenUrl CrossRef PubMed 39. A. M. Quinodoz , V. G. Peter , K. Cisarova , B. Royer-Bertrand , P. D. Stenson , D. N. Cooper , S. Unger , Superti-Furga , C. Rivolta , Analysis of missense variants in the human genome reveals widespread gene-specific clustering and improves prediction of pathogenicity . The American Journal of Human Genetics 109 , 457 – 470 ( 2022 ). OpenUrl CrossRef PubMed 40. ↵ S. Chen , L. C. Francioli , J. K. Goodrich , R. L. Collins , M. Kanai , Q. Wang , J. Alföldi , N. A. Watts , C. Vittal , L. D. Gauthier , T. Poterba , M. W. Wilson , Y. Tarasova , W. Phu , R. Grant , M. T. Yohannes , Z. Koenig , Y. Farjoun , E. Banks , S. Donnelly , S. Gabriel , N. Gupta , S. Ferriera , C. Tolonen , S. Novod , L. Bergelson , D. Roazen , V. Ruano-Rubio , M. Covarrubias , C. Llanwarne , N. Petrillo , G. Wade , T. Jeandet , R. Munshi , K. Tibbetts , Genome Aggregation Database Consortium , M. Abreu , C. A. Aguilar Salinas , T. Ahmad , C. M. Albert , D. Ardissino , I. M. Armean , E. G. Atkinson , G. Atzmon , J. Barnard , S. M. Baxter , L. Beaugerie , E. J. Benjamin , D. Benjamin , M. Boehnke , L. L. Bonnycastle , E. P. Bottinger , D. W. Bowden , M. J. Bown , H. Brand , S. Brant , T. Brookings , S. Bryant , S. E. Calvo , H. Campos , J. C. Chambers , J. C. Chan , K. R. Chao , S. Chapman , D. I. Chasman , R. Chisholm , J. Cho , R. Chowdhury , M. K. Chung , W. K. Chung , K. Cibulskis , B. Cohen , K. M. Connolly , A. Correa , B. B. Cummings , D. Dabelea , J. Danesh , D. Darbar , P. Darnowsky , J. Denny , R. Duggirala , J. Dupuis , P. T. Ellinor , R. Elosua , J. Emery , E. England , J. Erdmann , T. Esko , E. Evangelista , D. Fatkin , J. Florez , A. Franke , J. Fu , M. Färkkilä , K. Garimella , J. Gentry , G. Getz , D. C. Glahn , B. Glaser , S. J. Glatt , D. Goldstein , C. Gonzalez , L. Groop , S. Gudmundsson , A. Haessly , C. Haiman , I. Hall , C. L. Hanis , M. Harms , M. Hiltunen , M. M. Holi , C. M. Hultman , C. Jalas , M. Kallela , D. Kaplan , J. Kaprio , S. Kathiresan , E. E. Kenny , B.-J. Kim , Y. J. Kim , D. King , G. Kirov , J. Kooner , S. Koskinen , H. M. Krumholz , S. Kugathasan , S. H. Kwak , M. Laakso , N. Lake , T. Langsford , K. M. Laricchia , T. Lehtimäki , M. Lek , E. Lipscomb , R. J. F. Loos , W. Lu , S. A. Lubitz , T. T. Luna , R. C. W. Ma , G. M. Marcus , J. Marrugat , K. M. Mattila , S. McCarroll , M. I. McCarthy , J. L. McCauley , D. McGovern , R. McPherson , J. B. Meigs , O. Melander , A. Metspalu , D. Meyers , E. V. Minikel , B. D. Mitchell , V. K. Mootha , A. Naheed , S. Nazarian , P. M. Nilsson , M. C. O’Donovan , Y. Okada , D. Ongur , L. Orozco , M. J. Owen , C. Palmer , N. D. Palmer , A. Palotie , K. S. Park , C. Pato , A. E. Pulver , D. Rader , N. Rahman , A. Reiner , A. M. Remes , D. Rhodes , S. Rich , J. D. Rioux , S. Ripatti , D. M. Roden , J. I. Rotter , N. Sahakian , D. Saleheen , V. Salomaa , A. Saltzman , N. J. Samani , K. E. Samocha , A. Sanchis-Juan , J. Scharf , M. Schleicher , H. Schunkert , S. Schönherr , E. G. Seaby , S. H. Shah , M. Shand , T. Sharpe , M. B. Shoemaker , T. Shyong , E. K. Silverman , M. Singer-Berk , P. Sklar , J. T. Smith , J. G. Smith , H. Soininen , H. Sokol , R. G. Son , J. Soto , T. Spector , C. Stevens , N. O. Stitziel , P. F. Sullivan , J. Suvisaari , E. S. Tai , K. D. Taylor , Y. Y. Teo , M. Tsuang , T. Tuomi , D. Turner , T. Tusie-Luna , E. Vartiainen , M. Vawter , L. Wang , A. Wang , J. S. Ware , H. Watkins , R. K. Weersma , B. Weisburd , M. Wessman , N. Whiffin , J. G. Wilson , R. J. Xavier , A. O’Donnell-Luria , M. Solomonson , C. Seed , A. R. Martin , M. E. Talkowski , H. L. Rehm , M. J. Daly , G. Tiao , B. M. Neale , D. G. MacArthur , K. J. Karczewski , A genomic mutational constraint map using variation in 76,156 human genomes . Nature 625 , 92 – 100 ( 2024 ). OpenUrl CrossRef PubMed 41. ↵ R. Nakamura , T. Katsuno , Y. Kishimoto , S. Kaba , M. Yoshimatsu , M. Kitamura , A. Suehiro , N. Hiwatashi , M. Yamashita , I. Tateya , K. Omori , A novel method for live imaging of human airway cilia using wheat germ agglutinin . Sci Rep 10 , 14417 ( 2020 ). OpenUrl CrossRef PubMed 42. ↵ R. Nakamura , S. Oyagi , T. Katsuno , Y. Kishimoto , K. Omori , in Methods in Cell Biology , ( Elsevier , 2023 ), vol. 175 , pp. 33 – 43 . OpenUrl CrossRef PubMed 43. ↵ B. Mitchell , R. Jacobs , J. Li , S. Chien , C. Kintner , A positive feedback mechanism governs the polarity and motion of motile cilia . Nature 447 , 97 – 101 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 44. K. Kunimoto , Y. Yamazaki , T. Nishida , K. Shinohara , H. Ishikawa , T. Hasegawa , T. Okanoue , H. Hamada , T. Noda , A. Tamura , S. Tsukita , S. Tsukita , Coordinated Ciliary Beating Requires Odf2-Mediated Polarization of Basal Bodies via Basal Feet . Cell 148 , 189 – 200 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 45. E. Herawati , D. Taniguchi , H. Kanoh , K. Tateishi , S. Ishihara , S. Tsukita , Multiciliated cell basal bodies align in stereotypical patterns coordinated by the apical cytoskeleton . Journal of Cell Biology 214 , 571 – 586 ( 2016 ). OpenUrl Abstract / FREE Full Text 46. ↵ Z. Liu , Q. P. H. Nguyen , Q. Guan , A. Albulescu , L. Erdman , Y. Mahdaviyeh , J. Kang , H. Ouyang , R. G. Hegele , T. Moraes , A. Goldenberg , S. D. Dell , V. Mennella , A quantitative super-resolution imaging toolbox for diagnosis of motile ciliopathies . Sci. Transl. Med . 12 , eaay0071 ( 2020 ). OpenUrl FREE Full Text 47. ↵ M. He , B. Wu , W. Ye , D. D. Le , A. W. Sinclair , V. Padovano , Y. Chen , K.-X. Li , R. Sit , M. Tan , M. J. Caplan , N. Neff , Y. N. Jan , S. Darmanis , L. Y. Jan , Chloride channels regulate differentiation and barrier functions of the mammalian airway . eLife 9 , e53085 ( 2020 ). OpenUrl CrossRef PubMed 48. ↵ A. Horani , A. Nath , M. G. Wasserman , T. Huang , S. L. Brody , Rho-Associated Protein Kinase Inhibition Enhances Airway Epithelial Basal-Cell Proliferation and Lentivirus Transduction . Am J Respir Cell Mol Biol 49 , 341 – 347 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 49. ↵ C. Zhang , H. J. Lee , A. Shrivastava , R. Wang , T. J. McQuiston , S. S. Challberg , B. A. Pollok , T. Wang , Long-Term In Vitro Expansion of Epithelial Stem Cells Enabled by Pharmacological Inhibition of PAK1-ROCK-Myosin II and TGF-β Signaling . Cell Reports 25 , 598 – 610 .e5 ( 2018 ). OpenUrl CrossRef PubMed 50. ↵ H. W. Chu , C. Rios , C. Huang , A. Wesolowska-Andersen , E. G. Burchard , B. P. O’Connor , T. E. Fingerlin , D. Nichols , S. D. Reynolds , M. A. Seibold , CRISPR–Cas9-mediated gene knockout in primary human airway epithelial cells reveals a proinflammatory role for MUC18 . Gene Ther 22 , 822 – 829 ( 2015 ). OpenUrl CrossRef PubMed 51. J. L. Everman , S. Sajuthi , B. Saef , C. Rios , A. M. Stoner , M. Numata , D. Hu , C. Eng , S. Oh , J. Rodriguez-Santana , E. K. Vladar , D. R. Voelker , E. G. Burchard , M. A. Seibold , Functional genomics of CDHR3 confirms its role in HRV-C infection and childhood asthma exacerbations . Journal of Allergy and Clinical Immunology 144 , 962 – 971 ( 2019 ). OpenUrl CrossRef 52. ↵ J. K. DiStefano J. L. Everman , C. Rios , M. A. Seibold , in Disease Gene Identification , Methods in Molecular Biology . J. K. DiStefano , Ed. ( Springer New York , New York, NY , 2018 ), vol. 1706 , pp. 267 – 292 . OpenUrl CrossRef PubMed 53. ↵ Q. Zhang , J. C. Giacalone , C. Searby , E. M. Stone , B. A. Tucker , V. C. Sheffield , Disruption of RPGR protein interaction network is the common feature of RPGR missense variations that cause XLRP . Proc. Natl. Acad. Sci. U.S.A . 116 , 1353 – 1360 ( 2019 ). OpenUrl Abstract / FREE Full Text 54. ↵ Z. Bukowy-Bieryłło , E. Ziętkiewicz , N. T. Loges , M. Wittmer , M. Geremek , H. Olbrich , M. Fliegauf , K. Voelkel , E. Rutkiewicz , J. Rutland , L. Morgan , A. Pogorzelski , J. Martin , E. Haan , W. Berger , H. Omran , M. Witt , RPGR mutations might cause reduced orientation of respiratory cilia . Pediatric Pulmonology 48 , 352 – 363 ( 2013 ). OpenUrl CrossRef PubMed 55. ↵ S. R. Patnaik , X. Zhang , L. Biswas , S. Akhtar , X. Zhou , D. K. Kusuluri , J. Reilly , H. May-Simera , S. Chalmers , J. G. McCarron , X. Shu , RPGR protein complex regulates proteasome activity and mediates store-operated calcium entry . Oncotarget 9 , 23183 – 23197 ( 2018 ). OpenUrl CrossRef PubMed 56. ↵ C. Boutin , P. Labedan , J. Dimidschstein , F. Richard , H. Cremer , P. André , Y. Yang , M. Montcouquiol , A. M. Goffinet , F. Tissir , A dual role for planar cell polarity genes in ciliated cells . Proc. Natl. Acad. Sci. U.S.A . 111 ( 2014 ) , doi: 10.1073/pnas.1404988111 . OpenUrl Abstract / FREE Full Text 57. ↵ N. Sone , S. Konishi , K. Igura , K. Tamai , S. Ikeo , Y. Korogi , S. Kanagaki , T. Namba , Y. Yamamoto , Y. Xu , K. Takeuchi , Y. Adachi , T. F. Chen-Yoshikawa , H. Date , M. Hagiwara , S. Tsukita , T. Hirai , Y. Torisawa , S. Gotoh , Multicellular modeling of ciliopathy by combining iPS cells and microfluidic airway-on-a-chip technology . Sci. Transl. Med . 13 , eabb1298 ( 2021 ). OpenUrl Abstract / FREE Full Text 58. ↵ M. G. L. Gustafsson , L. Shao , P. M. Carlton , C. J. R. Wang , I. N. Golubovskaya , W. Z. Cande , D. A. Agard , J. W. Sedat , Three-Dimensional Resolution Doubling in Wide-Field Fluorescence Microscopy by Structured Illumination . Biophysical Journal 94 , 4957 – 4970 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 59. P. Kner , B. B. Chhun , E. R. Griffis , L. Winoto , M. G. L. Gustafsson , Super-resolution video microscopy of live cells by structured illumination . Nat Methods 6 , 339 – 342 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 60. ↵ L. Shao , P. Kner , E. H. Rego , M. G. L. Gustafsson , Super-resolution 3D microscopy of live whole cells using structured illumination . Nat Methods 8 , 1044 – 1046 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ S. A. Jones , S.-H. Shim , J. He , X. Zhuang , Fast, three-dimensional super-resolution imaging of live cells . Nat Methods 8 , 499 – 505 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 62. M. J. Rust , M. Bates , X. Zhuang , Sub-diffraction-limit imaging by stochastic optical reconstruction microscopy (STORM) . Nat Methods 3 , 793 – 796 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 63. ↵ Liu Zhen , Wu Yang , Super-Resolution Fluorescence Microscopy for Cilia Investigation and Ciliopathy Diagnosis (Invited) . Laser Optoelectron. Prog . 61 , 0618016 ( 2024 ). OpenUrl CrossRef 64. ↵ X. Shi , G. Garcia , J. C. Van De Weghe , R. McGorty , G. J. Pazour , D. Doherty , B. Huang , J. F. Reiter , Super-resolution microscopy reveals that disruption of ciliary transition-zone architecture causes Joubert syndrome . Nat Cell Biol 19 , 1178 – 1188 ( 2017 ). OpenUrl CrossRef PubMed 65. ↵ J. D. Ash , R. E. Anderson , M. M. LaVail , C. Bowes Rickman , J. G. Hollyfield , C. Grimm , Eds., Retinal Degenerative Diseases ( Springer International Publishing , Cham , 2018 ; http://link.springer.com/10.1007/978-3-319-75402-4 ). 66. ↵ H. Patil , M. R. Guruju , K. Cho , H. Yi , A. Orry , H. Kim , P. A. Ferreira , Structural and functional plasticity of subcellular tethering, targeting and processing of RPGRIP1 by RPGR isoforms . Biology Open 1 , 140 – 160 ( 2012 ). OpenUrl Abstract / FREE Full Text 67. ↵ R. D. Megaw , D. C. Soares , A. F. Wright , RPGR: Its role in photoreceptor physiology, human disease, and future therapies . Experimental Eye Research 138 , 32 – 41 ( 2015 ). OpenUrl CrossRef PubMed 68. ↵ M. Gakovic , X. Shu , I. Kasioulis , S. Carpanini , I. Moraga , A. F. Wright , The role of RPGR in cilia formation and actin stability . Human Molecular Genetics 20 , 4840 – 4850 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 69. ↵ K. N. Rao , W. Zhang , L. Li , M. Anand , H. Khanna , Prenylated retinal ciliopathy protein RPGR interacts with PDE6δ and regulates ciliary localization of Joubert syndrome-associated protein INPP5E . Hum. Mol. Genet , ddw281 ( 2016 ). 70. ↵ R. Megaw , H. Abu-Arafeh , M. Jungnickel , C. Mellough , C. Gurniak , W. Witke , W. Zhang , H. Khanna , P. Mill , B. Dhillon , A. F. Wright , M. Lako , C. ffrench-Constant , Gelsolin dysfunction causes photoreceptor loss in induced pluripotent cell and animal retinitis pigmentosa models . Nat Commun 8 , 271 ( 2017 ). OpenUrl CrossRef PubMed 71. ↵ J. Sedzinski , E. Hannezo , F. Tu , M. Biro , J. B. Wallingford , Emergence of an Apical Epithelial Cell Surface In Vivo . Developmental Cell 36 , 24 – 35 ( 2016 ). OpenUrl CrossRef PubMed 72. ↵ H. K. Hoffman , R. Prekeris , Roles of the actin cytoskeleton in ciliogenesis . Journal of Cell Science 135 , jcs259030 ( 2022 ). OpenUrl CrossRef PubMed 73. ↵ M. E. Werner , P. Hwang , F. Huisman , P. Taborek , C. C. Yu , B. J. Mitchell , Actin and microtubules drive differential aspects of planar cell polarity in multiciliated cells . Journal of Cell Biology 195 , 19 – 26 ( 2011 ). OpenUrl Abstract / FREE Full Text 74. ↵ M. P. Taylor , O. O. Koyuncu , L. W. Enquist , Subversion of the actin cytoskeleton during viral infection . Nat Rev Microbiol 9 , 427 – 439 ( 2011 ). OpenUrl CrossRef PubMed 75. ↵ J. Feldt , M. Schicht , F. Garreis , J. Welss , U. W. Schneider , F. Paulsen , Structure, regulation and related diseases of the actin-binding protein gelsolin . Expert Rev. Mol. Med . 20 , e7 ( 2018 ). OpenUrl CrossRef 76. ↵ S. S. Kulkarni , J. N. Griffin , P. P. Date , K. F. Liem , M. K. Khokha , WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation . Developmental Cell 46 , 595 – 610 .e3 ( 2018 ). OpenUrl CrossRef PubMed 77. ↵ J. S. Lucas , M. W. Leigh , Diagnosis of primary ciliary dyskinesia: searching for a gold standard . Eur Respir J 44 , 1418 – 1422 ( 2014 ). OpenUrl FREE Full Text 78. ↵ M. W. Leigh , C. O’Callaghan , M. R. Knowles , The Challenges of Diagnosing Primary Ciliary Dyskinesia . Proceedings of the American Thoracic Society 8 , 434 – 437 ( 2011 ). OpenUrl CrossRef PubMed 79. ↵ A. Mahuzier , A. Shihavuddin , C. Fournier , P. Lansade , M. Faucourt , N. Menezes , A. Meunier , M. Garfa-Traoré , M.-F. Carlier , R. Voituriez , A. Genovesio , N. Spassky , N. Delgehyr , Ependymal cilia beating induces an actin network to protect centrioles against shear stress . Nat Commun 9 , 2279 ( 2018 ). OpenUrl CrossRef PubMed 80. ↵ X. M. Bustamante-Marin , W.-N. Yin , P. R. Sears , M. E. Werner , E. J. Brotslaw , B. J. Mitchell , C. M. Jania , K. L. Zeman , T. D. Rogers , L. E. Herring , L. Refabért , L. Thomas , S. Amselem , E. Escudier , M. Legendre , B. R. Grubb , M. R. Knowles , M. A. Zariwala , L. E. Ostrowski , Lack of GAS2L2 Causes PCD by Impairing Cilia Orientation and Mucociliary Clearance . The American Journal of Human Genetics 104 , 229 – 245 ( 2019 ). OpenUrl CrossRef PubMed 81. ↵ Q. Lyu , Q. Li , J. Zhou , H. Zhao , Formation and function of multiciliated cells . Journal of Cell Biology 223 , e202307150 ( 2024 ). OpenUrl CrossRef PubMed 82. ↵ J. S. Lucas , E. C. Adam , P. M. Goggin , C. L. Jackson , N. Powles-Glover , S. H. Patel , J. Humphreys , M. D. Fray , E. Falconnet , J.-L. Blouin , M. T. Cheeseman , L. Bartoloni , D. P. Norris , P. M. Lackie , Static respiratory cilia associated with mutations in Dnahc11/DNAH11: A mouse model of PCD . Hum. Mutat . 33 , 495 – 503 ( 2012 ). OpenUrl CrossRef PubMed 83. L. E. Ostrowski , W. Yin , M. Patel , J. Sechelski , T. Rogers , K. Burns , B. R. Grubb , J. C. Olsen , Restoring ciliary function to differentiated primary ciliary dyskinesia cells with a lentiviral vector . Gene Ther 21 , 253 – 261 ( 2014 ). OpenUrl CrossRef PubMed 84. ↵ N. W. Keiser , E. Cant , S. Sitaraman , A. Shoemark , M. P. Limberis , Restoring Ciliary Function: Gene Therapeutics for Primary Ciliary Dyskinesia . Human Gene Therapy 34 , 821 – 835 ( 2023 ). OpenUrl CrossRef PubMed 85. ↵ T. Walton , M. Gui , S. Velkova , M. R. Fassad , R. A. Hirst , E. Haarman , C. O’Callaghan , M. Bottier , T. Burgoyne , H. M. Mitchison , A. Brown , Axonemal structures reveal mechanoregulatory and disease mechanisms . Nature 618 , 625 – 633 ( 2023 ). OpenUrl CrossRef PubMed 86. Z. Chen , M. Shiozaki , K. M. Haas , W. M. Skinner , S. Zhao , C. Guo , B. J. Polacco , Z. Yu , N. J. Krogan , P. V. Lishko , R. M. Kaake , R. D. Vale , D. A. Agard , De novo protein identification in mammalian sperm using in situ cryoelectron tomography and AlphaFold2 docking . Cell 186 , 5041 – 5053 .e19 ( 2023 ). OpenUrl CrossRef PubMed 87. M. Gui , H. Farley , P. Anujan , J. R. Anderson , D. W. Maxwell , J. B. Whitchurch , J. J. Botsch , T. Qiu , S. Meleppattu , S. K. Singh , Q. Zhang , J. Thompson , J. S. Lucas , C. D. Bingle , D. P. Norris , S. Roy , A. Brown , De novo identification of mammalian ciliary motility proteins using cryo-EM . Cell 184 , 5791 – 5806 .e19 ( 2021 ). OpenUrl CrossRef PubMed 88. J. Dai , M. Ma , Q. Niu , R. J. Eisert , X. Wang , P. Das , K. F. Lechtreck , S. K. Dutcher , R. Zhang , A. Brown , Mastigoneme structure reveals insights into the O-linked glycosylation code of native hydroxyproline-rich helices . Cell , S0092867424002538 ( 2024 ). 89. ↵ J. Huang , H. Tao , J. Chen , Y. Shen , J. Lei , J. Pan , C. Yan , N. Yan , Structure-guided discovery of protein and glycan components in native mastigonemes . Cell 187 , 1733 – 1744 .e12 ( 2024 ). OpenUrl CrossRef PubMed 90. ↵ G. Costain , Z. Liu , V. Mennella , G. Radicioni , A. N. Goczi , A. Albulescu , S. Walker , B. Ngan , D. Manson , R. Vali , M. Khan , N. Palaniyar , D. B. Hill , D. A. Hall , C. R. Marshall , M. Knowles , M. A. Zariwala , M. Kesimer , S. D. Dell , Hereditary Mucin Deficiency Caused by Biallelic Loss of Function of MUC5B . Am J Respir Crit Care Med 205 , 761 – 768 ( 2022 ). OpenUrl CrossRef PubMed 91. ↵ C. Ringers , S. Bialonski , M. Ege , A. Solovev , J. N. Hansen , I. Jeong , B. M. Friedrich , N. Jurisch-Yaksi , Novel analytical tools reveal that local synchronization of cilia coincides with tissue-scale metachronal waves in zebrafish multiciliated epithelia . eLife 12 , e77701 ( 2023 ). OpenUrl CrossRef PubMed 92. ↵ L. Feriani , Understanding the Collective Dynamics of Motile Cilia in Human Airways . 93. ↵ Y. Hao , T. Stuart , M. H. Kowalski , S. Choudhary , P. Hoffman , A. Hartman , A. Srivastava , G. Molla , S. Madad , C. Fernandez-Granda , R. Satija , Dictionary learning for integrative, multimodal and scalable single-cell analysis . Nat Biotechnol 42 , 293 – 304 ( 2024 ). OpenUrl CrossRef PubMed 94. ↵ O. Hadjebi , E. Casas-Terradellas , F. R. Garcia-Gonzalo , J. L. Rosa , The RCC1 superfamily: From genes, to function, to disease . Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1783 , 1467 – 1479 ( 2008 ). OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted March 14, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following RPGR regulates motile cilia by interfering with actin dynamics Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share RPGR regulates motile cilia by interfering with actin dynamics Yang Wu , Erika Tavares , Binrun Liang , Wallace Wee , Vito Mennella , Hanchao Feng , Jiaying Cao , Jiayi Zheng , Mu He , Kirk Stephenson , Liran Hanan , Janice Min Li , Sharon D Dell , Elise Heon , Zhen Liu bioRxiv 2025.03.13.643176; doi: https://doi.org/10.1101/2025.03.13.643176 Share This Article: Copy Citation Tools RPGR regulates motile cilia by interfering with actin dynamics Yang Wu , Erika Tavares , Binrun Liang , Wallace Wee , Vito Mennella , Hanchao Feng , Jiaying Cao , Jiayi Zheng , Mu He , Kirk Stephenson , Liran Hanan , Janice Min Li , Sharon D Dell , Elise Heon , Zhen Liu bioRxiv 2025.03.13.643176; doi: https://doi.org/10.1101/2025.03.13.643176 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7614) Biochemistry (17621) Bioengineering (13849) Bioinformatics (41818) Biophysics (21395) Cancer Biology (18522) Cell Biology (25416) Clinical Trials (138) Developmental Biology (13349) Ecology (19858) Epidemiology (2067) Evolutionary Biology (24277) Genetics (15579) Genomics (22455) Immunology (17696) Microbiology (40278) Molecular Biology (17134) Neuroscience (88391) Paleontology (666) Pathology (2823) Pharmacology and Toxicology (4811) Physiology (7630) Plant Biology (15104) Scientific Communication and Education (2042) Synthetic Biology (4281) Systems Biology (9807) Zoology (2265)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.