Dermal papilla cell-derived exosomes promote hair follicle regeneration during wound healing by activating Wnt/β‐catenin signaling pathway

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Hair follicle (HF) regeneration after skin injury remains a major clinical challenge. Dermal papilla cell-derived exosomes (DPC-Exos) have great potential to induce HF neogenesis. However, the role and mechanism of DPC-Exos in HF regeneration during wound healing are still unclear. In this study, the effect of DPC-Exos on fibroblasts in wound healing was explored for the first time. We found that DPC-Exos could promote the proliferation and migration of fibroblasts, and more importantly, enhance the hair-inducing capacity of fibroblasts. The fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. In addition, the results of in vivo experiments showed that DPC-Exos could accelerate wound re-epithelialization, and promote HF regeneration. The expression levels of Wnt pathway transcription factor β-catenin and Lef1 were elevated in fibroblasts and the dermis of skin wounds after DPC-Exos treatment. Taken together, this study proved that DPC-Exos could promote HF regeneration during wound healing by activating fibroblasts and the Wnt/β-catenin signaling pathway, suggesting that DPC-Exos might be a promising therapeutic strategy for skin wound regenerative healing.
Full text 158,018 characters · extracted from preprint-html · click to expand
Dermal papilla cell-derived exosomes promote hair follicle regeneration during wound healing by activating Wnt/β‐catenin signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dermal papilla cell-derived exosomes promote hair follicle regeneration during wound healing by activating Wnt/β‐catenin signaling pathway Yage Shang, Mengyang Li, Lixia Zhang, Chao Han, Kuo Shen, Kejia Wang, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3942786/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jul, 2024 Read the published version in Journal of Nanobiotechnology → Version 1 posted 9 You are reading this latest preprint version Abstract Hair follicle (HF) regeneration after skin injury remains a major clinical challenge. Dermal papilla cell-derived exosomes (DPC-Exos) have great potential to induce HF neogenesis. However, the role and mechanism of DPC-Exos in HF regeneration during wound healing are still unclear. In this study, the effect of DPC-Exos on fibroblasts in wound healing was explored for the first time. We found that DPC-Exos could promote the proliferation and migration of fibroblasts, and more importantly, enhance the hair-inducing capacity of fibroblasts. The fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. In addition, the results of in vivo experiments showed that DPC-Exos could accelerate wound re-epithelialization, and promote HF regeneration. The expression levels of Wnt pathway transcription factor β-catenin and Lef1 were elevated in fibroblasts and the dermis of skin wounds after DPC-Exos treatment. Taken together, this study proved that DPC-Exos could promote HF regeneration during wound healing by activating fibroblasts and the Wnt/β-catenin signaling pathway, suggesting that DPC-Exos might be a promising therapeutic strategy for skin wound regenerative healing. wound healing hair follicle regeneration DPC-Exos fibroblasts Wnt/β-catenin signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction As the largest human organ, skin plays an important role in defending against external damage and maintaining the body's internal homeostasis. Hair follicles (HFs) are tiny organs located in the dermis of the skin and contribute to human health in skin metabolism, thermoregulation, sensory perception, and social interactions [ 1 , 2 ]. In postpartum humans, hair loss from injuries does not regenerate, which affects the skin function and aesthetics, and causes pain and burden to patients[ 3 , 4 ]. HF regeneration helps to restore the normal function of the skin and reduce scar formation in wound healing[ 5 , 6 ]. Although many methods have been developed to accelerate HF neogenesis, it remains a challenge to find a way to promote HF regeneration during wound healing. Fibrotic scarring and regeneration healing are thought to be on opposite ends of wound healing, and studies show that fibroblasts are key components in deciding wound healing outcomes [ 7 – 9 ]. Fetal and neonatal mouse dermal fibroblasts still have the ability to induce HF neogenesis, but such hair-inducing capacity is lost in adult fibroblasts[ 10 , 11 ]. This is one of the reasons for wound scarring rather than regenerative healing in adulthood. Many studies were performed to enhance the hair-inducing capacity of adult dermal fibroblasts for HF regeneration. Ma, Y et al. demonstrated that small molecules and their combinations could induce L929 mouse fibroblast cell line and mouse dermal fibroblasts into dermal-papilla-cell-like cells, and confer a hair-forming ability on adult mouse fibroblasts[ 12 ]. Xie et al. reported that a 3D cultivation system of hydrogel microcapsules could induce dermal fibroblasts into dermal papilla cell-like cells[ 13 ]. Although these methods restored the trichogenecity of fibroblasts and induced HF neogenesis, they may not be suitable for wound treatment in terms of safety and feasibility. With the development of regenerative medicine, mesenchymal stem cell-derived exosomes have been considered as a promising therapeutic tool for tissue regeneration[ 14 – 16 ]. HFs consist of epithelial and mesenchymal parts and consistently undergo hair cycle of active growth (anagen), degeneration (catagen), and quiescence (telogen)[ 17 ]. As the only organ that can be completely regenerated in the body, HFs are widely used in regenerative medicine research. HF morphogenesis relies on the epithelial–mesenchymal interaction (EMI), which is a prerequisite for HF formation, growth, and hair cycles. Current strategies for in vivo HF regeneration aim to mimic EMI, which combines epithelial and inducible mesenchymal components to promote HF formation. Dermal papilla cells (DPCs) are specialized mesenchymal cells located at the base of hair follicles and are considered to be stem cell reservoirs in HF[ 18 , 19 ]. DPCs have a strong hair-inducing capacity to reprogram epidermal cells into hair follicle fate, and new HFs can be regenerated by introducing isolated dermal papilla tissues or cultured DPCs in hairless skin combined with epidermal cells[ 20 ]. As the signaling center of HF, DPCs constitute the dermal niche that instructs hair follicle epidermal cell fate and differentiation[ 21 , 22 ]. DPCs exert their regulatory effect in the form of paracrine, and exosomes are important mediators of their functions. Exosomes are extracellular vesicles that contain proteins, lipids, and nucleic acids, with a diameter of 30–150 nanometers, and play an important role in cell-to-cell communication[ 23 ]. Studies have shown that exosomes derived from DPCs (DPC-Exos) could stimulate the proliferation and differentiation of hair follicle stem cells, hair matrix cells, and outer root sheath cells, thus promoting HF growth, regeneration, and hair cycles[ 24 – 26 ]. Given the effect of DPC-Exos in promoting HF regeneration, we wondered if it could promote HF regeneration during wound healing. Although the effect of DPC-Exos is intensively studied, the effect of DPC-Exos on fibroblasts has not been reported. We performed a series of in vivo and in vitro experiments to observe and validate the effect of DPC-Exos on fibroblasts in wound healing. In the study, we found that DPC-Exos could promote the proliferation and migration of fibroblasts in a concentration-dependent manner, and enhance the hair-inducing capacity of fibroblasts. Hair reconstruction assay showed that fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. In addition, DPC-Exos could accelerate wound re-epithelialization, and promote HF regeneration during wound healing. Furthermore, the activation of the Wnt/β-catenin signaling pathway in fibroblasts and wound healing was verified by using Wnt pathway inhibitor. In conclusion, the aforementioned results demonstrated that DPC-Exos could promote HF regeneration during wound healing by activating the fibroblasts and the Wnt/β-catenin signaling pathway. Material and methods DPCs isolation DPCs were obtained from 6-week-old male C57BL/6J mice vibrissa HFs via microdissection combined with collagenase digestion as previously described[ 27 – 29 ]. Briefly, the upper lip containing the vibrissa pad was cut under anesthesia, and the dermis side was exposed under the Olympus stereomicroscope. All hair bulbs were transected with microscissors and digested in 0.2% type I collagenase (Gibco, Grand Island, USA) at 37°C for 30 min. The divided DP spheroids were resuspended into high-glucose DMEM (Gibco, USA) containing 20% FBS (Corning, USA) and 1% penicillin/streptomycin and cultured in an incubator with 5% CO 2 at 37 ℃. On day 3, the primary DPCs could migrate out from DP spheroids. On day 7, DPCs exhibited aggregative growth behavior around DP spheroids. Subcultured DPCs were cultured in DMEM/F12 (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin and passaged every 3–4 days. Passage 3–6 DPCs were used for subsequent assay. Flow cytometry and ALP staining of DPCs The specific markers of DPC were detected by flow cytometry. Passage 4 DPCs were incubated with fluorescence-conjugated antibodies, anti-Versican (ab311818, Abcam, 1:200), anti-Sox2 (ab93689, Abcam, 1:200), anti-β-catenin (8480T, CST, 1:200), and anti-ALP(4060T, CST, 1:200), then detected and analyzed by a flow cytometer (BD FACSAria™ III system; USA). The alkaline phosphatase (ALP) activity of DPCs was detected by alkaline phosphatase assay kit (P0321S, Beyotime, China). DPCs were incubated with NBT/BCIP solution, the reaction was stopped by washing with PBS, and dark grey staining was a positive for ALP. Images were observed under the Olympus FSX100 microscope. Osteoblastic and adipogenic differentiation of DPCs Passage 4 DPCs seeded in six-well plates to approximately 80–90% confluent, removed the old culture medium, and treated with osteogenic differentiation medium for 3 weeks or adipogenic differentiation medium for 2 weeks, respectively. After induced culture, DPCs were fixed with 4% paraformaldehyde and stained with Alizarin Red S or Oil Red O to detect the results of osteoblastic and adipogenic differentiation. Images were observed under the Olympus FSX100 microscope. Isolation and identification of DPC-Exos P3 to P6 DPCs were cultured in 100-mm dishes until 80% confluence, changing the culture medium with DMEM/F12 containing exosome-free FBS. After 48 h culture, the DPCs culture supernatants were harvested for exosome isolation by differential centrifugation/ ultracentrifugation techniques[ 30 ]. The supernatants went through 300× g for 10 min, 2,000× g for 10 min, and 10,000× g for 30 min to remove cell debris and middle-large extracellular vesicles. Then, the supernatants were ultracentrifuged at 100,000× g for 70 min, and pellets were thoroughly washed with cold PBS and ultracentrifuged again for purification and enrichment. The final exosome pellets were resuspended in 200 uL PBS (200 µL PBS for 200 mL supernatant), and stored at -80℃. The transmission electron microscope (TEM) and nanoparticle tracking analysis (NTA) were used to detect the morphology and size distribution of DPC-Exos respectively. Western blot was used to detect the protein markers of exosomes. The 0.22-µm filter is used to remove bacteria from extracted DPC-Exos before use. DPC-Exos were labeled with PKH26 to examine the internalization in fibroblasts. After incubation for 24h with PKH26 labeled exosomes, fibroblasts were fixed with 4% paraformaldehyde, and nuclear was counterstained with DAPI. Photographed with Olympus FSX100 microscope. Fibroblast isolation and culture Primary fibroblasts were isolated from the dorsal skin of 7-week-old male C57BL/6J mice as previously described[ 12 , 31 ]. Briefly, mice were sterilized with 75% alcohol after hair removal and washed 3 times in PBS. Back skin was harvested and incubated in 0.25% dispase-trypsin solution overnight at 4°C. The epidermal layer was scraped off and kept dermis only. Cut dermis into pieces and digested with 0.2% type I collagenase at 37°C for 1 h, and further digested with 0.25% trypsin-EDTA at 37°C for 10 min, the serum-containing medium was added to terminate the digestion. The debris of the digested mixture was removed by filtering through the 100-µm mesh. The cell suspension was centrifuged at 300 × g for 5min and pellets were inoculated in culture flasks. The cells were cultured with low-glucose DMEM supplemented with 10% FBS, and 1% penicillin/streptomycin in an incubator with 5% CO2 at 37 ℃. Passage 4 fibroblasts for subsequent experiments. Cell proliferation assay The proliferation of fibroblasts was measured by CCK-8 cell proliferation assay and EdU staining assay. For the CCK-8 assay, fibroblasts were seeded into 96-well plates, 5× 10 3 cells/well, and different concentrations of DPC-Exos (0, 10, 20, and 40 µg/mL) were added into wells at 0, 24, and 36 h after cell adherent. Each group had 6 replicate wells. After 48 h culture, 10 µl CCK-8 (AR1160-500, Boster, China) reagent was added into plates and incubated for 2 h at 37°C. The absorbance at 450 nm was measured using a microplate reader. Using EdU staining kit (C0075S, Beyotime, China) to detect the proliferation of fibroblasts. Cells were seeded in 12-well plates, and different treatments were added to the well for 24 h. Add EdU working solution and continue to incubate for 2 h. After labeled, the cells were fixed and permeabilized, EdU Click reaction solution was added to incubate in the dark for 30 minutes, and DAPI was used for nuclear staining. Photographed with Olympus FSX100 microscope. Cell migration assay The migration of fibroblasts was measured via scratch assay and transwell assay. For the scratch assay, fibroblasts were seeded in 35-mm cell culture dishes until approximately 90% confluent. The cell monolayer was scratched with a 200 µL sterile pipette tip to form a wound gap and washed with PBS, and then different treatments were added to the wells. Take pictures of the wounds at 0, 12, and 24 h post-wounding, and the distance of migration was measured by ImageJ. For transwell assay, fibroblasts were seeded in the upper part of the transwell 24-well plates (Corning, USA), 3 × 10 4 /well, and different concentrations of DPC-Exos were added in the upper chamber. 500µl basal medium was added to the lower chamber and incubated for 24 h. After that, cells that did not pass through the membrane of the chamber were wiped off, and the chamber was fixed with 4% paraformaldehyde and stained with 0.5% crystal violet solution (Boster) for 10 min at room temperature. Washed off the excess dye with PBS, the migrated cells were observed under the Olympus FSX100 microscope. Real-time PCR analysis The expression level of each gene was evaluated by qPCR. TRIzol Reagent (Takara, Japan) was used to extract RNA from cells and tissue samples following the manufacturer’s instructions. After confirming the quality and concentration, 600 ng of RNA was reversely transcribed into cDNA using Prime Script™ RT reagent Kit (Takara). The cDNA was amplified with SYBR Green PCR Master Mix and specific primers in the CFX Connect (BIO-RAD), and GAPDH as internal control. Reaction mixtures were treated with initial denaturation at 95 ℃ for 30 s, and amplified for 40 cycles (95 ℃ for 15 s, 60 ℃ for 30 s, and 70 ℃ for 1 min). The primer pairs used are listed in Table 1 . Table 1 primer pairs used for PCR. Gene (mouse) Primers Sequence (5’-3’) CTNNB Forward GAGGACAAGCCACAAGATTACA Reverse CCAAGATCAGCAGTCTCATTCC ALPP Forward CCCTGAGTACCCAGATGACTA Reverse AGTGCGGTTCCACACATAC LEF1 Forward GGCACCTGTTATCCTACTGAAA Reverse GCTCCATTACGACAGGGATTAG NOG Forward CATGCCGAGCGAGATCAAA Reverse CAGCCACATCTGTAACTTCCTC GAPDH Forward GGTGAAGGTCGGTGTGAACG Reverse CTCGCTCCTGGAAGATGGTG Western blot Protein expression levels of β-catenin, ALP, Lef1, and Noggin were detected by Western blot. The protein was extracted from cells and tissue samples by using lysis buffer (RIPA lysis buffer: protease inhibitor = 1000:1), and protein concentration was detected by BCA kit (AR0146, Boster) according to the kit instructions. The protein samples were subjected to 10% SDS-PAGE gels and transferred to PVDF membranes. Then the membranes were blocked for 2 h in a 5% non-fat milk solution at room temperature. Primary antibodies β-catenin (8480T, CST, 1:1000), ALP (4060T, CST, 1:2000), Lef1 (ab137872, Abcam, 1:1000), Noggin (30023-1-AP, Proteintech, 1:1000), and GAPDH (GB15004-100, Servicebio, 1:3000) were detected and visualized with ECL Kit (P0018FS, Beyotime). The intensity of protein expression was measured on the ImageJ and graphs were performed on the GraphPad Prism Hair patch assay Hair patch assay was conducted to rebuild HFs. Fresh epidermal cells were isolated from postnatal 1–2 days C57BL/6J mice according to published procedures[ 32 ]. Briefly, the skin of neonatal mice was peeled off and digested with 0.25% dispase solution overnight at 4℃ to separate the epidermis and dermis. The epidermis was cut into pieces and digested in 0.25% trypsin-EDTA for 5 minutes, the serum-containing medium was used to terminate digestion and cell suspensions were filtered through a 100-µm mesh. The filtered suspension was centrifuged at 300×g, and cell pellets were resuspended in PBS and counted. Fibroblasts treated with DPC-Exos for 48 h or treated without DPC-Exos were digested and centrifuged, and cell pellets were resuspended in PBS and counted. For each nude mouse, the cell mixture consisted of 1 × 10 6 fresh epidermal cells and 2 × 10 6 fibroblasts treated with or without DPC-Exos subcutaneously injected into the left and right back of nude mice (n = 15). Photographed mice on the 14 and 21 days after transplantation, On the 21st day, mice were sacrificed, and tissue samples were collected for histopathology analysis. Wound healing experiments in mice To evaluate the effect of DPC-Exos on wound healing, 6-8-week-old male C57BL/6J mice (Experimental Animal Center of Air Force Medical University) were randomly divided into groups (n = 5). Created full-thickness round skin excisions (diameter = 1 cm) in mouse dorsal skin and silicone rings were secured around the wounds to physically prevent wound contraction. On the 2nd, 4th, 6th ,8 th, and 10th day post-wounding, DPC-Exos or equal volume PBS was subcutaneously injected into mice dorsal skin around wounds. Exosome treatment dose: 100 µg exosomes in 100 µl PBS/ wound. All animal experiments were performed by the guidelines from the Experimental Animal Committee of Air Force Medical University (Xi′an, China) strictly. Images of wounds were acquired at different time points (day 0, 3, 7, 10, and 14 post-wounding). Mice were sacrificed 14 days post-wounding and skin samples were collected for the following histological study. Histopathology analysis Collected tissue samples were fixed with 4% paraformaldehyde, dehydrated, embedded, and cut into 5-µm-thick sections. H&E and Masson’s trichrome staining were used to detect the histological change and collagen deposition. For tissue immunofluorescence staining, the sections were immersed in 3% H 2 O 2 after deparaffinization to eliminate the activity of endogenous peroxidase at 37°C for 15 min and blocked with 5% BSA in PBS for 1 h to exclude the non-specific binding. Then, the slides were incubated with the primary antibodies against β-catenin (8480T, CST, 1:200) and Lef1(ab137872, Abcam, 1:500) overnight at 4°C. The next day, the slides were washed with PBS, and incubated with Alexa Fluor 594-conjugated goat anti-Rabbit IgG (1:200; Abcam) in the dark for 1 h. Nuclei counterstained with DAPI. Images were obtained by Pannoramic MIDI scanner (3DHISTECH, Hungary). Wnt/β-catenin inhibitor XAV939 selectively inhibits downstream β-catenin in the Wnt pathway[ 33 ]. We used XAV-939(cat. no. HY-15147, MCE) to block the Wnt pathway in fibroblasts and wound healing. For in vitro experiments, the inhibitor group was stimulated with 10 µM XAV939, the XAV939 + DPC-Exos group was treated with DPC-Exos (20 µg/mL) + 10µM XAV939, and the control group was given an equal volume of DMSO. For the in vivo assay, the XAV939 and XAV939 + Exos treated mice were intraperitoneally injected with XAV939 four times at a dose of 1.25 mg/kg each time on day 1 and day 2. Statistical Analysis All data was analyzed using GraphPad Prism7.0 software, and presented as mean ± SD. A t -test was used for comparisons between two groups, and analysis of variance (ANOVA) was used for multi-group comparisons. Every assay was repeated three times independently. p < 0.05 was considered statistically significant. Results Characterization of DPCs and DPC-Exos DP tissues were successfully separated from mouse vibrissa HFs via microdissection combined with collagenase digestion. After about 30 minutes of digestion in 0.2% type I collagenase, the hair bulb structure became loose, and DP tissue was gradually dissociated from the adjacent tissues. The dissociative DP tissue is conical or round in shape with high density (Fig. 1 A). Primary DPCs migrated from DP tissue 3 days after seeding, and by day 7 DPCs almost entirely moved out from DP tissue. Under the microscope, adherent DPCs have short spindle-like shape and exhibit aggregative behavior during cell culture. Oil Red O and Alizarin Red S staining indicated there were lipid droplets and calcium deposition in DPCs after adipogenic and osteogenic differentiation-induced culture. Moreover, DPCs showed highly positive Alkaline phosphatase (ALP) activity (Fig. 1 B). Versican, β-catenin, and ALP are considered molecular markers of DPCs. Sox2 is known to be expressed in DPCs and regulates the hair pigment[ 34 ]. The results of the flow cytometric indicated that the DPCs we isolated were highly positive for DPC-specific markers[ 35 ] (Fig. 1 C). All of these results confirmed that the cells we isolated were consistent with typical DPCs characteristics. For the identification of DPC-Exos, TEM showed that DPC-Exos are cup- or sphere-shaped morphology, and NTA analysis showed the particle diameters of DPC-Exos ranged from 50 to 150 nm, with an average of 79.0 nm (Fig. 1 E, F). Western blot also showed that DPC-Exos were positive for known exosomal markers CD9 and TSG101, and negative for cell marker Calnexin (Fig. 1 G). The results of TEM, NTA, and Western blot indicated that we successfully isolated DPC-Exos. DPC-Exos promoted the proliferation and migration of fibroblasts in a concentration-dependent manner Fibroblasts are the main cell population in the dermal skin and have been thought of as the key components in determining wound healing outcomes[ 36 ]. DPC-Exos can promote the proliferation and migration of hair follicle stem cells and hair matrix cells. To evaluate the effect of DPC-Exos on fibroblasts, we first tested whether DPC-Exos could be taken up by fibroblasts. By co-incubating PKH-26-labeled DPC-Exos with fibroblasts for 24 h, we found that the labeled DPC-Exos could be taken up and internalized by fibroblasts (Fig. 1 H). To further verify the effect of DPC-Exos on fibroblasts, we treated fibroblasts with different concentrations of DPC-Exos. The results of the CCK-8 assay showed that, compared to the control group, DPC-Exos significantly enhanced the proliferation of fibroblasts in a concentration-dependent manner. 20 µg/mL DPC-Exos treatment could produce a statistically significant difference, and fibroblasts proliferated fastest at 24 h of co-incubation. (Fig. 2 C). The results of EdU staining also confirmed the promoting effect of DPC-Exos on fibroblast proliferation (Fig. 2 E). In addition, the results of scratch assay and transwell assay showed that DPC-Exos could improve the migration rate of fibroblasts in a concentration-dependent manner. Compared to the control group, exosome concentrations of 20 µg/ mL and 40 µg/ mL significantly enhanced the migration rate of fibroblasts (Fig. 2 A, B, D). These results demonstrated that DPC-Exos can promote the proliferation and migration of fibroblasts. DPC-Exos promoted the expression level of molecules associated with hair-inducing capacity in fibroblasts β-catenin and ALP are widely used DPC markers and indicate the hair-inducing capacity of DPCs[ 37 , 38 ]. Noggin is expressed by DPCs and indicates the onset of hair growth[ 39 ]. Lef1 is a DPC marker, and Lef1 + fibroblasts are unique cells that can support HF regeneration[ 11 ]. To examine the hair-inductive activity of fibroblasts after DPC-Exos treatment, we used qPCR and Western blot to detect the expression levels of β-catenin, ALP, Lef1, and Noggin in fibroblasts. The results showed that compared to the control group, DPC-Exos at concentrations of 20 µg/ mL and 40 µg/ mL could significantly increase the mRNA and protein expression levels of β-catenin, ALP, Lef1, and Noggin in fibroblasts (Fig. 3 A, B). The results of immunofluorescence staining also confirmed this effect of exosomes (Fig. 3 D). In addition, ALP staining showed that DPC-Exos treatment could enhance ALP activity in fibroblasts (Fig. 3 C). Taken together, we demonstrated that DPC-Exos could promote the expression levels of molecules associated with hair-inducing capacity in fibroblasts. We hypothesize that, to some extent, the stimulation from DPC-Exos may contribute to fibroblasts acquiring characteristics of DPCs and support fibroblasts gradually transform into DPCs. More evidence is needed to support this view. Hair reconstitution assay indicated that fibroblasts treated with DPC-Exos could induce HF neogenesis when combined with neonatal mice epidermal cells Hair reconstitution assay was used to test the hair inductive properties of dermal cells. We conducted hair patch assay in 8-week-old nude mice to further verify the in vivo hair-inducing activity of fibroblasts after DPC-Exos treatment. The experimental operation process is shown in the Fig. 4 A. After 14 days of transplantation, there were black hair clumps under the skin at the injection site in the exosome-treated group, but no obvious black bulge was seen in the non-exosome-treated group. Due to the inconsistent directions of newly formed HFs, hair tufts could not break through the skin surface. We carefully peeled off part of the skin at the transplantation sites to facilitate the outward growth of new hair. On the 21 days after cell transplantation, black hair tufts were observed at the transplantation sites in the exosome-treated group. However, no hair grew at the transplantation site in the non-exosome-treatment group (Fig. 4 B). At 21 days after transplantation, HF formation was observed in 10 of the 15 transplantation sites in the DPC-Exos treatment group, and the success rate of induction was 66.67%, while no hair formed in the 15 transplantation sites in the non-exosome treatment group (Fig. 4 C). Microscopic observation showed that mature HFs with intact structure and different growth directions were formed in the hair clumps after DPC-Exos treatment, while no obvious hair structure was found in the non-exosome treatment group (Fig. 4 D). Furthermore, H&E staining of the transplantation sites of nude mice showed that the epidermal cells in the DPC-Exos treatment group were induced to form concentric circles-like layers, and there were new HFs scattered in the epidermal layers, while the non-exosome treatment group formed a cystic structure positive for eosin staining and a few of smaller concentric circles-like structures, and no obvious follicle-like structure was found (Fig. 4 E). The results of the hair reconstruction assay showed that fibroblasts treated with DPC-Exos could induce HF neogenesis when combined with neonatal mice epidermal cells. DPC-Exos accelerated wound healing and promoted HF regeneration in the excisional model of C57BL/6J mice Given the powerful effect of DPC-Exos on promoting hair development, we applied them to full-thickness skin excision wounds in mice to assess the effect of DPC-Exos on wound healing. The results of in vivo experiments showed that, compared to the control group, the DPC-Exos treatment group had a faster rate of wound healing, as confirmed by smaller wound areas measured on day 7 and day 10 post-wounding, and there were statistical differences between DPC-Exos and PBS groups. (p < 0.05) (Fig. 5 B-D). More importantly, we found that, compared to the control group, the DPC-Exos treatment group had earlier (starting on the 7th-day post-wounding) and faster hair growth, and the hair coverage area was significantly much more than the control group at the 7th, 10th, and 14th post-wounding (Fig. 5 B, E). The results of H&E and Masson’s trichrome staining of tissues showed there were new HFs formed at the wound site in the DPC-Exos treatment group. In addition, there was less collagen deposition in the DPC-Exos treatment group. We hypothesized that the regeneration of HFs may be related to the hair-inducing activity of fibroblasts. In addition, qPCR and Western blot of wound tissues showed that, compared to the control group, the expression levels of β-catenin, ALP, Lef1, and Noggin were significantly increased in the DPC-Exos treatment group (Fig. 6 A, B). Tissue immunofluorescence staining was used to detect the expression of β-catenin and Lef1. Compared to the control group, the expression of β-catenin and Lef1 in the DPC-Exos treatment group was increased, and there was a statistically significant difference between the two groups. ( p < 0.05). (Fig. 6 C, D), The results of in vivo experiments suggested that DPC-Exos could promote HF regeneration during wound healing. DPC‑Exos activated Wnt/β-catenin signaling pathway in fibroblasts Wnt inhibitor XAV939 was used to verify the effect of DPC-Exos on the Wnt/β-catenin signaling pathway. Here, fibroblasts were treated with DMSO, XAV939, and XAV939 + Exos. The results of the scratch assay, transwell assay, and EdU staining showed that XAV939 significantly inhibited the proliferation and migration of fibroblasts, suggesting that blocking the Wnt/β-catenin signaling pathway could inhibit the activity of fibroblasts, this is consistent with other studies about inhibiting Wnt/β-catenin signaling pathway in fibroblasts[ 15 ]. In the XAV939 + Exos treatment group, the proliferation and migration activity of fibroblasts was increased (Fig. 7A-C), suggesting that DPC-Exos alleviated the inhibitory effect of XAV939 on fibroblasts. In addition, Western blot and quantitative analysis showed the protein expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts were significantly decreased after XAV939 treatment, and DPC-Exos mitigated the inhibitory effect of XAV939 and increased the expression level of these molecules (Fig. 7D, E). The positive effect of DPC-Exos on the Wnt signaling pathway transcription factor β-catenin and Lef1 demonstrated the activation of the Wnt/β-catenin signaling pathway by DPC-Exos. These results suggested that DPC-Exos could promote fibroblast activity by activating the Wnt/β-catenin signaling pathway. Figure 7. Effect of DPC-Exos on fibroblasts after application of Wnt inhibitor. ( A ) ( B ). Scratch assay and transwell assay show that DPC-Exos alleviated the inhibitory effect of XAV939 on the migration of fibroblast. scale bars = 200µm. ( C ). EdU staining of fibroblast proliferation in control, XAV939, and XAV939 + exosomes groups at 24 h. scale bars = 200µm. ( D ) ( E ). Western blot and quantitative analysis indicating the expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts at control, XAV939, and XAV939 + exosomes groups. The data was shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. DPC‑Exos promotes HF regeneration during wound healing by activating Wnt/β‑catenin signaling pathway To further verify whether DPC-Exos regulates HF regeneration by activating the Wnt/β-catenin signaling pathway during wound healing, we used XAV-939 to block the Wnt pathway in wound healing. As shown in Fig. 8 A-C, after being treated with XAV939, the wound closure was significantly slower than in other groups, suggesting that blocking the Wnt/β-catenin signaling pathway could inhibit wound healing. The wound closure rate of XAV939 + Exos increased compared to the XAV939 treatment group, and the difference was statistically significant, suggesting that the inhibition of wound healing caused by the Wnt pathway inhibitor can be alleviated by DPC-Exos treatment. Meanwhile, we observed no significant statistical difference between the blank control group and the XAV939 + Exos treatment group. H&E and Masson staining showed that new HFs and sebaceous glands were formed in the DPC-Exos and XAV939 + Exos treatment groups. (Fig. 8 D). Western blot and quantitative analysis showed that XAV939 significantly reduced the expression levels of β-catenin, ALP, Lef1, and Noggin in tissues, while the expression of these molecules increased after DPC-Exos treatment. The expression levels of β-catenin, ALP, Lef1, and Noggin were no significant difference between the control group and the XAV939 + Exos treatment group. In addition, tissue immunofluorescence staining showed that the fluorescence intensity of β-catenin and Lef1 were significantly reduced in the dermal layer and new HFs after XAV939 treatment, and increased after DPC-Exos treatment (Fig. 9 C-E). The results of this part further demonstrated that DPC-Exos could promote HF regeneration during wound healing by activating the Wnt/β-catenin signaling pathway. Discussion Skin can repair itself after injury, but deep skin wounds generally heal with scar formation and do not regenerate HFs. HF regeneration is a sign of optimal wound healing[ 40 , 41 ]. It was thought that HF morphogenesis mainly occurred during embryonic development, and in adult mammals, HFs destroyed by deep injury were irreparable. In 2007, Ito et al. observed functional HF regeneration in large skin wounds (> 1 cm 2 ) in adult mice[ 42 ], which opened up new explorations into HF regeneration in wound healing. Wound healing is a complex biological process, involving a variety of cells, and fibroblasts are the primary cell population that determines wound healing outcomes. Li et al. found that exosomes derived from adipose stem cells can promote fibroblast proliferation and facilitate wound healing by activating the Wnt/β-catenin signaling pathway[ 15 ]. In this study, we found that similar to other stem cell-derived exosomes, DPC-Exos could improve the proliferation and migration of fibroblasts, which was undoubtedly helpful in promoting wound healing. Given the hair inductivity of DPCs and homology between DPCs and fibroblasts, multiple attempts have been made to promote the transformation of fibroblasts into DPCs, such as biomimetic hydrogel encapsulation culture[ 13 ], small molecule compounds inducing[ 12 ], and suspension culture with FGF2、PDGF and BIO[ 43 ]. These methods promote the hair-inducing ability of fibroblasts but are not suitable for wound healing. DPC-Exos, as a natural dermal signaling delivery system, could induce the proliferation and differentiation of hair follicle stem cells and hair matrix cells, and augment the hair-inductive capacity of dermal papilla spheres[ 44 , 45 ]. By co-incubating fibroblasts with DPC-Exos, we found that the expression level of molecules associated with the hair-inducing capacity of DPCs (β-catenin, ALP, Lef1, and Noggin) was elevated in fibroblasts. Moreover, the hair reconstitution assay further confirmed the hair-inducing activity of fibroblasts after DCP-Exos treatment. These results suggest that DPC-Exos promotes the pro-regenerative phenotype of fibroblasts, and lays the foundation for DPC-Exos to promote HF regeneration in wound healing. In the wound healing experiments, by tracking the area and hair growth of the wounds, we found that DPC-Exos could accelerate wound re-epithelialization. This is consistent with the promoting effect of other mesenchymal stem cell-derived exosomes on wound healing. In addition, there was significantly more HF neogenesis and less collagen deposition in the DPC-Exos treatment group. We hypothesize that DPC-Exos promoted HF regeneration by altering fibroblast phenotypes, and then we detected the expression level of molecules associated with hair-inducing capacity. The gene and protein expression levels of β-catenin, ALP, Lef1, and Noggin were elevated in the DPC-Exos treatment group. Additionally, the results of tissue immunofluorescence staining showed that the fluorescence intensity of β-catenin was significantly enhanced in the dermal layer and new hair follicles. Lef1 as a marker for newly formed hair follicles, exhibited higher fluorescence intensity in the DPC-Exos treatment group. These results supported our hypothesis that DPC-Exos could promote HF regeneration during wound healing by enhancing the hair-inducing activity of fibroblasts. The Wnt/β-catenin signaling pathway plays an important role in HF regeneration and wound healing[ 46 – 48 ]. Accumulating evidence has demonstrated that activation of the Wnt/β-catenin signaling pathway could promote wound healing[ 49 , 50 ]. During HF morphogenesis, the dermis provides the ‘first dermal signal’ that initiates the formation of epidermal placodes, and sustained β-catenin activity in the dermis leads to larger HF placodes and accelerates differentiation of HFs[ 49 , 51 ]. In the study, we found that DPC-Exos enhanced the expression level of Wnt/β-catenin pathway transcription factors β-catenin and Lef1 in fibroblasts, based on this, we speculated that the effect of DPC-Exos on fibroblasts was related to the activation of Wnt/β-catenin signaling pathway. To verify this hypothesis, we used the Wnt inhibitor XAV939 to block the Wnt pathway in fibroblasts. The results of in vitro experiments showed that the Wnt inhibitor suppressed the proliferation and migration of fibroblasts, and this inhibitory effect could be partially alleviated by DPC-Exos. In addition, the Wnt inhibitor significantly reduced the protein expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts, and the expression level of these molecules could be partially restored by DPC-Exos. These results demonstrated that DPC-Exos could enhance the hair-inducing activity of fibroblasts by activating the Wnt/β-catenin signaling pathway. For the role of the Wnt/β-catenin signaling pathway in wound healing, some studies showed that activation of the Wnt/β-catenin pathway in fibroblasts led to excessive collagen deposition and scarring[ 52 , 53 ]. These findings increase the thinking about the regulation of the Wnt/β-catenin signaling pathway. It’s well known that beyond producing and maintaining extracellular matrix, fibroblasts also are critical to HF regeneration. Phan et al. pointed out that Lef1 + papillary fibroblasts can regenerate new HFs by interacting with the adjacent epidermal cells[ 11 ]. Mascharak et al. found that inhibiting the YAP signaling in fibroblasts could promote regenerative healing by activating the Wnt signaling pathway[ 40 ]. The Wnt/β-catenin signaling pathway is involved in multiple stages of wound healing, and inhibiting its activity would influence cell viability and wound healing. We found that inhibiting the Wnt pathway also significantly hindered wound re-epithelialization and HF regeneration, and this inhibition could be partially alleviated by DPC-Exos. Although some wounds were re-epithelialized in the XAV939 treatment group, there was no HF regeneration at the wound site. In addition, the expression level of β-catenin, ALP, Lef1, and Noggin was decreased after XAV939 treatment, and DPC-Exos partially restored the expression of these molecules. Meanwhile, compared to the DPC-Exos treated group, blocking the Wnt pathway weakened the effect of DPC-Exos on HF regeneration. These results indicated that DPC-Exos could promote HF regeneration by activating the Wnt/β-catenin signaling pathway. Fibroblasts are highly dynamic cells and their heterogeneity and plasticity provide the possibility to change wound healing outcomes. Many studies have attenuated fibrotic repair by hindering the transformation of fibroblasts into myofibroblasts and disrupting YAP mechanotransduction in fibroblasts[ 54 , 55 ]. However, these regulatory methods may have an impact on the activity of fibroblasts and thus influence the wound healing process. Some studies point out that regeneration and fibrosis are not completely excluded in cells during wound healing, and cells with pro-regeneration properties are also present in scars. But without intervention, the pro-fibrosis program predominates and leads to scarring. In addition, failing to regenerate skin appendages in wound healing is related to the lack of dermal regeneration signals rather than the lack of intrinsic regenerative ability of cells[ 40 , 56 ]. Here, we introduced DPC-Exos, carrying regenerative dermal signaling, into wound healing, and found that DPC-Exos also worked to promote HF regeneration in case the integrity of the skin is compromised. In this study, the results of our experiments confirmed that DPC-Exos could promote HF regeneration during wound healing. However, this is not enough for complete regenerative healing, which also requires the restoration of skin structure and strength. The contents of DPC-Exos, which are important for their function, still need to be explored. In addition, the regulatory targets of DPC-Exos in the Wnt/β-catenin signaling pathway have not been well elucidated. All of these require more in-depth research to figure out. Conclusion In the study, the effect of DPC-Exos on fibroblasts in wound healing was explored for the first time. DPC-Exos could promote the proliferation and migration of fibroblasts, and enhance the hair-inducing capacity of fibroblasts. The fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. To our knowledge, this is the first investigation that DPC-Exos promotes HF regeneration during wound healing by activating the fibroblasts and the Wnt/β-catenin signaling pathway. This study provides a theoretical basis for the application of DPC-Exos in wound healing and also brings a novel therapeutic strategy for wound regenerative healing. Abbreviations DPCs Dermal papilla cells DPC-Exos Dermal papilla cell-derived exosomes HF Hair follicle TEM Transmission electron microscopy NTA nanoparticle tracking analysis ALP Alkaline phosphatase Lef1 Lymphoid enhancer-binding factor 1 DMEM Dulbecco’s modified Eagle’s medium FBS Fetal bovine serum DAPI 4′,6-diamidino-2-phenylindole GAPDH Glyceraldehyde-3-phosphate dehydrogenase BSA Bovine serum albumin H&E Hematoxylin and eosin. Declarations Ethics approval and consent to participate All animal studies were approved and performed in accordance with the Experimental Animal Committee of Fourth Military Medical University (Xi′an, China). Consent for publication All authors read and approved the final manuscript. Competing interests The authors declare no conflicts of interest. Author Details Department of Burns and Cutaneous Surgery, Xijing Hospital, Fourth Military Medical University, 127 West Chang-le Road, Xi’an 710032, Shaanxi, China. Funding This work was funded by grants from the General Program of National Natural Science Foundation of China (No.81772071), the Key Industry Innovation Chain (Cluster) foundation of Shaanxi Province, China (No.2023-ZDLSF-37), the Medical Research Program of Xi’an City (No.23YXYJ0185), and the Key Research and Development Program of Shaanxi Province (No.2023-ZDLSF-24). Author Contribution DHH, HTW, and XJW contributed to the research design and manuscript review; CH, SK, and KJW assisted with manuscript editing; YGS, MYL, and LXZ contributed equally to this work; YL, YZ, LL, YHJ, GK, WXC, and JZ provided the technical support. Acknowledgments The authors acknowledge all other members of the laboratory for their insight and technical support. Data availability No datasets were generated or analyzed in this study. References Hsu Y-C, Fuchs E. Building and Maintaining the Skin. Cold Spring Harb Perspect Biol. 2022;14:a040840. Zheng W, Xu C-H. Innovative Approaches and Advances for Hair Follicle Regeneration. ACS Biomater Sci Eng. 2023;9:2251–76. Martin P. Wound Healing–Aiming for Perfect Skin Regeneration. Science. 1997;276:75–81. Yang G, Chen H, Chen Q, Qiu J, Qahar M, Fan Z, et al. Injury-induced interleukin-1 alpha promotes Lgr5 hair follicle stem cells de novo regeneration and proliferation via regulating regenerative microenvironment in mice. Inflamm Regener. 2023;43:14. Liu J-Q, Zhao K-B, Feng Z-H, Qi F-Z. Hair follicle units promote re-epithelialization in chronic cutaneous wounds: A clinical case series study. Experimental Therapeutic Med. 2015;10:25–30. Aamar E, Avigad Laron E, Asaad W, Harshuk-Shabso S, Enshell-Seijffers D. Hair-Follicle Mesenchymal Stem Cell Activity during Homeostasis and Wound Healing. J Invest Dermatology. 2021;141:2797–2807e6. Rippa AL, Kalabusheva EP, Vorotelyak EA. Regeneration of Dermis: Scarring and Cells Involved. Cells. 2019;8:607. Driskell RR, Lichtenberger BM, Hoste E, Kretzschmar K, Simons BD, Charalambous M, et al. Distinct fibroblast lineages determine dermal architecture in skin development and repair. Nature. 2013;504:277–81. Jiang D, Rinkevich Y. Scars or Regeneration?—Dermal Fibroblasts as Drivers of Diverse Skin Wound Responses. Int J Mol Sci. 2020;21:617. Embryonic skin development and repair.pdf. Phan QM, Fine GM, Salz L, Herrera GG, Wildman B, Driskell IM, et al. Lef1 expression in fibroblasts maintains developmental potential in adult skin to regenerate wounds. eLife. 2020;9:e60066. Ma Y, Lin Y, Huang W, Wang X. Direct Reprograming of Mouse Fibroblasts into Dermal Papilla Cells via Small Molecules. IJMS. 2022;23:4213. Xie B, Chen M, Ding P, Lei L, Zhang X, Zhu D, et al. Induction of dermal fibroblasts into dermal papilla cell-like cells in hydrogel microcapsules for enhanced hair follicle regeneration. Appl Mater Today. 2020;21:100805. Jo H, Brito S, Kwak BM, Park S, Lee M-G, Bin B-H. Applications of Mesenchymal Stem Cells in Skin Regeneration and Rejuvenation. IJMS. 2021;22:2410. Li C, An Y, Sun Y, Yang F, Xu Q, Wang Z. Adipose Mesenchymal Stem Cell-Derived Exosomes Promote Wound Healing Through the WNT/β-catenin Signaling Pathway in Dermal Fibroblasts. Stem Cell Rev Rep. 2022;18:2059–73. Wu J, Yang Q, Wu S, Yuan R, Zhao X, Li Y, et al. Adipose-Derived Stem Cell Exosomes Promoted Hair Regeneration. Tissue Eng Regen Med. 2021;18:685–91. Zhang B, Chen T. Local and systemic mechanisms that control the hair follicle stem cell niche. Nat Rev Mol Cell Biol [Internet]. 2023 [cited 2023 Nov 9]; Available from: https://www.nature.com/articles/s41580-023-00662-3 . Driskell RR, Clavel C, Rendl M, Watt FM. Hair follicle dermal papilla cells at a glance. J Cell Sci. 2011;124:1179–82. Yang C-C, Cotsarelis G. Review of hair follicle dermal cells. J Dermatol Sci. 2010;57:2–11. Thangapazham RL, Klover P, Wang J, Zheng Y, Devine A, Li S, et al. Dissociated human dermal papilla cells induce hair follicle neogenesis in grafted dermal-epidermal composites. J Invest Dermatol. 2014;134:538–40. Madaan A, Verma R, Singh AT, Jaggi M. Review of Hair Follicle Dermal Papilla cells as in vitro screening model for hair growth. Intern J Cosmet Sci. 2018;40:429–50. Morgan BA. The Dermal Papilla: An Instructive Niche for Epithelial Stem and Progenitor Cells in Development and Regeneration of the Hair Follicle. Cold Spring Harb Perspect Med. 2014;4:a015180. He J, Ren W, Wang W, Han W, Jiang L, Zhang D, et al. Exosomal targeting and its potential clinical application. Drug Deliv Transl Res. 2022;12:2385–402. Li J, Zhao B, Yao S, Dai Y, Zhang X, Yang N, et al. Dermal PapillaCell-Derived Exosomes Regulate Hair Follicle Stem Cell Proliferation via LEF1. Int J Mol Sci. 2023;24:3961. Yan H, Gao Y, Ding Q, Liu J, Li Y, Jin M, et al. Exosomal Micro RNAs Derived from Dermal Papilla Cells Mediate Hair Follicle Stem Cell Proliferation and Differentiation. Int J Biol Sci. 2019;15:1368–82. Zhou L, Wang H, Jing J, Yu L, Wu X, Lu Z. Regulation of hair follicle development by exosomes derived from dermal papilla cells. Biochem Biophys Res Commun. 2018;500:325–32. Topouzi H, Logan NJ, Williams G, Higgins CA. Methods for the isolation and 3D culture of dermal papilla cells from human hair follicles. Exp Dermatol. 2017;26:491–6. Wang B, Liu X-M, Liu Z-N, Wang Y, Han X, Lian A-B, et al. Human hair follicle-derived mesenchymal stem cells: Isolation, expansion, and differentiation. WJSC. 2020;12:462–70. Wu JJ, Liu RQ, Lu YG, Zhu TY, Cheng B, Men X. Enzyme digestion to isolate and culture human scalp dermal papilla cells: a more efficient method. Arch Dermatol Res. 2005;297:60–7. Las Heras K, Royo F, Garcia-Vallicrosa C, Igartua M, Santos-Vizcaino E, Falcon-Perez JM, et al. Extracellular vesicles from hair follicle-derived mesenchymal stromal cells: isolation, characterization and therapeutic potential for chronic wound healing. Stem Cell Res Ther. 2022;13:147. Seluanov A, Vaidya A, Gorbunova V. Establishing Primary Adult Fibroblast Cultures From Rodents. JoVE. 2010;2033. Zhang M, Ye Y, Zhao P, Bai L, Li X. Preliminary studies of hair follicle regeneration by injections of epidermal stem cells and dermal papilla cells into nude mice. Cell Tissue Bank. 2020;21:321–7. Bejaoui M, Villareal MO, Isoda H. β-catenin-mediated hair growth induction effect of 3,4,5-tri-O-caffeoylquinic acid. Aging. 2019;11:4216. Ng KJ, Lim J, Tan YN, Quek D, Lim Z, Pantelireis N, et al. Sox2 in the dermal papilla regulates hair follicle pigmentation. Cell Rep. 2022;40:111100. Gan Y, Wang H, Du L, Li K, Qu Q, Liu W, et al. Cellular Heterogeneity Facilitates the Functional Differences Between Hair Follicle Dermal Sheath Cells and Dermal Papilla Cells: A New Classification System for Mesenchymal Cells within the Hair Follicle Niche. Stem Cell Rev Rep. 2022;18:2016–27. Mascharak S, desJardins-Park HE, Longaker MT. Fibroblast Heterogeneity in Wound Healing: Hurdles to Clinical Translation. Trends Mol Med. 2020;26:1101–6. Xiao S-E, Miao Y, Wang J, Jiang W, Fan Z-X, Liu X-M, et al. As a carrier–transporter for hair follicle reconstitution, platelet-rich plasma promotes proliferation and induction of mouse dermal papilla cells. Sci Rep. 2017;7:1125. Kang D, Liu Z, Qian C, Huang J, Zhou Y, Mao X, et al. 3D bioprinting of a gelatin-alginate hydrogel for tissue-engineered hair follicle regeneration. Acta Biomater. 2023;165:19–30. Rishikaysh P, Dev K, Diaz D, Qureshi WMS, Filip S, Mokry J. Signaling Involved in Hair Follicle Morphogenesis and Development. Int J Mol Sci. 2014;15:1647–70. Mascharak S, Talbott HE, Januszyk M, Griffin M, Chen K, Davitt MF, et al. Multi-omic analysis reveals divergent molecular events in scarring and regenerative wound healing. Cell Stem Cell. 2022;29:315–327e6. Zheng B, Yang L, Feng S, Zhu Y, Du L, Zhang J et al. Organoid-Loaded Cryomicroneedles for Biomimic Hair Regeneration. Adv Funct Mater. 2023;2304950. Ito M, Yang Z, Andl T, Cui C, Kim N, Millar SE, et al. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature. 2007;447:316–20. Zhao Q, Li N, Zhang H, Lei X, Cao Y, Xia G, et al. Chemically induced transformation of human dermal fibroblasts to hair-inducing dermal papilla-like cells. Cell Prolif. 2019;52:e12652. Kwack MH, Seo CH, Gangadaran P, Ahn B-C, Kim MK, Kim JC, et al. Exosomes derived from human dermal papilla cells promote hair growth in cultured human hair follicles and augment the hair-inductive capacity of cultured dermal papilla spheres. Exp Dermatol. 2019;28:854–7. Chen Y, Huang J, Liu Z, Chen R, Fu D, Yang L, et al. miR-140-5p in Small Extracellular Vesicles From Human Papilla Cells Stimulates Hair Growth by Promoting Proliferation of Outer Root Sheath and Hair Matrix Cells. Front Cell Dev Biol. 2020;8:593638. Choi S, Yoon M, Choi K-Y. Approaches for Regenerative Healing of Cutaneous Wound with an Emphasis on Strategies Activating the Wnt/β-Catenin Pathway. Adv Wound Care. 2022;11:70–86. Lim X, Nusse R. Wnt Signaling in Skin Development, Homeostasis, and Disease. Cold Spring Harb Perspect Biol. 2013;5:a008029. Tsai S-Y, Sennett R, Rezza A, Clavel C, Grisanti L, Zemla R, et al. Wnt/β-catenin signaling in dermal condensates is required for hair follicle formation. Dev Biol. 2014;385:179–88. Chen D, Jarrell A, Guo C, Lang R, Atit R. Dermal β-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development. 2012;139:1522–33. Yoon M, Kim E, Seo SH, Kim G-U, Choi K-Y. KY19382 Accelerates Cutaneous Wound Healing via Activation of the Wnt/β-Catenin Signaling Pathway. Int J Mol Sci. 2023;24:11742. Mok K-W, Saxena N, Heitman N, Grisanti L, Srivastava D, Muraro MJ, et al. Dermal Condensate Niche Fate Specification Occurs Prior to Formation and Is Placode Progenitor Dependent. Dev Cell. 2019;48:32–48e5. Rognoni E, Gomez C, Pisco AO, Rawlins EL, Simons BD, Watt FM et al. Inhibition of β-catenin signalling in dermal fibroblasts enhances hair follicle regeneration during wound healing. Development. 2016;dev.131797. Talbott HE, Mascharak S, Griffin M, Wan DC, Longaker MT. Wound healing, fibroblast heterogeneity, and fibrosis. Cell Stem Cell. 2022;29:1161–80. Li Y, Zhang J, Shi J, Liu K, Wang X, Jia Y, et al. Exosomes derived from human adipose mesenchymal stem cells attenuate hypertrophic scar fibrosis by miR-192-5p/IL-17RA/Smad axis. Stem Cell Res Ther. 2021;12:221. Mascharak S, desJardins-Park HE, Davitt MF, Griffin M, Borrelli MR, Moore AL, et al. Preventing Engrailed-1 activation in fibroblasts yields wound regeneration without scarring. Science. 2021;372:eaba2374. Lim CH, Sun Q, Ratti K, Lee S-H, Zheng Y, Takeo M, et al. Hedgehog stimulates hair follicle neogenesis by creating inductive dermis during murine skin wound healing. Nat Commun. 2018;9:4903. Schemes Scheme 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Scheme1.png Scheme 1. Schematic illustration of the experimental process. DPCs were extracted from mouse vibrissa HFs and exosomes were isolated from cell culture supernatants. DPC-Exos was taken up by fibroblasts, promoted the proliferation and migration of fibroblasts, and enhanced the hair-inducing activity of fibroblasts in vivo and in vitro . DPC-Exos could promote wound healing and HF regeneration during wound healing. The therapeutic effect of DPC-exos is attributed to the upregulation of β-catenin, ALP, Lef1, and Noggin in fibroblasts and wound healing. Cite Share Download PDF Status: Published Journal Publication published 19 Jul, 2024 Read the published version in Journal of Nanobiotechnology → Version 1 posted Editorial decision: Revision requested 15 Apr, 2024 Reviews received at journal 25 Mar, 2024 Reviews received at journal 23 Mar, 2024 Reviewers agreed at journal 18 Mar, 2024 Reviewers agreed at journal 16 Mar, 2024 Reviewers invited by journal 16 Mar, 2024 Submission checks completed at journal 10 Feb, 2024 Editor assigned by journal 10 Feb, 2024 First submitted to journal 09 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3942786","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":272148840,"identity":"8eadb136-e0a0-41f9-b6ec-8b54a73126fe","order_by":0,"name":"Yage Shang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yage","middleName":"","lastName":"Shang","suffix":""},{"id":272148841,"identity":"5376a27d-fd91-433d-941d-cdee815e8be6","order_by":1,"name":"Mengyang Li","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mengyang","middleName":"","lastName":"Li","suffix":""},{"id":272148842,"identity":"58008aaa-a23d-4735-b50a-18c632b26ced","order_by":2,"name":"Lixia Zhang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lixia","middleName":"","lastName":"Zhang","suffix":""},{"id":272148843,"identity":"c5fae10e-6190-4c23-91b1-03b19e4022f8","order_by":3,"name":"Chao Han","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Han","suffix":""},{"id":272148844,"identity":"21396401-c8c4-443d-aa8d-64babc97acb8","order_by":4,"name":"Kuo Shen","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kuo","middleName":"","lastName":"Shen","suffix":""},{"id":272148845,"identity":"8de73c3a-108b-4916-bf0d-879eed420fee","order_by":5,"name":"Kejia Wang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kejia","middleName":"","lastName":"Wang","suffix":""},{"id":272148846,"identity":"c0f23cf7-5447-4a93-aeb1-5375a149c188","order_by":6,"name":"Yan Li","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Li","suffix":""},{"id":272148847,"identity":"c5ad3258-6fe3-4626-b86e-1772235d6f34","order_by":7,"name":"Yue Zhang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Zhang","suffix":""},{"id":272148848,"identity":"82cba9f2-37af-486f-8db5-933437f7ce7c","order_by":8,"name":"Liang Luo","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Luo","suffix":""},{"id":272148849,"identity":"a1c4ef6b-8953-41c0-9f84-e4e097673b4a","order_by":9,"name":"Yanhui Jia","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanhui","middleName":"","lastName":"Jia","suffix":""},{"id":272148850,"identity":"f1778af8-3e8c-4fac-b216-336ec503cb92","order_by":10,"name":"Kai Guo","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Guo","suffix":""},{"id":272148851,"identity":"50b8fab0-7615-4e8b-aad2-2950bda9f810","order_by":11,"name":"Weixia Cai","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weixia","middleName":"","lastName":"Cai","suffix":""},{"id":272148852,"identity":"0faaedca-38b2-4738-980f-9cddc4f23a89","order_by":12,"name":"Jian Zhang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Zhang","suffix":""},{"id":272148853,"identity":"003aabe5-2d13-4ef1-b860-d7dd00d82d78","order_by":13,"name":"Xujie Wang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xujie","middleName":"","lastName":"Wang","suffix":""},{"id":272148854,"identity":"91d1db77-6000-449b-b674-2bdbb41f2e44","order_by":14,"name":"Hongtao Wang","email":"","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hongtao","middleName":"","lastName":"Wang","suffix":""},{"id":272148855,"identity":"b923fb66-965c-419c-a245-9df912434b3b","order_by":15,"name":"Dahai Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYBACAwYGMyBpww/hshGvJU2ygUQtDIdJ0GIukbztwY+C8xK6084YMHwoO8zAP7sBvxbLGWnlhj0GtyXMbucYMM44d5hB4s4BAg67kWMmwWNwuw6khZm37TCDgUQCYS2SfwzOgW1h/kusFmkegwMQLYxEaTnzrExaxiAZqCWt4GDPuXQeiRuEtBxP3ib55o8dUEvyxgc/yqzl+GcQ0IICDgAxDwnqR8EoGAWjYBTgAgD99EEFjvLeaQAAAABJRU5ErkJggg==","orcid":"","institution":"Xijing Hospital, Fourth Military Medical University","correspondingAuthor":true,"prefix":"","firstName":"Dahai","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2024-02-09 10:59:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3942786/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3942786/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12951-024-02689-w","type":"published","date":"2024-07-19T16:04:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":51083884,"identity":"c1c307b2-272f-46f2-a120-26f56766f922","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3041417,"visible":true,"origin":"","legend":"\u003cp\u003eIsolation and characterization of the DPCs and DPC-Exos. (\u003cstrong\u003eA\u003c/strong\u003e). Separated DP tissues from mouse vibrissae follicles via microdissection coupled with collagenase digestion. (\u003cstrong\u003eB\u003c/strong\u003e). The primary DPCs under the microscope 7 days after seeding, adipogenic and osteogenic differentiation, and cell alkaline phosphatase staining of passage 4 DPCs. (\u003cstrong\u003eC\u003c/strong\u003e). Flow cytometry shows DPCs were positive for specific markers Versican (87.6%), Sox (95.6%), β-catenin (98.1%), and ALP (96.8%). (\u003cstrong\u003eD\u003c/strong\u003e). Isolated DPC-Exos from cell culture supernatants using differential centrifugation/ ultracentrifugation techniques. (\u003cstrong\u003eE\u003c/strong\u003e) (\u003cstrong\u003eF\u003c/strong\u003e). Morphology and diameter distribution of DPC-Exos detected by TEM and NTA respectively. (\u003cstrong\u003eG\u003c/strong\u003e). Immunoblot analysis of known exosomal markers (CD9, TSG101) and negative marker (Calnexin). H. PKH 26-labeled DPC-Exos internalized by fibroblasts. scale bars =100 μm. Red: PKH26 labeled DPC-Exos; Blue: DAPI.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/8d46453a7c8c5a06ad0ed99a.png"},{"id":51083882,"identity":"c64b0c4e-e6c3-4209-9c49-0f0bfdd5c608","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2165581,"visible":true,"origin":"","legend":"\u003cp\u003eDPC-Exos promotes fibroblast proliferation and migration in a concentration-dependent manner. (\u003cstrong\u003eA\u003c/strong\u003e) (\u003cstrong\u003eB\u003c/strong\u003e) Scratch assay and quantitative analysis of cell migration in each group at 12 h and 24 h. scale bars = 100 μm. (\u003cstrong\u003eC\u003c/strong\u003e). CCK-8 analysis shows the fibroblast proliferation results after different concentrations of DPC-Exos treatments at 12 h and 24 h. (\u003cstrong\u003eD\u003c/strong\u003e). Transwell assay and quantitative analysis of cell migration in each group at 24 h. scale bars = 100 μm. (\u003cstrong\u003eE\u003c/strong\u003e). EdU staining and quantitative analysis of fibroblast proliferation in each group at 24 h. scale bars = 275 μm. The data was shown as mean ± SD. n.s., no significant difference; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/5d0461d7e45ef79eab94aa63.png"},{"id":51083885,"identity":"d3617f3e-1c21-4855-812f-2a5b689bd117","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":14964739,"visible":true,"origin":"","legend":"\u003cp\u003eDPC-Exos induced high expression of β-catenin, ALP, Lef1, and Noggin in fibroblasts. (\u003cstrong\u003eA\u003c/strong\u003e). Fibroblasts were treated with different concentrations of DPC-Exos. The gene expression of β-catenin, ALP, Lef1, and Noggin in fibroblasts was detected by qPCR. (\u003cstrong\u003eB\u003c/strong\u003e). Western blot and quantitative analysis to show the protein expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts after different concentrations of DPC-Exos treatment. (\u003cstrong\u003eC\u003c/strong\u003e). ALP staining of fibroblasts after different concentrations of DPC-Exos treatment. scale bars =100 μm. (\u003cstrong\u003eD\u003c/strong\u003e). Immunofluorescent staining of β-catenin, ALP, Lef1, and Noggin in fibroblasts after PBS (control) and DPC-Exos (20μg/mL) treatment. scale bars =125 μm. The data was shown as mean ± SD. n.s., no significant difference; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/7568e2fd8bcecddc9eccef21.png"},{"id":51083891,"identity":"485be96e-101e-4ded-b516-8fbaeb5cc07e","added_by":"auto","created_at":"2024-02-13 19:43:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":20230993,"visible":true,"origin":"","legend":"\u003cp\u003eThe hair inductive property of fibroblasts after DPC-Exos treatment was assessed by hair reconstitution assay. (\u003cstrong\u003eA\u003c/strong\u003e). Schematic illustration of methods for the generation and transplantation of cell mixture. (\u003cstrong\u003eB\u003c/strong\u003e). The appearance of hair neogenesis in nude mice at day 14 and day 21 post-grafting. (\u003cstrong\u003eC\u003c/strong\u003e). Results of hair follicle formation of the control group and DPC-Exos group in the patch assay. (\u003cstrong\u003eD\u003c/strong\u003e). Stereo images of skin dermal side from nude mice transplanted of neonatal mice epidermal cells combined with fibroblasts treated without DPC-Exos (upper), or fibroblasts treated with DPC-Exos (lower). scale bar =200 μm. (\u003cstrong\u003eE\u003c/strong\u003e). H\u0026amp;E staining of transplanted sites in the control group and DPC-Exos group 21 days post-grafting. scale bar =100 μm, 10 μm.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/4d7f84119aea6f282a6ffb7c.png"},{"id":51083886,"identity":"bbe5a876-d568-4dae-b71f-895b07e4a930","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":15291529,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of DPC-Exos on the excisional model of C57BL/6J mice.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e). Schematic diagram of the experimental processes. (\u003cstrong\u003eB\u003c/strong\u003e). Digital photographs of wound area treated with PBS or DPC-Exos on days 3, 7, 10, and 14 post-wounding. (\u003cstrong\u003eC\u003c/strong\u003e). Traces of wound-bed closure during 14 days \u003cem\u003ein vivo\u003c/em\u003e between the PBS group and DPC-Exos group. (\u003cstrong\u003eD\u003c/strong\u003e) (\u003cstrong\u003eE\u003c/strong\u003e). The histogram showed the relative wound area and hair coverage area between the PBS group and the DPC-Exos group. (\u003cstrong\u003eF\u003c/strong\u003e). H\u0026amp;E and Masson staining of the sections on day 14 post-wounding in wound tissue treated with PBS or DPC-Exos group, scale bar = 500 μm, 100 μm. (\u003cstrong\u003eG\u003c/strong\u003e) (\u003cstrong\u003eH\u003c/strong\u003e). Quantitative analysis of relative hair follicle number and Masson staining+ area between PBS group and DPC-Exos group. The data was shown as mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/a7032a27ad67e1108c77962f.png"},{"id":51083888,"identity":"c4852fbd-e059-43a8-9d21-e58582604287","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1111918,"visible":true,"origin":"","legend":"\u003cp\u003eDPC-Exos improved β-catenin, ALP, Lef1, and Noggin expression in tissue samples.\u003cstrong\u003e (A\u003c/strong\u003e). Gene expression of β-catenin, ALP, Lef1, and Noggin in tissue samples was detected by qPCR. (\u003cstrong\u003eB\u003c/strong\u003e). Western blotting and quantitative analysis to show the protein expression levels of β-catenin, ALP, Lef1, and Noggin in PBS and DPC-Exos treated mice. (\u003cstrong\u003eC\u003c/strong\u003e). The results of β-catenin(left), and Lef1(right) tissue immunofluorescent staining in PBS and DPC-Exos treated mice. Blue: DAPI; Red: β-catenin (left), Lef1 (right). scale bar = 500 μm, 100 μm. (\u003cstrong\u003eD\u003c/strong\u003e). Quantitative analysis of the mean fluorescent intensity of β-catenin and Lef1 in PBS and DPC-Exos treated mice. The data was shown as mean ± SD. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/61e4cf209d85ff3838a29c15.png"},{"id":51083890,"identity":"7208acd5-1ed2-441e-94f9-4342f1b37cf3","added_by":"auto","created_at":"2024-02-13 19:43:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":12630728,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DPC-Exos on fibroblasts after application of Wnt inhibitor. (\u003cstrong\u003eA\u003c/strong\u003e) (\u003cstrong\u003eB\u003c/strong\u003e). Scratch assay and transwell assay show that DPC-Exos alleviated the inhibitory effect of XAV939 on the migration of fibroblast. scale bars = 200μm. (\u003cstrong\u003eC\u003c/strong\u003e). EdU staining of fibroblast proliferation in control, XAV939, and XAV939 + exosomes groups at 24 h. scale bars = 200μm. (\u003cstrong\u003eD\u003c/strong\u003e) (\u003cstrong\u003eE\u003c/strong\u003e). Western blot and quantitative analysis indicating the expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts at control, XAV939, and XAV939 + exosomes groups. The data was shown as mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/14fe66d350a099b6085ae760.png"},{"id":51083892,"identity":"ee4603a8-86bb-4fee-821a-6c1aa41dc0bc","added_by":"auto","created_at":"2024-02-13 19:43:08","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":24154465,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DPC-Exos on wound healing after application of Wnt pathway inhibitor.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e). Digital photographs of the wound area of the control group, DPC-Exos group, XAV939 group, and XAV939 + Exos group at 0, 3, 7, 10, and 14 days after wounding. (\u003cstrong\u003eB\u003c/strong\u003e). Traces of wound-bed closure during 14 days \u003cem\u003ein vivo\u003c/em\u003efor each treatment category. (\u003cstrong\u003eC\u003c/strong\u003e). Histogram showed the relative change of wound area during 14 days among the control, DPC-Exos, XAV939, and DPC-Exos + X groups. (\u003cstrong\u003eD\u003c/strong\u003e). Representative H\u0026amp;E and Masson trichromatic staining images of wound tissue sections of the control, DPC-Exos, XAV939, and XAV939 + Exos groups on day 14 after wounding, scale bar = 500μm, 50μm. The data was shown as mean ± SD. n.s., no significant difference; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fihure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/cc55ebeae5dcbfd18f5ec5c9.png"},{"id":51083889,"identity":"568f0b86-f013-4ccb-a32b-add62bcad584","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":4712410,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of β-catenin, ALP, Lef1, and Noggin in tissue samples after use of Wnt pathway inhibitor. (\u003cstrong\u003eA\u003c/strong\u003e) (\u003cstrong\u003eB\u003c/strong\u003e). Western blot bands and quantitative analysis to show the protein expression levels of β-catenin, ALP, Lef1, and Noggin in tissue samples of control, DPC-Exos, XAV939, and XAV939 + Exos treated groups. (\u003cstrong\u003eC\u003c/strong\u003e). β-catenin(left), and Lef1(right) immunofluorescent staining in wounds 14 days post-wounding after the use of Wnt pathway inhibitor. Blue: DAPI; Red: β-catenin (left), Lef1 (right). (\u003cstrong\u003eD\u003c/strong\u003e) (\u003cstrong\u003eE\u003c/strong\u003e). Quantitative analysis of the mean fluorescent intensity of β-catenin and Lef1 in tissue samples. The data was shown as mean ± SD. n.s., no significant difference; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/031a9898c55f36b72db666cc.png"},{"id":61594653,"identity":"17b865a1-e9c3-4914-8ee2-23937d307b77","added_by":"auto","created_at":"2024-08-01 17:14:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":139556266,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/ee3597af-7874-4cc8-ae51-5a3766093c57.pdf"},{"id":51083883,"identity":"b3e7cb77-98d9-4b77-9339-53234da97aa3","added_by":"auto","created_at":"2024-02-13 19:43:07","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":131627,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme 1. \u003c/strong\u003eSchematic illustration of the experimental process. DPCs were extracted from mouse vibrissa HFs and exosomes were isolated from cell culture supernatants. DPC-Exos was taken up by fibroblasts, promoted the proliferation and migration of fibroblasts, and enhanced the hair-inducing activity of fibroblasts \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. DPC-Exos could promote wound healing and HF regeneration during wound healing. The therapeutic effect of DPC-exos is attributed to the upregulation of β-catenin, ALP, Lef1, and Noggin in fibroblasts and wound healing.\u003c/p\u003e","description":"","filename":"Scheme1.png","url":"https://assets-eu.researchsquare.com/files/rs-3942786/v1/4a778c22ab551b67cf997b83.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dermal papilla cell-derived exosomes promote hair follicle regeneration during wound healing by activating Wnt/β‐catenin signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAs the largest human organ, skin plays an important role in defending against external damage and maintaining the body's internal homeostasis. Hair follicles (HFs) are tiny organs located in the dermis of the skin and contribute to human health in skin metabolism, thermoregulation, sensory perception, and social interactions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In postpartum humans, hair loss from injuries does not regenerate, which affects the skin function and aesthetics, and causes pain and burden to patients[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. HF regeneration helps to restore the normal function of the skin and reduce scar formation in wound healing[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Although many methods have been developed to accelerate HF neogenesis, it remains a challenge to find a way to promote HF regeneration during wound healing.\u003c/p\u003e \u003cp\u003eFibrotic scarring and regeneration healing are thought to be on opposite ends of wound healing, and studies show that fibroblasts are key components in deciding wound healing outcomes [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Fetal and neonatal mouse dermal fibroblasts still have the ability to induce HF neogenesis, but such hair-inducing capacity is lost in adult fibroblasts[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This is one of the reasons for wound scarring rather than regenerative healing in adulthood. Many studies were performed to enhance the hair-inducing capacity of adult dermal fibroblasts for HF regeneration. Ma, Y et al. demonstrated that small molecules and their combinations could induce L929 mouse fibroblast cell line and mouse dermal fibroblasts into dermal-papilla-cell-like cells, and confer a hair-forming ability on adult mouse fibroblasts[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Xie et al. reported that a 3D cultivation system of hydrogel microcapsules could induce dermal fibroblasts into dermal papilla cell-like cells[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Although these methods restored the trichogenecity of fibroblasts and induced HF neogenesis, they may not be suitable for wound treatment in terms of safety and feasibility. With the development of regenerative medicine, mesenchymal stem cell-derived exosomes have been considered as a promising therapeutic tool for tissue regeneration[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHFs consist of epithelial and mesenchymal parts and consistently undergo hair cycle of active growth (anagen), degeneration (catagen), and quiescence (telogen)[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. As the only organ that can be completely regenerated in the body, HFs are widely used in regenerative medicine research. HF morphogenesis relies on the epithelial\u0026ndash;mesenchymal interaction (EMI), which is a prerequisite for HF formation, growth, and hair cycles. Current strategies for \u003cem\u003ein vivo\u003c/em\u003e HF regeneration aim to mimic EMI, which combines epithelial and inducible mesenchymal components to promote HF formation. Dermal papilla cells (DPCs) are specialized mesenchymal cells located at the base of hair follicles and are considered to be stem cell reservoirs in HF[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. DPCs have a strong hair-inducing capacity to reprogram epidermal cells into hair follicle fate, and new HFs can be regenerated by introducing isolated dermal papilla tissues or cultured DPCs in hairless skin combined with epidermal cells[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. As the signaling center of HF, DPCs constitute the dermal niche that instructs hair follicle epidermal cell fate and differentiation[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. DPCs exert their regulatory effect in the form of paracrine, and exosomes are important mediators of their functions. Exosomes are extracellular vesicles that contain proteins, lipids, and nucleic acids, with a diameter of 30\u0026ndash;150 nanometers, and play an important role in cell-to-cell communication[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Studies have shown that exosomes derived from DPCs (DPC-Exos) could stimulate the proliferation and differentiation of hair follicle stem cells, hair matrix cells, and outer root sheath cells, thus promoting HF growth, regeneration, and hair cycles[\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGiven the effect of DPC-Exos in promoting HF regeneration, we wondered if it could promote HF regeneration during wound healing. Although the effect of DPC-Exos is intensively studied, the effect of DPC-Exos on fibroblasts has not been reported. We performed a series of \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e experiments to observe and validate the effect of DPC-Exos on fibroblasts in wound healing. In the study, we found that DPC-Exos could promote the proliferation and migration of fibroblasts in a concentration-dependent manner, and enhance the hair-inducing capacity of fibroblasts. Hair reconstruction assay showed that fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. In addition, DPC-Exos could accelerate wound re-epithelialization, and promote HF regeneration during wound healing. Furthermore, the activation of the Wnt/β-catenin signaling pathway in fibroblasts and wound healing was verified by using Wnt pathway inhibitor. In conclusion, the aforementioned results demonstrated that DPC-Exos could promote HF regeneration during wound healing by activating the fibroblasts and the Wnt/β-catenin signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDPCs isolation\u003c/h2\u003e \u003cp\u003eDPCs were obtained from 6-week-old male C57BL/6J mice vibrissa HFs via microdissection combined with collagenase digestion as previously described[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Briefly, the upper lip containing the vibrissa pad was cut under anesthesia, and the dermis side was exposed under the Olympus stereomicroscope. All hair bulbs were transected with microscissors and digested in 0.2% type I collagenase (Gibco, Grand Island, USA) at 37\u0026deg;C for 30 min. The divided DP spheroids were resuspended into high-glucose DMEM (Gibco, USA) containing 20% FBS (Corning, USA) and 1% penicillin/streptomycin and cultured in an incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37 ℃. On day 3, the primary DPCs could migrate out from DP spheroids. On day 7, DPCs exhibited aggregative growth behavior around DP spheroids. Subcultured DPCs were cultured in DMEM/F12 (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin and passaged every 3\u0026ndash;4 days. Passage 3\u0026ndash;6 DPCs were used for subsequent assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry and ALP staining of DPCs\u003c/h2\u003e \u003cp\u003eThe specific markers of DPC were detected by flow cytometry. Passage 4 DPCs were incubated with fluorescence-conjugated antibodies, anti-Versican (ab311818, Abcam, 1:200), anti-Sox2 (ab93689, Abcam, 1:200), anti-β-catenin (8480T, CST, 1:200), and anti-ALP(4060T, CST, 1:200), then detected and analyzed by a flow cytometer (BD FACSAria\u0026trade; III system; USA). The alkaline phosphatase (ALP) activity of DPCs was detected by alkaline phosphatase assay kit (P0321S, Beyotime, China). DPCs were incubated with NBT/BCIP solution, the reaction was stopped by washing with PBS, and dark grey staining was a positive for ALP. Images were observed under the Olympus FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eOsteoblastic and adipogenic differentiation of DPCs\u003c/h2\u003e \u003cp\u003ePassage 4 DPCs seeded in six-well plates to approximately 80\u0026ndash;90% confluent, removed the old culture medium, and treated with osteogenic differentiation medium for 3 weeks or adipogenic differentiation medium for 2 weeks, respectively. After induced culture, DPCs were fixed with 4% paraformaldehyde and stained with Alizarin Red S or Oil Red O to detect the results of osteoblastic and adipogenic differentiation. Images were observed under the Olympus FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and identification of DPC-Exos\u003c/h2\u003e \u003cp\u003eP3 to P6 DPCs were cultured in 100-mm dishes until 80% confluence, changing the culture medium with DMEM/F12 containing exosome-free FBS. After 48 h culture, the DPCs culture supernatants were harvested for exosome isolation by differential centrifugation/ ultracentrifugation techniques[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The supernatants went through 300\u0026times;\u003cem\u003eg\u003c/em\u003e for 10 min, 2,000\u0026times;\u003cem\u003eg\u003c/em\u003e for 10 min, and 10,000\u0026times;\u003cem\u003eg\u003c/em\u003e for 30 min to remove cell debris and middle-large extracellular vesicles. Then, the supernatants were ultracentrifuged at 100,000\u0026times;\u003cem\u003eg\u003c/em\u003e for 70 min, and pellets were thoroughly washed with cold PBS and ultracentrifuged again for purification and enrichment. The final exosome pellets were resuspended in 200 uL PBS (200 \u0026micro;L PBS for 200 mL supernatant), and stored at -80℃.\u003c/p\u003e \u003cp\u003eThe transmission electron microscope (TEM) and nanoparticle tracking analysis (NTA) were used to detect the morphology and size distribution of DPC-Exos respectively. Western blot was used to detect the protein markers of exosomes. The 0.22-\u0026micro;m filter is used to remove bacteria from extracted DPC-Exos before use. DPC-Exos were labeled with PKH26 to examine the internalization in fibroblasts. After incubation for 24h with PKH26 labeled exosomes, fibroblasts were fixed with 4% paraformaldehyde, and nuclear was counterstained with DAPI. Photographed with Olympus FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFibroblast isolation and culture\u003c/h2\u003e \u003cp\u003ePrimary fibroblasts were isolated from the dorsal skin of 7-week-old male C57BL/6J mice as previously described[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Briefly, mice were sterilized with 75% alcohol after hair removal and washed 3 times in PBS. Back skin was harvested and incubated in 0.25% dispase-trypsin solution overnight at 4\u0026deg;C. The epidermal layer was scraped off and kept dermis only. Cut dermis into pieces and digested with 0.2% type I collagenase at 37\u0026deg;C for 1 h, and further digested with 0.25% trypsin-EDTA at 37\u0026deg;C for 10 min, the serum-containing medium was added to terminate the digestion. The debris of the digested mixture was removed by filtering through the 100-\u0026micro;m mesh. The cell suspension was centrifuged at 300 \u0026times;\u003cem\u003eg\u003c/em\u003e for 5min and pellets were inoculated in culture flasks. The cells were cultured with low-glucose DMEM supplemented with 10% FBS, and 1% penicillin/streptomycin in an incubator with 5% CO2 at 37 ℃. Passage 4 fibroblasts for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assay\u003c/h2\u003e \u003cp\u003eThe proliferation of fibroblasts was measured by CCK-8 cell proliferation assay and EdU staining assay. For the CCK-8 assay, fibroblasts were seeded into 96-well plates, 5\u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well, and different concentrations of DPC-Exos (0, 10, 20, and 40 \u0026micro;g/mL) were added into wells at 0, 24, and 36 h after cell adherent. Each group had 6 replicate wells. After 48 h culture, 10 \u0026micro;l CCK-8 (AR1160-500, Boster, China) reagent was added into plates and incubated for 2 h at 37\u0026deg;C. The absorbance at 450 nm was measured using a microplate reader. Using EdU staining kit (C0075S, Beyotime, China) to detect the proliferation of fibroblasts. Cells were seeded in 12-well plates, and different treatments were added to the well for 24 h. Add EdU working solution and continue to incubate for 2 h. After labeled, the cells were fixed and permeabilized, EdU Click reaction solution was added to incubate in the dark for 30 minutes, and DAPI was used for nuclear staining. Photographed with Olympus FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell migration assay\u003c/h2\u003e \u003cp\u003eThe migration of fibroblasts was measured via scratch assay and transwell assay. For the scratch assay, fibroblasts were seeded in 35-mm cell culture dishes until approximately 90% confluent. The cell monolayer was scratched with a 200 \u0026micro;L sterile pipette tip to form a wound gap and washed with PBS, and then different treatments were added to the wells. Take pictures of the wounds at 0, 12, and 24 h post-wounding, and the distance of migration was measured by ImageJ. For transwell assay, fibroblasts were seeded in the upper part of the transwell 24-well plates (Corning, USA), 3 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e/well, and different concentrations of DPC-Exos were added in the upper chamber. 500\u0026micro;l basal medium was added to the lower chamber and incubated for 24 h. After that, cells that did not pass through the membrane of the chamber were wiped off, and the chamber was fixed with 4% paraformaldehyde and stained with 0.5% crystal violet solution (Boster) for 10 min at room temperature. Washed off the excess dye with PBS, the migrated cells were observed under the Olympus FSX100 microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR analysis\u003c/h2\u003e \u003cp\u003eThe expression level of each gene was evaluated by qPCR. TRIzol Reagent (Takara, Japan) was used to extract RNA from cells and tissue samples following the manufacturer\u0026rsquo;s instructions. After confirming the quality and concentration, 600 ng of RNA was reversely transcribed into cDNA using Prime Script\u0026trade; RT reagent Kit (Takara). The cDNA was amplified with SYBR Green PCR Master Mix and specific primers in the CFX Connect (BIO-RAD), and GAPDH as internal control. Reaction mixtures were treated with initial denaturation at 95 ℃ for 30 s, and amplified for 40 cycles (95 ℃ for 15 s, 60 ℃ for 30 s, and 70 ℃ for 1 min). The primer pairs used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eprimer pairs used for PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene (mouse)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePrimers Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCTNNB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGACAAGCCACAAGATTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAGATCAGCAGTCTCATTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALPP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTGAGTACCCAGATGACTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGCGGTTCCACACATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLEF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCACCTGTTATCCTACTGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCCATTACGACAGGGATTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATGCCGAGCGAGATCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCCACATCTGTAACTTCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGAAGGTCGGTGTGAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGCTCCTGGAAGATGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eProtein expression levels of β-catenin, ALP, Lef1, and Noggin were detected by Western blot. The protein was extracted from cells and tissue samples by using lysis buffer (RIPA lysis buffer: protease inhibitor\u0026thinsp;=\u0026thinsp;1000:1), and protein concentration was detected by BCA kit (AR0146, Boster) according to the kit instructions. The protein samples were subjected to 10% SDS-PAGE gels and transferred to PVDF membranes. Then the membranes were blocked for 2 h in a 5% non-fat milk solution at room temperature. Primary antibodies β-catenin (8480T, CST, 1:1000), ALP (4060T, CST, 1:2000), Lef1 (ab137872, Abcam, 1:1000), Noggin (30023-1-AP, Proteintech, 1:1000), and GAPDH (GB15004-100, Servicebio, 1:3000) were detected and visualized with ECL Kit (P0018FS, Beyotime). The intensity of protein expression was measured on the ImageJ and graphs were performed on the GraphPad Prism\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHair patch assay\u003c/h2\u003e \u003cp\u003eHair patch assay was conducted to rebuild HFs. Fresh epidermal cells were isolated from postnatal 1\u0026ndash;2 days C57BL/6J mice according to published procedures[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Briefly, the skin of neonatal mice was peeled off and digested with 0.25% dispase solution overnight at 4℃ to separate the epidermis and dermis. The epidermis was cut into pieces and digested in 0.25% trypsin-EDTA for 5 minutes, the serum-containing medium was used to terminate digestion and cell suspensions were filtered through a 100-\u0026micro;m mesh. The filtered suspension was centrifuged at 300\u0026times;g, and cell pellets were resuspended in PBS and counted. Fibroblasts treated with DPC-Exos for 48 h or treated without DPC-Exos were digested and centrifuged, and cell pellets were resuspended in PBS and counted. For each nude mouse, the cell mixture consisted of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e fresh epidermal cells and 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e fibroblasts treated with or without DPC-Exos subcutaneously injected into the left and right back of nude mice (n\u0026thinsp;=\u0026thinsp;15). Photographed mice on the 14 and 21 days after transplantation, On the 21st day, mice were sacrificed, and tissue samples were collected for histopathology analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eWound healing experiments in mice\u003c/h2\u003e \u003cp\u003eTo evaluate the effect of DPC-Exos on wound healing, 6-8-week-old male C57BL/6J mice (Experimental Animal Center of Air Force Medical University) were randomly divided into groups (n\u0026thinsp;=\u0026thinsp;5). Created full-thickness round skin excisions (diameter\u0026thinsp;=\u0026thinsp;1 cm) in mouse dorsal skin and silicone rings were secured around the wounds to physically prevent wound contraction. On the 2nd, 4th, 6th ,8\u003csup\u003eth,\u003c/sup\u003e and 10th day post-wounding, DPC-Exos or equal volume PBS was subcutaneously injected into mice dorsal skin around wounds. Exosome treatment dose: 100 \u0026micro;g exosomes in 100 \u0026micro;l PBS/ wound. All animal experiments were performed by the guidelines from the Experimental Animal Committee of Air Force Medical University (Xi\u0026prime;an, China) strictly. Images of wounds were acquired at different time points (day 0, 3, 7, 10, and 14 post-wounding). Mice were sacrificed 14 days post-wounding and skin samples were collected for the following histological study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHistopathology analysis\u003c/h2\u003e \u003cp\u003eCollected tissue samples were fixed with 4% paraformaldehyde, dehydrated, embedded, and cut into 5-\u0026micro;m-thick sections. H\u0026amp;E and Masson\u0026rsquo;s trichrome staining were used to detect the histological change and collagen deposition. For tissue immunofluorescence staining, the sections were immersed in 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e after deparaffinization to eliminate the activity of endogenous peroxidase at 37\u0026deg;C for 15 min and blocked with 5% BSA in PBS for 1 h to exclude the non-specific binding. Then, the slides were incubated with the primary antibodies against β-catenin (8480T, CST, 1:200) and Lef1(ab137872, Abcam, 1:500) overnight at 4\u0026deg;C. The next day, the slides were washed with PBS, and incubated with Alexa Fluor 594-conjugated goat anti-Rabbit IgG (1:200; Abcam) in the dark for 1 h. Nuclei counterstained with DAPI. Images were obtained by Pannoramic MIDI scanner (3DHISTECH, Hungary).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWnt/β-catenin inhibitor\u003c/h2\u003e \u003cp\u003eXAV939 selectively inhibits downstream β-catenin in the Wnt pathway[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. We used XAV-939(cat. no. HY-15147, MCE) to block the Wnt pathway in fibroblasts and wound healing. For \u003cem\u003ein vitro\u003c/em\u003e experiments, the inhibitor group was stimulated with 10 \u0026micro;M XAV939, the XAV939\u0026thinsp;+\u0026thinsp;DPC-Exos group was treated with DPC-Exos (20 \u0026micro;g/mL)\u0026thinsp;+\u0026thinsp;10\u0026micro;M XAV939, and the control group was given an equal volume of DMSO. For the \u003cem\u003ein vivo\u003c/em\u003e assay, the XAV939 and XAV939\u0026thinsp;+\u0026thinsp;Exos treated mice were intraperitoneally injected with XAV939 four times at a dose of 1.25 mg/kg each time on day 1 and day 2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll data was analyzed using GraphPad Prism7.0 software, and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. A \u003cem\u003et\u003c/em\u003e-test was used for comparisons between two groups, and analysis of variance (ANOVA) was used for multi-group comparisons. Every assay was repeated three times independently. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of DPCs and DPC-Exos\u003c/h2\u003e \u003cp\u003eDP tissues were successfully separated from mouse vibrissa HFs via microdissection combined with collagenase digestion. After about 30 minutes of digestion in 0.2% type I collagenase, the hair bulb structure became loose, and DP tissue was gradually dissociated from the adjacent tissues. The dissociative DP tissue is conical or round in shape with high density (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Primary DPCs migrated from DP tissue 3 days after seeding, and by day 7 DPCs almost entirely moved out from DP tissue. Under the microscope, adherent DPCs have short spindle-like shape and exhibit aggregative behavior during cell culture. Oil Red O and Alizarin Red S staining indicated there were lipid droplets and calcium deposition in DPCs after adipogenic and osteogenic differentiation-induced culture. Moreover, DPCs showed highly positive Alkaline phosphatase (ALP) activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Versican, β-catenin, and ALP are considered molecular markers of DPCs. Sox2 is known to be expressed in DPCs and regulates the hair pigment[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The results of the flow cytometric indicated that the DPCs we isolated were highly positive for DPC-specific markers[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). All of these results confirmed that the cells we isolated were consistent with typical DPCs characteristics.\u003c/p\u003e \u003cp\u003eFor the identification of DPC-Exos, TEM showed that DPC-Exos are cup- or sphere-shaped morphology, and NTA analysis showed the particle diameters of DPC-Exos ranged from 50 to 150 nm, with an average of 79.0 nm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F). Western blot also showed that DPC-Exos were positive for known exosomal markers CD9 and TSG101, and negative for cell marker Calnexin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). The results of TEM, NTA, and Western blot indicated that we successfully isolated DPC-Exos.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eDPC-Exos promoted the proliferation and migration of fibroblasts in a concentration-dependent manner\u003c/h2\u003e \u003cp\u003eFibroblasts are the main cell population in the dermal skin and have been thought of as the key components in determining wound healing outcomes[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. DPC-Exos can promote the proliferation and migration of hair follicle stem cells and hair matrix cells. To evaluate the effect of DPC-Exos on fibroblasts, we first tested whether DPC-Exos could be taken up by fibroblasts. By co-incubating PKH-26-labeled DPC-Exos with fibroblasts for 24 h, we found that the labeled DPC-Exos could be taken up and internalized by fibroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). To further verify the effect of DPC-Exos on fibroblasts, we treated fibroblasts with different concentrations of DPC-Exos. The results of the CCK-8 assay showed that, compared to the control group, DPC-Exos significantly enhanced the proliferation of fibroblasts in a concentration-dependent manner. 20 \u0026micro;g/mL DPC-Exos treatment could produce a statistically significant difference, and fibroblasts proliferated fastest at 24 h of co-incubation. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The results of EdU staining also confirmed the promoting effect of DPC-Exos on fibroblast proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In addition, the results of scratch assay and transwell assay showed that DPC-Exos could improve the migration rate of fibroblasts in a concentration-dependent manner. Compared to the control group, exosome concentrations of 20 \u0026micro;g/ mL and 40 \u0026micro;g/ mL significantly enhanced the migration rate of fibroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B, D). These results demonstrated that DPC-Exos can promote the proliferation and migration of fibroblasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eDPC-Exos promoted the expression level of molecules associated with hair-inducing capacity in fibroblasts\u003c/h2\u003e \u003cp\u003eβ-catenin and ALP are widely used DPC markers and indicate the hair-inducing capacity of DPCs[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Noggin is expressed by DPCs and indicates the onset of hair growth[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Lef1 is a DPC marker, and Lef1\u003csup\u003e+\u003c/sup\u003e fibroblasts are unique cells that can support HF regeneration[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. To examine the hair-inductive activity of fibroblasts after DPC-Exos treatment, we used qPCR and Western blot to detect the expression levels of β-catenin, ALP, Lef1, and Noggin in fibroblasts. The results showed that compared to the control group, DPC-Exos at concentrations of 20 \u0026micro;g/ mL and 40 \u0026micro;g/ mL could significantly increase the mRNA and protein expression levels of β-catenin, ALP, Lef1, and Noggin in fibroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). The results of immunofluorescence staining also confirmed this effect of exosomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition, ALP staining showed that DPC-Exos treatment could enhance ALP activity in fibroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Taken together, we demonstrated that DPC-Exos could promote the expression levels of molecules associated with hair-inducing capacity in fibroblasts. We hypothesize that, to some extent, the stimulation from DPC-Exos may contribute to fibroblasts acquiring characteristics of DPCs and support fibroblasts gradually transform into DPCs. More evidence is needed to support this view.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHair reconstitution assay indicated that fibroblasts treated with DPC-Exos could induce HF neogenesis when combined with neonatal mice epidermal cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHair reconstitution assay was used to test the hair inductive properties of dermal cells. We conducted hair patch assay in 8-week-old nude mice to further verify the \u003cem\u003ein vivo\u003c/em\u003e hair-inducing activity of fibroblasts after DPC-Exos treatment. The experimental operation process is shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA. After 14 days of transplantation, there were black hair clumps under the skin at the injection site in the exosome-treated group, but no obvious black bulge was seen in the non-exosome-treated group. Due to the inconsistent directions of newly formed HFs, hair tufts could not break through the skin surface. We carefully peeled off part of the skin at the transplantation sites to facilitate the outward growth of new hair. On the 21 days after cell transplantation, black hair tufts were observed at the transplantation sites in the exosome-treated group. However, no hair grew at the transplantation site in the non-exosome-treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). At 21 days after transplantation, HF formation was observed in 10 of the 15 transplantation sites in the DPC-Exos treatment group, and the success rate of induction was 66.67%, while no hair formed in the 15 transplantation sites in the non-exosome treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Microscopic observation showed that mature HFs with intact structure and different growth directions were formed in the hair clumps after DPC-Exos treatment, while no obvious hair structure was found in the non-exosome treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eFurthermore, H\u0026amp;E staining of the transplantation sites of nude mice showed that the epidermal cells in the DPC-Exos treatment group were induced to form concentric circles-like layers, and there were new HFs scattered in the epidermal layers, while the non-exosome treatment group formed a cystic structure positive for eosin staining and a few of smaller concentric circles-like structures, and no obvious follicle-like structure was found (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The results of the hair reconstruction assay showed that fibroblasts treated with DPC-Exos could induce HF neogenesis when combined with neonatal mice epidermal cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eDPC-Exos accelerated wound healing and promoted HF regeneration in the excisional model of C57BL/6J mice\u003c/h2\u003e \u003cp\u003eGiven the powerful effect of DPC-Exos on promoting hair development, we applied them to full-thickness skin excision wounds in mice to assess the effect of DPC-Exos on wound healing. The results of \u003cem\u003ein vivo\u003c/em\u003e experiments showed that, compared to the control group, the DPC-Exos treatment group had a faster rate of wound healing, as confirmed by smaller wound areas measured on day 7 and day 10 post-wounding, and there were statistical differences between DPC-Exos and PBS groups. (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-D). More importantly, we found that, compared to the control group, the DPC-Exos treatment group had earlier (starting on the 7th-day post-wounding) and faster hair growth, and the hair coverage area was significantly much more than the control group at the 7th, 10th, and 14th post-wounding (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results of H\u0026amp;E and Masson\u0026rsquo;s trichrome staining of tissues showed there were new HFs formed at the wound site in the DPC-Exos treatment group. In addition, there was less collagen deposition in the DPC-Exos treatment group. We hypothesized that the regeneration of HFs may be related to the hair-inducing activity of fibroblasts. In addition, qPCR and Western blot of wound tissues showed that, compared to the control group, the expression levels of β-catenin, ALP, Lef1, and Noggin were significantly increased in the DPC-Exos treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B). Tissue immunofluorescence staining was used to detect the expression of β-catenin and Lef1. Compared to the control group, the expression of β-catenin and Lef1 in the DPC-Exos treatment group was increased, and there was a statistically significant difference between the two groups. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, D), The results of \u003cem\u003ein vivo\u003c/em\u003e experiments suggested that DPC-Exos could promote HF regeneration during wound healing.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eDPC‑Exos activated Wnt/β-catenin signaling pathway in fibroblasts\u003c/h2\u003e \u003cp\u003eWnt inhibitor XAV939 was used to verify the effect of DPC-Exos on the Wnt/β-catenin signaling pathway. Here, fibroblasts were treated with DMSO, XAV939, and XAV939\u0026thinsp;+\u0026thinsp;Exos. The results of the scratch assay, transwell assay, and EdU staining showed that XAV939 significantly inhibited the proliferation and migration of fibroblasts, suggesting that blocking the Wnt/β-catenin signaling pathway could inhibit the activity of fibroblasts, this is consistent with other studies about inhibiting Wnt/β-catenin signaling pathway in fibroblasts[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In the XAV939\u0026thinsp;+\u0026thinsp;Exos treatment group, the proliferation and migration activity of fibroblasts was increased (Fig.\u0026nbsp;7A-C), suggesting that DPC-Exos alleviated the inhibitory effect of XAV939 on fibroblasts. In addition, Western blot and quantitative analysis showed the protein expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts were significantly decreased after XAV939 treatment, and DPC-Exos mitigated the inhibitory effect of XAV939 and increased the expression level of these molecules (Fig.\u0026nbsp;7D, E). The positive effect of DPC-Exos on the Wnt signaling pathway transcription factor β-catenin and Lef1 demonstrated the activation of the Wnt/β-catenin signaling pathway by DPC-Exos. These results suggested that DPC-Exos could promote fibroblast activity by activating the Wnt/β-catenin signaling pathway.\u003c/p\u003e \u003cp\u003eFigure 7. Effect of DPC-Exos on fibroblasts after application of Wnt inhibitor. (\u003cb\u003eA\u003c/b\u003e) (\u003cb\u003eB\u003c/b\u003e). Scratch assay and transwell assay show that DPC-Exos alleviated the inhibitory effect of XAV939 on the migration of fibroblast. scale bars\u0026thinsp;=\u0026thinsp;200\u0026micro;m. (\u003cb\u003eC\u003c/b\u003e). EdU staining of fibroblast proliferation in control, XAV939, and XAV939\u0026thinsp;+\u0026thinsp;exosomes groups at 24 h. scale bars\u0026thinsp;=\u0026thinsp;200\u0026micro;m. (\u003cb\u003eD\u003c/b\u003e) (\u003cb\u003eE\u003c/b\u003e). Western blot and quantitative analysis indicating the expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts at control, XAV939, and XAV939\u0026thinsp;+\u0026thinsp;exosomes groups. The data was shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eDPC‑Exos promotes HF regeneration during wound healing by activating Wnt/β‑catenin signaling pathway\u003c/h2\u003e \u003cp\u003eTo further verify whether DPC-Exos regulates HF regeneration by activating the Wnt/β-catenin signaling pathway during wound healing, we used XAV-939 to block the Wnt pathway in wound healing. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-C, after being treated with XAV939, the wound closure was significantly slower than in other groups, suggesting that blocking the Wnt/β-catenin signaling pathway could inhibit wound healing. The wound closure rate of XAV939\u0026thinsp;+\u0026thinsp;Exos increased compared to the XAV939 treatment group, and the difference was statistically significant, suggesting that the inhibition of wound healing caused by the Wnt pathway inhibitor can be alleviated by DPC-Exos treatment. Meanwhile, we observed no significant statistical difference between the blank control group and the XAV939\u0026thinsp;+\u0026thinsp;Exos treatment group. H\u0026amp;E and Masson staining showed that new HFs and sebaceous glands were formed in the DPC-Exos and XAV939\u0026thinsp;+\u0026thinsp;Exos treatment groups. (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWestern blot and quantitative analysis showed that XAV939 significantly reduced the expression levels of β-catenin, ALP, Lef1, and Noggin in tissues, while the expression of these molecules increased after DPC-Exos treatment. The expression levels of β-catenin, ALP, Lef1, and Noggin were no significant difference between the control group and the XAV939\u0026thinsp;+\u0026thinsp;Exos treatment group. In addition, tissue immunofluorescence staining showed that the fluorescence intensity of β-catenin and Lef1 were significantly reduced in the dermal layer and new HFs after XAV939 treatment, and increased after DPC-Exos treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003eC-E). The results of this part further demonstrated that DPC-Exos could promote HF regeneration during wound healing by activating the Wnt/β-catenin signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSkin can repair itself after injury, but deep skin wounds generally heal with scar formation and do not regenerate HFs. HF regeneration is a sign of optimal wound healing[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. It was thought that HF morphogenesis mainly occurred during embryonic development, and in adult mammals, HFs destroyed by deep injury were irreparable. In 2007, Ito et al. observed functional HF regeneration in large skin wounds (\u0026gt;\u0026thinsp;1 cm\u003csup\u003e2\u003c/sup\u003e) in adult mice[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], which opened up new explorations into HF regeneration in wound healing.\u003c/p\u003e \u003cp\u003eWound healing is a complex biological process, involving a variety of cells, and fibroblasts are the primary cell population that determines wound healing outcomes. Li et al. found that exosomes derived from adipose stem cells can promote fibroblast proliferation and facilitate wound healing by activating the Wnt/β-catenin signaling pathway[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In this study, we found that similar to other stem cell-derived exosomes, DPC-Exos could improve the proliferation and migration of fibroblasts, which was undoubtedly helpful in promoting wound healing. Given the hair inductivity of DPCs and homology between DPCs and fibroblasts, multiple attempts have been made to promote the transformation of fibroblasts into DPCs, such as biomimetic hydrogel encapsulation culture[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], small molecule compounds inducing[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and suspension culture with FGF2、PDGF and BIO[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These methods promote the hair-inducing ability of fibroblasts but are not suitable for wound healing. DPC-Exos, as a natural dermal signaling delivery system, could induce the proliferation and differentiation of hair follicle stem cells and hair matrix cells, and augment the hair-inductive capacity of dermal papilla spheres[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. By co-incubating fibroblasts with DPC-Exos, we found that the expression level of molecules associated with the hair-inducing capacity of DPCs (β-catenin, ALP, Lef1, and Noggin) was elevated in fibroblasts. Moreover, the hair reconstitution assay further confirmed the hair-inducing activity of fibroblasts after DCP-Exos treatment. These results suggest that DPC-Exos promotes the pro-regenerative phenotype of fibroblasts, and lays the foundation for DPC-Exos to promote HF regeneration in wound healing.\u003c/p\u003e \u003cp\u003eIn the wound healing experiments, by tracking the area and hair growth of the wounds, we found that DPC-Exos could accelerate wound re-epithelialization. This is consistent with the promoting effect of other mesenchymal stem cell-derived exosomes on wound healing. In addition, there was significantly more HF neogenesis and less collagen deposition in the DPC-Exos treatment group. We hypothesize that DPC-Exos promoted HF regeneration by altering fibroblast phenotypes, and then we detected the expression level of molecules associated with hair-inducing capacity. The gene and protein expression levels of β-catenin, ALP, Lef1, and Noggin were elevated in the DPC-Exos treatment group. Additionally, the results of tissue immunofluorescence staining showed that the fluorescence intensity of β-catenin was significantly enhanced in the dermal layer and new hair follicles. Lef1 as a marker for newly formed hair follicles, exhibited higher fluorescence intensity in the DPC-Exos treatment group. These results supported our hypothesis that DPC-Exos could promote HF regeneration during wound healing by enhancing the hair-inducing activity of fibroblasts.\u003c/p\u003e \u003cp\u003eThe Wnt/β-catenin signaling pathway plays an important role in HF regeneration and wound healing[\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Accumulating evidence has demonstrated that activation of the Wnt/β-catenin signaling pathway could promote wound healing[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. During HF morphogenesis, the dermis provides the \u0026lsquo;first dermal signal\u0026rsquo; that initiates the formation of epidermal placodes, and sustained β-catenin activity in the dermis leads to larger HF placodes and accelerates differentiation of HFs[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In the study, we found that DPC-Exos enhanced the expression level of Wnt/β-catenin pathway transcription factors β-catenin and Lef1 in fibroblasts, based on this, we speculated that the effect of DPC-Exos on fibroblasts was related to the activation of Wnt/β-catenin signaling pathway. To verify this hypothesis, we used the Wnt inhibitor XAV939 to block the Wnt pathway in fibroblasts. The results of \u003cem\u003ein vitro\u003c/em\u003e experiments showed that the Wnt inhibitor suppressed the proliferation and migration of fibroblasts, and this inhibitory effect could be partially alleviated by DPC-Exos. In addition, the Wnt inhibitor significantly reduced the protein expression level of β-catenin, ALP, Lef1, and Noggin in fibroblasts, and the expression level of these molecules could be partially restored by DPC-Exos. These results demonstrated that DPC-Exos could enhance the hair-inducing activity of fibroblasts by activating the Wnt/β-catenin signaling pathway.\u003c/p\u003e \u003cp\u003eFor the role of the Wnt/β-catenin signaling pathway in wound healing, some studies showed that activation of the Wnt/β-catenin pathway in fibroblasts led to excessive collagen deposition and scarring[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. These findings increase the thinking about the regulation of the Wnt/β-catenin signaling pathway. It\u0026rsquo;s well known that beyond producing and maintaining extracellular matrix, fibroblasts also are critical to HF regeneration. Phan et al. pointed out that Lef1\u003csup\u003e+\u003c/sup\u003e papillary fibroblasts can regenerate new HFs by interacting with the adjacent epidermal cells[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Mascharak et al. found that inhibiting the YAP signaling in fibroblasts could promote regenerative healing by activating the Wnt signaling pathway[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The Wnt/β-catenin signaling pathway is involved in multiple stages of wound healing, and inhibiting its activity would influence cell viability and wound healing. We found that inhibiting the Wnt pathway also significantly hindered wound re-epithelialization and HF regeneration, and this inhibition could be partially alleviated by DPC-Exos. Although some wounds were re-epithelialized in the XAV939 treatment group, there was no HF regeneration at the wound site. In addition, the expression level of β-catenin, ALP, Lef1, and Noggin was decreased after XAV939 treatment, and DPC-Exos partially restored the expression of these molecules. Meanwhile, compared to the DPC-Exos treated group, blocking the Wnt pathway weakened the effect of DPC-Exos on HF regeneration. These results indicated that DPC-Exos could promote HF regeneration by activating the Wnt/β-catenin signaling pathway.\u003c/p\u003e \u003cp\u003eFibroblasts are highly dynamic cells and their heterogeneity and plasticity provide the possibility to change wound healing outcomes. Many studies have attenuated fibrotic repair by hindering the transformation of fibroblasts into myofibroblasts and disrupting YAP mechanotransduction in fibroblasts[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. However, these regulatory methods may have an impact on the activity of fibroblasts and thus influence the wound healing process. Some studies point out that regeneration and fibrosis are not completely excluded in cells during wound healing, and cells with pro-regeneration properties are also present in scars. But without intervention, the pro-fibrosis program predominates and leads to scarring. In addition, failing to regenerate skin appendages in wound healing is related to the lack of dermal regeneration signals rather than the lack of intrinsic regenerative ability of cells[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Here, we introduced DPC-Exos, carrying regenerative dermal signaling, into wound healing, and found that DPC-Exos also worked to promote HF regeneration in case the integrity of the skin is compromised.\u003c/p\u003e \u003cp\u003eIn this study, the results of our experiments confirmed that DPC-Exos could promote HF regeneration during wound healing. However, this is not enough for complete regenerative healing, which also requires the restoration of skin structure and strength. The contents of DPC-Exos, which are important for their function, still need to be explored. In addition, the regulatory targets of DPC-Exos in the Wnt/β-catenin signaling pathway have not been well elucidated. All of these require more in-depth research to figure out.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn the study, the effect of DPC-Exos on fibroblasts in wound healing was explored for the first time. DPC-Exos could promote the proliferation and migration of fibroblasts, and enhance the hair-inducing capacity of fibroblasts. The fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. To our knowledge, this is the first investigation that DPC-Exos promotes HF regeneration during wound healing by activating the fibroblasts and the Wnt/β-catenin signaling pathway. This study provides a theoretical basis for the application of DPC-Exos in wound healing and also brings a novel therapeutic strategy for wound regenerative healing.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDPCs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDermal papilla cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDPC-Exos\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDermal papilla cell-derived exosomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHair follicle\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTransmission electron microscopy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNTA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enanoparticle tracking analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eALP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlkaline phosphatase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLef1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLymphoid enhancer-binding factor 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDMEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDAPI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e4\u0026prime;,6-diamidino-2-phenylindole\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGAPDH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBovine serum albumin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eH\u0026amp;E\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHematoxylin and eosin.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003e All animal studies were approved and performed in accordance with the Experimental Animal Committee of Fourth Military Medical University (Xi\u0026prime;an, China).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eAll authors read and approved the final manuscript.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eAuthor Details\u003c/h2\u003e \u003cp\u003eDepartment of Burns and Cutaneous Surgery, Xijing Hospital, Fourth Military Medical University, 127 West Chang-le Road, Xi\u0026rsquo;an 710032, Shaanxi, China.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was funded by grants from the General Program of National Natural Science Foundation of China (No.81772071), the Key Industry Innovation Chain (Cluster) foundation of Shaanxi Province, China (No.2023-ZDLSF-37), the Medical Research Program of Xi\u0026rsquo;an City (No.23YXYJ0185), and the Key Research and Development Program of Shaanxi Province (No.2023-ZDLSF-24).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eDHH, HTW, and XJW contributed to the research design and manuscript review; CH, SK, and KJW assisted with manuscript editing; YGS, MYL, and LXZ contributed equally to this work; YL, YZ, LL, YHJ, GK, WXC, and JZ provided the technical support.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThe authors acknowledge all other members of the laboratory for their insight and technical support.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eNo datasets were generated or analyzed in this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHsu Y-C, Fuchs E. Building and Maintaining the Skin. Cold Spring Harb Perspect Biol. 2022;14:a040840.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng W, Xu C-H. Innovative Approaches and Advances for Hair Follicle Regeneration. ACS Biomater Sci Eng. 2023;9:2251\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin P. Wound Healing\u0026ndash;Aiming for Perfect Skin Regeneration. Science. 1997;276:75\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang G, Chen H, Chen Q, Qiu J, Qahar M, Fan Z, et al. Injury-induced interleukin-1 alpha promotes Lgr5 hair follicle stem cells de novo regeneration and proliferation via regulating regenerative microenvironment in mice. Inflamm Regener. 2023;43:14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J-Q, Zhao K-B, Feng Z-H, Qi F-Z. Hair follicle units promote re-epithelialization in chronic cutaneous wounds: A clinical case series study. Experimental Therapeutic Med. 2015;10:25\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAamar E, Avigad Laron E, Asaad W, Harshuk-Shabso S, Enshell-Seijffers D. Hair-Follicle Mesenchymal Stem Cell Activity during Homeostasis and Wound Healing. J Invest Dermatology. 2021;141:2797\u0026ndash;2807e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRippa AL, Kalabusheva EP, Vorotelyak EA. Regeneration of Dermis: Scarring and Cells Involved. Cells. 2019;8:607.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDriskell RR, Lichtenberger BM, Hoste E, Kretzschmar K, Simons BD, Charalambous M, et al. Distinct fibroblast lineages determine dermal architecture in skin development and repair. Nature. 2013;504:277\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang D, Rinkevich Y. Scars or Regeneration?\u0026mdash;Dermal Fibroblasts as Drivers of Diverse Skin Wound Responses. Int J Mol Sci. 2020;21:617.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmbryonic skin development and repair.pdf.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhan QM, Fine GM, Salz L, Herrera GG, Wildman B, Driskell IM, et al. Lef1 expression in fibroblasts maintains developmental potential in adult skin to regenerate wounds. eLife. 2020;9:e60066.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Y, Lin Y, Huang W, Wang X. Direct Reprograming of Mouse Fibroblasts into Dermal Papilla Cells via Small Molecules. IJMS. 2022;23:4213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie B, Chen M, Ding P, Lei L, Zhang X, Zhu D, et al. Induction of dermal fibroblasts into dermal papilla cell-like cells in hydrogel microcapsules for enhanced hair follicle regeneration. Appl Mater Today. 2020;21:100805.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo H, Brito S, Kwak BM, Park S, Lee M-G, Bin B-H. Applications of Mesenchymal Stem Cells in Skin Regeneration and Rejuvenation. IJMS. 2021;22:2410.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, An Y, Sun Y, Yang F, Xu Q, Wang Z. Adipose Mesenchymal Stem Cell-Derived Exosomes Promote Wound Healing Through the WNT/β-catenin Signaling Pathway in Dermal Fibroblasts. Stem Cell Rev Rep. 2022;18:2059\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Yang Q, Wu S, Yuan R, Zhao X, Li Y, et al. Adipose-Derived Stem Cell Exosomes Promoted Hair Regeneration. Tissue Eng Regen Med. 2021;18:685\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang B, Chen T. Local and systemic mechanisms that control the hair follicle stem cell niche. Nat Rev Mol Cell Biol [Internet]. 2023 [cited 2023 Nov 9]; Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.nature.com/articles/s41580-023-00662-3\u003c/span\u003e\u003cspan address=\"https://www.nature.com/articles/s41580-023-00662-3\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDriskell RR, Clavel C, Rendl M, Watt FM. Hair follicle dermal papilla cells at a glance. J Cell Sci. 2011;124:1179\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang C-C, Cotsarelis G. Review of hair follicle dermal cells. J Dermatol Sci. 2010;57:2\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThangapazham RL, Klover P, Wang J, Zheng Y, Devine A, Li S, et al. Dissociated human dermal papilla cells induce hair follicle neogenesis in grafted dermal-epidermal composites. J Invest Dermatol. 2014;134:538\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadaan A, Verma R, Singh AT, Jaggi M. Review of Hair Follicle Dermal Papilla cells as \u003cem\u003ein vitro\u003c/em\u003e screening model for hair growth. Intern J Cosmet Sci. 2018;40:429\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorgan BA. The Dermal Papilla: An Instructive Niche for Epithelial Stem and Progenitor Cells in Development and Regeneration of the Hair Follicle. Cold Spring Harb Perspect Med. 2014;4:a015180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe J, Ren W, Wang W, Han W, Jiang L, Zhang D, et al. Exosomal targeting and its potential clinical application. Drug Deliv Transl Res. 2022;12:2385\u0026ndash;402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Zhao B, Yao S, Dai Y, Zhang X, Yang N, et al. Dermal PapillaCell-Derived Exosomes Regulate Hair Follicle Stem Cell Proliferation via LEF1. Int J Mol Sci. 2023;24:3961.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan H, Gao Y, Ding Q, Liu J, Li Y, Jin M, et al. Exosomal Micro RNAs Derived from Dermal Papilla Cells Mediate Hair Follicle Stem Cell Proliferation and Differentiation. Int J Biol Sci. 2019;15:1368\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou L, Wang H, Jing J, Yu L, Wu X, Lu Z. Regulation of hair follicle development by exosomes derived from dermal papilla cells. Biochem Biophys Res Commun. 2018;500:325\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopouzi H, Logan NJ, Williams G, Higgins CA. Methods for the isolation and 3D culture of dermal papilla cells from human hair follicles. Exp Dermatol. 2017;26:491\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang B, Liu X-M, Liu Z-N, Wang Y, Han X, Lian A-B, et al. Human hair follicle-derived mesenchymal stem cells: Isolation, expansion, and differentiation. WJSC. 2020;12:462\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu JJ, Liu RQ, Lu YG, Zhu TY, Cheng B, Men X. Enzyme digestion to isolate and culture human scalp dermal papilla cells: a more efficient method. Arch Dermatol Res. 2005;297:60\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLas Heras K, Royo F, Garcia-Vallicrosa C, Igartua M, Santos-Vizcaino E, Falcon-Perez JM, et al. Extracellular vesicles from hair follicle-derived mesenchymal stromal cells: isolation, characterization and therapeutic potential for chronic wound healing. Stem Cell Res Ther. 2022;13:147.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeluanov A, Vaidya A, Gorbunova V. Establishing Primary Adult Fibroblast Cultures From Rodents. JoVE. 2010;2033.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Ye Y, Zhao P, Bai L, Li X. Preliminary studies of hair follicle regeneration by injections of epidermal stem cells and dermal papilla cells into nude mice. Cell Tissue Bank. 2020;21:321\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBejaoui M, Villareal MO, Isoda H. β-catenin-mediated hair growth induction effect of 3,4,5-tri-O-caffeoylquinic acid. Aging. 2019;11:4216.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg KJ, Lim J, Tan YN, Quek D, Lim Z, Pantelireis N, et al. Sox2 in the dermal papilla regulates hair follicle pigmentation. Cell Rep. 2022;40:111100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGan Y, Wang H, Du L, Li K, Qu Q, Liu W, et al. Cellular Heterogeneity Facilitates the Functional Differences Between Hair Follicle Dermal Sheath Cells and Dermal Papilla Cells: A New Classification System for Mesenchymal Cells within the Hair Follicle Niche. Stem Cell Rev Rep. 2022;18:2016\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMascharak S, desJardins-Park HE, Longaker MT. Fibroblast Heterogeneity in Wound Healing: Hurdles to Clinical Translation. Trends Mol Med. 2020;26:1101\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao S-E, Miao Y, Wang J, Jiang W, Fan Z-X, Liu X-M, et al. As a carrier\u0026ndash;transporter for hair follicle reconstitution, platelet-rich plasma promotes proliferation and induction of mouse dermal papilla cells. Sci Rep. 2017;7:1125.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang D, Liu Z, Qian C, Huang J, Zhou Y, Mao X, et al. 3D bioprinting of a gelatin-alginate hydrogel for tissue-engineered hair follicle regeneration. Acta Biomater. 2023;165:19\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRishikaysh P, Dev K, Diaz D, Qureshi WMS, Filip S, Mokry J. Signaling Involved in Hair Follicle Morphogenesis and Development. Int J Mol Sci. 2014;15:1647\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMascharak S, Talbott HE, Januszyk M, Griffin M, Chen K, Davitt MF, et al. Multi-omic analysis reveals divergent molecular events in scarring and regenerative wound healing. Cell Stem Cell. 2022;29:315\u0026ndash;327e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng B, Yang L, Feng S, Zhu Y, Du L, Zhang J et al. Organoid-Loaded Cryomicroneedles for Biomimic Hair Regeneration. Adv Funct Mater. 2023;2304950.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIto M, Yang Z, Andl T, Cui C, Kim N, Millar SE, et al. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature. 2007;447:316\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Q, Li N, Zhang H, Lei X, Cao Y, Xia G, et al. Chemically induced transformation of human dermal fibroblasts to hair-inducing dermal papilla-like cells. Cell Prolif. 2019;52:e12652.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwack MH, Seo CH, Gangadaran P, Ahn B-C, Kim MK, Kim JC, et al. Exosomes derived from human dermal papilla cells promote hair growth in cultured human hair follicles and augment the hair-inductive capacity of cultured dermal papilla spheres. Exp Dermatol. 2019;28:854\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Huang J, Liu Z, Chen R, Fu D, Yang L, et al. miR-140-5p in Small Extracellular Vesicles From Human Papilla Cells Stimulates Hair Growth by Promoting Proliferation of Outer Root Sheath and Hair Matrix Cells. Front Cell Dev Biol. 2020;8:593638.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi S, Yoon M, Choi K-Y. Approaches for Regenerative Healing of Cutaneous Wound with an Emphasis on Strategies Activating the Wnt/β-Catenin Pathway. Adv Wound Care. 2022;11:70\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim X, Nusse R. Wnt Signaling in Skin Development, Homeostasis, and Disease. Cold Spring Harb Perspect Biol. 2013;5:a008029.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai S-Y, Sennett R, Rezza A, Clavel C, Grisanti L, Zemla R, et al. Wnt/β-catenin signaling in dermal condensates is required for hair follicle formation. Dev Biol. 2014;385:179\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen D, Jarrell A, Guo C, Lang R, Atit R. Dermal β-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development. 2012;139:1522\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoon M, Kim E, Seo SH, Kim G-U, Choi K-Y. KY19382 Accelerates Cutaneous Wound Healing via Activation of the Wnt/β-Catenin Signaling Pathway. Int J Mol Sci. 2023;24:11742.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMok K-W, Saxena N, Heitman N, Grisanti L, Srivastava D, Muraro MJ, et al. Dermal Condensate Niche Fate Specification Occurs Prior to Formation and Is Placode Progenitor Dependent. Dev Cell. 2019;48:32\u0026ndash;48e5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRognoni E, Gomez C, Pisco AO, Rawlins EL, Simons BD, Watt FM et al. Inhibition of β-catenin signalling in dermal fibroblasts enhances hair follicle regeneration during wound healing. Development. 2016;dev.131797.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalbott HE, Mascharak S, Griffin M, Wan DC, Longaker MT. Wound healing, fibroblast heterogeneity, and fibrosis. Cell Stem Cell. 2022;29:1161\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Zhang J, Shi J, Liu K, Wang X, Jia Y, et al. Exosomes derived from human adipose mesenchymal stem cells attenuate hypertrophic scar fibrosis by miR-192-5p/IL-17RA/Smad axis. Stem Cell Res Ther. 2021;12:221.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMascharak S, desJardins-Park HE, Davitt MF, Griffin M, Borrelli MR, Moore AL, et al. Preventing \u003cem\u003eEngrailed-1\u003c/em\u003e activation in fibroblasts yields wound regeneration without scarring. Science. 2021;372:eaba2374.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim CH, Sun Q, Ratti K, Lee S-H, Zheng Y, Takeo M, et al. Hedgehog stimulates hair follicle neogenesis by creating inductive dermis during murine skin wound healing. Nat Commun. 2018;9:4903.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Schemes","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-nanobiotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnan","sideBox":"Learn more about [Journal of Nanobiotechnology](http://jnanobiotechnology.biomedcentral.com)","snPcode":"12951","submissionUrl":"https://submission.nature.com/new-submission/12951/3","title":"Journal of Nanobiotechnology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"wound healing, hair follicle regeneration, DPC-Exos, fibroblasts, Wnt/β-catenin signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-3942786/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3942786/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHair follicle (HF) regeneration after skin injury remains a major clinical challenge. Dermal papilla cell-derived exosomes (DPC-Exos) have great potential to induce HF neogenesis. However, the role and mechanism of DPC-Exos in HF regeneration during wound healing are still unclear. In this study, the effect of DPC-Exos on fibroblasts in wound healing was explored for the first time. We found that DPC-Exos could promote the proliferation and migration of fibroblasts, and more importantly, enhance the hair-inducing capacity of fibroblasts. The fibroblasts treated with DPC-Exos could induce HF neogenesis in nude mice when combined with neonatal mice epidermal cells. In addition, the results of \u003cem\u003ein vivo\u003c/em\u003e experiments showed that DPC-Exos could accelerate wound re-epithelialization, and promote HF regeneration. The expression levels of Wnt pathway transcription factor β-catenin and Lef1 were elevated in fibroblasts and the dermis of skin wounds after DPC-Exos treatment. Taken together, this study proved that DPC-Exos could promote HF regeneration during wound healing by activating fibroblasts and the Wnt/β-catenin signaling pathway, suggesting that DPC-Exos might be a promising therapeutic strategy for skin wound regenerative healing.\u003c/p\u003e","manuscriptTitle":"Dermal papilla cell-derived exosomes promote hair follicle regeneration during wound healing by activating Wnt/β‐catenin signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-13 19:43:02","doi":"10.21203/rs.3.rs-3942786/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-15T16:27:50+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-26T02:14:21+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-24T03:03:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81c20a0e-4f35-42e5-a29d-c6fcb1117ff4","date":"2024-03-19T02:05:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"231e1504-f516-48a1-a907-19fb94acf9ae","date":"2024-03-17T01:20:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-17T01:12:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-10T12:37:39+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-10T12:37:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Nanobiotechnology","date":"2024-02-09T10:50:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-nanobiotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnan","sideBox":"Learn more about [Journal of Nanobiotechnology](http://jnanobiotechnology.biomedcentral.com)","snPcode":"12951","submissionUrl":"https://submission.nature.com/new-submission/12951/3","title":"Journal of Nanobiotechnology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"72486a68-7bb1-4d5b-89f7-fa1507da79cf","owner":[],"postedDate":"February 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-01T16:14:20+00:00","versionOfRecord":{"articleIdentity":"rs-3942786","link":"https://doi.org/10.1186/s12951-024-02689-w","journal":{"identity":"journal-of-nanobiotechnology","isVorOnly":false,"title":"Journal of Nanobiotechnology"},"publishedOn":"2024-07-19 16:04:51","publishedOnDateReadable":"July 19th, 2024"},"versionCreatedAt":"2024-02-13 19:43:02","video":"","vorDoi":"10.1186/s12951-024-02689-w","vorDoiUrl":"https://doi.org/10.1186/s12951-024-02689-w","workflowStages":[]},"version":"v1","identity":"rs-3942786","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3942786","identity":"rs-3942786","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0