PEDV infection induces ferroptosis in Vero cells via an ACSL-mediated lipid peroxidation pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PEDV infection induces ferroptosis in Vero cells via an ACSL-mediated lipid peroxidation pathway Qian Weng, Yuheng Li, Yuze Wei, Simin Wang, Tingyu Hu, Zhihua Pei, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5419876/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Porcine epidemic diarrhea virus (PEDV) is a highly contagious viral pathogen causing severe economic losses in the swine industry. However, the underlying mechanisms of PEDV-induced host cell death largely unknown. In this study, we investigated the role of ferroptosis, a non-apoptotic form of programmed cell death, in PEDV pathogenesis. The experiments were divided into four groups: a control group, a PEDV (MOI = 1.0) group, an Erastin (5µM) positive control group and a Liprostatin (0.5µM) negative control group. Levels of GSH, ROS, Fe 3+ and cell viability were evaluated using ELISA test kits. Fluorescence microscopy was employed to assess Fe 2+ aggregation, while flow cytometry was utilizeed to measure lipid peroxide levels. The mRNA transcript levels of key gene involved the ferroptosis pathway-ACSL4, GPX4, ALOX15 and LPCAT3 - were determined by quantitative reverse transcription PCR. Compared to the control group, the PEDV group exhibited a significant decrease in GSH levels (P < 0.01) and a gradual reduction in Fe 3+ levels (P < 0.05) over time. Furthermore, the PEDV group showed a substantial increase in ROS release (P < 0.05) and a corresponding decrease in cell viability (P < 0.05) relative to the control group. The results of the qRT-PCR revealed that the expression levels of ACSL4, ALOX15 and LPCAT3 mRNA were significantly elevated in the PEDV group (P<0.01). Additionally, Western blot analysis confirmed that the protein expression levels of ACSL4, ALOX15 and LPCAT3 also increased progressively (P < 0.01). In conclusion, our findings demonstrated that PEDV can induce ferroptosis in Vero cells through the lipid peroxidation pathway mediated by ACSL 4. Porcine epidemic diarrhea virus(PEDV) Ferroptosis Lipid peroxidation Figures Figure 1 Figure 2 Figure 3 Introduction Porcine epidemic diarrhea virus (PEDV) is endemic worldwide and has significantly impacted the pig industry. Currently, there are no specific treatments for PEDV. PEDV is an enveloped, single-stranded RNA virus with a genome that spans approximately 28 kb in length (excluding the polyA tail) [ 1 ]. The genome structure comprises a 5' untranslated region (UTR), seven open reading frames (ORFs: ORF1a, ORF1b and ORF 2–6), a 3' UTR, and a polyA tail at 3' end. These seven open reading frames encode four structural proteins (S, M, E, N) as well as non-structural proteins (nsps) pp1a, pp1ab, and ORF3 [ 2 ]. Ferroptosis is a ecently identified from of programmed cell death. Dolma et al. First discovered that a range of compounds could induce cell death while invesigating the anti-cancer treatment pathways of small molecule compounds [ 3 ]. In 2008, Yang et al . discovered that the small molecule compound RSL3 elicited an iron-dependent cell death mechanism that was distinct from apoptosis and necrosis in tumor cells harboring Ras mutations [ 4 ]. Ferroptosis was formally characterized in 2012, when it was demonstrated that the small molecule compound Erastin inhibits cystine uptake via the cystine/glutamate transport system (System Xc-). This inhibition leads to the accumulation of iron ions, mitochondrial swelling, rupture of the outer membrane, and a distinct form of cell death that differs from apoptosis [ 5 ]. In 2014, Yang et al . identified Glutathione peroxidase 4 (GPX4) as a critical protein in the process of ferroptosis. GPX4 protects against iron-induced cell death by reducing the formation of phospholipid hydroperoxide through the inhibition of Alox12-mediated lipid peroxidation [ 6 ]. In 2017, Acyl-CoA synthetase long-chain family member 4 (ACSL4) was identified as an enzyme crucial for the synthesis of polyunsaturated fatty acids (PUFA) and recognized as a key biomarker for detecting ferroptosis [ 7 ]. Subsequently, Ingold et al. revealed that GPX4 acts to inhibit ferroptosis through its utilization of selenium [ 8 ]. More recently, ferroptosis suppressor protein 1 (FSP1) and Coenzyme Q (CoQ) have been identified on the outer membrane and inner mitochondrial membrane, respectively. Additionally, CoQ pathways of ferroptosis that are regulated by CoQ, including those independent of GPX4, have been discovered, highlighting the roles of CoQ and dihydroorotate dehydrogenase (DHODH) in this process [ 9 – 11 ]. In 2022, Protein Kinase C beta II (PKCβII), an important receptor molecule that promotes the accumulation of lipid peroxidation, was found to regulate both lipid peroxidation and ferroptosis through a phosphorylation pathway that activates ACSL4 [ 12 ]. The local epidemic of PEDV is primarily linked to the high mutation rate of the virus's S gene. The S protein, which is encoded by the S gene, is crucial for eliciting an immune response from vaccines. Therefore, notable differences between the vaccine strain and the locally endemic strain can adversely affect the vaccine's efficacy. This discrepancy is a key factor contributing to the suboptimal immune response to the vaccine. PEDV primarily targets intestinal epithelial cells, which disrupts the intestine’s capacity to digest and absorb nutrients, leading to acute diarrhea, particularly in young piglets. Currently, there is no specific treatment available for PEDV, primarily due to an insufficient understanding of its pathogenic mechanisms. This lack of clarity significantly hinders the development of new therapeutic drugs. Ferroptosis is a novel form of iron-dependent cell death characterized by lipid peroxidation, distinguishing it from other cell death mechanisms such as apoptosis, necrosis, pyroptosis and autophagy. The primary characteristics of ferroptosis include iron accumulation and lipid peroxidation. To further investigate the molecular pathogenesis of PEDV, this study aims to examine the mechanisms underlying PEDV-induced cell damage through the lens of ferroptosis. The findings from this research will identify critical targets for the development of new veterinary drugs and provide theoretical foundations and essential resources for the scientific prevention and control of PEDV. Materials and methods Cell culture and PEDV infection Vero cells were cultured into T25 flasks supplemented with 8% fetal calf serum (Hyclone, USA) and antibiotics (100 units/ml of penicillin and 100 µg/mL of streptomycin). Upon reaching 80–85% confluence, the cells were inoculated with 1.0 mL of PEDV at a multiplicity of infection (MOI) of 1.0. The cells were then incubated for 35 minutes to facilitate PEDV adsorption. Following adsorption, the medium was removed, and 5 mL of maintenance solution was added to each flask. The cells were subsequently returned to the incubator, and samples for analysis were collected at designated time intervals. The PEDV CV777 strain and Vero cell were obtained from the Institute of Microbiology, College of Veterinary Medicine, Jilin Agricultural University. Reagents and antibodies The Glutathione (GSH) Kit, Reactive Oxygen Species (ROS) Kit, and Lactate Dehydrogenase Cytotoxicity Detection Kit were procured from Biyun Tian Biological Co. Ltd. The Iron Determination Kit (colorimetric method) was obtained from TaKaRa Biomedical Technology (Beijing) Co. Ltd. The Liperfluo-Lipid Peroxides Fluorescent Probe and Iron Ion Fluorescent Probe-Mito-ferrogreen were obtained from Tongren Chemistry. Erastin and Liprostatin (0.5 µM)[ 13 ] were purchased from Shanghai Taosu Biotechnology Co. Ltd. The AxyPrep DNA Gel Extraction Kit was purchased from Corning Life Science Co. Ltd., while the anti-GPX4 polyclonal antibody was purchased from Beijing Borsi Co. Ltd. Western blot The experiments were divided into PEDV and control groups, with three replicates in each group. Following the removal of the culture supernatants, Vero cells were prepared for analysis. Protein concentration was quantified using the BCA Protein Detection Kit (Biouniquer Technology Co, Ltd., China), and 50 µg of protein lysate from each sample was reserved for further analyses. Subsequently, the proteins underwent SDS-PAGE electrophoresis, and the proteins were electro-transferred to a blotting membrane (NC membrane). To minimize non-specific antibody binding, the membrane was blocked with 5% skimmed milk powder for 1 hour. Primary antibodies targeting Glut1 (Santa Cruz, USA), PEDV-N (Medgene Labs, China), RIG-1 (Proteintech, USA), MDA5 (Proteintech, USA), β-actin (Santa Cruz, USA) and GAPDH (Servicebio, China) were incubated overnight at 4 ℃. Following incubation, the membranes were washed three times with TBST. Subsequently, either recombinant anti-GAPDH or Goat Anti-Rabbit IgG/Goat Anti-Mouse IgG (CWBIO, China) secondary antibodies were applied, and the samples were further incubated at room temperature for 1 h. The membranes were washed three times with TBST to remove unbound antibodies. Finally, the protein bands were visualized using ECL kits (Amersham, UK), and signal intensity was quantified using Gray-scale analysis software (Image Tool 3.0). ELISA method The experiments were organized into PEDV and control groups, with three replicates in each group. Cell culture supernatants were collected at four time points 12, 24, 36, and 48 hours post-infection. The levels of GSH, ROS, Fe 2+ and LDH were subsequently quantified using their respective kits. Effect of the iron-death inhibitor liproxstatin-1 We investigated the effects of the ferroptosis inhibitor liproxstatin-1 on LDH, Fe 2+ levels and lipid peroxidation induced by PEDV. The experiments were divided into control groups, viral groups and negative control groups, with three replicates for each group. Cell culture supernatants were collected at four distinct time intervals: 12, 24, 36, 48 hours post-infection. To test the impact of liproxstatin-1 on PEDV-induced LDH levels, we measured LDH concentrations according to kit instructions. Fluorescence microscopy was employed to monitor the changes in Fe 2+ aggregation. After discarding the supernatants from each group, samples were washed 1 ~ 3 times with Hanks' Balanced Salt Solution (HBSS). Each well received 1 mL of working solution and was incubated for 30 minutes. Subsequently, samples were visualized under green excitation light (Ex: 532 nm). For the analysis of lipid peroxides, flow cytometry was utilized. A total of 100 µg of liperfluo tubes were combined with 120 µg of DMSO, thoroughly mixed using a shaker, and diluted to 1 µmol/L with serum-free DMEM before being stored at 4°C for subsequent assays. Treated cells from each group were washed 1 to 2 times with serum-free DMEM. Then, 1.5 mL of working liquid was added to each well and the cells were incubated in a CO 2 incubator for 30 minutes. The levels of lipid peroxides were quantified using flow cytometry, with the excitation wavelength set to 488 nm and emission wavelength within the range of 515 ~ 545 nm. Primer design and screening for the key genes of iron death Key genes involved in various ferroptosis regulatory pathways were selected for analysis, including: Transcriptional Activation Factor Pathway (ATF4), Lipid Peroxidation-driven Pathway (ACSL4, LPCAT3, ALOX15), Glutathione Pathway (SLC3A2, GPX4), Ferric Ion Pathway (TFR, FTH1), Mevalonate Pathway (P53), Hemoglobin Oxygenase Pathway (HMOX1), and Ferroptosis Pathway (TFR, FTH1). Gene sequences were retrieved from GenBank to identify corresponding genes, followed by the design of specific. The primers were synthesized by Bioengineering (Shanghai) Co., Ltd.. Real-Time PCR Total viral RNA was extracted following the manufacturer's instructions, and the quality of the extracted RNA was assessed, demonstrating high purity with optical density (OD) values ranging from 1.9 to 2.2. Complementary DNA (cDNA) was synthesized using the Takara reverse transcription kit. The reaction mixture for quantitative PCR was prepared by adding 2.0 µL of cDNA template, 400 µL of TB Green Premix Ex Taq (Tli RNaseH Plus) (2×) kept on ice, 16 µL each of PCR forward and reverse primer (10 µM), 16 µL of ROX Reference Dye (50×), and 272 µL of sterilized water. The mixture was thoroughly mixed and then aliquoted into sterile PCR tubes, with each tube receiving 18 µL of the mixture. The real-time PCR setup was programmed as follows: Stage 1 - Pre-denaturation: 1 cycle at 95°C for 30 seconds; Stage 2 - PCR reaction: 40 cycles consisting of 95°C for 5 seconds and 60°C for 30 ~ 34 seconds for data collection and analysis. Table 1 Primers used in the RT-qPCR study. Gene Primer sequence(5'-3') β-actin F CTTCCTGGGTGAGTGGAGAC β-actin R GAAGGTAGTTTCATGGATGCC ACSL4(F) CTGGACTGGGACCAAAGGAC ACSL4(R) TCCGGAACAGCAGCCATAAG TFRC(F) TGTCATACACCCGGTTCAGC TFRC(R) GGTTCCTGCCAGTCTCTCAC ATF4(F) ATGGGTTCTCCAGCGACAAG ATF4(R) TCTGGCATGGTTTCCAGGTC HMOX1(F) CAGTGCCACCAAGTTCAAGC HMOXI(R) CAGCTCCTGCAACTCCTCAA SLC3A2(F) GGGCGTCTCGATTACCTGAG SLC3A2(R) ACTGCAGAGCATCCTTCACC GPX4(F) GGAGCCAGGGAGTAACGAAG GPX4(R) ACGGAGCCGTTCTTGTCAAT FTH1(F) GAGGAAAGGGAACATGCCGA FTH1(R) ACACTCCATCGCATTCAGCC P53(F) GTCTGGGCTTCCTGCATTCT P53(R) CACGACCTCAGTCATGTGCT ALOX15(F) TCTGCAACTGGATCTCCGTG ALOX15(R) GTGAGATCCTCTTCTCGCCC LPCAT3(F) CCCCGAGCCGGAATTGG LPCAT3(R) AAGGCTCAGCTCCTGGAAAC Statistical analysis All data in this experiment were statistically analyzed and graphed by Graph Prism 8.0 software. The significant differences between two groups was analyzed by t-test, while the significant of differences among multiple groups was determined by one-way ANOVA. p < 0.05 marked *, indicating that the difference was significant; p < 0.01 marked **, indicating that the difference was very significant; p < 0.001 marked ***, indicating that the difference was extremely significant. Results Changes in iron death-related markers indicate the occurrence of ferroptosis in Vero cells GPX4 serves as a crucial antioxidant regulatory center in this process. Consequently, we measured the GSH content in cell culture supernatants at various time points following PEDV infection of Vero cells, specifically at 12, 24, 36, 48 hours. The results indicated a highly difference in GSH content between the control and experimental groups (p < 0.01) compared to the control (Fig. 1 A). Reactive oxygen species (ROS) are also a key marker of ferroptosis, with significant ROS release accompanied iron-dependent cell death. Measurements of ROS from PEDV-infected Vero cells revealed a substantial difference between the experimental and control groups at 24, 36, and 48 hours post-infection (Fig. 1 B). Regarding LDH, enzyme activity and cell viability were determined at various times points. The results demonstrated a highly significant difference between the virus group and the control group across all time intervals, indicating a gradual decline in cell viability in the virus group as time progressed (p < 0.01) (Fig. 1 C). To further evaluate the effect of PEDV on ferroptosis, the iron death inhibitor liproxstatin-1 (0.5 µM) was employed. LDH release and viability were determined assessed across each group (Fig. 1 D). Results indicated significant differences in the inhibitor group at 12, 24 and 36 hours post-infection (p 0.05), possibly due to the half-life of liproxstatin-1. Changes in characteristic markers of ferroptosis suggest the occurrence of iron-dependent cell death in Vero cells We evaluated the expression levels of GPX4 protein in both the PEDV group and the control group (vaccinated with an equivalent dose of DMEM maintenance solution) using Western blot analysis. The results demonstrated a gradual decrease in GPX4 protein expression with prolonged PEDV infection. Comparisons with the normal cell control group indicated significant difference (p < 0.05) (Fig. 1 E-F). Iron ions, as key drivers of ferroptosis, are taken up by cells through transferrin receptor 1 (TfR 1) on the cellular membrane. These iron ions play a crucial role in regulating lipid peroxidation and the release of reactive oxygen species, enhancing the cell's sensitivity to iron and contributing to ferroptosis. To assess this, we measured changes in the content of iron ions in the PEDV group compared to the control group at different time intervals. The results revealed that ferrous ion content gradually decreased in the PEDV group, while it increased in the control group, with significant differences noted when comparing the virus group to the control group (Fig. 1 G). This suggests that the virus group had a gradual increase in intracellular ferrous ion content due to the substantial involvement of ferrous ions in subsequent reactions. PEDV induces ferroptosis in Vero cells via the lipid peroxidation pathway The Fenton reaction promotes the generation of phospholipid hydroperoxides (PLOO) from polyunsaturated fatty acid phospholipids (PUFA-PL), which increases reactive ROS levels and leads to the production of large quantities of lipid peroxides. This mechanism distinguishes ferroptosis from other forms of programmed cell death. To assess lipid peroxide levels, we employed lipid peroxide probes (Fig. 2 A-B). The results demonstrated that lipid peroxidation levels in the infected group were significantly higher compared to the inhibitor group (p < 0.01), and there was also a notable difference between the infected group and the blank control group (p < 0.05). These findings indicate that PEDV causes Vero cells to produce substantial amounts of lipid peroxides, which were mitigated by liproxstatin-1 (0.5 µM). Additionally, Fe 2+ plays a pivotal role in subsequent lipid peroxidation reactions via the Fenton reaction. We examined PEDV-induced Fe 2+ aggregation, using a separate group pretreated with liproxstatin-1 (0.5 µM) for 30 minutes. Fluorescence microscopy was utilized to observe the groups 36 hours post-inoculation with PEDV. The results revealed significant Fe 2+ accumulation in the virus group, while Fe 2+ aggregation decreased markedly in the inhibitor pretreatment group (Fig. 2 C). Fluorescence intensity was quantified using Image J software to analyzed the differences among the groups (Fig. 2 D). The results showed that an extremely significant difference in mean fluorescence intensity between the PEDV group and the control group (p < 0.001), with the inhibitor group significantly reducing virus-induced Fe 2+ aggregation (p < 0.001). The expression levels of ACSL4, LPCAT3, and ALOX15 significantly increased with the duration of PEDV infection We first assessed changes in the expression of key regulatory genes associated with ferroptosis by measuring transcript levels in each group. The results indicated that the mRNA level of ACSL4 increased with the extension of virus infection duration (Fig. 3 A). Compared with the control group, the differences were significant at 12 hours and 24 hours (p < 0.05), and an extremely significant difference at 36 hours. Conversely, the mRNA level of GPX4 decreased as the duration of virus infection increased (Fig. 3 B). The differences at 12, 24 and 36 hours of infection were extremely significant (P < 0.001) when compared to the control group. Similarly, the mRNA levels of LPCAT3 also increased over the course of PEDV infection (Fig. 3 C). Compared to the control group, the differences became extremely significant (p < 0.001) at 24 and 36 hours, and significant (p < 0.01) at 12 hours. Lastly, the mRNA levels of ALOX15 also increased in line with the extended duration of virus infection increased (Fig. 3 D). The differences were significant (p < 0.01) at 12 hours and extremely significant (p < 0.001) at 24 and 36 hours compared to the control group. Next, we investigated changes in the expression of key regulatory proteins involved in ferroptosis. We examined the expression levels of the relevant proteins and calculated their relative expressions. The results of Western blot assay showed that the expression of ALOX15 was significantly increased in cells infected with PEDV as well as in cells treated with Erastin compared to the blank control group (Fig. 3 E). The difference between the infected group and the control group was highly significant (P < 0.01). Similarly, The expression levels of LPCAT3 were elevated in the infected group in comparison to the blank control group (Fig. 3 F), with the difference being highly significant (P < 0.01). Furthermore, ACSL4 expression also showed a marked increase in the infected group when compared to the blank control group for both PEDV and Erastin treatments (Fig. 3 G), with the difference again being highly significant (p < 0.01). Discussion Porcine diarrhea coronaviruses are clinically significant pathogens responsible for inducing diarrhea in piglets. Identified strains of porcine diarrhoea coronaviruses include the porcine epidemic diarrhoea virus, porcine infectious gastroenteritis virus, porcine Delta coronavirus and porcine acute diarrhoea syndrome coronavirus [ 14 ]. These coronaviruses are capable of infecting pigs across all age groups and typically manifest very similar clinical symptoms. Common presenttations include vomiting, severe diarrhea, and high mortality rates among piglets, alongside indistinct pathological changes characterized by severe inflammatory lesions in the small intestinal tissues. Consequently, diarrhea in piglets has consistently posed a substantial challenge for the swine industry, resulting in significant economic losses [ 15 ]. Ferroptosis is a form of programmed cell death driven by iron ion-mediated lipid peroxidation and subsequent membrane damage. GPX4 plays a critical role in this process by utilizing glutathione (GSH) as a co-substrate to catalyze the reduction of lipid peroxides. As the primary antioxidant system against ferroptosis, GPX4 is essential for protecting cells from iron-induced oxidative stress [ 16 ]. Iron ions play a crucial role in catalyzing the peroxidation of polyunsaturated fatty acid phospholipids, resulting in the formation of lipid peroxides and lipid reactive oxygen species. This process enhances cellular sensitivity to ferroptosis and further contributes to cell membrane damage. To investigate whether PEDV could induce ferroptosis in Vero cells, we measured the changes in GSH content in PEDV-infected Vero cells and observed a gradual decrease in GSH levels over the course of infection. To confirm the effects of PEDV infection on GPX4 expression, we examined GPX4 levels at various time points following PEDV infection. The results indicated that glutathione biosynthesis in Vero cells was highly sensitive to PEDV. We further analyzed the levels of lipid peroxidation, ROS and iron ions. The findings revealed that the PEDV-infected group produced a substantial amount of lipid peroxides, accompanied by significant ROS release and pronounced aggregation of ferrous ions, compared to the control group. Subsequently, cells were pretreated with the ferroptosis inhibitor liproxstatin−1 (0.5 µM) before inoculation with PEDV. We then assessed cell viability, ferrous ion aggregation, and the levels of lipid peroxides released, to evaluate the protective effects of the inhibitor against PEDV-induced ferroptosis. The results demonstrated that treatment with liproxstatin-1 protected a portion of the cells from undergoing death, while also leading to a reduction in lipid peroxidation levels. Additionally, ferrous ion aggregation was less pronounced in the inhibitor-treated group compared to the PEDV group. These findings collectively indicate that PEDV triggers ferroptosis in Vero cells. GPX4 is a crucial regulatory center in ferroptosis, as it catalyzes the reduction of toxic lipid hydroperoxides (L-OOH) to their corresponding alcohols (L-OH) while simultaneously oxidizing GSH to glutathione disulfide (GSSG). Consequently, inhibition of GPX4 activity leads to the accumulation of lipid peroxides, thereby promoting ferroptosis [ 17 ]. Iron homeostasis in cells involves a balanced process of absorption, utilization, storage, and expulsion of iron to maintain dynamic equilibrium. Transferrin receptor 1 (TFR1) is a membrane protein responsible for transporting Fe³⁺ into cells, where it is reduced to Fe²⁺ by ferric reductase upon entry into the endosome. Both Fe³⁺ and Fe²⁺ play essential roles in ATP redox processes and the reduction of DNA precursors. When iron ion levels exceed cellular requirements, excess iron is sequestered intracellularly by ferritin, which consists of ferritin light chain (FTL) and ferritin heavy chain (FTH). When iron is needed again, it can be quickly mobilized through transporter proteins, such as ferroportin (FPN), at the cell membrane [ 14 ]. The tumor suppressor gene p53 plays a critical role in mediating cell cycle arrest, senescence, and apoptosis. Jiang et al . discovered that p53 promotes ferroptosis in fibroblasts and certain cancer cells by trans-repressing the expression of the SLC7A11 gene, which encodes the cystine/glutamate antiporter System Xc- [ 18 ]. Additionally, HMOX1 encodes heme oxygenase 1, an enzyme that detoxifies hemoglobin to produce biliverdin, while simultaneously releasing carbon monoxide and Fe²⁺. This process contributes to cellular iron homeostasis and can affect ferroptosis pathways. This process is closely linked to oxidative stress. HMOX1 expression is regulated by Nrf2, which is in turn controlled by the Keap1 protein. Cramer et al . found that exposure to moderate concentrations of intoxicin A leads to the overexpression of HMOX1 by binding to Keap1. This binding results in an increase in available iron ions within the cellular iron pool, contributing to oxidative stress and promoting ferroptosis [ 19 ]. Additionally, Erastin can induce endoplasmic reticulum stress, which activates the ATF4 signaling pathway. Activation of this pathway can lead to the degradation of GSH and facilitate the onset of ferroptosis [ 20 , 21 ]. In this study, we observed significant differences in the transcript levels of the genes GPX4, SLC3A2, and TFR; however, there were no corresponding changes in their protein expression levels (data not shown). Similarly, the mRNA levels and protein expression of the genes FTH, ATF, p53, and HMOX1 did not show significant differences (data not shown), indicating that PEDV does not induce ferroptosis in Vero cells through these pathways. The oxidative degradation of polyunsaturated fatty acids (PUFAs) is a consequence of cellular metabolism. Lipid peroxidation (LPO) and its byproducts have diverse effects on cell function, influencing immunity, tumor suppression, senescence, and cell death [ 22 ]. Especially in cases of over-oxidation, lipid peroxidation disrupts the integrity and fluidity of the cell membrane, which is a critical factor in the onset of ferroptosis [ 23 ]. Additionally, the composition of membrane lipids affects the biological response, activity, and stability of respiratory chain supercomplexes, thereby influencing cellular energy metabolism and overall cell function. It is evident that membrane lipid composition and mitochondrial function are closely linked to cellular energy dynamics. Lipid metabolism plays a significant role in the execution of ferroptosis. The process of lipid peroxide-induced ferroptosis involves three key enzymes that catalyze the metabolism of polyunsaturated fatty acids. One of these, acyl coenzyme A synthetase long-chain family member 4 (ACSL4), catalyzes the esterification of arachidonic acid (AA) or adrenic acid (AdA) to phosphatidylethanolamine (PE), thereby increasing the concentration of long-chain polyunsaturated ω6 fatty acids in cell membranes, ultimately resulting in the formation of AA-CoA or AdA-CoA. These products are then acted upon by lysophosphatidylcholine acyltransferase 3 (LPCAT3), which facilitates the reaction between AA-CoA or AdA-CoA and membrane phospholipids to generate AA-PE or AdA-PE. This pathway highlights the intricate relationship between lipid metabolism and iron-dependent cell death. Both ACSL4 and LPCAT3 play crucial roles in promoting ferroptosis by upregulating the accumulation of intracellular lipid peroxidation substrates and are essential enzymes in the production of polyunsaturated fatty acid phosphatidylethanolamines (PUFA-PE). Ultimately, ALOX15 recognizes and oxidizes AA-PE and AdA-PE, converting them into signals that drive ferroptosis. Additionally, lipoxygenase (LOX) is necessary for the enrichment of polyunsaturated fatty acids (PUFAs) to facilitate this process. We examined changes in the mRNA expression of key genes associated with ferroptosis and found significant differences in the transcript levels of ACSL4, LPCAT3, and ALOX15. This underscores the close relationship between lipid metabolism and the induction of ferroptosis, highlighting the importance of these pathways in regulating cell fate.The genes ACSL4 and LPCAT3 serve as crucial regulators in the synthesis of lipid precursors, specifically polyunsaturated fatty acid phospholipids (PUFA-PL). Following this, we performed Western blot analysis to assess protein expression levels. The results indicated a significant increase in the protein expression of ACSL4, LPCAT3 and ALOX15 with the prolonged duration of virus infection. Based on these findings, we can initially infer that PEDV contributes to the occurrence of ferroptosis through the ACSL4-mediated lipid peroxidation pathway. This suggests that the virus may exploit lipid metabolism as a mechanism to induce cellular stress and promote ferroptosis in infected cells. Conclusion In this study, we demonstrated that PEDV can induce ferrropptosis in Vero cells. Furhemore, our findings suggest that PEDV may promote ferroptosis in Vero cells through the lipid peroxidation pathway regulated by ACSL 4. Declarations Conflict of interest The authors declare that the research was conducted in the absence of any commercial orfinancial relationships that could be construed as a potential conflict of interest. Author contributions Kai Wang and Guixue Hu conceived and designed the experiments. Qian Weng and Yuheng Li and Yuze Wei were responsible for sampling and sample testing and analysing the data. Simin Wang and Tingyu Hu and Zhihua Pei wrote and edited the paper. All authors contributed to the article and approved the submitted version. Acknowledgements This study was financially supported by the natural science foundation of Jilin provincial (grant number: 20240101219JC, 20210101040JC). References Kocherhans R, Bridgen A, Ackermann M et al (2001) Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23(2):137–144. https://doi.org/10.1023/a:1011831902219 2, Duarte M, Tobler K, Bridgen A et al (1994) Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology 198(2):466–476. https://doi.org/10.1006/viro.1994.1058 Yang WS, Stockwell BR (2008) Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in Oncogenic-RAS-Harboring cancer cells. Chem Biol 15(3):234–245. https://doi:10.1016/j.chem biol.2008.02.010 Sonam D, Stephen LL, William CH et al (2003) Identification of genotype-selective antitumor agents using synthetic lethal chemical screening in engineered human tumor cells. Cancer Cell 3(3):285–296 https://doi: 10.101 6/s1535-6108(03)00050 – 3 Dixon SJ, Lemberg KM, Lamprecht MR et al (2012) Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149(5):1060–1072. https://doi:10.1016/j.cell.2012.03.042 Yang WS, SriRamaratnam R, Welsch ME et al (2014) Regulation of ferroptotic cancer cell death by GPX4. Cell 156(1–2):317–331. https://doi:10.1016/j.c ell.2013.12.010 Doll S, Proneth B, Tyurina YY et al (2017) ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition. Nat Chem Biol 13(1):91–98. https://doi:10.1038/nchembio.2239 Ingold I, Berndt C, Schmitt S et al (2018) Selenium utilization by GPX4 is required to prevent hydroperoxide-induced ferroptosis. Cell 172(3):409–422. https://doi:10.1016/j.cell.2017.11.048 Doll S, Freitas FP, Shah R et al (2019) FSP1 is a glutathione-independent ferroptosis suppressor. Nature 575(7784):693–698. https://doi:10.1038/s41586-01 9-1707-0 Bersuker K, Hendricks JM, Li ZP et al (2019) The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature 575(7784):688–692. https://doi:10.1038/s41586-019-1705-2 Mao C, Liu XG, Zhang YL et al (2021) DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer. Nature, 593(7860): 586–590. https://doi.10.1038/s41586-021-03820-9 Zhang HL, Hu BX, Li ZL et al (2022) PKCβII phosphorylates ACSL4 to amplify lipid peroxidation to induce ferroptosis. Nat Cell Biol 24(1):88–98. https://doi:10.1038/s41556-021-00818-3 Bo Z, Xiang C, Feng R et al (2021) Liproxstatin-1 attenuates unilateral ureteral obstruction-induced renal fibrosis by inhibiting renal tubular epithelial cells ferroptosis. Cell Death Dis 12(9):843. https://doi:10.1038/s41419-021-04137-1 Turlewicz PH, Pomorska MM (2021) Porcinecoronaviruses:Overview of the state of the art. Virologica Sinica, 36(5): 833–851. https://doi.10.1007/s122 50-021-00364-0 Maiorino M, Conrad M, Ursini F (2018) GPx4, Lipid peroxidation, and cell death: discoveries, rediscoveries, and open issues. Antioxid Redox Signal 29(1):61–74. https://doi:10.1089/ars.2017.7115 Friedmann AJP, Schneider M, Proneth B et al (2014) Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Free Radic Biol Med 76(12):1180–1191. https://doi:10.1038/ncb3064 Fang XX, Cai ZX, Wang H et al (2020) Loss of cardiac ferritin H facilitates cardiomyopathy via Slc7a11-mediated ferroptosis. Circ Res 127(4):486–501. https://doi:10.1161/CIRCRESAHA.120.316509 Jiang L, Kon N, Li T et al (2015) Ferroptosis as a p53-mediated activity during tumour suppression. Nature 520(7545):57–62. https://doi:10.1038/nature14344 Cramer SL, Saha A, Liu J et al (2017) Systemic depletion of L-cyst(e)ine with cyst(e)inase increases reactive oxygen species and suppresses tumor growth. Nat Med 23(1):120–127. https://doi:10.1038/nm.4232 Dixon SJ, Patel DN, Welsch M et al (2014) Pharmacological inhibition of cystine-glutamate exchange induces endoplasmic reticulum stress and ferroptosis. Elife 1:e02523. https://doi:10.7554/eLife.02523 Chen MS, Wang SF, Hsu CY et al (2017) CHAC1 degradation of glutathione enhances cystine-starvation-induced necroptosis and ferroptosis in human triple negative breast cancer cells via the GCN2-eIF2α-ATF4 pathway. Oncotarget 8(70):114588–114602. https://doi:10.18632/oncotarget.23055 Yang WS, Kim KJ, Gaschler MM et al (2016) Peroxidation of polyunsaturated fatty acids by lipoxygenases drives ferroptosis. Proceedings of the National Academy of Sciences, 113(34): E4966-E4975. https://doi:10.1073/pnas.160324 4113 Haeggström JZ, Funk CD (2011) Lipoxygenase and leukotriene pathways: biochemistry, biology, and roles in disease. Chem Rev 111(10):5866–5898. https://doi:10.1021/cr200246d Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5419876","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":384353493,"identity":"16d3671e-14f7-4585-b9a5-4d4f9ffd4570","order_by":0,"name":"Qian Weng","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Weng","suffix":""},{"id":384353494,"identity":"13217174-550e-4ce5-953c-8f1e98afbad3","order_by":1,"name":"Yuheng Li","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuheng","middleName":"","lastName":"Li","suffix":""},{"id":384353495,"identity":"08b400e9-4b21-4c51-9759-eb2b6ae3a7fb","order_by":2,"name":"Yuze Wei","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuze","middleName":"","lastName":"Wei","suffix":""},{"id":384353496,"identity":"7a90d497-1787-4973-82b1-55c48f4edb99","order_by":3,"name":"Simin Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Simin","middleName":"","lastName":"Wang","suffix":""},{"id":384353497,"identity":"f388ddb3-b334-4957-9092-e9cfb1e3bd58","order_by":4,"name":"Tingyu Hu","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tingyu","middleName":"","lastName":"Hu","suffix":""},{"id":384353498,"identity":"8f09ba5f-d8ec-42ef-8ac5-e7829089bf68","order_by":5,"name":"Zhihua Pei","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhihua","middleName":"","lastName":"Pei","suffix":""},{"id":384353499,"identity":"df9e5981-519a-4e7c-aa76-c302bac147c6","order_by":6,"name":"Kai Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAw0lEQVRIie3PMQrCMBTG8RcCdYnU8RU8RKAQOhR6EJeCUCf3DkUaC3ERPFMJ6JLS1bHSC+juYHBzkMbNIf/5/eB7AD7fP8aIHJ8lspDSdnAktOHMJMvoEKy5I5kpnKsy5T0TCyfBTasQDbJYgwCo0tU06WSTcPuL0FAMcC629RQRPZHX3LzJhZNaO5Ea7TYWN0ShG+nkPpKWcEoDN5KZtonBDkMdUJ67/BIdN7cRyl0WnvrHcK/SafJZ/tu5z+fz+b71Av6oPZT3ba6TAAAAAElFTkSuQmCC","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Kai","middleName":"","lastName":"Wang","suffix":""},{"id":384353500,"identity":"1f9f0fdd-c6c6-4554-a74e-6fb6d1ed86f5","order_by":7,"name":"Guixue Hu","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Guixue","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2024-11-09 05:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5419876/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5419876/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":70375707,"identity":"e7cdfc80-10ca-4666-94b0-9996fcadc149","added_by":"auto","created_at":"2024-12-02 15:17:01","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":302587,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in iron death-related markers indicate ferroptosis in Vero cells.\u003c/strong\u003e (A) Changes of GSH content in control and experimental groups following PEDV infection over the specified time points. (B) Measurement of ROS content in control and experimental groups at different infection durations. (C) Assessment of LDH vitality status in control and experimental groups in response to PEDV infection at the indicated time points. \u003cstrong\u003e(D) \u003c/strong\u003eInfluence of the ferroptosis inhibitor liproxstatin-1 on PEDV-induced LDH release and cell viability. \u003cstrong\u003e(E, F) \u003c/strong\u003eComparison of the relative expression of GPX4 protein between viral and control groups at different time intervals. \u003cstrong\u003e(G) \u003c/strong\u003eChanges in iron ion content in virus-infected and control groups over the various time points following PEDV infection. The meaning of ns is “no significance”, p\u0026lt;0.05 marked *, indicating that the difference was significant; p\u0026lt;0.01 marked **, indicating that the difference was very significant; p\u0026lt;0.001 marked ***, indicating that the difference was extremely significant.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5419876/v1/116c1d760ff4c1f881059158.jpg"},{"id":70375705,"identity":"21296cb7-2b12-4b88-9e06-f9aec68aec55","added_by":"auto","created_at":"2024-12-02 15:17:01","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":335378,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of the ferroptosis inhibitor liproxstatin-1 on PEDV-induced lipid peroxidation.\u003c/strong\u003e (A) The influence of the iron-death inhibitor liproxstatin-1 on lipid peroxides FITC-A induced by PEDV. (B) Analysis of lipid peroxide fluorescence intensity in Vero cells induced by PEDV, with and without treatment by the ferroptosis inhibitor liproxstatin-1.(C) The influence of the ferroptosis inhibitor liproxstatin-1 on the Fe²⁺ aggregation induced by PEDV, highlighting changes in iron levels in response to the treatmnt. (D) Average fluorescence intensity reflecting Fe²⁺ aggregation in cells affected by PEDV, demonstrating the impact of liproxstatin-1 treatment. p\u0026lt;0.05 marked *, indicating that the difference was significant; p\u0026lt;0.01 marked **, indicating that the difference was very significant; p\u0026lt;0.001 marked ***, indicating that the difference was extremely significant.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5419876/v1/7e03fef78285c28c934f14bf.jpg"},{"id":70375706,"identity":"53c7504d-c056-41d5-899c-c890cf2ea2d9","added_by":"auto","created_at":"2024-12-02 15:17:01","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":289934,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePEDV induces ferroptosis in Vero cells via the lipid peroxidation pathway.\u003c/strong\u003e \u003cstrong\u003e(A-D) \u003c/strong\u003eTranscript levels of the ACSL4, GPX4, LPCAT3 and ALOX15 gene across different time points following PEDV infection. \u003cstrong\u003e(E-G) \u003c/strong\u003eProtein expression levels of ALOX15, LPCAT3, ACSL4 and a comparison of its relative expression in virus-infected versus control groups. p\u0026lt;0.05 marked *, indicating that the difference was significant; p\u0026lt;0.01 marked **, indicating that the difference was very significant; p\u0026lt;0.001 marked ***, indicating that the difference was extremely significant.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5419876/v1/985b22e609a1893dae3faa0a.jpg"},{"id":70597668,"identity":"5f79d54e-acc3-4bc9-a989-7004441c3b98","added_by":"auto","created_at":"2024-12-04 18:38:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1473163,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5419876/v1/4b7726f0-b815-4e31-ba11-36160d8758a9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PEDV infection induces ferroptosis in Vero cells via an ACSL-mediated lipid peroxidation pathway ","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePorcine epidemic diarrhea virus (PEDV) is endemic worldwide and has significantly impacted the pig industry. Currently, there are no specific treatments for PEDV. PEDV is an enveloped, single-stranded RNA virus with a genome that spans approximately 28 kb in length (excluding the polyA tail) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The genome structure comprises a 5' untranslated region (UTR), seven open reading frames (ORFs: ORF1a, ORF1b and ORF 2\u0026ndash;6), a 3' UTR, and a polyA tail at 3' end. These seven open reading frames encode four structural proteins (S, M, E, N) as well as non-structural proteins (nsps) pp1a, pp1ab, and ORF3 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFerroptosis is a ecently identified from of programmed cell death. Dolma et al. First discovered that a range of compounds could induce cell death while invesigating the anti-cancer treatment pathways of small molecule compounds [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In 2008, Yang \u003cem\u003eet al\u003c/em\u003e. discovered that the small molecule compound RSL3 elicited an iron-dependent cell death mechanism that was distinct from apoptosis and necrosis in tumor cells harboring Ras mutations [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Ferroptosis was formally characterized in 2012, when it was demonstrated that the small molecule compound Erastin inhibits cystine uptake via the cystine/glutamate transport system (System Xc-). This inhibition leads to the accumulation of iron ions, mitochondrial swelling, rupture of the outer membrane, and a distinct form of cell death that differs from apoptosis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In 2014, Yang \u003cem\u003eet al\u003c/em\u003e. identified Glutathione peroxidase 4 (GPX4) as a critical protein in the process of ferroptosis. GPX4 protects against iron-induced cell death by reducing the formation of phospholipid hydroperoxide through the inhibition of Alox12-mediated lipid peroxidation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In 2017, Acyl-CoA synthetase long-chain family member 4 (ACSL4) was identified as an enzyme crucial for the synthesis of polyunsaturated fatty acids (PUFA) and recognized as a key biomarker for detecting ferroptosis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Subsequently, Ingold et al. revealed that GPX4 acts to inhibit ferroptosis through its utilization of selenium [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. More recently, ferroptosis suppressor protein 1 (FSP1) and Coenzyme Q (CoQ) have been identified on the outer membrane and inner mitochondrial membrane, respectively. Additionally, CoQ pathways of ferroptosis that are regulated by CoQ, including those independent of GPX4, have been discovered, highlighting the roles of CoQ and dihydroorotate dehydrogenase (DHODH) in this process [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In 2022, Protein Kinase C beta II (PKCβII), an important receptor molecule that promotes the accumulation of lipid peroxidation, was found to regulate both lipid peroxidation and ferroptosis through a phosphorylation pathway that activates ACSL4 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe local epidemic of PEDV is primarily linked to the high mutation rate of the virus's S gene. The S protein, which is encoded by the S gene, is crucial for eliciting an immune response from vaccines. Therefore, notable differences between the vaccine strain and the locally endemic strain can adversely affect the vaccine's efficacy. This discrepancy is a key factor contributing to the suboptimal immune response to the vaccine. PEDV primarily targets intestinal epithelial cells, which disrupts the intestine\u0026rsquo;s capacity to digest and absorb nutrients, leading to acute diarrhea, particularly in young piglets. Currently, there is no specific treatment available for PEDV, primarily due to an insufficient understanding of its pathogenic mechanisms. This lack of clarity significantly hinders the development of new therapeutic drugs. Ferroptosis is a novel form of iron-dependent cell death characterized by lipid peroxidation, distinguishing it from other cell death mechanisms such as apoptosis, necrosis, pyroptosis and autophagy. The primary characteristics of ferroptosis include iron accumulation and lipid peroxidation. To further investigate the molecular pathogenesis of PEDV, this study aims to examine the mechanisms underlying PEDV-induced cell damage through the lens of ferroptosis. The findings from this research will identify critical targets for the development of new veterinary drugs and provide theoretical foundations and essential resources for the scientific prevention and control of PEDV.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and PEDV infection\u003c/h2\u003e \u003cp\u003eVero cells were cultured into T25 flasks supplemented with 8% fetal calf serum (Hyclone, USA) and antibiotics (100 units/ml of penicillin and 100 \u0026micro;g/mL of streptomycin). Upon reaching 80\u0026ndash;85% confluence, the cells were inoculated with 1.0 mL of PEDV at a multiplicity of infection (MOI) of 1.0. The cells were then incubated for 35 minutes to facilitate PEDV adsorption. Following adsorption, the medium was removed, and 5 mL of maintenance solution was added to each flask. The cells were subsequently returned to the incubator, and samples for analysis were collected at designated time intervals. The PEDV CV777 strain and Vero cell were obtained from the Institute of Microbiology, College of Veterinary Medicine, Jilin Agricultural University.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReagents and antibodies\u003c/h3\u003e\n\u003cp\u003eThe Glutathione (GSH) Kit, Reactive Oxygen Species (ROS) Kit, and Lactate Dehydrogenase Cytotoxicity Detection Kit were procured from Biyun Tian Biological Co. Ltd. The Iron Determination Kit (colorimetric method) was obtained from TaKaRa Biomedical Technology (Beijing) Co. Ltd. The Liperfluo-Lipid Peroxides Fluorescent Probe and Iron Ion Fluorescent Probe-Mito-ferrogreen were obtained from Tongren Chemistry. Erastin and Liprostatin (0.5 \u0026micro;M)[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] were purchased from Shanghai Taosu Biotechnology Co. Ltd. The AxyPrep DNA Gel Extraction Kit was purchased from Corning Life Science Co. Ltd., while the anti-GPX4 polyclonal antibody was purchased from Beijing Borsi Co. Ltd.\u003c/p\u003e\n\u003ch3\u003eWestern blot\u003c/h3\u003e\n\u003cp\u003eThe experiments were divided into PEDV and control groups, with three replicates in each group. Following the removal of the culture supernatants, Vero cells were prepared for analysis. Protein concentration was quantified using the BCA Protein Detection Kit (Biouniquer Technology Co, Ltd., China), and 50 \u0026micro;g of protein lysate from each sample was reserved for further analyses. Subsequently, the proteins underwent SDS-PAGE electrophoresis, and the proteins were electro-transferred to a blotting membrane (NC membrane). To minimize non-specific antibody binding, the membrane was blocked with 5% skimmed milk powder for 1 hour. Primary antibodies targeting Glut1 (Santa Cruz, USA), PEDV-N (Medgene Labs, China), RIG-1 (Proteintech, USA), MDA5 (Proteintech, USA), β-actin (Santa Cruz, USA) and GAPDH (Servicebio, China) were incubated overnight at 4 ℃. Following incubation, the membranes were washed three times with TBST. Subsequently, either recombinant anti-GAPDH or Goat Anti-Rabbit IgG/Goat Anti-Mouse IgG (CWBIO, China) secondary antibodies were applied, and the samples were further incubated at room temperature for 1 h. The membranes were washed three times with TBST to remove unbound antibodies. Finally, the protein bands were visualized using ECL kits (Amersham, UK), and signal intensity was quantified using Gray-scale analysis software (Image Tool 3.0).\u003c/p\u003e\n\u003ch3\u003eELISA method\u003c/h3\u003e\n\u003cp\u003eThe experiments were organized into PEDV and control groups, with three replicates in each group. Cell culture supernatants were collected at four time points 12, 24, 36, and 48 hours post-infection. The levels of GSH, ROS, Fe\u003csup\u003e2+\u003c/sup\u003e and LDH were subsequently quantified using their respective kits.\u003c/p\u003e\n\u003ch3\u003eEffect of the iron-death inhibitor liproxstatin-1\u003c/h3\u003e\n\u003cp\u003eWe investigated the effects of the ferroptosis inhibitor liproxstatin-1 on LDH, Fe\u003csup\u003e2+\u003c/sup\u003e levels and lipid peroxidation induced by PEDV. The experiments were divided into control groups, viral groups and negative control groups, with three replicates for each group. Cell culture supernatants were collected at four distinct time intervals: 12, 24, 36, 48 hours post-infection. To test the impact of liproxstatin-1 on PEDV-induced LDH levels, we measured LDH concentrations according to kit instructions. Fluorescence microscopy was employed to monitor the changes in Fe\u003csup\u003e2+\u003c/sup\u003e aggregation. After discarding the supernatants from each group, samples were washed 1\u0026thinsp;~\u0026thinsp;3 times with Hanks' Balanced Salt Solution (HBSS). Each well received 1 mL of working solution and was incubated for 30 minutes. Subsequently, samples were visualized under green excitation light (Ex: 532 nm).\u003c/p\u003e \u003cp\u003eFor the analysis of lipid peroxides, flow cytometry was utilized. A total of 100 \u0026micro;g of liperfluo tubes were combined with 120 \u0026micro;g of DMSO, thoroughly mixed using a shaker, and diluted to 1 \u0026micro;mol/L with serum-free DMEM before being stored at 4\u0026deg;C for subsequent assays. Treated cells from each group were washed 1 to 2 times with serum-free DMEM. Then, 1.5 mL of working liquid was added to each well and the cells were incubated in a CO\u003csub\u003e2\u003c/sub\u003e incubator for 30 minutes. The levels of lipid peroxides were quantified using flow cytometry, with the excitation wavelength set to 488 nm and emission wavelength within the range of 515\u0026thinsp;~\u0026thinsp;545 nm.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePrimer design and screening for the key genes of iron death\u003c/h2\u003e \u003cp\u003eKey genes involved in various ferroptosis regulatory pathways were selected for analysis, including: Transcriptional Activation Factor Pathway (ATF4), Lipid Peroxidation-driven Pathway (ACSL4, LPCAT3, ALOX15), Glutathione Pathway (SLC3A2, GPX4), Ferric Ion Pathway (TFR, FTH1), Mevalonate Pathway (P53), Hemoglobin Oxygenase Pathway (HMOX1), and Ferroptosis Pathway (TFR, FTH1). Gene sequences were retrieved from GenBank to identify corresponding genes, followed by the design of specific. The primers were synthesized by Bioengineering (Shanghai) Co., Ltd..\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReal-Time PCR\u003c/h3\u003e\n\u003cp\u003eTotal viral RNA was extracted following the manufacturer's instructions, and the quality of the extracted RNA was assessed, demonstrating high purity with optical density (OD) values ranging from 1.9 to 2.2. Complementary DNA (cDNA) was synthesized using the Takara reverse transcription kit. The reaction mixture for quantitative PCR was prepared by adding 2.0 \u0026micro;L of cDNA template, 400 \u0026micro;L of TB Green Premix Ex Taq (Tli RNaseH Plus) (2\u0026times;) kept on ice, 16 \u0026micro;L each of PCR forward and reverse primer (10 \u0026micro;M), 16 \u0026micro;L of ROX Reference Dye (50\u0026times;), and 272 \u0026micro;L of sterilized water. The mixture was thoroughly mixed and then aliquoted into sterile PCR tubes, with each tube receiving 18 \u0026micro;L of the mixture. The real-time PCR setup was programmed as follows: Stage 1 - Pre-denaturation: 1 cycle at 95\u0026deg;C for 30 seconds; Stage 2 - PCR reaction: 40 cycles consisting of 95\u0026deg;C for 5 seconds and 60\u0026deg;C for 30\u0026thinsp;~\u0026thinsp;34 seconds for data collection and analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the RT-qPCR study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence(5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCCTGGGTGAGTGGAGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGGTAGTTTCATGGATGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACSL4(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGACTGGGACCAAAGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACSL4(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCGGAACAGCAGCCATAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTFRC(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCATACACCCGGTTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTFRC(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTCCTGCCAGTCTCTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATF4(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGTTCTCCAGCGACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATF4(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGGCATGGTTTCCAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHMOX1(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGTGCCACCAAGTTCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHMOXI(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCTCCTGCAACTCCTCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC3A2(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCGTCTCGATTACCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC3A2(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGCAGAGCATCCTTCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPX4(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGCCAGGGAGTAACGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPX4(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGGAGCCGTTCTTGTCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFTH1(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGGAAAGGGAACATGCCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFTH1(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACTCCATCGCATTCAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP53(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTGGGCTTCCTGCATTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP53(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACGACCTCAGTCATGTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALOX15(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGCAACTGGATCTCCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALOX15(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGAGATCCTCTTCTCGCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPCAT3(F)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCCGAGCCGGAATTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLPCAT3(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGCTCAGCTCCTGGAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data in this experiment were statistically analyzed and graphed by Graph Prism 8.0 software. The significant differences between two groups was analyzed by t-test, while the significant of differences among multiple groups was determined by one-way ANOVA. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 marked *, indicating that the difference was significant; p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 marked **, indicating that the difference was very significant; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 marked ***, indicating that the difference was extremely significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eChanges in iron death-related markers indicate the occurrence of ferroptosis in Vero cells\u003c/h2\u003e \u003cp\u003eGPX4 serves as a crucial antioxidant regulatory center in this process. Consequently, we measured the GSH content in cell culture supernatants at various time points following PEDV infection of Vero cells, specifically at 12, 24, 36, 48 hours. The results indicated a highly difference in GSH content between the control and experimental groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Reactive oxygen species (ROS) are also a key marker of ferroptosis, with significant ROS release accompanied iron-dependent cell death. Measurements of ROS from PEDV-infected Vero cells revealed a substantial difference between the experimental and control groups at 24, 36, and 48 hours post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Regarding LDH, enzyme activity and cell viability were determined at various times points. The results demonstrated a highly significant difference between the virus group and the control group across all time intervals, indicating a gradual decline in cell viability in the virus group as time progressed (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). To further evaluate the effect of PEDV on ferroptosis, the iron death inhibitor liproxstatin-1 (0.5 \u0026micro;M) was employed. LDH release and viability were determined assessed across each group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Results indicated significant differences in the inhibitor group at 12, 24 and 36 hours post-infection (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), though no significant difference was observed at 48 hours (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), possibly due to the half-life of liproxstatin-1.\u003c/p\u003e \u003cp\u003e \u003cb\u003eChanges in characteristic markers of ferroptosis suggest the occurrence of iron-dependent cell death in Vero cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe evaluated the expression levels of GPX4 protein in both the PEDV group and the control group (vaccinated with an equivalent dose of DMEM maintenance solution) using Western blot analysis. The results demonstrated a gradual decrease in GPX4 protein expression with prolonged PEDV infection. Comparisons with the normal cell control group indicated significant difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). Iron ions, as key drivers of ferroptosis, are taken up by cells through transferrin receptor 1 (TfR 1) on the cellular membrane. These iron ions play a crucial role in regulating lipid peroxidation and the release of reactive oxygen species, enhancing the cell's sensitivity to iron and contributing to ferroptosis. To assess this, we measured changes in the content of iron ions in the PEDV group compared to the control group at different time intervals. The results revealed that ferrous ion content gradually decreased in the PEDV group, while it increased in the control group, with significant differences noted when comparing the virus group to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). This suggests that the virus group had a gradual increase in intracellular ferrous ion content due to the substantial involvement of ferrous ions in subsequent reactions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePEDV induces ferroptosis in Vero cells via the lipid peroxidation pathway\u003c/h2\u003e \u003cp\u003eThe Fenton reaction promotes the generation of phospholipid hydroperoxides (PLOO) from polyunsaturated fatty acid phospholipids (PUFA-PL), which increases reactive ROS levels and leads to the production of large quantities of lipid peroxides. This mechanism distinguishes ferroptosis from other forms of programmed cell death. To assess lipid peroxide levels, we employed lipid peroxide probes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B). The results demonstrated that lipid peroxidation levels in the infected group were significantly higher compared to the inhibitor group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and there was also a notable difference between the infected group and the blank control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These findings indicate that PEDV causes Vero cells to produce substantial amounts of lipid peroxides, which were mitigated by liproxstatin-1 (0.5 \u0026micro;M). Additionally, Fe\u003csup\u003e2+\u003c/sup\u003e plays a pivotal role in subsequent lipid peroxidation reactions via the Fenton reaction. We examined PEDV-induced Fe\u003csup\u003e2+\u003c/sup\u003e aggregation, using a separate group pretreated with liproxstatin-1 (0.5 \u0026micro;M) for 30 minutes. Fluorescence microscopy was utilized to observe the groups 36 hours post-inoculation with PEDV. The results revealed significant Fe\u003csup\u003e2+\u003c/sup\u003e accumulation in the virus group, while Fe\u003csup\u003e2+\u003c/sup\u003e aggregation decreased markedly in the inhibitor pretreatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Fluorescence intensity was quantified using Image J software to analyzed the differences among the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The results showed that an extremely significant difference in mean fluorescence intensity between the PEDV group and the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with the inhibitor group significantly reducing virus-induced Fe\u003csup\u003e2+\u003c/sup\u003e aggregation (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe expression levels of ACSL4, LPCAT3, and ALOX15 significantly increased with the duration of PEDV infection\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe first assessed changes in the expression of key regulatory genes associated with ferroptosis by measuring transcript levels in each group. The results indicated that the mRNA level of ACSL4 increased with the extension of virus infection duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Compared with the control group, the differences were significant at 12 hours and 24 hours (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and an extremely significant difference at 36 hours. Conversely, the mRNA level of GPX4 decreased as the duration of virus infection increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The differences at 12, 24 and 36 hours of infection were extremely significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) when compared to the control group. Similarly, the mRNA levels of LPCAT3 also increased over the course of PEDV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Compared to the control group, the differences became extremely significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) at 24 and 36 hours, and significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) at 12 hours. Lastly, the mRNA levels of ALOX15 also increased in line with the extended duration of virus infection increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The differences were significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) at 12 hours and extremely significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) at 24 and 36 hours compared to the control group.\u003c/p\u003e \u003cp\u003eNext, we investigated changes in the expression of key regulatory proteins involved in ferroptosis. We examined the expression levels of the relevant proteins and calculated their relative expressions. The results of Western blot assay showed that the expression of ALOX15 was significantly increased in cells infected with PEDV as well as in cells treated with Erastin compared to the blank control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The difference between the infected group and the control group was highly significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Similarly, The expression levels of LPCAT3 were elevated in the infected group in comparison to the blank control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), with the difference being highly significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, ACSL4 expression also showed a marked increase in the infected group when compared to the blank control group for both PEDV and Erastin treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG), with the difference again being highly significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePorcine diarrhea coronaviruses are clinically significant pathogens responsible for inducing diarrhea in piglets. Identified strains of porcine diarrhoea coronaviruses include the porcine epidemic diarrhoea virus, porcine infectious gastroenteritis virus, porcine Delta coronavirus and porcine acute diarrhoea syndrome coronavirus [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. These coronaviruses are capable of infecting pigs across all age groups and typically manifest very similar clinical symptoms. Common presenttations include vomiting, severe diarrhea, and high mortality rates among piglets, alongside indistinct pathological changes characterized by severe inflammatory lesions in the small intestinal tissues. Consequently, diarrhea in piglets has consistently posed a substantial challenge for the swine industry, resulting in significant economic losses [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFerroptosis is a form of programmed cell death driven by iron ion-mediated lipid peroxidation and subsequent membrane damage. GPX4 plays a critical role in this process by utilizing glutathione (GSH) as a co-substrate to catalyze the reduction of lipid peroxides. As the primary antioxidant system against ferroptosis, GPX4 is essential for protecting cells from iron-induced oxidative stress [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Iron ions play a crucial role in catalyzing the peroxidation of polyunsaturated fatty acid phospholipids, resulting in the formation of lipid peroxides and lipid reactive oxygen species. This process enhances cellular sensitivity to ferroptosis and further contributes to cell membrane damage. To investigate whether PEDV could induce ferroptosis in Vero cells, we measured the changes in GSH content in PEDV-infected Vero cells and observed a gradual decrease in GSH levels over the course of infection. To confirm the effects of PEDV infection on GPX4 expression, we examined GPX4 levels at various time points following PEDV infection. The results indicated that glutathione biosynthesis in Vero cells was highly sensitive to PEDV. We further analyzed the levels of lipid peroxidation, ROS and iron ions. The findings revealed that the PEDV-infected group produced a substantial amount of lipid peroxides, accompanied by significant ROS release and pronounced aggregation of ferrous ions, compared to the control group. Subsequently, cells were pretreated with the ferroptosis inhibitor liproxstatin\u0026minus;1 (0.5 \u0026micro;M) before inoculation with PEDV. We then assessed cell viability, ferrous ion aggregation, and the levels of lipid peroxides released, to evaluate the protective effects of the inhibitor against PEDV-induced ferroptosis. The results demonstrated that treatment with liproxstatin-1 protected a portion of the cells from undergoing death, while also leading to a reduction in lipid peroxidation levels. Additionally, ferrous ion aggregation was less pronounced in the inhibitor-treated group compared to the PEDV group. These findings collectively indicate that PEDV triggers ferroptosis in Vero cells.\u003c/p\u003e \u003cp\u003eGPX4 is a crucial regulatory center in ferroptosis, as it catalyzes the reduction of toxic lipid hydroperoxides (L-OOH) to their corresponding alcohols (L-OH) while simultaneously oxidizing GSH to glutathione disulfide (GSSG). Consequently, inhibition of GPX4 activity leads to the accumulation of lipid peroxides, thereby promoting ferroptosis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Iron homeostasis in cells involves a balanced process of absorption, utilization, storage, and expulsion of iron to maintain dynamic equilibrium. Transferrin receptor 1 (TFR1) is a membrane protein responsible for transporting Fe\u0026sup3;⁺ into cells, where it is reduced to Fe\u0026sup2;⁺ by ferric reductase upon entry into the endosome. Both Fe\u0026sup3;⁺ and Fe\u0026sup2;⁺ play essential roles in ATP redox processes and the reduction of DNA precursors. When iron ion levels exceed cellular requirements, excess iron is sequestered intracellularly by ferritin, which consists of ferritin light chain (FTL) and ferritin heavy chain (FTH). When iron is needed again, it can be quickly mobilized through transporter proteins, such as ferroportin (FPN), at the cell membrane [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The tumor suppressor gene p53 plays a critical role in mediating cell cycle arrest, senescence, and apoptosis. Jiang \u003cem\u003eet al\u003c/em\u003e. discovered that p53 promotes ferroptosis in fibroblasts and certain cancer cells by trans-repressing the expression of the SLC7A11 gene, which encodes the cystine/glutamate antiporter System Xc- [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additionally, HMOX1 encodes heme oxygenase 1, an enzyme that detoxifies hemoglobin to produce biliverdin, while simultaneously releasing carbon monoxide and Fe\u0026sup2;⁺. This process contributes to cellular iron homeostasis and can affect ferroptosis pathways. This process is closely linked to oxidative stress. HMOX1 expression is regulated by Nrf2, which is in turn controlled by the Keap1 protein. Cramer \u003cem\u003eet al\u003c/em\u003e. found that exposure to moderate concentrations of intoxicin A leads to the overexpression of HMOX1 by binding to Keap1. This binding results in an increase in available iron ions within the cellular iron pool, contributing to oxidative stress and promoting ferroptosis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, Erastin can induce endoplasmic reticulum stress, which activates the ATF4 signaling pathway. Activation of this pathway can lead to the degradation of GSH and facilitate the onset of ferroptosis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In this study, we observed significant differences in the transcript levels of the genes GPX4, SLC3A2, and TFR; however, there were no corresponding changes in their protein expression levels (data not shown). Similarly, the mRNA levels and protein expression of the genes FTH, ATF, p53, and HMOX1 did not show significant differences (data not shown), indicating that PEDV does not induce ferroptosis in Vero cells through these pathways. The oxidative degradation of polyunsaturated fatty acids (PUFAs) is a consequence of cellular metabolism. Lipid peroxidation (LPO) and its byproducts have diverse effects on cell function, influencing immunity, tumor suppression, senescence, and cell death [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Especially in cases of over-oxidation, lipid peroxidation disrupts the integrity and fluidity of the cell membrane, which is a critical factor in the onset of ferroptosis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAdditionally, the composition of membrane lipids affects the biological response, activity, and stability of respiratory chain supercomplexes, thereby influencing cellular energy metabolism and overall cell function. It is evident that membrane lipid composition and mitochondrial function are closely linked to cellular energy dynamics. Lipid metabolism plays a significant role in the execution of ferroptosis. The process of lipid peroxide-induced ferroptosis involves three key enzymes that catalyze the metabolism of polyunsaturated fatty acids. One of these, acyl coenzyme A synthetase long-chain family member 4 (ACSL4), catalyzes the esterification of arachidonic acid (AA) or adrenic acid (AdA) to phosphatidylethanolamine (PE), thereby increasing the concentration of long-chain polyunsaturated ω6 fatty acids in cell membranes, ultimately resulting in the formation of AA-CoA or AdA-CoA. These products are then acted upon by lysophosphatidylcholine acyltransferase 3 (LPCAT3), which facilitates the reaction between AA-CoA or AdA-CoA and membrane phospholipids to generate AA-PE or AdA-PE. This pathway highlights the intricate relationship between lipid metabolism and iron-dependent cell death. Both ACSL4 and LPCAT3 play crucial roles in promoting ferroptosis by upregulating the accumulation of intracellular lipid peroxidation substrates and are essential enzymes in the production of polyunsaturated fatty acid phosphatidylethanolamines (PUFA-PE). Ultimately, ALOX15 recognizes and oxidizes AA-PE and AdA-PE, converting them into signals that drive ferroptosis. Additionally, lipoxygenase (LOX) is necessary for the enrichment of polyunsaturated fatty acids (PUFAs) to facilitate this process. We examined changes in the mRNA expression of key genes associated with ferroptosis and found significant differences in the transcript levels of ACSL4, LPCAT3, and ALOX15. This underscores the close relationship between lipid metabolism and the induction of ferroptosis, highlighting the importance of these pathways in regulating cell fate.The genes ACSL4 and LPCAT3 serve as crucial regulators in the synthesis of lipid precursors, specifically polyunsaturated fatty acid phospholipids (PUFA-PL). Following this, we performed Western blot analysis to assess protein expression levels. The results indicated a significant increase in the protein expression of ACSL4, LPCAT3 and ALOX15 with the prolonged duration of virus infection.\u003c/p\u003e \u003cp\u003eBased on these findings, we can initially infer that PEDV contributes to the occurrence of ferroptosis through the ACSL4-mediated lipid peroxidation pathway. This suggests that the virus may exploit lipid metabolism as a mechanism to induce cellular stress and promote ferroptosis in infected cells.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eIn this study, we demonstrated that PEDV can induce ferrropptosis in Vero cells. Furhemore, our findings suggest that PEDV may promote ferroptosis in Vero cells through the lipid peroxidation pathway regulated by ACSL 4.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial orfinancial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003ch2\u003eAuthor contributions\u003c/h2\u003e\n\u003cp\u003eKai Wang and Guixue Hu conceived and designed the experiments. Qian Weng and Yuheng Li and Yuze Wei were responsible for sampling and sample testing and analysing the data. Simin Wang and Tingyu Hu and Zhihua Pei wrote and edited the paper. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eThis study was financially supported by the natural science foundation of Jilin provincial (grant number: 20240101219JC, 20210101040JC).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKocherhans R, Bridgen A, Ackermann M et al (2001) Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23(2):137\u0026ndash;144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/a:1011831902219\u003c/span\u003e\u003cspan address=\"10.1023/a:1011831902219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e2, Duarte M, Tobler K, Bridgen A et al (1994) Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology 198(2):466\u0026ndash;476. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/viro.1994.1058\u003c/span\u003e\u003cspan address=\"10.1006/viro.1994.1058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang WS, Stockwell BR (2008) Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in Oncogenic-RAS-Harboring cancer cells. Chem Biol 15(3):234\u0026ndash;245. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.chem biol.2008.02.010\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.chem biol.2008.02.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSonam D, Stephen LL, William CH et al (2003) Identification of genotype-selective antitumor agents using synthetic lethal chemical screening in engineered human tumor cells. Cancer Cell 3(3):285\u0026ndash;296 https://doi: 10.101 6/s1535-6108(03)00050\u0026thinsp;\u0026ndash;\u0026thinsp;3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon SJ, Lemberg KM, Lamprecht MR et al (2012) Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149(5):1060\u0026ndash;1072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.cell.2012.03.042\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.cell.2012.03.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang WS, SriRamaratnam R, Welsch ME et al (2014) Regulation of ferroptotic cancer cell death by GPX4. Cell 156(1\u0026ndash;2):317\u0026ndash;331. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.c ell.2013.12.010\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.c ell.2013.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoll S, Proneth B, Tyurina YY et al (2017) ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition. Nat Chem Biol 13(1):91\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/nchembio.2239\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/nchembio.2239\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIngold I, Berndt C, Schmitt S et al (2018) Selenium utilization by GPX4 is required to prevent hydroperoxide-induced ferroptosis. Cell 172(3):409\u0026ndash;422. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.cell.2017.11.048\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.cell.2017.11.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoll S, Freitas FP, Shah R et al (2019) FSP1 is a glutathione-independent ferroptosis suppressor. Nature 575(7784):693\u0026ndash;698. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/s41586-01 9-1707-0\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/s41586-01 9-1707-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBersuker K, Hendricks JM, Li ZP et al (2019) The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature 575(7784):688\u0026ndash;692. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/s41586-019-1705-2\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/s41586-019-1705-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao C, Liu XG, Zhang YL et al (2021) DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer. Nature, 593(7860): 586\u0026ndash;590. https://doi.10.1038/s41586-021-03820-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang HL, Hu BX, Li ZL et al (2022) PKCβII phosphorylates ACSL4 to amplify lipid peroxidation to induce ferroptosis. Nat Cell Biol 24(1):88\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/s41556-021-00818-3\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/s41556-021-00818-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBo Z, Xiang C, Feng R et al (2021) Liproxstatin-1 attenuates unilateral ureteral obstruction-induced renal fibrosis by inhibiting renal tubular epithelial cells ferroptosis. Cell Death Dis 12(9):843. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/s41419-021-04137-1\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/s41419-021-04137-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurlewicz PH, Pomorska MM (2021) Porcinecoronaviruses:Overview of the state of the art. Virologica Sinica, 36(5): 833\u0026ndash;851. https://doi.10.1007/s122 50-021-00364-0\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaiorino M, Conrad M, Ursini F (2018) GPx4, Lipid peroxidation, and cell death: discoveries, rediscoveries, and open issues. Antioxid Redox Signal 29(1):61\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1089/ars.2017.7115\u003c/span\u003e\u003cspan address=\"https://doi:10.1089/ars.2017.7115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriedmann AJP, Schneider M, Proneth B et al (2014) Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Free Radic Biol Med 76(12):1180\u0026ndash;1191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/ncb3064\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/ncb3064\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang XX, Cai ZX, Wang H et al (2020) Loss of cardiac ferritin H facilitates cardiomyopathy via Slc7a11-mediated ferroptosis. Circ Res 127(4):486\u0026ndash;501. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1161/CIRCRESAHA.120.316509\u003c/span\u003e\u003cspan address=\"https://doi:10.1161/CIRCRESAHA.120.316509\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang L, Kon N, Li T et al (2015) Ferroptosis as a p53-mediated activity during tumour suppression. Nature 520(7545):57\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/nature14344\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/nature14344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCramer SL, Saha A, Liu J et al (2017) Systemic depletion of L-cyst(e)ine with cyst(e)inase increases reactive oxygen species and suppresses tumor growth. Nat Med 23(1):120\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/nm.4232\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/nm.4232\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon SJ, Patel DN, Welsch M et al (2014) Pharmacological inhibition of cystine-glutamate exchange induces endoplasmic reticulum stress and ferroptosis. Elife 1:e02523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.7554/eLife.02523\u003c/span\u003e\u003cspan address=\"https://doi:10.7554/eLife.02523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen MS, Wang SF, Hsu CY et al (2017) CHAC1 degradation of glutathione enhances cystine-starvation-induced necroptosis and ferroptosis in human triple negative breast cancer cells via the GCN2-eIF2α-ATF4 pathway. Oncotarget 8(70):114588\u0026ndash;114602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.18632/oncotarget.23055\u003c/span\u003e\u003cspan address=\"https://doi:10.18632/oncotarget.23055\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang WS, Kim KJ, Gaschler MM et al (2016) Peroxidation of polyunsaturated fatty acids by lipoxygenases drives ferroptosis. Proceedings of the National Academy of Sciences, 113(34): E4966-E4975. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1073/pnas.160324 4113\u003c/span\u003e\u003cspan address=\"https://doi:10.1073/pnas.160324 4113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaeggstr\u0026ouml;m JZ, Funk CD (2011) Lipoxygenase and leukotriene pathways: biochemistry, biology, and roles in disease. Chem Rev 111(10):5866\u0026ndash;5898. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1021/cr200246d\u003c/span\u003e\u003cspan address=\"https://doi:10.1021/cr200246d\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Porcine epidemic diarrhea virus(PEDV), Ferroptosis, Lipid peroxidation","lastPublishedDoi":"10.21203/rs.3.rs-5419876/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5419876/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePorcine epidemic diarrhea virus (PEDV) is a highly contagious viral pathogen causing severe economic losses in the swine industry. However, the underlying mechanisms of PEDV-induced host cell death largely unknown. In this study, we investigated the role of ferroptosis, a non-apoptotic form of programmed cell death, in PEDV pathogenesis. The experiments were divided into four groups: a control group, a PEDV (MOI\u0026thinsp;=\u0026thinsp;1.0) group, an Erastin (5\u0026micro;M) positive control group and a Liprostatin (0.5\u0026micro;M) negative control group. Levels of GSH, ROS, Fe\u003csup\u003e3+\u003c/sup\u003e and cell viability were evaluated using ELISA test kits. Fluorescence microscopy was employed to assess Fe\u003csup\u003e2+\u003c/sup\u003e aggregation, while flow cytometry was utilizeed to measure lipid peroxide levels. The mRNA transcript levels of key gene involved the ferroptosis pathway-ACSL4, GPX4, ALOX15 and LPCAT3 - were determined by quantitative reverse transcription PCR. Compared to the control group, the PEDV group exhibited a significant decrease in GSH levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and a gradual reduction in Fe\u003csup\u003e3+\u003c/sup\u003e levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) over time. Furthermore, the PEDV group showed a substantial increase in ROS release (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and a corresponding decrease in cell viability (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) relative to the control group. The results of the qRT-PCR revealed that the expression levels of ACSL4, ALOX15 and LPCAT3 mRNA were significantly elevated in the PEDV group (P\u0026lt;0.01). Additionally, Western blot analysis confirmed that the protein expression levels of ACSL4, ALOX15 and LPCAT3 also increased progressively (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In conclusion, our findings demonstrated that PEDV can induce ferroptosis in Vero cells through the lipid peroxidation pathway mediated by ACSL 4.\u003c/p\u003e","manuscriptTitle":"PEDV infection induces ferroptosis in Vero cells via an ACSL-mediated lipid peroxidation pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-02 15:16:56","doi":"10.21203/rs.3.rs-5419876/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ce2bfe76-b561-42be-ace6-06066235603c","owner":[],"postedDate":"December 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-04T18:38:16+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-02 15:16:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5419876","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5419876","identity":"rs-5419876","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.