Androgens at the skin surface regulateS. aureuspathogenesis through the activation ofagrquorum sensing

Staphylococcus aureus, the most frequent cause of skin infections, is more common in men than women and selectively colonizes the skin during inflammation . Yet, the specific cues that drive 25 infection in these settings remain unclear. Here we show that the host androgens testosterone and dihydrotestosterone promote S. aureus pathogenesis and skin infection. Without the secretion of these hormones, skin infection in vivo is limited. Testosterone activates S. aureus virulence in a concentration dependent manner through stimulation of the agr quorum sensing system, with the capacity to circumvent other inhibitory signals in the environment . Taken together, our work 30 defines a previously uncharacterized inter-kingdom signal between the skin and the opportunistic pathogen S. aureus and identifies the mechanism of sex -dependent differences in S. aureus skin infection. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 2 35 One-Sentence Summary: Testosterone promotes S. aureus pathogenesis through activation of the agr quorum sensing system. Main Text: 40

The community of commensal organisms residing in mammalian skin thrive in the desiccate, acidic, and lipid-rich landscape (1). Staphylococcal species such as S. epidermidis and S. hominis are established resident microbes of human skin (2, 3) . In contrast, t he related 45 opportunistic pathogen S. aureus is restricted to the nares of only a third of humans, with skin colonization and infection occurring as a rare event (4). Indeed, the numerous virulence factors encoded by S. aureus that allow it to bind, invade, and damage epithelial cells and cause infection are dampened by coordinated regulatory networks that tune their expression depending on sensed environmental conditions (5). 50 The most well-described system of virulence regulation in S. aureus is the accessory gene regulator (agr) quorum-sensing system (5, 6) that controls the expression of toxins and adhesins required for skin colonization. S. aureus strains can auto -activate agr signaling through the production of an autoinducing peptide (AIP) signal. They have also evolved the ability to respond to quorum signals generated by other bacteria, including the variant AIP signals from non-cognate 55 strains of S. aureus (5). Though similar in structure , many non-cognate AIPs inhibit quorum sensing i n S. aureus (5). Agr quorum sensing can also be inhibited by multiple host derived mechanisms (7–9). It remains unclear what host cues promote S. aureus pathogenesis and allow it to begin to effectively colonize the skin during flares of inflammatory skin conditions, such as atopic 60 dermatitis, or why males are more susceptible to skin and soft tissue infections with S. aureus than females (10–15). One established difference between males and females is the amount of androgens generated by the skin and by sex organs (16, 17). It was recently reported that IL-4 mediated inflammation in atopic dermatitis regulates androgen production in the skin, providing a potential link between the sexual dimorphism of S. aureus infections and the blooms of S. aureus 65 colonization during IL-4 mediated skin conditions (18, 19). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 3 Here, we demonstrate that mice that secrete lower levels of testosterone and dihydrotestosterone (DHT) are resistant to S. aureus skin infection. Further, testosterone and DHT specifically activate the agr quorum sensing system, independently of the bacterially derived agonist AIP-I. Testosterone can overcome inhibitory signals from other bacterial strains in a dose 70 dependent manner, indicating that testosterone may be a host-derived cue that directly antagonizes inhibitory signals from other competing bacteria at the skin surface. Our findings are further supported by protein folding models that demonstrate a testosterone binding pocket at a separate site from AIP -I on the agr receptor, AgrC. Taken together, our work defines a previously uncharacterized interaction between the skin and the opportunistic pathogen, S. aureus, and defines 75 a molecular inter-kingdom signal between the skin and the microbiota.

Androgen secretion at the skin surface is required for S. aureus skin infection. 80 Higher androgen secretion is associated with S. aureus colonization and infection (4, 13, 20). S. aureus colonization is significantly more common in men versus women (10–13) and S. aureus induces greater necrosis in male murine skin infections compared to female mice (13). To confirm these findings in a model of methicillin resistant S. aureus (MRSA) skin infection, we epicutaneously infected male and female age-matched C57BL6 mice with a bioluminescent strain 85 of MRSA (MRSA::lux), which generates light in proportion to the number of colony forming units present at the skin surface (21). Consistent with prior findings, we observed a two log fold difference in MRSA infection in male mice compared to female mice (Fig. 1A and fig. S1) (13). In keeping with our prior study in humans (17) , male mice also secrete greater amounts of androgens at the skin surface compared to female mice (Fig. 1B, C). Taken together, these findings 90 demonstrate the association between high er androgen secretion and increased bacterial burdens during S. aureus skin infection. In addition to the increased burden of S. aureus in male patients, people with the inflammatory skin condition atopic dermatitis are ubiquitously colonized by S. aureus (22–25), with little understanding as to why S. aureus begins to dominate the skin surface in this setting 95 (22–25). Interestingly, the immune system in atopic dermatitis can directly regulate androgen production through stimulation of a rate limiting enzyme in the synthesis of steroid hormones, 3β- hydroxysteroid dehydrogenase 1 (HSD3B1) (18, 26, 27) (Fig. 1D). Thus, immune regulation of (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 4 HSD3B1 in atopic dermatitis provides a second link between high androgen state s and S. aureus colonization (18). To further dissect the link between androgens and S. aureus in vivo we created 100 mice lacking androgen production at the skin surface, through skin specific deletion of the mouse ortholog to HSD3B1, Hsd3b6 (18). We used CRISPR/Cas-9 mediated gene targeting to insert loxP sites around the first exon of the Hsd3b6 locus creating the Hsd3b6fl/fl mice (fig. S2A). We then crossed these mice to a skin specific Cre driver (K14-Cre+/-) to generate the Hsd3b6∆skin (K14Cre+- /; Hsd3b6fl/fl) mice and verified the loss of HSD3B6 expression by immunofluorescence (fig. S2B). 105 Hsd3b6∆skin mice displayed no visible phenotypes when reared in a specified-pathogen-free (SPF) facility and displayed no signs of skin inflammation (fig. S2C). However, Hsd3b6∆skin mice had marked reductions in the amount of testosterone, progesterone, and DHT secreted at the skin surface compared to Hsd3b6 fl/fl mice (Fig. 1B-C, fig. S3A, B). Hsd3b6∆skin mice did not display differences in serum production of hormones, weights, immune cell populations, or skin barrier 110 function (fig. S3C-F). Next, we assessed the susceptibility of Hsd3b6 ∆skin mice to skin infection. Epicutaneous infection of the Hsd3b6∆skin mice with MRSA::lux resulted in a marked reduction of MRSA skin infection compared to the Hsd3b6fl/fl control mice infected with the same inoculum (Fig. 1E-F, fig. S4A). Additionally, infection of female Hsd3b6∆skin mice with MRSA::lux was augmented by the 115 topical addition of testosterone at the skin surface (Fig. 1G-H , fig. S4B). Thus, the reduction of testosterone, DHT, and progesterone at the skin surface protected the skin from skin infection and treatment with exogenous testosterone promoted S. aureus infection of the skin. Reduction of skin secreted hormones also abrogated sex-dependent differences in infection (Fig. 1E-H). Testosterone and DHT activate agr quorum sensing and promote S. aureus pathogenesis. 120 To determine how hormones might regulate the S. aureus transcriptome, we next sequenced RNA from S. aureus treated with testosterone compared to controls. Interestingly, testosterone had a very narrow impact on the S. aureus regulon, with marked increases in the expression of a few genes, agrB , agrD, agrC, agr A, psmα, psmβ, and RNAIII (Fig. 2A), all of which are in the accessory gene regulator (agr) quorum-sensing pathway (5, 6, 28, 29) (Fig. 2B). 125 In contrast, pregnenolone, a hormone with a similar structure and carbon count to testosterone, had no discernable impact on the S. aureus transcriptome (fig. S5A, B). Agr activation occurs through transcriptional regulation of the P3 promoter (Fig. 2B) (5). We therefore tested the impact of androgens on luminescent P3 promoter fusions of S. aureus (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 5 (HG003 agrP3::lux) that generate bioluminescence in proportion to the activation of quorum 130 sensing (30). In this model, testosterone and DHT activated the agr P3 promoter, with similar kinetics to the established ligand AIP -I (Fig. 2C). In contrast, estradiol and progesterone had no impact on agr activation (fig. S5C-F). To confirm these findings, we quantified the transcription of key readouts of agr activity, psmα and RNAIII, in the HG003 strain of S. aureus and demonstrated that testosterone stimulates the expression of both transcripts (Fig. 2D) . Thus, 135 testosterone and DHT activate the transcription of the agr regulon in S. aureus , but estradiol, pregnenolone, and progesterone do not. Every staphylococcal isolate contains only a single copy of the agr system, and each species produces different types of autoinducing AIP signal through variation in the agrBDCA operon (5). There are four types of AIP signal made by S. aureus and HG003 falls into the agr 140 Type I class. To test the generality of t he effects of testosterone across agr types , we treated additional strains with testosterone and measured psmα and RNAIII expression, including USA100 (Type II) and MW2 (Type III) (31–34). All strains showed robust expression of psmα and RNAIII (Fig. 2E, F). T estosterone also activated the P3 promoter in Type II and Type III luminescent strains ( fig. S5G, H ). Further, t estosterone stimulated the transcription of the agr regulated 145 virulence factors lukS-PV, hla, hld, the cytoplasmic regulator agrA (fig. S6A-D) and increased red blood cell hemolysis and neutrophil killing capacity of S. aureus (Fig. 2G). These effects were comparable to those of the established agr ligand AIP-I (Fig. 2C-G, fig. 6A-D). Greater than 90% of strains are Type I-III (35, 36), suggesting that testosterone stimulates virulence across S. aureus strains with active agr systems. Given the strong association between S. aureus and atopic 150 dermatitis (37), we also tested an array of strains obtained from diseased skin (25). Testosterone treatment increased the transcription of psmα, RNAIII, and agrA in strains obtained from atopic dermatitis skin (fig. S6E-G). Consistent with our prior in vivo data (Fig. 1E), quorum sensing was quenched in Hsd3b6∆skin mice infected with the quorum sensing reporter strain in comparison to Hsd3b6 fl/fl 155 mice (Fig. 2H, I. fig. S7A, B). Agr activation was also greater in male mice compared to female mice (fig. S7 C). Taken together, these data show that the androgens testosterone and DHT stimulate the agr quorum sensing system and promote S. aureus infection in vivo. Androgens stimulate agr independently of the auto-inducing peptides. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 6 AIP, the established endogenous ligand of agr, is synthesized by the coordinated action of 160 integral membrane endopeptidases AgrB and MroQ on the ribosomally generated propetide AgrD (Fig. 2B) (28, 29, 38). Thus, the biosynthesis mutant strain of S. aureus, ∆agrBD, lacks the ability to auto-stimulate the agr quorum sensing system (9). We hypothesized that testosterone would require AIP-I to activate agr. However, in the biosynthesis mutant, testosterone retained the ability to activate agr associated phenotypes, including stimulation of P3 promoter transcripts, increased 165 hemolysis and neutrophil killing (Fig. 3A -C). These effects were dose dependent, with greater concentrations of testosterone increasing transcription of RNAIII, agrA, agrC , and psmα (fig. S8A). Additionally, we generated a biosynthesis mutant luminescent reporter ( ∆agrBD::lux) and confirm that progesterone and estradiol ha d no effect on S. aureus. DHT and testosterone both retained the capacity to stimulate bioluminescence (fig. S8B). Since AIP and testosterone could 170 act independently, we next wanted to test the impact of both AIP -I and testosterone on agr signaling. Indeed treatment of S. aureus with testosterone had the capacity to augment AIP -I signaling in a dose-dependent manner ( Fig. 3D, fig. S8C), establishing that testosterone may synergize with AIP signals to regulate S. aureus pathogenesis. Though cognate AIPs stimulate agr, non-cognate AIPs generated from other agr Types of 175 S. aureus can inhibit agr signaling and are in development as S. aureus therapeutics (5, 39) (fig. S8D). Therefore, we tested how the stimulatory testosterone signal derived from the host might compete with inhibitory signals derived from competing S. aureus species that generate non - cognate AIPs, including AIP -II and AIP -III. Interestingly, when we exposed a Type-I strain to equal low nanomolar concentrations of AIP -II and testosterone, quorum sensing was inhibi ted, 180 demonstrating that testosterone was unable to overcome inhibitory signals at the same concentration (Fig. 3E, fig. S9A). However, at higher concentrations, testosterone stimulated agr signaling and overcame the inhibitory AIP-II signal (Fig. 3E, fig. S9A). Similar dynamics were observed with AIP-III (Fig. 3F, fig. S9B). Taken together, these findings suggest that the host derived signal, testosterone, participates in the established crosstalk between competing microbes 185 at the skin surface, and when present at levels higher than the inhibitor can overcome inhibitory signals generated towards S. aureus. Lastly, we tested the effect of testosterone on the AIP biosynthesis mutant (∆agrBD::lux) in vivo. Following epicutaneous infection, the biosynthesis mutant displayed a blunted infectious phenotype in the Hsd3b6 ∆skin mice compared to Hsd3b6 fl/fl control (Fig. 3G, H ). As was true in 190 vitro, treatment with AIP-I or testosterone was able to boost S. aureus infection in vivo (Fig. 3G, (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 7 H). These findings confirm that skin derived androgens facilitate epicutaneous infection in S. aureus. Moreover, both exogenous AIP and testosterone are sufficient to increase infection at the skin surface through enhanced expression of quorum sensing regulated virulence factors. The AgrC histidine kinase is required for testosterone mediated stimulation of agr. 195 AIP stimulates the agr system through activation of the AgrC histidine kinase(5, 40). Once activated, AgrC phosphorylates the response regulator AgrA, which in turn autoinduces transcription of the Agr machinery (5, 41) (Fig. 2B). Given the specific impact of testosterone on the agr quorum sensing system (Fig. 2A) and its ability to cooperate and compete with established ligands of AgrC (Fig. 3)(40), we next tested if testosterone would require a complete AgrCA two-200 component system to regulate S. aureus virulence. We generated a constitutive bioluminescent reporter deficient in A grC ( ∆agrC::lux)(9). In contrast to the ∆agrBD::lux, ∆agrC::lux did not respond to testosterone (Figure 4A). Indeed, the inducing activity of testosterone on S. aureus required both AgrC and AgrA (Fig. 4B-D, fig. S10 A-C) and skin infections with the AgrC mutant had a muted infectious course (Fig. 4E,F, fig. S10D, E). Additionally, both in vitro and in vivo the 205 addition of exogenous testosterone or AIP -I was not able to rescue agr activation in the agrCA deficient strains (Fig. 4B-D, fig. S10 A-C, F, G). Moreover, there were limited sex-differences in infections with ∆agrC (Fig. 4E, fig. S10E). To gain further insight on interactions between AgrC and testosterone, we predicted the structure of the AgrC type I dimer using Alphafold2 (42, 43), and docked testosterone and AIP-I 210 in silico on the AgrC sensory domain (44 –46) (Fig. 4G, fig. S10H). Testosterone is predicted to bind to a hydrophobic cleft distinct from the established A IP binding stie. An allosteric binding site for testosterone is consistent with our studies demonstrating cooperative interactions between AIP-I and testosterone in Type-I strains (Fig. 3D-F). Taken together with our prior findings, these

demonstrate that testosterone enhances S. aureus pathogenesis and requires both the skin 215 secretion of androgens and a functioning AgrCA two-component system. The enantiomer of testosterone inhibits S. aureus pathogenesis. As a final step to understanding the specificity of the interaction of testosterone with the agr system we tested the impact of a stereoisomer of testosterone, enantiomer -testosterone ( ent-T), on S. aureus pathogenesis. Like other unnatural enantiomers, ent -T has the same physiochemical 220 properties as testosterone but with a mirror image orientation at all six chiral centers that leads to altered rotation of polarized light (Fig. 5A) (47, 48). Enantiomers have been observed to have (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 8 unique receptor binding and signaling properties (48, 49). Unlike the other hormone s we tested which displayed neutral effects on the agr system (fig. S5C-F), ent-T acted as a broad inhibitor of the agr quorum sensing system (Fig. 5B-H , fig. S11) . Ent-T was able to decrease S. aureus 225 dependent hemolysis and neutrophil killing in Type-1 agr strains (Fig. 5B, C). Further, ent-T had the capacity to decrease the expression of agr transcriptional readouts in Type -II, Type-III, and atopic dermatitis strains of S. aureus (Fig. 5D-F, fig. S11A). Moreover, topical application of ent- T to the skin of S. aureus infected mice turns off quorum sensing in vivo (Fig. 5G, H; fig. S11B). Thus, ent-T is a global inhibitor of S. aureus quorum sensing that works across agr types, similar 230 to established bacterially derived regulators of agr, such as non-cognate AIPs (Fig. 5B, C) (6).

Here we have identified that S. aureus pathogenesis is regulated at the skin surface by the secreted androgens, testosterone and DHT . Testosterone regulates S. aureus pathogenesis specifically through stimulation of the agr quorum sensing system and can signal this system 235 independently of the well characterized bacterially produced AIP. Further, in the absence of host testosterone, S. aureus infection is markedly diminished at the skin surface and sex-dependent differences in infection are markedly reduced. Testosterone signaling of agr requires the presence of the AgrC histidine kinase and its response regulator AgrA and predictive modeling suggests that testosterone might bind directly to the transmembrane protein, AgrC. Other hormones such as 240 progesterone, estradiol, and pregnenolone, had no impact on quorum sensing in S. aureus. A unique feature of both testosterone and DHT are the carbonyl and hydroxyl groups that extended beyond the steroid rings. The hormones that are unable to stimulate agr lack both moieties, potentially explaining the ability of testosterone and DHT to activate agr signaling and the inability of the other classes of hormones to mediate this pathway. 245 In contrast to progesterone and estradiol that had a neutral effect on S. aureus, ent-T, the stereoisomer of testosterone, decreased quorum sensing and decreased bacterially induced hemolysis and neutrophil killing. ent-T also inhibited quorum sensing during S. aureus infections in vivo. Our findings demonstrate that S. aureus responds to testosterone in an enantioselective manner, with testosterone generating activating signals and its chiral counterpart, ent-T leading to 250 inhibition of the same phenotypes. Since natural hormones and their enantiomers have been shown to have the same physiochemical properties within membranes (47), the distinct phenotypes of (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 9 testosterone and ent-T suggest that the effects of these hormones on agr signaling are independent of any predicted impacts of androgen hormones on bacterial membranes. The skin is known to generate antimicrobial proteins, antimicrobial lipids and nitric oxide 255 that inhibit S. aureus pathogenesis (1, 8, 9, 50–52) . Our work uniquely describes how the skin potentiates the infectious phenotypes of a pathogen at the skin surface through the secretion of testosterone. Indeed, though the biosynthetic mutant had reduced hemolysis and neutrophil killing in in vitro assays (Fig. 3B), it retained the ability to sustain in vivo skin infections in mice with normal hormone production (Fig. 3G, H ). Thus, the host derived hormone signal is sufficient to 260 activate S. aureus in vivo. Our work adds to other examples of host hormones and cholesterol - derived molecules that supply activating interkingdom signals to microorganisms with which they have co-evolved (53–57). These data provide a novel dissection of host molecules curating the virulence phenotypes of an opportunistic pathogen at the skin surface. Given their capacity to cue the microbiota, our findings define the need for greater 265 characterization of skin-secreted small molecules and to understand their regulation. Recently, we quantified hormone secretion at the skin surface and illuminated large topographic differences in androgen secretion in young adult humans without skin disease (17). We have also identified that IL-4 receptor signaling can regulate androgen production (18). More work is needed to determine how androgens may shift in skin conditions mediated by allergic inflammation , such as atopic 270 dermatitis, and to quantify hormonal shifts at the skin surface throughout the human life cycle. Herein we also show that testosterone regulates S. aureus in a dose-dependent manner and that it can limit the ability of other quorum sensing inhibitors to negatively regulate S. aureus. Thus, S. aureus phenotypes are an aggregate of environmental signals generated from the host and signals generated by the microbiota (58) . P robiotic approaches that aim to control S. aureus 275 virulence through inhibition of the quorum sensing system must take into account the concentration dependent stimulation of agr by host derived testosterone and DHT (39, 59) . Our findings suggest that t hese therapeutics may be augmented by regulation of host androgen production or exposure to ent-T. 280 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 10

and Notes 1. T. A. Harris-Tryon, E. A. Grice, Microbiota and maintenance of skin barrier function. Science 285 376, 940–945 (2022). 2. M. M. Severn, M. R. Williams, A. Shahbandi, Z. L. Bunch, L. M. Lyon, A. Nguyen, L. S. Zaramela, D. A. Todd, K. Zengler, N. B. Cech, R. L. Gallo, A. R. Horswill, The Ubiquitous Human Skin Commensal Staphylococcus hominis Protects against Opportunistic Pathogens. MBio 13 (2022), doi:10.1128/MBIO.00930-22/SUPPL_FILE/MBIO.00930-22-S0010.DOCX. 290 3. Y. E. Chen, M. A. Fischbach, Y. Belkaid, Skin microbiota-host interactions. Nat. Publ. Gr. (2018), doi:10.1038/nature25177. 4. J. Smit, L. E. López-Cortés, A. J. Kaasch, M. Søgaard, R. W. Thomsen, H. C. Schønheyder, J. Rodríguez-Baño, H. Nielsen, Gender differences in the outcome of community-acquired Staphylococcus aureus bacteraemia: a historical population-based cohort study. Clin. Microbiol. 295 Infect. 23, 27–32 (2017). 5. C. Jenul, A. R. Horswill, Regulation of Staphylococcus aureus virulence. Microbiol. Spectr. 6 (2018), doi:10.1128/MICROBIOLSPEC.GPP3-0031-2018. 6. M. Thoendel, J. S. Kavanaugh, C. E. Flack, A. R. Horswill, Peptide signaling in the staphylococci. Chem. Rev. 111, 117–151 (2011). 300 7. P. R. Hall, B. O. Elmore, C. H. Spang, S. M. Alexander, B. C. Manifold-Wheeler, M. J. Castleman, S. M. Daly, M. M. Peterson, E. K. Sully, J. K. Femling, M. Otto, A. R. Horswill, G. S. Timmins, H. D. Gresham, Nox2 Modification of LDL Is Essential for Optimal Apolipoprotein B-mediated Control of agr Type III Staphylococcus aureus Quorum-sensing. PLoS Pathog. 9 (2013), doi:10.1371/JOURNAL.PPAT.1003166. 305 8. J. M. Rothfork, G. S. Timmins, M. N. Harris, X. Chen, A. J. Lusis, M. Otto, A. L. Cheung, H. D. Gresham, Inactivation of a bacterial virulence pheromone by phagocyte-derived oxidants: New role for the NADPH oxidase in host defense. Proc. Natl. Acad. Sci. U. S. A. 101, 13867– 13872 (2004). 9. R. Urbano, J. E. Karlinsey, S. J. Libby, P. T. Doulias, H. Ischiropoulos, H. I. Warheit-Niemi, 310 D. H. Liggitt, A. R. Horswill, F. C. Fang, Host Nitric Oxide Disrupts Microbial Cell-to-Cell Communication to Inhibit Staphylococcal Virulence. Cell Host Microbe 23, 594 (2018). 10. M. Pomorska-Wesołowska, A. Różańska, J. Natkaniec, B. Gryglewska, A. Szczypta, M. Dzikowska, A. Chmielarczyk, J. Wójkowska-Mach, Longevity and gender as the risk factors of methicillin-resistant Staphylococcus aureus infections in southern Poland. , doi:10.1186/s12877-315 017-0442-3. 11. D. B. Stensen, L. Småbrekke, K. Olsen, G. Grimnes, C. S. Nielsen, J. U. E. Sollid, G. S. Simonsen, B. Almås, A. S. Furberg, Circulating sex-steroids and Staphylococcus aureus nasal carriage in a general female population. Eur. J. Endocrinol. 184, 337 (2021). 12. E. Ricardo Vázquez-Martínez, E. García-Gómez, I. Camacho-Arroyo, B. González-Pedrajo, 320 Sexual dimorphism in bacterial infections. , doi:10.1186/s13293-018-0187-5. 13. M. J. Castleman, S. Pokhrel, K. D. Triplett, D. F. Kusewitt, B. O. Elmore, J. A. Joyner, J. K. Femling, G. Sharma, H. J. Hathaway, E. R. Prossnitz, P. R. Hall, Innate Sex Bias of (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 11 Staphylococcus aureus Skin Infection Is Driven by α-Hemolysin . J. Immunol. 200, 657–668 (2018). 325 14. K. Olsen, B. M. Falch, K. Danielsen, M. Johannessen, J. U. Ericson Sollid, I. Thune, G. Grimnes, R. Jorde, G. S. Simonsen, A. S. Furberg, Staphylococcus aureus nasal carriage is associated with serum 25-hydroxyvitamin D levels, gender and smoking status. The Tromsø Staph and Skin Study. Eur. J. Clin. Microbiol. Infect. Dis. 31, 465–473 (2012). 15. A. S. Paller, H. H. Kong, P. Seed, S. Naik, T. C. Scharschmidt, R. L. Gallo, T. Luger, A. D. 330 Irvine, The microbiome in patients with atopic dermatitis. J. Allergy Clin. Immunol. 143, 26–35 (2019). 16. S. R. Hammes, E. R. Levin, Impact of estrogens in males and androgens in females. J. Clin. Invest. 129, 1818–1826 (2019). 17. J. Pineider, K. M. Eckert, J. G. McDonald, T. Harris-Tryon, Cutaneous Hormone Production 335 Is Distinct between Anatomical Sites and between Males and Females. J. Invest. Dermatol. 143, 596–601 (2023). 18. C. Zhang, M. Chinnappan, C. A. Prestwood, M. Edwards, M. Artami, B. M. Thompson, K. M. Eckert, G. Vale, C. C. Zouboulis, J. G. McDonald, T. A. Harris-Tryon, Interleukins 4 and 13 drive lipid abnormalities in skin cells through regulation of sex steroid hormone synthesis. Proc. 340 Natl. Acad. Sci. 118, 2021 (2021). 19. J. Simard, M. L. Ricketts, S. Gingras, P. Soucy, F. A. Feltus, M. H. Melner, Molecular Biology of the 3β-Hydroxysteroid Dehydrogenase/Δ5-Δ4 Isomerase Gene Family. Endocr. Rev. 26, 525–582 (2005). 20. D. B. Stensen, L. Småbrekke, K. Olsen, G. Grimnes, C. S. Nielsen, J. U. Ericson, G. S. 345 Simonsen, B. Almås, A. S. Furberg, Circulating sex-steroids and Staphylococcus aureus nasal carriage in a general male population. Epidemiol. Infect. 150, e93 (2022). 21. H. Liu, N. K. Archer, C. A. Dillen, Y. Wang, A. G. Ashbaugh, R. V. Ortines, T. Kao, S. K. Lee, S. S. Cai, R. J. Miller, M. C. Marchitto, E. Zhang, D. P. Riggins, R. D. Plaut, S. Stibitz, R. S. Geha, L. S. Miller, Staphylococcus aureus Epicutaneous Exposure Drives Skin Inflammation 350 via IL-36-Mediated T Cell Responses. Cell Host Microbe 22, 653-666.e5 (2017). 22. S. Benenson, O. Zimhony, D. Dahan, M. Solomon, D. Raveh, Y. Schlesinger, A. M. Yinnon, Atopic dermatitis - A risk factor for invasive Staphylococcus aureus infections: Two cases and review [2]. Am. J. Med. 118, 1048–1051 (2005). 23. K. Breuer, S. Häussler, A. Kapp, T. Werfel, Staphylococcus aureus: colonizing features and 355 influence of an antibacterial treatment in adults with atopic dermatitis. Br. J. Dermatol. 147, 55– 61 (2002). 24. L. Suh, S. Coffin, K. H. Leckerman, J. M. Gelfand, P. J. Honig, A. C. Yan, Methicillin- resistant Staphylococcus aureus colonization in children with atopic dermatitis. Pediatr. Dermatol. 25, 528–534 (2008). 360 25. A. L. Byrd, C. Deming, S. K. B. Cassidy, O. J. Harrison, W. I. Ng, S. Conlan, Y. Belkaid, J. A. Segre, H. H. Kong, Staphylococcus aureus and S. epidermidis strain diversity underlying human atopic dermatitis. Sci. Transl. Med. 9 (2017), doi:10.1126/SCITRANSLMED.AAL4651. 26. G. Wu, S. Huang, K. L. Nastiuk, J. Li, J. Gu, M. Wu, Q. Zhang, H. Lin, D. Wu, Variant allele of HSD3B1 increases progression to castration-resistant prostate cancer. Prostate (2015), 365 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 12 doi:10.1002/pros.22967. 27. J. Simard, M. L. Ricketts, S. Gingras, P. Soucy, F. A. Feltus, M. H. Melner, Molecular biology of the 3β-hydroxysteroid dehydrogenase/ Δ5-Δ4 isomerase gene familyEndocr. Rev. 26, 525–582 (2005). 28. M. R. Stock, L. Fang, K. R. Johnson, C. Cosgriff, W. P. Teoh, F. Alonzo, Characterization of 370 MroQ-Dependent Maturation and Export of the Staphylococcus aureus Accessory Gene Regulatory System Autoinducing Peptide. Infect. Immun. 90 (2022), doi:10.1128/IAI.00263-22. 29. S. Marroquin, B. Gimza, B. Tomlinson, M. Stein, A. Frey, R. A. Keogh, R. Zapf, D. A. Todd, N. B. Cech, R. K. Carroll, L. N. Shaw, MroQ is a novel Abi-domain protein that influences virulence gene expression in Staphylococcus aureus via modulation of agr activity. 375 Infect. Immun. 87 (2019), doi:10.1128/IAI.00002-19/SUPPL_FILE/IAI.00002-19-S0001.PDF. 30. C. P. Parlet, J. S. Kavanaugh, H. A. Crosby, H. A. Raja, T. El-Elimat, D. A. Todd, C. J. Pearce, N. B. Cech, N. H. Oberlies, A. R. Horswill, Apicidin Attenuates MRSA Virulence through Quorum-Sensing Inhibition and Enhanced Host Defense. Cell Rep. 27, 187-198.e6 (2019). 380 31. C. L. Malone, B. R. Boles, A. R. Horswill, Biosynthesis of Staphylococcus aureus Autoinducing Peptides by Using the Synechocystis DnaB Mini-Intein. Appl. Environ. Microbiol. 73, 6036 (2007). 32. M. Carrel, E. N. Perencevich, M. Z. David, USA300 Methicillin-Resistant Staphylococcus aureus, United States, 2000–2013. Emerg. Infect. Dis. 21, 1973 (2015). 385 33. D. S. Lima-Junior, S. R. Krishnamurthy, N. Bouladoux, N. Collins, S. J. Han, E. Y. Chen, M. G. Constantinides, V. M. Link, A. I. Lim, M. Enamorado, C. Cataisson, L. Gil, I. Rao, T. K. Farley, G. Koroleva, J. Attig, S. H. Yuspa, M. A. Fischbach, G. Kassiotis, Y. Belkaid, Endogenous retroviruses promote homeostatic and inflammatory responses to the microbiota. Cell 184, 3794 (2021). 390 34. P. AS, K. HH, S. P, N. S, S. TC, G. RL, L. T, I. AD, The microbiome in patients with atopic dermatitis. J. Allergy Clin. Immunol. 143, 26–35 (2019). 35. S. Abbasian, N. N. Farahani, Z. Mir, F. Alinejad, M. Haeili, M. Dahmardehei, M. Mirzaii, S. S. Khoramrooz, M. J. Nasiri, D. Darban-Sarokhalil, Genotypic characterization of Staphylococcus aureus isolated from a burn centre by using agr, spa and SCC mec typing 395 methods. New microbes new Infect. 26, 15–19 (2018). 36. S. N. Peerayeh, A. Azimian, Q. B. Nejad, M. Kashi, Prevalence of agr Specificity Groups Among Staphylococcus aureus Isolates From University Hospitals in Tehran. Lab. Med. 40, 27– 29 (2009). 37. H. H. Kong, J. Oh, C. Deming, S. Conlan, E. A. Grice, M. A. Beatson, E. Nomicos, E. C. 400 Polley, H. D. Komarow, J. Mullikin, J. Thomas, R. Blakesley, A. Young, G. Chu, C. Ramsahoye, S. Lovett, J. Han, R. Legaspi, C. Sison, C. Montemayor, M. Gregory, A. Hargrove, T. Johnson, N. Riebow, B. Schmidt, B. Novotny, J. Gupta, B. Benjamin, S. Brooks, H. Coleman, S. L. Ho, K. Schandler, M. Stantripop, Q. Maduro, G. Bouffard, M. Dekhtyar, X. Guan, C. Masiello, B. Maskeri, J. McDowell, M. Park, M. Vemulapalli, P. R. Murray, M. L. Turner, J. A. 405 Segre, Temporal shifts in the skin microbiome associated with disease flares and treatment in children with atopic dermatitis. Genome Res. 22, 850–859 (2012). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 13 38. A. Zhao, S. P. Bodine, Q. Xie, B. Wang, G. Ram, R. P. Novick, T. W. Muir, Reconstitution of the S. aureus agr quorum sensing pathway reveals a direct role for the integral membrane protease MroQ in pheromone biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 119, e2202661119 410 (2022). 39. T. Nakatsuji, T. R. Hata, Y. Tong, J. Y. Cheng, F. Shafiq, A. M. Butcher, S. S. Salem, S. L. Brinton, A. K. Rudman Spergel, K. Johnson, B. Jepson, A. Calatroni, G. David, M. Ramirez- Gama, P. Taylor, D. Y. M. Leung, R. L. Gallo, Development of a human skin commensal microbe for bacteriotherapy of atopic dermatitis and use in a phase 1 randomized clinical trial. 415 Nat. Med. 27, 700–709 (2021). 40. B. Wang, A. Zhao, R. P. Novick, T. W. Muir, Activation and inhibition of the receptor histidine kinase AgrC occurs through opposite helical transduction motions. Mol. Cell 53, 929– 940 (2014). 41. S. T. Rutherford, B. L. Bassler, Bacterial Quorum Sensing: Its Role in Virulence and 420 Possibilities for Its Control. Cold Spring Harb. Perspect. Med. 2 (2012), doi:10.1101/CSHPERSPECT.A012427. 42. J. Jumper, R. Evans, A. Pritzel, T. Green, M. Figurnov, O. Ronneberger, K. Tunyasuvunakool, R. Bates, A. Žídek, A. Potapenko, A. Bridgland, C. Meyer, S. A. A. Kohl, A. J. Ballard, A. Cowie, B. Romera-Paredes, S. Nikolov, R. Jain, J. Adler, T. Back, S. Petersen, D. 425 Reiman, E. Clancy, M. Zielinski, M. Steinegger, M. Pacholska, T. Berghammer, S. Bodenstein, D. Silver, O. Vinyals, A. W. Senior, K. Kavukcuoglu, P. Kohli, D. Hassabis, Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021). 43. M. Mirdita, K. Schütze, Y. Moriwaki, L. Heo, S. Ovchinnikov, M. Steinegger, ColabFold: making protein folding accessible to all. Nat. Methods 19, 679–682 (2022). 430 44. A. Grosdidier, V. Zoete, O. Michielin, Fast docking using the CHARMM force field with EADock DSS. J. Comput. Chem. 32, 2149–2159 (2011). 45. T. Sterling, J. J. Irwin, ZINC 15--Ligand Discovery for Everyone. J. Chem. Inf. Model. 55, 2324–2337 (2015). 46. Y. Tal-Gan, M. Ivancic, G. Cornilescu, C. C. Cornilescu, H. E. Blackwell, Structural 435 characterization of native autoinducing peptides and abiotic analogues reveals key features essential for activation and inhibition of an AgrC quorum sensing receptor in Staphylococcus aureus. J. Am. Chem. Soc. 135, 18436–18444 (2013). 47. D. F. Covey, A. S. Evers, Y. Izumi, J. L. Maguire, S. J. Mennerick, C. F. Zorumski, Neurosteroid enantiomers as potentially novel neurotherapeutics. Neurosci. Biobehav. Rev. 149, 440 105191 (2023). 48. D. F. Covey, ent-Steroids: Novel Tools for Studies of Signaling Pathways. Steroids 74, 577 (2009). 49. J. Crowley, M. Withana, E. Deplazes, The interaction of steroids with phospholipid bilayers and membranes. Biophys. Rev. 14, 163 (2022). 445 50. C. Zhang, Z. Hu, A. G. Lone, M. Artami, M. Edwards, C. C. Zouboulis, M. Stein, T. A. Harris-Tryon, Small proline-rich proteins (SPRRs) are epidermally produced antimicrobial proteins that defend the cutaneous barrier by direct bacterial membrane disruption. Elife 11 (2022), doi:10.7554/ELIFE.76729. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 14 51. H. J. Pyle, M. Artami, M. Edwards, P. Raj, B. Zhang, C. Arana, T. A. Harris-Tryon, 450 Saprophytic bacteria and fungi colonize stearoyl coenzyme-A desaturase-1 knockout skin. Exp. Dermatol. 32, 78–84 (2023). 52. P. R. Hall, B. O. Elmore, C. H. Spang, S. M. Alexander, B. C. Manifold-Wheeler, M. J. Castleman, S. M. Daly, M. M. Peterson, E. K. Sully, J. K. Femling, M. Otto, A. R. Horswill, G. S. Timmins, H. D. Gresham, Nox2 modification of LDL is essential for optimal apolipoprotein 455 B-mediated control of agr type III Staphylococcus aureus quorum-sensing. PLoS Pathog. 9 (2013), doi:10.1371/JOURNAL.PPAT.1003166. 53. A. R. Pacheco, V. Sperandio, Inter-kingdom signaling: chemical language between bacteria and hostCurr. Opin. Microbiol. 12, 192–198 (2009). 54. E. García-Gómez, B. González-Pedrajo, I. Camacho-Arroyo, Role of sex steroid hormones in 460 bacterial-host interactionsBiomed Res. Int. 2013 (2013), doi:10.1155/2013/928290. 55. M. B. Clarke, D. T. Hughes, C. Zhu, E. C. Boedeker, V. Sperandio, The QseC sensor kinase: a bacterial adrenergic receptor. Proc. Natl. Acad. Sci. U. S. A. 103, 10420–10425 (2006). 56. C. G. Moreira, V. Sperandio, The Epinephrine/Norepinephrine/Autoinducer-3 Interkingdom Signaling System in Escherichia coli O157:H7. Adv. Exp. Med. Biol. 874, 247–261 (2016). 465 57. A. J. Zou, L. Kinch, S. Chimalapati, N. Garcia, D. R. Tomchick, K. Orth, Molecular determinants for differential activation of the bile acid receptor from the pathogen Vibrio parahaemolyticus. J. Biol. Chem. 299, 104591 (2023). 58. M. R. Williams, S. K. Costa, L. S. Zaramela, S. Khalil, D. A. Todd, H. L. Winter, J. A. Sanford, A. M. O’Neill, M. C. Liggins, T. Nakatsuji, N. B. Cech, A. L. Cheung, K. Zengler, A. 470 R. Horswill, R. L. Gallo, Quorum sensing between bacterial species on the skin protects against epidermal injury in atopic dermatitis. Sci. Transl. Med. 11 (2019), doi:10.1126/SCITRANSLMED.AAT8329. 59. T. Nakatsuji, T. H. Chen, S. Narala, K. A. Chun, A. M. Two, T. Yun, F. Shafiq, P. F. Kotol, A. Bouslimani, A. V. Melnik, H. Latif, J. N. Kim, A. Lockhart, K. Artis, G. David, P. Taylor, J. 475 Streib, P. C. Dorrestein, A. Grier, S. R. Gill, K. Zengler, T. R. Hata, D. Y. M. Leung, R. L. Gallo, Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis. Sci. Transl. Med. 9 (2017), doi:10.1126/scitranslmed.aah4680. 60. H. Sampath, M. T. Flowers, X. Liu, C. M. Paton, R. Sullivan, K. Chu, M. Zhao, J. M. 480 Ntambi, Skin-specific deletion of stearoyl-CoA desaturase-1 alters skin lipid composition and protects mice from high fat diet-induced obesity. J. Biol. Chem. 284, 19961–19973 (2009). 61. A. Elmi, V. Galligioni, N. Govoni, M. Bertocchi, C. Aniballi, M. L. Bacci, J. M. Sánchez- Morgado, D. Ventrella, Quantification of Hair Corticosterone, DHEA and Testosterone as a Potential Tool for Welfare Assessment in Male Laboratory Mice. Anim. an open access J. from 485 MDPI 10, 1–11 (2020). 62. M. L. Bacci, E. Nannoni, N. Govoni, F. Scorrano, A. Zannoni, M. Forni, G. Martelli, L. Sardi, Hair cortisol determination in sows in two consecutive reproductive cycles. Reprod. Biol. 14, 218–223 (2014). 63. T. Amano, T. Takeda, H. Yano, T. Tamura, Olopatadine hydrochloride accelerates the 490 recovery of skin barrier function in mice. Br. J. Dermatol. 156, 906–912 (2007). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 15 64. C. P. Parlet, J. S. Kavanaugh, H. A. Crosby, N. B. Cech, N. H. Oberlies, A. R. Horswill Correspondence, Apicidin Attenuates MRSA Virulence through Quorum-Sensing Inhibition and Enhanced Host Defense. CellReports 27, 187-198.e6 (2019). 65. R. N. Kirchdoerfer, A. L. Garner, C. E. Flack, J. M. Mee, A. R. Horswill, K. D. Janda, G. F. 495 Kaufmann, I. A. Wilson, Structural basis for ligand recognition and discrimination of a quorum- quenching antibody. J. Biol. Chem. 286, 17351–17358 (2011). 66. M. L. Grundstad, C. P. Parlet, J. M. Kwiecinski, J. S. Kavanaugh, H. A. Crosby, Y.-S. Cho, K. Heilmann, D. J. Diekema, A. R. Horswill, Quorum Sensing, Virulence, and Antibiotic Resistance of USA100 Methicillin-Resistant Staphylococcus aureus Isolates. mSphere 4 (2019), 500 doi:10.1128/MSPHERE.00553-19. 67. G. E. Rowe, R. A. Welch, Assays of hemolytic toxins. Methods Enzymol. 235, 657–667 (1994). 68. J. M. Kwiecinski, R. M. Kratofil, C. P. Parlet, B. G. J. Surewaard, P. Kubes, A. R. Horswill, Staphylococcus aureus uses the ArlRS and MgrA cascade to regulate immune evasion during 505 skin infection. Cell Rep. 36 (2021), doi:10.1016/J.CELREP.2021.109462. 69. H. A. Crosby, P. M. Schlievert, J. A. Merriman, J. M. King, W. Salgado-Pabón, A. R. Horswill, The Staphylococcus aureus Global Regulator MgrA Modulates Clumping and Virulence by Controlling Surface Protein Expression. PLOS Pathog. 12, e1005604 (2016). 70. R. K. Carroll, A. Weiss, W. H. Broach, R. E. Wiemels, A. B. Mogen, K. C. Rice, L. N. 510 Shaw, Genome-wide Annotation, Identification, and Global Transcriptomic Analysis of Regulatory or Small RNA Gene Expression in Staphylococcus aureus. MBio 7 (2016), doi:10.1128/MBIO.01990-15. 515 Acknowledgments: Alex Croft, Ph.D. for discussions and aid in experimental design. Funding: National Institutes of Health grant NIAMS-K08AR076459 (TAH), NIAID-AI162964 (ARH) and NIAID-AI153185 (ARH) 520 VA Merit Award BX002711 (ARH) Burroughs Wellcome Fund 1022777 (TAH) Author contributions: Conceptualization: TAH, MSJ, JK ARH, 525 Methodology: TAH, MSJ, JK, TS Investigation: MSJ, MC, TS, MA, MB, RAK, JK Visualization: MSJ, TAH, TS, RAK, JK, Funding acquisition: TAH, ARH (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 16 Project administration: TAH 530 Supervision: TAH, ARH Writing – original draft: TAH, MSJ Writing – review & editing: TAH, MSJ, MC, MB, TS, JK, ARH 535 Data availability: Sequencing data have been submitted to National Center for Biotechnology Information Sequence Read Archive under BioProject accession number PRJNA1071176.

availability: Reagents created for this study including the Hsd3b6 Δskin mice and 540 bioluminescent strains of S. aureus are available upon request to Dr. Harris-Tryon. Su pplementary Materials

Figs. S1 to S11 545 Tables S1 to S2 Fig ure Legends 550 Fig. 1. Hsd3b6∆skin mice lack skin-secreted androgens and are resistant to skin infection with S. aureus. (A) Male and female wild-type (WT) mice were epicutaneously infected for 3 days with 1×106 col ony forming units (CFUs) of a bioluminescent strain of methicillin resistant S. aureus (MRSA::lux). Bioluminescence quantified over time. n=6 male and n=7 female mice, aggregate555 of two experiments. (B, C) Testosterone (B) and dihydrotestosterone (DHT) (C) quantification from the skin secretions of male Hsd3b6fl/fl (n=11) and Hsd3b6∆skin (n=8) and female Hsd3b6fl/fl (n=7) and Hsd3b6∆skin (n=11) mice, age-matched at 7 weeks. (D) Schematic of HSD3B6/1 enzyme mediated conversion of pregnenolone to testosterone and DHT. (E) Male Hsd3b6fl/fl (n=5) and Hsd3b6∆skin (n=7) mice epicutaneously infected for 3 days with 1×106 CFUs of560 MRSA::lux. Aggregate of two experiments (F) Representative image of (E). (G) Female Hsd3b6∆skin mice epicutaneously infected for 3 days with 1×106 CFUs of MRSA::lux treated with testosterone or vehicle control. n=5 per group. Aggregate of two experiments (H) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 17 Representative image of (G). Means ± SEM (error bars) are plotted. *p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed t-test. 565 Fig. 2. Testosterone stimulates agr quorum sensing in S. aureus. (A) HG003 strain of S. aureus was treated with 10nM testosterone or untreated with vehicle alone. Volcano plot demonstrating genes with > 4-fold change in expression (green) after treatment as determined by transcriptomics (RNA-seq). (B) Schematic of S. aureus agr two- component quorum sensing system. (C) Bioluminescence of agr-P3 reporter (HG003agrP3::lux)570 treated with testosterone, DHT, AIP-I, or vehicle alone. Statistics of testosterone compared to vehicle at 12 hours. (D) qRT-PCR of S. aureus strain, HG003 (Type I strain), cultured to mid- exponential growth treated with 10nM Testosterone, AIP-I, or untreated with vehicle alone (n=3). Gene expression of target gene normalized to gyrA expression. (E, F) qRT-PCR of agr Type II (USA100) (E) and Type III (MW2) (F) S. aureus strains cultured to mid-exponential575 growth treated with 10 nM Testosterone, AIP-II and AIP-III respectively (n=3). Gene expression of target gene normalized to gyrA expression. (G) Percentage of S. aureus induced red blood cell (RBC) hemolysis and neutrophil killing with and without 10nM Testosterone or AIP-I. (H, I) In vivo analysis of agr-P3 reporter. Epicutaneous infection of male Hsd3b6fl/fl (n=7) and Hsd3b6∆skin mice (n=6) with HG003agrP3::lux with bioluminescence quantified over time.580 Aggregate of two experiments (H) and representative images (I). Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. Fig. 3. Testosterone retains agr activity in a biosynthetic mutant strain of S. aureus, ΔagrBD 585 (A-C) S. aureus biosynthetic mutant (ΔagrBD-HG003) and its respective agr-P3 bioluminescent reporter strain (ΔagrBD agrP3::lux) were treated with 10nM Testosterone, AIP-I, or untreated. (A) Agr-P3-lux reporter kinetics were recorded every hour by a plate reader (n=12). Statistics of testosterone compared to vehicle. (B) Percentage of S. aureus induced hemolysis and neutrophil killing (n=3). (C) qRT-PCR of psmα expression normalized to gyrA expression. (D) qRT-PCR for590 psmα expression in the biosynthetic mutant strain treated with AIP-I and 10nM or 100nM or testosterone (n=3). (E, F) qRT-PCR for psmα expression in the biosynthetic mutant strain treated with AIP-II or AIP-III alone or in combination with increasing concentrations of testosterone (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 18 (10nM to 10µM). (G, H) Male Hsd3b6fl/fl (n=8) and Hsd3b6∆skin mice were epicuataneously infected with 1×106 CFUs of the biosynthetic mutant strain reporter (ΔagrBD::lux) treated 595 topically with testosterone, AIP-I, or untreated (n=5) and bioluminescence quantified over time. Data from two experiments. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. F ig. 4. Testosterone does not stimulate quorum sensing in an AgrC mutant strain of S. aureus 600 (A) S. aureus wildtype (HG003::lux) and mutants (ΔagrBD::lux and ΔagrC::lux) strains treated with 10nM Testosterone. lux reporter bioluminescence kinetics recorded every hour by plate reader. Statistics of HG003 compared to ΔagrC treated with testosterone at 9 hours. (B-D) ΔagrC mutant treated with 10nM Testosterone, AIP-I, or untreated. Percentage of S. aureus induced hemolysis (B), neutrophil killing (C), and relative psmα expression (D) (n=3). (E) Male wild-605 type mice were epicutaneoulsy infected with 1×106 CFUs of wild-type (MRSA::lux) (n=5) or agrC histidine kinase deficient (ΔagrC::lux) (n=6) bioluminescent reporter strain of S. aureus. Aggregate data of two experiments. (F) Representative bioluminescence images of (E). (G) Ribbon diagram of Alphafold2 structure of AgrC histidine kinase dimer with the docking of space filling models of testosterone and AIP-I and a representative testosterone docking solution. 610 Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. F ig. 5. Enantiomer-testosterone inhibits S. aureus virulence and agr quorum sensing. (A) Structure of Testosterone and its stereoisomer enantiomer-Testosterone (ent-T). (B, C) 615 Wildtype S. aureus (HG003) treated with 100nM of ent-T, AIP-II, or untreated (vehicle). Percentage of S. aureus induced hemolysis (B) and neutrophil killing (C) (n=3). (D-F) qRT-PCR for psmα expression in wild-type agr Type II (D), Type III (E), and atopic dermatitis (F) S. aureus strains treated with 10nM of testosterone or 10nM of ent-T. Relative expression of psmα is normalized to housekeeping gene gyrA expression. (G) Female wild-type mice were 620 epicutaneously infected with 1×106 CFUs agr-P3 S. aureus reporter treated with testosterone or ent-T. Bioluminescence quantified over time. Testosterone (n=4), ent-T(n=4), vehicle (n=4). (H) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 19 Quantification of (G). Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. 625 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 20 Fig. 1. Hsd3b6∆skin mice lack skin-secreted androgens and are resistant to skin infection with S. aureus. 630 (A) Male and female wild-type (WT) mice were epicutaneously infected for 3 days with 1×10 6 colony forming units (CFUs) of a bioluminescent strain of methicillin resistant S. aureus (MRSA:: lux). Bioluminescence quantified over time. n=6 male and n=7 female mice, aggregate of two experiments. (B, C) Testosterone (B) and dihydrotestosterone (DHT) (C) quantification from the skin secretions of male Hsd3b6 fl/fl (n=11) and Hsd3b6 ∆skin ( n=8) and female Hsd3b6fl/fl (n=7) and Hsd3b6∆skin (n=11) mice, age-matched at 7 weeks. (D) Schematic of HSD3B6/1 enzyme mediated 635 conversion of p regnenolone to testosterone and DHT. (E) Male Hsd3b6fl/fl (n=5) and Hsd3b6 ∆skin ( n=7) mice epicutaneously infected for 3 days with 1×106 CFUs of MRSA::lux. Aggregate of two experiments (F) Representative image of (E). (G) Female Hsd3b6∆skin mice epicutaneously infected for 3 days with 1×106 CFUs of MRSA::lux treated (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 21 with testosterone or vehicle control. n=5 per group. Aggregate of two experiments (H) Representative image of (G). Means ± SEM (error bars) are plotted. *p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-640 tailed t-test. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 22 Fig. 2. Testosterone stimulates agr quorum sensing in S. aureus. (A) HG003 strain of S. aureus was treated with 10nM testosterone or untreated with vehicle alone. Volcano plot demonstrating 645 genes with > 4-fold change in expression (green) after treatment as determined by transcriptomics (RNA-seq). (B) Schematic of S. aureus agr two-component quorum sensing system. (C) Bioluminescence of agr-P3 reporter (HG003agrP3::lux) treated with testosterone, DHT, AIP-I, or vehicle alone. Statistics of testosterone compared to vehicle at 12 hours. (D) qRT-PCR of S. aureus strain, HG003 (Type I strain), cultured to mid-exponential growth treated with 10nM Testosterone, 650 AIP-I, or untreated with vehicle alone (n=3). Gene expression of target gene normalized to gyrA expression. (E, F) qRT- PCR of agr Type II (USA100) (E) and Type III (MW2) (F ) S. aureus strains cultured to mid -exponential growth treated with 10 nM Testosterone, AIP-II and AIP-III respectively (n=3). Gene expression of target gene normalized to gyrA expression. (G) Percentage of S. aureus induced red blood cell (RBC) hemolysis and neutrophil killing with and without 10nM 655 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 23 Testosterone or AIP-I. (H, I) In vivo analysis of agr-P3 reporter. Epicutaneous infection of m ale Hsd3b6fl/fl ( n=7) and Hsd3b6 ∆skin mice ( n=6) with HG003agrP3::lux with bioluminescence quantified over time. Aggregate of two experiments (H) and representative images ( I). Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. 660 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 24 Fig. 3. Testosterone retains agr activity in a biosynthetic mutant strain of S. aureus, ΔagrBD (A-C) S. aureus biosynthetic mutant ( ΔagrBD-HG003) and its respective agr-P3 bioluminescent reporter strain ( ΔagrBD agrP3::lux) were treated with 10nM Testosterone, AIP-I, or untreated. 665 (A) Agr-P3-lux reporter kinetics were recorded every hour by a plate reader (n=12). Statistics of testosterone compared to vehicle. (B) Percentage of S. aureus induced hemolysis and neutrophil killing (n=3). (C) qRT-PCR of psmα expression normalized to gyrA expression. (D) qRT-PCR for psmα expression in the biosynthetic mutant strain treated with AIP -I and 10nM or 100nM or testosterone (n=3). (E, F) qRT-PCR for psmα expression in the biosynthetic mutant strain treated 670 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 25 with AIP -II or AIP -III alone or in combination with increasing concentrations of testosterone (10nM to 10µM) . (G, H) M ale Hsd3b6fl/fl (n=8) and Hsd3b6∆skin mice were epicuataneously infected with 1×106 CFUs of the biosynthetic mutant strain reporter ( ΔagrBD::lux) treated topically with testosterone, AIP -I, or untreated (n=5) and bioluminescence quantified over time. Data from two experiments. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 675 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 26 Fig. 4. Testosterone does not stimulate quorum sensing in an AgrC mutant strain of S. aureus (A) S. aur eus wildtype (HG003::lux ) and mutants ( ΔagrBD::lux and ΔagrC::lux) strains treated 680 with 10nM Testos terone. lux reporter bioluminescence kinetics recorded every hour by plate reader. Statistics of HG003 compared to ΔagrC treated with testosterone at 9 hours. (B-D) ΔagrC mutant treated with 10nM Testosterone, AIP -I, or untreated. Percentage of S. aureus induced hemolysis (B), neutrophil killing (C), and relative psmα expression (D) (n=3). (E) Male wild-type mice were epicutaneoulsy infected with 1×10 6 CFUs of wild -type ( MRSA::lux) (n=5) or agrC 685 histidine kinase deficient ( ΔagrC::lux) (n =6) bioluminescent reporter strain of S. aureus. Aggregate data of two experiments. (F) Representative bioluminescence images of (E). (G) Ribbon diagram of Alphafold2 structure of AgrC histidine kinase dimer with the docking of space filling models of testosterone and AIP-I and a representative testosterone docking solution. Means (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 27 ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not 690 significant by two-tailed unpaired t-test. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 28 Fig. 5. Enantiomer-testosterone inhibits S. aureus virulence and agr quorum sensing. (A) S tructure of Testosterone and its stereoisomer e nantiomer-Testosterone ( ent-T). (B, C) Wildtype S. aureus 695 (HG003) treated with 100nM of ent-T, AIP-II, or untreated (vehicle). Percentage of S. aureus induced hemolysis (B) and neutrophil killing (C) (n=3). (D-F) qRT-PCR for psmα expression in wild-type agr Type II (D), Type III (E), and atopic dermatitis (F) S. aureus strains treated with 10nM of testosterone or 10nM of ent -T. Relative expression of psmα is normalized to housekeeping gene gyrA expression. (G) Female wild-type mice were epicutaneously infected with 1×106 CFUs agr-P3 S. aureus reporter treated with testosterone or ent-T. Bioluminescence quantified over time. 700 Testosterone (n=4), ent-T(n=4), vehicle (n=4). (H) Quantification of (G). Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 1 705 Supplementary Materials for Androgens excreted at the skin surface regulate S. aureus pathogenesis through activation of agr quorum sensing 710 Maria Sindhura John,1 Mahendran Chinnappan,1 Methinee Artami,1 Mohini Bhattacharya,2 Rebecca A. Keogh,2 Jeffrey Kavanaugh,2 Tripti Sharma, Alexander R. Horswill2,3, Tamia A. Harris- Tryon,1,4* *Corresponding author: Email: [email protected] 715 The PDF file includes:

720 Figs. S1 to S12 Tables S1, S2

1-72 Other Supplementary Materials for this manuscript include the following: N/A 725 730 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 2

Mice Conventionally raised C57BL6/J male and female mice aged 6-9 weeks old mice were purchased 735 from the Jackson Laboratory. C57BL6/J wild-type, K14 Cre+/-(60), and Hsd3b6fl/fl (fig. S2A) mice were bred and maintained in the specific pathogen- free (SPF) barrier facility at the University of Texas Southwestern Medical Center at Dallas. The generation of Hsd3b6 ΔSkin (K14Cre+/-; Hsd3b6fl/fl) is described below. Mice were co -housed with 3–5 mice per cage in all experiments. All mice were housed under a 12 -hour-light:12-hour-dark cycle. Mice were fed ad libitum with 740 free access to drinking water according to protocols approved by the Institutional Animal Care and Use Committees (IACUC) of UT Southwestern Medical Center Hsd3b6 fl/fl (C57BL6/J), with loxP sites surrounding the first coding exon of Hsd3b6 were generated using CRISPR/Cas9 genome editing with guide RNAs targeting regions of the Hsd3b6 locus (fig. 745 S2A). Guide RNAs were injected into fertilized C57BL/6J embryos by the Children’s research institute mouse genome engineering facility at UT Southwestern. Healthy blastocytes were implanted in pseudo-pregnant mice. The resulting litter was screened by genomic sequencing to detect insertion of loxP sites and mice were bred to homozygosity and backcrossed with wild-type C57BL/6 mice. To generate K14Cre+/-;Hsd3b6fl/fl(Hsd3b6ΔSkin) mice, Hsd3b6fl/fl mice were crossed 750 with K14Cre+/- mice to generate K14Cre +/-;Hsd3b6fl/+ mice, K14Cre; Hsd3b6 fl/+ mice were crossed to Hsd3b6 fl/fl mice to obtain experimental mice K14Cre; Hsd3b6 fl/fl ( Hsd3b6ΔSkin) and corresponding controls, Hsd3b6fl/fl. Hsd3b6fl/fl and Hsd3b6ΔSkin status was determined using PCR primers (Table S1) and resolving on a 3% Agarose gel. 755 Quantification of Serum and Skin Hormones in Mouse Samples Age and sex matched Hsd3b6fl/fl and Hsd3b6ΔSkin mice were analyzed. Blood samples were obtained from the retro- orbital vein of anesthetized mice followed by serum isolation with the micro sample tube Serum Gel (SARSTEDT, Cat # 41.1378.005). Skin hormones were quantified from skin secretions. After anes thesia with isoflurane, hair was removed with depilatory cream 760 and shaving. After 24h, Sebutape ® (Clinical and Derm LLC, Texas) was applied to dorsal surface for 15 minutes (fig. S3A). Steroid extraction was performed as previously described (17, 18, 61, 62). Sebutape® was removed and placed in 3 ml of chromatography-mass spectrometry grade (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 3 methanol (Thermo Fisher Scientific, Pittsburg, PA, Cat#A456- 500) in an 8 ml polytetrafluorethylene/rubber-lined vial (Thermo Fisher Scientific, Cat#03 -343-3E). The sample 765 was then dried by vacuum centrifuge at 40°C and stored at −20°C until analysis. For analysis, samples were reconstituted with 100 μL of kit assay buffer. Steroid Hormone Quantification of progesterone, testosterone, and DHT was measured by mouse specific immunoassay (My BioSource, USA, Cat# MBS7606191, MBS266250, MBS760829) following the manufacturer’s instructions. 770 FACS analysis skin Ear skin from the epidermis of 8- 12 weeks old wildtype, HSD3B6 fl/fl and HSD3B6Δskinmice were digested with DNase -I at 1 -mg/mL (Sigma -Aldrich; DN25 -1G), Liberase -TL at 0.32- mg/mL (Sigma-Aldrich; 5401020001), Collagenase -D at 6 -mg/mL (Sigma -Aldrich; 11088858001) in 775 RPMI media, minced and incubated for 1 hr at 37°C at 1400 rpm on a thermocycler, and passed through a 70-µm cell separation filter. After washing, the cell pellet was suspended in FACS buffer (PBS with 3% BSA and 2 mM EDTA). The cell suspensions were transferred to a 96 well plate with v-bottom (Corning Inc: Costar; 3894) and processed further. Cell viability was determined with Ghost-Dye-Red-710 (Cytek; SKU 13-0871-T100). To prevent non-specific antibody binding 780 the cells were stained with Fc receptor blocking with anti -mouse CD16/32 antibody (BD Biosciences; 553142). Different cell populations were assessed with the following antibodies re - suspended in FACS buffer for 15 minutes in 4°C. Brilliant -Violet (BV) -650-anti-CD45 (Biolegend; 103151), FITC -anti-CD3 (Cytek; SKU 35-0032- U025), BV -421-anti-CD11b (Biolegend; ), BV711-anti- F4/80 (Biolegend;). The gating strategy used to determine cell 785 populations is as follows: For total leucocytes singlet live cells were gated on CD45+ markers, from which the total T cells were identified as CD45+CD3+ cells, macrophages were identified as CD45+CD11b+F4/80+ cells. Cells were acquired by using NovoCyte flow cytometer and analyzed using NovoExpress software. 790 Immunofluorescence microscopy Mouse skin samples were fixed in formalin and embedded in paraffin by the UT Southwestern histology core. Samples were deparaffined with xylene followed by rehydration with decreasing concentrations of ethanol. Heat induced antigen retrieval was attained i n 10 mM sodium citrate buffer. Sections were washed briefly and blocked for an hour in blocking/permeabilization buffer 795 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 4 (PBS+5% Goat serum+0.5%Triton X-100). Sections were incubated in blocking/permeabilization buffer overnight with the following antibodies: anti -HSD3B6 (2.5 µg/mL; Biorbyt; orb592071), anti- cytokeratin-14 (1 µg/mL; Santa Cruz Biotechnology; sc-53253). After a brief wash in PBST (PBS+0.2% Tween-20) sections were incubated with corresponding secondary antibodies: Donkey anti-rabbit alexa-fluor-647 (2 µg/mL; Jackson Immuno; 711-605-152), Donkey anti-mouse alexa-800 fluor-594 (2 µg/mL; Thermofisher Scientific; A -21203). The slides were then washed briefly in PBST and mounted with 4, 6- diamidino-2-phenylindole (DAPI) containing mounting medium (SouthernBiotech; 0100-20). Images were processed using ZEISS 780 confocal microscope. TEWL measurement 805 Transepidermal water loss (TEWL), a measure of barrier function and integrity, of mice dorsal skin was measured using Vapometer (Delfin Technologies) according to manufacturer instructions(63). Bacterial strains and plasmids 810 S. aureus strains (Table S1) were streaked on tryptic soy agar (TSA) plates and grown overnight at 37 °C. Single colonies were selected and cultured in TSB at 150 RPM at 37 °C in a shaking incubator overnight followed by a 1:100 subculture at 37 °C in a shaking incubator to obtain mid- logarithmic phase bacteria. For fusion reporter strains, all in vitro cultures were performed using TSB in the presence of 10 µg/mL of chloramphenicol. Bacteria were pelleted, washed, and re -815 suspended in either TSB for in vitro experiments or PBS for in vivo experiments. HG003, ΔagrC, ΔagrBD, and ΔagrA mutant strains were obtained from Dr. Ferric Fang (9). S. aureus strains from atopic dermatitis skin obtained from Drs. Julie Segre and Heidi Kong (25). All other strains from the collections of the Horswill and the Harris-Tryon labs. 820 Construction of a lux expressing S. aureus strain As described previously(64) , the integrated luxCDABEG cassette was transduced into S. aureus strains HG003, ΔagrBD and ΔagrC obtained from the lab of Ferric Fang (9) using phage 11 generating strains AH6222 (lux+), AH6224 (lux+) and AH6223 (lux+), respectively. 825 In vitro luminescence assays (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 5 S. aureus strains, HG003, ΔagrBD and ΔagrC expressing Lux (φ11::LL29luxCDABEG ) and quorum sensing lux (pAmiAgrP3lux) plasmids (HG003 (AH6225) agr Type I, USA100 (AH430). Type II and MW2 (AH1747) agr Type III) (52, 65, 66) were grown in TSB supplemented with antibiotic selection and subcultured in TSB 1:200 into fresh TSB containing steroid hormone. 830 Assay completed in Opaque-sided, 96-well, clear bottom, tissue-culture treated plates with a final well volume of 200 μL. Bioluminescent signals (photons/0.1 second acquisition time) were measured by BioTek H1 Synergy plate reader. Experiments completed in triplicate, with agr type specific AIPs AIP -I (Peptide Institute, Inc., Cat# 4515- v), AIP -II (Peptide Institute, Inc., Cat# 4516-v), and AIP-III(Peptide Institute, Inc., Cat# 4517-v) as positive control. 835 Hemolysis assay Hemolysis assay completed as previously described (67) with the following modifications. Overnight cultures of HG003, ΔagrBD, and ΔagrC strains were inoculated 1:200 into 10 mL of TSB containing testosterone, AIP-I, or vehicle alone at concentrations of 10 nM. Cells were grown 840 to mid -log phase (OD600 nm 0.6). Supernatant of 1ml of culture was filter sterilized using Millex® sterile syringe filters of 0.22 µm pore size (Cat#SLGV033RS). Filtered supernatant diluted 1:1 with PBS was added to 25 µL of human blood to a 96- well V -bottom plate and incubated with agitation at 37 oC for 1 hr. After spinning 1000RPM for 10 min, the supernatant was transferred to a flat-bottom 96-well plate. Absorbance read at 541 nm for hemoglobin using a 845 BioTek H1 Synergy plate reader. % hemolysis calculated using the following formula: (A541 of RBC treated sample-A541 of buffer)/ (A541 of H20-A541 of buffer) Buffer (PBS) = baseline, H20 = 100% hemolysis. Neutrophil Killing assay 850 S. aureus induced neutrophil killing measured as previously described (68). HG003, ΔagrBD and ΔagrC strains were treated with testosterone, AIP -I or vehicle at concentrations of 10nM and allowed to grow to mid log phase (OD600nm 0.6). Purified Human Neutrophils (IQ Biosciences) were seeded at 1 × 105 cells per well into 96 -well plate in 90 μL o f RPM I . 1 0 μL of bacterial supernatants were added (final concentration of 10%). After 3h incubation at 37°C, 5% CO2, the 855 plates were centrifuged at 250g, 10 min, and resulting supernatants were used to measure lactate dehydrogenase (LDH) leakage from damaged cells as the marker of neutrophil lysis with an LDH Cytotoxicity Detection Kit (Invitrogen, Cat# 2570393). Percent neutrophil lysis was (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 6 calculated using neutrophils incubated with 10% of RPMI as zero percent lysis control, and neutrophils incubated with 0.2% Triton X-100 defined as 100 percent lysis. 860 Quantitative real-time PCR HG003, USA100 (AH3684), MW2 (AH843), ΔagrBD, ΔagrA, ΔagrC and atopic dermatitis strains were treated with testosterone and/or respective AIPs at concentrations of 10nM and allowed to grow to mid-log phase (OD600nm 0.6). Cells were pelleted and lysed with lysis matrix B tubes 865 containing 0.1mm silica spheres (MP Lysing Matrix Tubes, Cat#174701) and lysostaphin (Sigma, Cat# L7386) at room temperature, and RNA was purified using the RNeasy Mini Kit (Qiagen, Cat# 74104). RNA was quantified by absorbance at 260 nm, and its purity wa s evaluated by the ratios of absorbance at 260/280 nm. RNA was used as a template to generate cDNA with the High- Capacity Reverse Transcription Kit (Applied Biosystems, Cat#01071619). Quantitative real-time 870 PCR was performed by amplifying cDNA with Power SYBR Green Master Mix (Applied Biosystems, Cat# 2749999) and QuantStudio 7 Flex Real -Time PCR System (Applied Biosystems). Relative expression values were calculated using the comparative Ct (ΔΔCt) method, and transcript abundances were normalized to gyrA transcript abundance. The primer sequences are shown in Table S2. 875 RNA Seq RNAseq was performed as previously described (69) . Briefly, cultures of HG003 were grown in TSB with 10nM testosterone, pregnenolone, or DMSO alone in triplicate to an optical density of 0.6 at OD600 nm. Cells were harvested and treated with RNA Protect Bacteria Reagent (Qiagen, 880 Cat# 76526). Cells were lysed using lysostaphin (Sigma, Cat# L7386) and RNA purified using the RNeasy mini kit (Qiagen, Cat# 74104) and sample quality was affirmed via Bio analyzer (Agilent). Ribosomal RNA was depleted using RiboCop for bacterial META Removal Kit (Lexogen). cDNA libraries were generated at the University of Michigan Microbiome core using the CORALL RNA- seq Library Prep Kit (Lexogen). Samples were barcoded, pooled and sequenced in 125×125 885 paired-end reads on an Illumina HiSeq 2000 sequencer. Raw sequencing reads in fastq format were aligned and annotated to the S. aureus NCTC8325 reference genome with annotated sRNA (70) using QiagenCLC Genomics Workbench default settings (version 21.0.5): mismatch cost, 2; insertion and deletion cost, 3; length and similarity fraction, 0.8. Normalization and differential (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 7 expression calculations of uniquely mapped bacterial transcripts were performed using CLC. All 890 transcripts with an FDR adjusted p-value <0.05 were considered significant. S. aureus skin infections Prior to mouse infection studies, mice were acclimatized to the animal biosafety level 2 (ABSL - 2) animal housing facility. Age, strain and sex matched C57BL/6 male and female mice, Hsd3b6fl/fl 895 and Hsd3b6ΔSkin were used in the study. A previously described mouse model of epicutaneous S. aureus exposure was followed (21, 50) . Briefly, the dorsal skin of anesthetized mice (2% isoflurane) were shaved and depilated (Nair cream). After 24 hours, bioluminescent S. aureus strains were grown to mid-log- phase, pelleted and resuspended in PBS to achieve inoculum containing 1×10 6 CFU. A 100 μL volume of PBS containing 1×106 CFU with or without 10nmoles 900 of testosterone, AIP -I, or the same volume of vehicle was placed on a sterile gauze pad and attached to the shaved skin with transparent bio-occlusive dressing (Tegaderm; 3M, Henry Schein medicals, Cat#1622W), and secured with adhesive bandages (BAND-AID, Johnson and Johnson, American white cross, Cat#1275033) for 4 days. Photons emitted from luminescent bacteria were collected during an auto exposure using the IVIS Lumina3 imager machine and living image 905 software (Xenogen, Alameda, CA). Bioluminescent image data are presented on a pseudocolor scale (blue representing least intense and red representing the most intense signal) overlaid onto a gray-scale photographic image. Using the image analysis tools in living image software, circular analysis windows (of uniform area) were overlaid onto dorsal regions of infection area, and the corresponding bioluminescence values (total flux) were measured and plotted versus days after 910 infection. Mice were randomly assigned to treatment groups, and at experimental endpoints, mice were humanely euthanized using carbon dioxide inhalation. Measurement of quorum sensing in vivo S. aureus strains expressing quorum sensing lux (pAmiAgrP3lux) plasmids as described above 915 (30) were grown in TSB medium containing chloramphenicol overnight at 37 oC in a shaking incubator set to 150 rpm. Overnight cultures were diluted 1:100 TSB with chloramphenicol to mid- logarithmic phase and then pelleted and washed twice in PBS and resuspended in sterile saline. 100 μL of PBS inoculum suspensions containing 1×10 6 CFUs were placed on a sterile gauze pad (1×1cm) and attached to the shaved skin with transparent bio- occlusive dressing, with or without 920 testosterone, enantiomer-testosterone, AIP-I, or vehicle (Tegaderm; 3M), and secured with 2 layers (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 8 of adhesive bandages (BAND-AID, Johnson and Johnson). Beginning immediately after infection, mice were imaged under isoflurane inhalation anesthesia (2%) and continued to take images for every 1hr. Photons emitted from luminescent bacteria were collected during auto exposure using the IVIS Lumina3 imager machine and living image software (Xenogen, Alameda, CA). 925 Corresponding bioluminescence values (total flux) were measured and plotted versus time after infection. In silico docking The dimeric structure of AgrC was predicted using Alphafold2 (42, 43) as implemented in Colab 930 (42, 43) and then AIP-I was in silico docked using SWISSDOCK (44–46) onto the sensory domain of a single subunit, consisting residues 1 through 207, using NMR derived coordinates for AIP -I (44–46). The AIP -I docking solution that appeared most consistent with the structure -activity relationships reviewed in Thoendel et al. (5, 6) was selected as the target AgrC-AIP-I complex for docking of steroids, using stereospecific compound templates from PubChem; testosterone (CID 935 6013). All visualization of in silico results was done using PyMOL [ver 2.5.2, Schrödinger, LLC]. Quantification and Statistical Analysis Statistical details of experiments can be found in the figure legends, including how significance was defined and the statistical methods used. Data represent mean ± standard error of the mean. 940 Formal randomization techniques were not used; however, mice were allocated to experiments randomly and samples were processed in an arbitrary order. Mouse skin samples that were determined to be in the anagen hair cycle were excluded. All statistical analyses were performed with GraphPad Prism software, except the bioluminescent imaging data that was analyzed as described above. To assess the statistical significance of the difference between two treatments, 945 we used two-tailed Student’s t-tests. To assess the statistical significance of differences between more than two treatments, we used one-way ANOVA. Outliers within experiments were identified by Grubb’s test and removed. For the RNAseq experiments, expression data was analyzed with CLC. All transcripts with an FDR adjusted p-value <0.05 were considered significant. 950 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 9 955 960 965 970 975 980 985 990 Fig. S1. Sex bias of S. aureus skin infection. (A, B) Wildtype male mice (n=6) and female mice (n=7) were epicutaneously challenged with 1×106 CFUs with bioluminescent MRSA (MRSA::lux) for 3 days and bioluminescence quantified over time. (A) In vivo Bioluminescence images. 995 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 10 Fig. S2. G eneration and validation of Hsd3b6 ∆skin mice by CRISPR/Cas9 genomic targeting. (A) Schematic diagram of CRISPR/Cas9 -mediated gene insertion of loxP sites flanking the first coding exon of the Hsd3b6 locus. (B) Immunofluorescence staining of HSD3B6 expression in Hsd3b6fl/fl and Hsd3b6 ∆skin mice skin . Scale 50µM. (C) Hematoxylin and eosin staining of 1000 Hsd3b6fl/fl and Hsd3b6∆skin skin. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 11 1005 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 12 Fig. S3. Analysis of the Hsd3b6 ∆skin mice compared to controls . (A) Skin secretions captured with commercial Sebutape® applied to the dorsal skin after hair removal. Each hormone quantified by hormone specific immunoassay. (B) Skin secreted progesterone quantified by immunoassay of male and female Hsd3b6fl/fl and Hsd3b6∆skin mice. (C) Serum progesterone and DHT quantified by 1010 hormone immunoassay of male and female Hsd3b6 fl/fl and Hsd3b6 ∆skin mice. (D) Weight measurements of male and female Hsd3b6fl/fl and Hsd3b6∆skin mice. (E) Transepidermal water loss (TEWL), a measures of skin barrier integrity, of male and female Hsd3b6fl/fl and Hsd3b6∆skin mice measured by Vapometer device . (F) Flow cytometry for macrophages, total leucocytes, and T - cells (markers as shown), in the skin of Hsd3b6fl/fl and Hsd3b6∆skin mice. n as shown. Means ± SEM 1015 (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 13 1020 Fig. S4. Hsd3b6∆skin mice are resistant to skin infection with S. aureus . (A) Male Hsd3b6fl/fl (n=7) and Hsd3b6 ∆skin (n=7) mice were epicutaneously challenged with 1×10 6 CFUs with bioluminescent MRSA (MRSA::lux) for 3 days and bioluminescence quantified over time. (B) Female Hsd3b6∆skin mice were epicutaneously challenged with 1×10 6 CFUs with bioluminescent 1025 MRSA (MRSA::lux) for 3 days with or without testosterone(n=5) and vehicle (n=5). (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 14 1030 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 15 Fig. S5. Testosterone and DHT activate quorum sensing readouts in S. aureus , but other hormone classes do not activate quorum sensing. (A, B) Transcriptomics (RNA-seq) of HG003 strain of S. aureus treated with 10nM testosterone, pregnenolone, or untreated with vehicle alone. (A) Volcano plot demonstrating genes with >4-fold change in expression in testosterone transcriptome compared to pregnenolone treated S. aureus, (n=3). (B) Volcano plot comparing the 1035 transcriptome of S. aureus treated with pregnenolone compared to vehicle control (n=3). (C-F) In vitro bioluminescence of agr reporter (HG003 agrP3::lux) after treatment with 10nM of testosterone (C), DHT (C, D), progesterone (C, E), AIP-I (C-F), or estradiol(C, F). (G, H) In vitro bioluminescence of Type II (USA100 agrP3::lux ) (G) and Type III (MW2 agrP3::lux ) (H) agr reporters treated with 10nM of testosterone (n=3). 1040 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 16 1045 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 17 Fig. S6. Testosterone stimulates the expression of virulence factors across strains of S. aureus. (A-D) qRT-PCR of S. aureus agr Type I strain HG003 treated with 10nM Testosterone or AIP -I (n=3) till mid -exponential growth. E xpression of target gene s, lukS-PV, hla, hld, and agrA normalized to gyrA expression. (E-G) qRT-PCR of strains of S. aureus obtained from patients with atopic dermatitis (25) and treated with 10nM of testosterone to the mid- exponential growth 1050 (n=3). Expression of target gene, psmα (E), RNAIII (F), and agrA (G), normalized to housekeeping gene gyrA expression. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. 1055 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 18 Fig. S7. Sexual dimorphism of agr quorum sensing in vivo. (A -C) In vivo analysis of agr- P3 reporter. Female Hsd3b6fl/fl and Hsd3b6∆skin mice were epicuataneously infected with 1×106 CFUs of the agr-P3lux and bioluminescence quantified over time . (A) Kinetics and (B) representative 1060 images. (C) Comparison between male (Fig 2H) and female Hsd3b6fl/fl mice. Aggregate of two experiments, n=5 male and n=5 female mice. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by two-tailed unpaired t-test. 1065 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 19 Fig. S8. Testosterone stimulates agr quorum sensing in S. aureus in a dose dependent manner, independent of the autoinducing peptides (AIP). (A) S. aureus biosynthetic mutant (ΔagrBD) treated with increasing doses of testosterone, followed by qRT-PCR. RNAIII, agrA, agrC, and psmα expression normalized to gyrA expression. (B) S. 1070 aureus biosynthetic mutant reporter ( ΔagrBD::lux) treated with 10nM t estosterone, DHT, progesterone, or estradiol. (C) qRT -PCR for RNAIII expression in the biosynthetic mutant strain treated with 10nM AIP-I and 10 nM or 100nM or testosterone . (D) Schematic diagram showing inhibitory action of non-cognate AIPs on agr signaling. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by one-way ANOVA. 1075 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 20 Fig. S9. Testosterone can overcome the inhibition of AgrC signaling in a dose dependent 1080 manner. (A, B ) qRT -PCR for RNAIII, agrA and agrC expression in the biosynthetic mutant , ΔagrBD, treated with AIP -II (A) or AIP -III (B) alone or in combination with increasing concentrations of testosterone (10nM to 10µM) . Target gene expression normalized to housekeeping gene gyr A. Means ± SEM (error bars) are plotted.*p < 0.05; **p < 0.01; ***p < 0.001, ****p <0.0001, ns, not significant by one-way ANOVA. 1085 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 21 Fig. S10. T estosterone stimulation requires agrC in vivo and in vitro. (A-C) S. aureus ΔagrC (A) and ΔagrA (B, C) mutant strains were treated with 10nM Testosterone, AIP -I, or untreated 1090 (vehicle). Psmα (B) and RNAIII (C) expression quantified by qRT -PCR and normalized to gyrA expression. (D, E) Female wild-type mice were epicutaneoulsy infected with 1×106 CFUs of wild- type (MRSA:: lux) (n=5) or agrC histidine kinase deficient ( ΔagrC::lux) ( n=6) bioluminescent reporter strain of S. aureus and bioluminescence quantified over time. Bioluminescence images (D) and infection kinetics from an aggregate of two experiments (E). (F, G) Male wildtype mice 1095 were infected for 3 days with 1×10 6 CFUs of Δ agrC::lux treated with testosterone ( n=5), AIP-I (n=5) or vehicle ( n=5) control. Bioluminescence images (F) and infection kinetics (G). Means ± SEM (error bars) are plotted. ns, not significant by two-tailed unpaired t-test. (H) Ribbon diagram of the AgrC sensory domain (Alphafold 2) with docking of space filling models of AIP -I and predictive locations of testosterone docking. 1100 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 22 Fig. S11. Enantiomer-testosterone (ent-T) inhibits S. aureus virulence factor expression and quorum sensing. (A) qRT- PCR of strains of S. aureus obtained from patients with atopic 1105 dermatitis (25) and treated with 10nM or ent-T, the stereoisomer of testosterone (n=3). Expression of target gene RNAIII normalized to housekeeping gene gyrA expression. Means ± SEM (error bars) are plotted.*p < 0.05 by two- tailed unpaired t -test. (B) Representative b ioluminescence images of Fig. 5H, female wild -type mice epicutaneously infected with 1× 106 CFUs agr-P3 S. aureus reporter treated with testosterone, ent-T, vehicle, or untreated. (n=4). 1110 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 23 Table S1. S. aureus strains Reference Identifier HG003 (9) RU083 USA100 (29) AH3684 MW2 (29) AH843 HG003-ΔagrA (29) RU111 HG003-ΔagrC (29) RU141 HG003-ΔagrBD (29) RU299 MRSA SAP430::luxABCDE (21) Staphylococcus aureus USA300 LAC::lux HG003, φ11::LL29luxCDABEG This work AH6222 HG003-ΔagrBD, φ11::LL29luxCDABEG This work AH6224 HG003-ΔagrC, φ11::LL29luxCDABEG This work AH6223 USA300 LAC + pAmiAgrP3lux (camR) (29) AH2759 HG003+ pAmiAgrP3lux (camR) This work AH6225 USA100 IA116 + pAmiAgrP3lux (camR) (29) AH4390 MW2+ pAmiAgrP3lux (camR) (65) AH3185 HG003-ΔagrBD + pAmiAgrP3lux (camR) This work AH6227 HG003-ΔagrC+ pAmiAgrP3lux (camR) This work AH6226 1115 Supplemental Table 1. Staphylococcus aureus strains used in this work. (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint 24 Table S2. 1120 Supplemental Table 2. Primers for Quantitative RT-PCR and Gene Sequencing 1125 Gene Species Sequence, 5′→3′ Ref. gyrA Staphylococcus aureus Forward: AAGGTGTTCGCTTAATTCGC (67) Reverse: ATTGCATTTCCTGGTGTTTC psmα Staphylococcus aureus Forward: TATCAAAAGCTTAATCGAACAATTC (67) Reverse: CCCCTTCAAATAAGATGTTCATATC hla Staphylococcus aureus Forward : GGGGACCATATGATAGAGATT (67) Reverse: TGTAGCGAAGTCTGGTGAAA lukS-PV Staphylococcus aureus Forward: ATGAGGTGGCCTTTCCAATAC (67) Reverse: CCTGTTGATGGACCACTATTA RNAIII Staphylococcus aureus Forward: CGATGTTGTTTACGATAGCTT (67) Reverse: CCATCCCAACTTAATAACCA hld Staphylococcus aureus Forward: GAGTTGTTTAATTTTAAG (68) Reverse: TTTTAGTGAATTTGT agrA Staphylococcus aureus Forward: GAAGACGATCCAAAACAAAGAG (9) Reverse: GTCATTCATATTTTTAGCTTGCTC Hsd3b6- Full Mus musculus Forward: CCCAGAGACCATCCTTTATGTC Reverse: CTCTCCCTGTCTCCTTACATTTC Hsd3b6- Left Mus musculus Forward: CCCAGAGACCATCCTTTATGTC Reverse: CAAACCTCCCATAGCACAGAT Hsd3b6- Right Mus musculus Forward: GGGATCCTCCCTTGTCTAGTA Reverse: CTCTCCCTGTCTCCTTACATTTC (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted February 14, 2024. ; https://doi.org/10.1101/2024.02.10.579753doi: bioRxiv preprint