NEIL3 Promotes the Carcinogenesis of Prostate Cancer by Activating PI3K/Akt/mTOR Signaling

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-19 · read from full text

The study investigated whether Nei endonuclease VIII-like 3 (NEIL3) contributes to prostate cancer by analyzing The Cancer Genome Atlas (TCGA) datasets and performing siRNA knockdown experiments in prostate cancer cell lines. Using TCGA (498 tumor vs 52 adjacent non-tumor samples), the authors found NEIL3 overexpression in prostate cancer and reported worse patient outcomes in those with high NEIL3; in vitro, NEIL3 knockdown reduced proliferation, invasion, and migration, alongside reduced PI3K/AKT/mTOR pathway signaling and decreased androgen receptor (AR) and HMGA2 protein levels in C4-2 cells, based on RNA-sequencing and related expression assays. A key limitation explicitly stated is that the work is a preprint that has not been peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 76,648 characters · extracted from preprint-html · click to expand
NEIL3 Promotes the Carcinogenesis of Prostate Cancer by Activating PI3K/Akt/mTOR Signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NEIL3 Promotes the Carcinogenesis of Prostate Cancer by Activating PI3K/Akt/mTOR Signaling Wei Zhang, Zihao Liu, Simeng Wen, Yuan Shao, Zhen Yang, Yong Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5087118/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Prostate cancer (PCa) is one of the most common cancers worldwide. Nei endonuclease VIII-like 3 (NEIL3) plays important roles in diverse cancers. In this study, we found that NEIL3 was over-expressed in PCa tissues and cell lines. NEIL3 over-expression is associated with worse prognostic outcomes in PCa patients. In vitro, PCa cell proliferation, invasion, and migration could be significantly inhibited with knocking down NEIL3 by inactivating the phosphatidylinositol 3-kinase (PI3K)/AKT/mammalian target of the rapamycin (mTOR) signaling. Besides, based on the results of RNA-sequencing, we found that the protein expression of high-mobility gene group A2 and androgen receptor (AR) were decreased in C4-2 cells treated with siNEIL3. Therefore, this result suggests that NEIL3 regulates the progression of PCa by modulating the PI3K/AKT/mTOR signaling and the expression of AR. NEIL3 Prostate cancer PI3K AR HMGA2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Prostate cancer (PCa), ranking fourth in terms of incidence and eighth in terms of mortality, is one of the most common cancers worldwide. According to the Global Cancer Observatory (GCO) (gco.iarc.fr, accessed on 8 February 2024), there were 1,467,854 new cases and 397,430 deaths of PCa globally in 2022. However, screening and treatment for prostate cancer have their limitations[ 1 , 2 ]. Therefore, it is urgent to clarify molecular mechanisms underlying the occurrence, progression, and metastasis of PCa. Nei endonuclease VIII-like 3 (NEIL3), which is a mainly a monofunctional DNA glycosylase belonging to the bacterial Fpg/Nei like family, plays important roles in diverse physiological and pathophysiological processes[ 1 ]. It can function in DNA alcoholization repair, immune response regulation, nervous system development and function, and DNA damage signal transduction. It was reported that the repair function of NEIL3 associated with the DNA replication, correlating with induced expression of the proteins in S/G2 phases of the cell cycle and responding to genomic injury during kidney development[ 3 , 4 ]. As a novel tumor-related gene, NEIL3 is overexpressed in multiple human cancers, including glioblastoma multiforme, breast cancer, pancreatic adenocarcinoma, lung adenocarcinoma, renal clear cell carcinoma, kidney renal papillary cell carcinoma [ 5 ]. The upregulation of NEIL3 is involved in glycolysis, angiogenesis and metastasis of hepatocellular carcinoma [ 6 , 7 ]. In addition, NEIL3 could propel the cisplatin resistance in lung adenocarcinoma by repressing DNA damage[ 8 ]. Loss of NEIL3 could markedly enhance the sensitivity to ataxia-telangiectasia-mutated-and-Rad3-related kinase (ATR) inhibitors in glioblastoma cells[ 9 ]. However, NEIL3 was downregulated in castration-resistant and neuroendocrine PCa cell lines [ 10 ]. It has reported that NEIL3 could regulate chemotherapy resistance, and deficiency of NEIL3 could enhance the chemotherapy resistance of PCa [ 10 ]. Another study showed that NEIL3 could also promote the sensitivity of PCa cells to radiotherapy by affecting the cell cycle activity through the regulation of ATR/ checkpoint kinase 1 (CHK1) pathway[ 11 ]. However, the role of NEIL3 in PCa has not been conclusively clarified. Here, we analyzed the related data of PCa from The Cancer Genome Atlas (TCGA) database to explore whether NEIL3 is over-expressed in PCa patients or not. Additionally, we knocked down its expression to investigate whether NEIL3 can affect the ability of proliferation, invasion, and migration in PCa cells. Furthermore, we discussed the possible mechanisms underlying the observed therapeutic effects, as well as whether NEIL3 could influence the expression of AR in PCa cell lines. Materials and Methods Gene expression profile and patient clinical data The gene expression profiles and clinical data of PCa patients were from TCGA database (https://cancergenome.nih.gov/). 550 samples were collected for integrated bioinformatics analysis, including 498 PCa tumor tissues and 52 adjacent non-tumor samples. According to the regional lymph node metastasis, 498 PCa samples divide into 249 N0 stage and 249 N1 stage. The disease-free survival (DFS) was analyzed using the Kaplan-Meier approach based on the mean value of NEIL3. In this study, there was no need for ethical approval as all data which were downloaded from TCGA. In addition, the data processing met the guidelines of TCGA publication (https://cancergenome.nih.gov/publications/guidelines). Cell lines and cell culture Human normal prostate epithelial cell line (RWPE-1) and human PCa cell lines (PC-3M, DU145 and C4-2) were purchased from Procell Life Science&Technology Co.,Ltd. Cells were cultured on RPMI-1640 cell medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 100 U/mL penicillin-streptomycin at 37 °C in a humidified atmosphere containing 5% CO 2 . Cell lines were grown in culture flasks at 80% to 90% confluence and harvested with trypsin/EDTA. Small interfering RNA (siRNA) transfection The siRNA duplexes targeting human NEIL3 (si-NEIL3), 5’-CAAUCAGUUCAGAAUCUAATT-3’ and 5’- UUAGAUUCUGAACUGAUUGTT-3’, were obtained from Sangon Biotech (Shanghai, China). A scrambled siRNA (si-NC), 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’, served as the negative control (Sangon Biotech, Shanghai, China). The siRNAs were transiently transfected into human PCa cell lines using Lipofectamine RNAiMax reagent according to the manufacturer’s instructions (Invitrogen, USA). We transfected PC-3M cells or C4-2 cells with 50 nmol siRNA per 6-cm plate with 10 μL RNAiMax for 48 h. RNA isolation and quantitative real-time PCR (qRT-PCR) The total RNAs of cells were isolated using TRIzol reagent (Invitrogen, USA) and quantified with RiboGreen Quantification Reagent (Invitrogen, USA). 1 μg of total RNAs were included in each reverse transcriptase reaction with HiScript IV RT SuperMix (Vazyme, China), according to the manufacturer's protocol. qRT-PCRs were performed using FastStart SYBR Green Master (Roche). Relative mRNA expression was normalized to gapdh levels, using the 2 −ΔΔCt method. The sequence for each primer was in Table 1. Western blot RIPA lysis solution was used to prepare cell lysates. We centrifuged the lysates and collected the supernatant. Quantitative protein sample was to 5 × loading buffer and degenerated the sample under high temperature conditions. Proteins were electrophoresed and transferred to PDVF membranes. The membranes were blocked for 2 hours with 5% BSA in TBST and then incubated with primary antibodies against NEIL3 (1:1000, Proteintech, Wuhan, China), Ki67(1:500, Affinity, Jiangsu, China), MMP2(1:500, Affinity, Jiangsu, China), MMP9(1:300, Affinity, Jiangsu, China), PI3K(1:1000, Affinity, Jiangsu, China), AKT(1:1000, Affinity, Jiangsu, China), mTOR(1:1000, Affinity, Jiangsu, China), p-mTOR(1:1000, Affinity, Jiangsu, China), p-AKT (1:1000, Cell Signaling Technology, Massachusetts, USA), HMGA2(1:1000, Cell Signaling Technology, Massachusetts, USA), AR(1:1000, Cell Signaling Technology, Massachusetts, USA), β-actin (1:3000, AbClonal, Wuhan, China). Appropriate secondary antibodies were conjugated to horseradish peroxidase (1:1000, Seracare, Gaithersburg, MD, USA). The immunoreactive bands were detected and visualized using the ECL Advance reagent (Meilun, Dalian, China). Cell viability assay Cell Counting Kit-8 (CCK-8) (Beyotime, Shanghai, China) was used in the cell viability assay. In brief, PC-3M cells and C4-2 cells were seeded into 96-well plates (4.0 × 10 3 cells/well) and transfected with NEIL3 siRNA and negative control siRNA, separately. The cells and incubated with serum-free medium to a final volume of 100 μL. Each well was filled with 10µL CCK8 reagent, in accordance with the CCK8 instructions (Beyotime, Shanghai, China). The plate was further incubated for 4 h in the dark at 37°C and the absorbance at 450 nm was measured. Each assay was performed three times. Wound healing assay We used the scratch assay to evaluate cell migration following wounding. Cells were seeded into a 6-well plate and transfected with NEIL3 siRNA and negative control siRNA, separately. Upon reaching confluency, a scratch was made in the monolayer of cells using a cell scratch spatula. After 48h, the relative migration distance to the scratch area was photographed. Transwell assay Transwell plates with matrigel-coated upper chambers were used for the matrigel invasion assay. Transfected cells were plated to transwell plates of 8-μm pore size transwell plates (Corning, MA, USA). Cells that appeared on the undersurface of the filter were fixed with methanol, stained with 0.1 % crystal violet, and counted under a microscope approximately 24 hours after seeding. RNA isolation and RNA-sequencing RNA was isolated from C4-2 cells using the CELL RNA kit (YEASEN, Shanghai, China). RNA quality was assessed by a microplate reader (Invitrogen, USA). RNA sequencing was performed between si-NC and si-NEIL3 group. Differential expression analysis after NEIL3 knockdown was performed using the DESeq2 R package (1.20.0). DEGs with |log2FC|>1 and P -adjust <0.05 were considered to be significantly different expressed genes. A total of 293 DEGs was identified and then performed cluster analysis on DEGs. The GO and KEGG enrichment analysis of differential genes can explain the functional enrichment of DEGs and clarify the differences at the gene function level. We use cluster Profiler R software package for GO function enrichment and KEGG pathway enrichment analysis. P < 0.05 was considered that the GO or KEGG function is significantly enriched. Statistical analysis All statistics were analyzed using GraphPad Prism 9. Results are presented as mean ± SD. Mann-Whitney tests or one-way ANOVA were used to determine statistical significance. P value ≤0.05 was considered to be significant. Results NEIL3 is overexpression in PCa tissues and cell lines We found that the comparison of the NEIL3 gene in 498 PCa tumor tissues and 52 adjacent non-tumor samples from TCGA dataset (Fig.1A). Meanwhile, based on TCGA database, PCa patients with high NEIL3 levels had poorer overall survival (OS) using Kaplan-Meier survival analysis (Fig.1B). In addition, we used western blot and qRT-PCR to determine the protein expression (Fig. 1C) and mRNA expression (Fig. 1D) of NEIL3 in PC-3M, DU145 and C4-2 cell lines in comparison to RWPE-1. The results showed that the NEIL3 was higher expression in PC-3M, DU145 and C4-2 cell lines compared with RWPE-1 cell line. Taken together, NEIL3 was increased in PCa which is associated with shorter OS. Knockdown of NEIL3 inhibits the proliferation of PCa cells To explore whether NEIL3 could influence the proliferation of PCa cells, cell viability (CCK-8) assay was used to detected cell growth, and the expression of the proliferation associated gene (Ki67) was assessed in C4-2 and PC-3M cells. According to the above results, the expression of NEIL3 was increased in C4-2 and PC-M cells, we therefore knocked down its expression in both the two cell lines (Fig. 2A and 2B). The result of CCK8 demonstrated that NEIL3 knockdown could significantly suppressed cell growth in both C4-2 and PC-M cells (Fig. 2C). In addition, the expression of Ki67 was decreased by knocking down NEIL3 with both mRNA (Fig. 2D) and protein (Fig. 2E and 2F) levels in C4-2 and PC-M cells. All of these results indicated knocking down NEIL3 can inhibit cell proliferation in PCa cells. Knockdown of NEIL3 inhibits migration and invasion of PCa cells To evaluate the effects of NEIL3 on migratory and invasive properties of PCa cells, NEIL3 was knocked down in C4-2 and PC-M cells. Then we investigated the potential role of NEIL3 in modulating the migration and invasion abilities of C4-2 and PC-M cells by wound healing assay, transwell assay, as well as detecting the expressions of the matrix metalloproteinase (MMP) genes (MMP2 and MMP9). The results of wound healing assays showed that the migration rate of PCa cells (C4-2 and PC-M) with NEIL3 knockdown was lower than these cells without knocking down NEIL3, which suggested that knocking down NEIL3 suppressed the migration of C4-2 and PC-M cells (Figure 3A and 3B). Next, we used transwell assays with matrigel to determine the invasion abilities of C4-2 and PC-M cells with or without knocking down NEIL3. The results revealed that the invasion cell numbers of C4-2 or PC-M was more slowly with NEIL3 knockdown (Figure 3C and 3D). Besides, we also measured the expressions of MMP2 and MMP9 by qRT-PCR and Western blot to evaluate NEIL3-mediating the migration and invasion of C4-2 and PC-M cells. These results showed that si-NEIL3 could repress the mRNA and protein expressions of MMP2 and MMP9 in both C4-2 cells (Fig. 3E, 3G and 3H) and PC-M cells (Fig. 3F, 3G and 3I). The above results revealed that NEIL3 knockdown can inhibit the migration and invasion of PCa cells. Knockdown of NEIL3 can inactivate PI3K/AKT/mTOR signaling As it is reported, the PI3K/AKT/mTOR pathway has been implicated in the development of many cancers, including prostate cancer [12]. As a consequence, Western blot was used to detect the expression levels of p-PI3K, PI3K, p-AKT, AKT, p-mTOR and mTOR in both C4-2 cells and PC-M cells to investigate whether NEIL3 can affect PI3K/AKT/mTOR signaling. The result showed NEIL3 knockdown inhibited the expressions of these proteins and the PI3K, AKT as well as mTOR phosphorylation levels in both C4-2 cells (Figure 4A and 4B) and PC-M cells (Figure 4C and 4D). Furthermore, pharmacological activation of PI3K/AKT/mTOR signaling by insulin growth factor-1 (IGF-1) (100ng/mL) enhanced si-NEIL3-inhibited AKT and mTOR phosphorylation levels, but it does not affect the expression of NEIL3 in C4-2 cells (Figure 5A and 5B) and PC-M cells (Figure 5C and 5D). Besides, we found that IGF-1 could also increase si-NEIL3-inhibited the expression of MMP2 and MMP9 proteins in C4-2 cells (Figure 5A and 5E) and PC-M cells (Figure 5C and 5F). All these results showed that knockdown of NEIL3 might inhibit the expression of MMP2 and MMP9 to repress the metastasis of PCa by inactivating PI3K/AKT/mTOR signaling. Knockdown of NEIL3 suppresses the proliferation, migration and invasion of PCa cells by inactivating PI3K/AKT/mTOR signaling To investigate the potential mechanism of NEIL3-mediating the migration and invasion, we used CCK8, wound healing and transwell assays to detect the migration and invasion abilities in C4-2 and PC-M cells with or without SF79 by knocking down NEIL3. We found that this activator could increase siNEIL3-inhibited proliferation of C4-2 and PC-M cells (Figure 6A). The results of wound healing assays showed that this activator could increase siNEIL3-inhibited migration in both C4-2 (Figure 6B) and PC-M (Figure 6C) cells. Additionally, the results of transwell assays revealed that this activator could also increase siNEIL3-inhibited invasion in both C4-2 (Figure 6D). Collectively, according to these results, we could know that knockdown of NEIL3 suppresses the proliferation, migration and invasion of PCa cells by inactivating PI3K/AKT/mTOR signaling. Knocking down NEIL3 inhibits the expression of androgen receptor (AR) We collected the total RNAs of C4-2 cells with or without siNEIL3 for RNA sequencing. According to the results of RNA-sequencing, we found that there were 293 differentially expressed genes (DEGs) included 85 up-regulated genes and 208 down-regulated genes between siNC group and siNEIL3 group (Fig. 7A). Among them, the high-mobility gene group A2 (HMGA2) was significantly decreased in siNEIL3 group (Fig. 7C). Next, we found that downregulation of HMGA2 is associated with regulation of steroid hormone receptors according to the Gene Ontology Enrichment Analysis of DEGs (Fig. 7D and 7E), while androgens belong to the category of steroid receptors. Therefore, we used western blot to analyze the expression of HMGA2 and androgen receptor (AR). Their expression was significantly decreased in C4-2 cells with knockdown of NEIL3 (Fig. 7F and 7G). These results indicate that knockdown of NEIL3 can repress the expression of AR. Discussion As a class of DNA glycosylases, NEIL3 is involved in DNA repair. It has reported that its abnormal expression is associated with cardiovascular diseases, neurological disorders and cancers [1]. NEIL3 was overexpressed in multiple types of human cancers, including glioblastoma multiforme, hepatocellular carcinoma, breast cancer, non-small cell lung cancer and pancreatic adenocarcinoma, etc.[5] [1]. It was also reported that patients with these cancers had poorer OS with NEIL3 overexpression[5]. In this study, we found that NEIL3 also overexpressed in patients with PCa by obtaining and analyzing the related genetic data regarding PCa from TCGA. Besides, its overexpression predicted poorer survival, which was consistent with the role of NEIL3 in other cancers, such as colorectal cancer, liver cancer, lung cancer, etc. [10]. All of these results suggested that NEIL3 may serve very important roles in PCa in the clinic. Research have reported that NEIL3 was down-regulated in castration-resistant and neuroendocrine PCa cell lines, and that deficiency of NEIL3 could enhance the chemotherapy and radiotherapy resistance of PCa cells (Wang, Xu et al. 2021)[11]. Nevertheless, we didn’t discuss the effects of NEIL3 in the chemotherapy and radiotherapy resistance. Here, we mainly discuss that the proliferation, metastasis and invasion of PCa cell lines were inhibited by knocking down NEIL3, which indicated that it may be a potential therapeutic target for PCa with NEIL3 knockdown. It has reported that NEIL3 can promote the progression of cancer via multiple molecular mechanisms [10]. In both lung cancer and liver cancer, NEIL3 mediates the carcinogenesis by modulating PI3K/AKT/mTOR signaling[13, 14]. According to the previous study, PI3K/AKT/mTOR signaling is activating in most of PCa patients, and it is a therapeutic approach for PCa by inhibiting this signaling pathway[15, 16]. Here, we found that the phosphorylation levels of PI3K, AKT and mTOR were significantly decreased in the two cell lines treated with knocking down NEIL3. This result implied that the expression of NEIL3 may be positively correlated with the activation of PI3K/AKT/mTOR signaling. Therefore, we next used IGF-1 to activate this signaling or not in C4-2 and PC-M cells NEIL3 knockdown. We found that IGF-1 could enhance siNEIL3-inhibited p-mTOR and p-AKT level, but not the protein level of NEIL3. Additionally, IGF-1 could increase siNEIL3-decreasd the proliferation, metastasis and invasion in both C4-2 and PC-3M cells. Similarly, we found that IGF-1 could increase siNEIL3-decreasd MMP2 and MMP9 expression in both C4-2 and PC-3M cells. According to this result, we supposed that NEIL3 may act as an upstream regulatory factor of PI3K/AKT/mTOR signaling to promote the progression of PCa. AR, as the main driver of PCa progression, is positive in the majority of patients’ tissues[17-19]. In the present study, we found that knockdown of NEIL3 could inhibit the expression of AR protein in C4-2 cells. It has proved that PI3K-AKT-mTOR signaling could interact with other pathways to, including AR signaling[20, 21]. However, it needs furthermore experiments to verify whether NEIL3 regulates the expression of AR through PI3K/AKT/mTOR signaling. In summary, NEIL3 is overexpressed in PCa tissues and cell lines. Additionally, there are more aggressive clinical features and worse prognostic outcomes in PCa patients with NEIL3 overexpression. In vitro, PCa cell proliferation, invasion, and migration could be significantly inhibited with knocking down NEIL3 by inactivating PI3K/Akt/mTOR signaling, which indicates that NEIL3 could promotes the carcinogenesis of PCa by activating this pathway. Besides, based on the results of RNA-sequencing, we found that the protein expression of HMGA2 and AR were decreased in C4-2 cells treated with siNEIL3. This result suggests that NEIL3 regulates the progression of PCa by modulating the expression of AR. Meanwhile, this study has some limitations. It is still unknown whether NEIL3 regulates the expression of AR through PI3K/AKT/mTOR signaling. Therefore, we will conduct furthermore experiments to validate it. Declarations Funding The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Wei Zhang, Zihao Liu, Simeng Wen, Yuan Shao and Zhen Yang. The first draft of the manuscript was written by Wei Zhang and Yong Wang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data Availability Data supporting Fig.1-7, Table1 are publicly available in the figshare repository. References Chen L, Huan X, Gao XD, Yu WH, Xiao GH, Li TF, Wang ZY and Zhang YC. Biological Functions of the DNA Glycosylase NEIL3 and Its Role in Disease Progression Including Cancer. Cancers. 2022;14:10.3390/cancers14235722 Tidd-Johnson A, Sebastian SA, Co EL, Afaq M, Kochhar H, Sheikh M, Mago A, Poudel S, Fernandez JA, Rodriguez ID and Razdan S. Prostate cancer screening: Continued controversies and novel biomarker advancements. Current urology. 2022;16:197-206.10.1097/cu9.0000000000000145 Albelazi MS, Martin PR, Mohammed S, Mutti L, Parsons JL and Elder RH. The Biochemical Role of the Human NEIL1 and NEIL3 DNA Glycosylases on Model DNA Replication Forks. Genes. 2019;10:10.3390/genes10040315 Dickinson K, Hammond L, Akpa M, Chu LL, Lalonde CT, Goumba A and Goodyer P. WT1 regulates expression of DNA repair gene Neil3 during nephrogenesis. American journal of physiology Renal physiology. 2023;324:F245-f255.10.1152/ajprenal.00207.2022 Tran OT, Tadesse S, Chu C and Kidane D. Overexpression of NEIL3 associated with altered genome and poor survival in selected types of human cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2020;42:1010428320918404.10.1177/1010428320918404 Zhang F, Wang B, Zhang W, Xu Y, Zhang C and Xue X. Transcription Factor MAZ Potentiates the Upregulated NEIL3-mediated Aerobic Glycolysis, Thereby Promoting Angiogenesis in Hepatocellular Carcinoma. Current cancer drug targets. 2024;10.2174/0115680096265896231226062212 Lai HH, Hung LY, Yen CJ, Hung HC, Chen RY, Ku YC, Lo HT, Tsai HW, Lee YP, Yang TH, Chen YY, Huang YS and Huang W. NEIL3 promotes hepatoma epithelial-mesenchymal transition by activating the BRAF/MEK/ERK/TWIST signaling pathway. The Journal of pathology. 2022;258:339-352.10.1002/path.6001 Wang T, Zhu X, Wang K, Li J, Hu X, Lin P and Zhang J. Transcriptional factor MAZ promotes cisplatin-induced DNA damage repair in lung adenocarcinoma by regulating NEIL3. Pulmonary pharmacology & therapeutics. 2023;80:102217.10.1016/j.pupt.2023.102217 Klattenhoff AW, Thakur M, Chu CS, Ray D, Habib SL and Kidane D. Loss of NEIL3 DNA glycosylase markedly increases replication associated double strand breaks and enhances sensitivity to ATR inhibitor in glioblastoma cells. Oncotarget. 2017;8:112942-112958.10.18632/oncotarget.22896 Wang Y, Xu L, Shi S, Wu S, Meng R, Chen H and Jiang Z. Deficiency of NEIL3 Enhances the Chemotherapy Resistance of Prostate Cancer. Int J Mol Sci. 2021;22:10.3390/ijms22084098 Wang Q, Li Z, Yang J, Peng S, Zhou Q, Yao K, Cai W, Xie Z, Qin F, Li H, Chen X, Li K and Huang H. Loss of NEIL3 activates radiotherapy resistance in the progression of prostate cancer. Cancer biology & medicine. 2021;19:1193-1210.10.20892/j.issn.2095-3941.2020.0550 Kaarbø M, Mikkelsen OL, Malerød L, Qu S, Lobert VH, Akgul G, Halvorsen T, Maelandsmo GM and Saatcioglu F. PI3K-AKT-mTOR pathway is dominant over androgen receptor signaling in prostate cancer cells. Cellular oncology : the official journal of the International Society for Cellular Oncology. 2010;32:11-27.10.3233/clo-2009-0487 Huang H and Hua Q. NEIL3 Mediates Lung Cancer Progression and Modulates PI3K/AKT/mTOR Signaling: A Potential Therapeutic Target. International journal of genomics. 2022;2022:8348499.10.1155/2022/8348499 Wang W, Yin Q, Guo S and Wang J. NEIL3 contributes toward the carcinogenesis of liver cancer and regulates PI3K/Akt/mTOR signaling. Experimental and therapeutic medicine. 2021;22:1053.10.3892/etm.2021.10487 Roudsari NM, Lashgari NA, Momtaz S, Abaft S, Jamali F, Safaiepour P, Narimisa K, Jackson G, Bishayee A, Rezaei N, Abdolghaffari AH and Bishayee A. Inhibitors of the PI3K/Akt/mTOR Pathway in Prostate Cancer Chemoprevention and Intervention. Pharmaceutics. 2021;13:10.3390/pharmaceutics13081195 Shorning BY, Dass MS, Smalley MJ and Pearson HB. The PI3K-AKT-mTOR Pathway and Prostate Cancer: At the Crossroads of AR, MAPK, and WNT Signaling. Int J Mol Sci. 2020;21:10.3390/ijms21124507 Ehsani M, David FO and Baniahmad A. Androgen Receptor-Dependent Mechanisms Mediating Drug Resistance in Prostate Cancer. Cancers (Basel). 2021;13:10.3390/cancers13071534 Pisano C, Tucci M, Di Stefano RF, Turco F, Scagliotti GV, Di Maio M and Buttigliero C. Interactions between androgen receptor signaling and other molecular pathways in prostate cancer progression: Current and future clinical implications. Crit Rev Oncol Hematol. 2021;157:103185.10.1016/j.critrevonc.2020.103185 Sakellakis M and Flores LJ. Androgen receptor signaling-mitochondrial DNA-oxidative phosphorylation: A critical triangle in early prostate cancer. Current urology. 2022;16:207-212.10.1097/cu9.0000000000000120 Tortorella E, Giantulli S, Sciarra A and Silvestri I. AR and PI3K/AKT in Prostate Cancer: A Tale of Two Interconnected Pathways. Int J Mol Sci. 2023;24:10.3390/ijms24032046 Raith F, O'Donovan DH, Lemos C, Politz O and Haendler B. Addressing the Reciprocal Crosstalk between the AR and the PI3K/AKT/mTOR Signaling Pathways for Prostate Cancer Treatment. Int J Mol Sci. 2023;24:10.3390/ijms24032289 Table Table 1 The primers for real-time PCR qRT-PCR Primer Sequences Gene Forward primer (5′→3′) Reverse primer (5′→3′) Ki67 CTGACCCTGATGAGAGTGAGGG TGGTTGAGGCTGTTCCTTGA MMP2 ACAAGTGGTCCGCGTAAAGT AGTCTGTGGTGGAGGAGATCA MMP9 GGAATTTGTTTAGGTTTGGGATTT CCCTTCATCCACAAAAATACCT β-actin GTTGCTATCCAGGCTGTGCT GAGGGCATACCCCTCGTAGA Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 16 Oct, 2024 Reviews received at journal 14 Oct, 2024 Reviewers agreed at journal 11 Oct, 2024 Reviews received at journal 10 Oct, 2024 Reviewers agreed at journal 09 Oct, 2024 Reviewers agreed at journal 09 Oct, 2024 Reviewers agreed at journal 03 Oct, 2024 Reviewers invited by journal 01 Oct, 2024 Editor assigned by journal 30 Sep, 2024 Submission checks completed at journal 26 Sep, 2024 First submitted to journal 14 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5087118","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":366633727,"identity":"a41b9812-0ee1-4959-a448-1f9ab52259e2","order_by":0,"name":"Wei Zhang","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhang","suffix":""},{"id":366633728,"identity":"b513c4a2-e956-4906-8497-417c6bcb2037","order_by":1,"name":"Zihao Liu","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zihao","middleName":"","lastName":"Liu","suffix":""},{"id":366633729,"identity":"7ad6106f-057c-47aa-8e42-53921112a665","order_by":2,"name":"Simeng Wen","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Simeng","middleName":"","lastName":"Wen","suffix":""},{"id":366633730,"identity":"1366fdd6-40d6-4915-a727-32976dece5ed","order_by":3,"name":"Yuan Shao","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Shao","suffix":""},{"id":366633731,"identity":"66fb9b88-8ceb-4cac-9da0-f3059959c47c","order_by":4,"name":"Zhen Yang","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Yang","suffix":""},{"id":366633732,"identity":"770626a0-bb47-4a3a-8695-ff264970fdcb","order_by":5,"name":"Yong Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAm0lEQVRIiWNgGAWjYFAC5gMQ+gDxWtgSG0jVwmNIohaDGznfH91sY5Dju5HA+LmAOC25G5tz2xiMJW8kMEvPIEaLGVRL4oYbCWzMPMRpyXkI0lJPkhZGkJYEA6K12J95Zjg755yE4cwzD5ulidIi2Z784HNOmY083/Hkg5+J0sIgkAAiJYCYsYEoDQwM/AeIVDgKRsEoGAUjFwAAJLYzIMPPKSEAAAAASUVORK5CYII=","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":true,"prefix":"","firstName":"Yong","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-09-14 05:29:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5087118/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5087118/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":71539969,"identity":"35ccd7c6-b883-4000-a206-aaa4fdbf5c6e","added_by":"auto","created_at":"2024-12-16 14:32:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":369438,"visible":true,"origin":"","legend":"\u003cp\u003eNEIL3 was upregulated in PCa and was associated with worse clinical features. (A) A higher NEIL3 expression was found in PCa tissues. (B) NEIL3 overexpression correlates with reduced OS. (C and D) Western blot for the expression of NEIL3 protein in normal human prostate epithelial cell (RWPE-1) and PCa cells (PC-3M, DU145 and C4-2 cells). Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/1b723abbae0731dfe091944c.png"},{"id":71537655,"identity":"d5c7a670-7b95-4a4b-b127-85d809e97f5a","added_by":"auto","created_at":"2024-12-16 14:16:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":730684,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of NEIL3 inhibits the proliferation of PCa cells. (A and B) The protein levels of NEIL3 were measured in PCa cells (C4-2 and PC-3M cells) by western blot with (si-NEIL3) or without knockdown of NEIL3 (si-Con). (C) CCK8 analysis determined the cell viability in both C4-2 and PC-3M cells. (D) The mRNA levels of Ki67were measured in both C4-2 and PC-3M cells by qRT-PCR. (E and F) Western blot analysis determined Ki67 expressions in both C4-2 and PC-3M cells. Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/528fe3384ee0b5754a70f645.png"},{"id":71539185,"identity":"b8987b46-9bac-42df-8268-94f8cfd2c8ad","added_by":"auto","created_at":"2024-12-16 14:24:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2567451,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of NEIL3 on migratory and invasive properties of PCa cells with NEIL3 knockdown. (A and B) Wound healing assay was performed in both C4-2 and PC-M cells with (si-NEIL3) or without NEIL3 (si-NC). (C and D) Transwell assay was performed in both C4-2 and PC-M cells with (si-NEIL3) or without NEIL3 (si-NC). (E and F) The mRNA levels of MMP2 and MMP9 were measured in both C4-2 and PC-3M cells by qRT-PCR. (G, H and I) Western blot was used to determine the protein levels of MMP2 and MMP9 in both C4-2 and PC-3M cells. Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/05bc3171ef8b820d0116132b.png"},{"id":71537656,"identity":"9a41eae3-212a-4039-a233-88ad801c5750","added_by":"auto","created_at":"2024-12-16 14:16:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":254412,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of NEIL3 can inactivate PI3K/AKT/mTOR signaling. (A and B) The PI3K, AKT and mTOR phosphorylation levels were detected by western blot in C4-2 cells. (C and D) The PI3K, AKT and mTOR phosphorylation levels were detected by western blot in PC-M cells. Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/7afb62f33f2c5b34b8af33f9.png"},{"id":71539187,"identity":"620f4121-a627-4323-98c7-2ce495b53ae2","added_by":"auto","created_at":"2024-12-16 14:24:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":694665,"visible":true,"origin":"","legend":"\u003cp\u003eIGF-1 can enhance siNEIL3-decreasd the proliferation, metastasis and invasion by activating PI3K/AKT/mTOR signaling. (A, B and E) Western blot was used to examine the protein expression of mTOR, AKT, MMP2, MMP9, as well as the phosphorylation levels of mTOR and AKT in C4-2 cells. (C, D and F) Western blot was used to examine the protein expression of mTOR, AKT, MMP2, MMP9, as well as the phosphorylation levels of mTOR and AKT in PC-3M cells. Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/459f7ba6e6a3d84092e26947.png"},{"id":71537661,"identity":"01fa48f8-ffa8-4715-acd1-fc226626c796","added_by":"auto","created_at":"2024-12-16 14:16:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2526081,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of NEIL3 suppresses the proliferation, migration and invasion of PCa cells by inactivating PI3K/AKT/mTOR signaling. (A) CCK8 determined cell viability in C4-2 and PC-3M cells. (B) Wound healing assay was performed in C4-2 cells. (C) Wound healing assay was conducted in PC-M cells and PC-M cells. (D) Transwell assay was performed in both C4-2 and PC-M cells. Data are presented as mean ± SD, n = 3, for *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/bc9349e4f1afbef51e98b5ad.png"},{"id":71537658,"identity":"e27920cc-ab37-4d4b-a8c4-f7d3a7e7b538","added_by":"auto","created_at":"2024-12-16 14:16:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":517231,"visible":true,"origin":"","legend":"\u003cp\u003eKnocking down NEIL3 inhibits the expression of AR. (A) Volcano plot showed DEGs included 85 up-regulated genes and 208 down-regulated genes in C4-2 cells treated with (si-NEIL3) or without NEIL3 knockdown (si-NC). (B) The KEGG enrichment analysis showed the related pathways in C4-2 cells treated with (si-NEIL3) or without NEIL3 knockdown (si-NC). (C) A subset of the differentially expressed proteins detected in C4-2cells treated with (si-NEIL3) or without NEIL3 knockdown (si-NC) by microarray analysis was selected and summarized. (D) The Gene Ontology enrichment analysis showed the significantly functions of HMGA2 in C4-2cells treated with (si-NEIL3) or without NEIL3 knockdown (si-NC). (F and G) Western blot was used to detect the AR, HMGA and NEIL3 expression in PCa cells treated with (si-NEIL3) or without NEIL3 knockdown (si-NC). Data are presented as mean ± SD, n = 3, for **P\u0026lt;0.01, ***P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/555cbb42a76f53af04819a17.png"},{"id":71539970,"identity":"02c7973e-dfca-4900-acdc-926ea55fe781","added_by":"auto","created_at":"2024-12-16 14:33:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8961530,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5087118/v1/6a9c8881-6740-4d40-98d4-b5752dfd35ea.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"NEIL3 Promotes the Carcinogenesis of Prostate Cancer by Activating PI3K/Akt/mTOR Signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eProstate cancer (PCa), ranking fourth in terms of incidence and eighth in terms of mortality, is one of the most common cancers worldwide. According to the Global Cancer Observatory (GCO) (gco.iarc.fr, accessed on 8 February 2024), there were 1,467,854 new cases and 397,430 deaths of PCa globally in 2022. However, screening and treatment for prostate cancer have their limitations[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, it is urgent to clarify molecular mechanisms underlying the occurrence, progression, and metastasis of PCa.\u003c/p\u003e \u003cp\u003eNei endonuclease VIII-like 3 (NEIL3), which is a mainly a monofunctional DNA glycosylase belonging to the bacterial Fpg/Nei like family, plays important roles in diverse physiological and pathophysiological processes[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It can function in DNA alcoholization repair, immune response regulation, nervous system development and function, and DNA damage signal transduction. It was reported that the repair function of NEIL3 associated with the DNA replication, correlating with induced expression of the proteins in S/G2 phases of the cell cycle and responding to genomic injury during kidney development[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As a novel tumor-related gene, NEIL3 is overexpressed in multiple human cancers, including glioblastoma multiforme, breast cancer, pancreatic adenocarcinoma, lung adenocarcinoma, renal clear cell carcinoma, kidney renal papillary cell carcinoma [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The upregulation of NEIL3 is involved in glycolysis, angiogenesis and metastasis of hepatocellular carcinoma [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In addition, NEIL3 could propel the cisplatin resistance in lung adenocarcinoma by repressing DNA damage[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Loss of NEIL3 could markedly enhance the sensitivity to ataxia-telangiectasia-mutated-and-Rad3-related kinase (ATR) inhibitors in glioblastoma cells[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, NEIL3 was downregulated in castration-resistant and neuroendocrine PCa cell lines [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It has reported that NEIL3 could regulate chemotherapy resistance, and deficiency of NEIL3 could enhance the chemotherapy resistance of PCa [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Another study showed that NEIL3 could also promote the sensitivity of PCa cells to radiotherapy by affecting the cell cycle activity through the regulation of ATR/ checkpoint kinase 1 (CHK1) pathway[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the role of NEIL3 in PCa has not been conclusively clarified.\u003c/p\u003e \u003cp\u003eHere, we analyzed the related data of PCa from The Cancer Genome Atlas (TCGA) database to explore whether NEIL3 is over-expressed in PCa patients or not. Additionally, we knocked down its expression to investigate whether NEIL3 can affect the ability of proliferation, invasion, and migration in PCa cells. Furthermore, we discussed the possible mechanisms underlying the observed therapeutic effects, as well as whether NEIL3 could influence the expression of AR in PCa cell lines.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cem\u003eGene expression profile and patient clinical data\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe gene expression profiles and clinical data of PCa patients were from TCGA database (https://cancergenome.nih.gov/). 550 samples were collected for integrated bioinformatics analysis, including 498 PCa tumor tissues and 52 adjacent non-tumor samples. According to the regional lymph node metastasis, 498 PCa samples divide into 249 N0 stage and 249 N1 stage. The disease-free survival (DFS) was analyzed using the Kaplan-Meier approach based on the mean value of NEIL3. In this study, there was no need for ethical approval as all data which were downloaded from TCGA. In addition, the data processing met the guidelines of TCGA publication (https://cancergenome.nih.gov/publications/guidelines).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell lines and cell culture\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHuman normal prostate epithelial cell line (RWPE-1) and human PCa cell lines (PC-3M, DU145 and C4-2) were purchased from Procell Life Science\u0026amp;Technology Co.,Ltd. Cells were cultured on RPMI-1640 cell medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 100 U/mL penicillin-streptomycin at 37 °C in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. Cell lines were grown in culture flasks at 80% to 90% confluence and harvested with trypsin/EDTA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSmall interfering RNA (siRNA) transfection\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe siRNA duplexes targeting human NEIL3 (si-NEIL3), 5’-CAAUCAGUUCAGAAUCUAATT-3’ and 5’- UUAGAUUCUGAACUGAUUGTT-3’, were obtained from Sangon Biotech (Shanghai, China). A scrambled siRNA (si-NC), 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’, served as the negative control (Sangon Biotech, Shanghai, China). The siRNAs were transiently transfected into human PCa cell lines using Lipofectamine RNAiMax reagent according to the manufacturer’s instructions (Invitrogen, USA). We transfected PC-3M cells or C4-2 cells with 50 nmol siRNA per 6-cm plate with 10 μL RNAiMax for 48 h.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRNA isolation and quantitative real-time PCR (qRT-PCR)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe total RNAs of cells were\u0026nbsp;isolated using TRIzol reagent (Invitrogen, USA) and quantified with RiboGreen Quantification Reagent (Invitrogen, USA). 1 μg of total RNAs were included in each reverse transcriptase reaction with HiScript IV RT SuperMix (Vazyme, China), according to the manufacturer's protocol. qRT-PCRs were performed using FastStart SYBR Green Master (Roche). Relative mRNA expression was normalized to \u003cem\u003egapdh\u003c/em\u003e levels, using the 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e method. The sequence for each primer was in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWestern blot\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRIPA lysis solution was used to prepare cell lysates. We centrifuged the lysates and collected the supernatant. Quantitative protein sample was to 5 × loading buffer and degenerated the sample under high temperature conditions. Proteins were electrophoresed and transferred to PDVF membranes. The membranes were blocked for 2 hours with 5% BSA in TBST and then incubated with primary antibodies against NEIL3 (1:1000, Proteintech, Wuhan, China), Ki67(1:500, Affinity, Jiangsu, China), MMP2(1:500, Affinity, Jiangsu, China), MMP9(1:300, Affinity, Jiangsu, China), PI3K(1:1000, Affinity, Jiangsu, China), AKT(1:1000, Affinity, Jiangsu, China), mTOR(1:1000, Affinity, Jiangsu, China), p-mTOR(1:1000, Affinity, Jiangsu, China), p-AKT\u0026nbsp;(1:1000, Cell Signaling Technology, Massachusetts, USA), HMGA2(1:1000, Cell Signaling Technology, Massachusetts, USA), AR(1:1000, Cell Signaling Technology, Massachusetts, USA), β-actin (1:3000, AbClonal, Wuhan, China). Appropriate secondary antibodies were conjugated to horseradish peroxidase (1:1000, Seracare, Gaithersburg, MD, USA). The immunoreactive bands were detected and visualized using the ECL Advance reagent (Meilun, Dalian, China).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell viability assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCell Counting Kit-8 (CCK-8) (Beyotime, Shanghai, China) was used in the cell viability assay. In brief, PC-3M cells and C4-2 cells were seeded into 96-well plates (4.0 × 10\u003csup\u003e3\u003c/sup\u003e cells/well) and transfected with NEIL3 siRNA and negative control siRNA, separately. The cells and incubated with serum-free medium to a final volume of 100 μL. Each well was filled with 10µL CCK8 reagent, in accordance with the CCK8 instructions (Beyotime, Shanghai, China). The plate was further incubated for 4 h in the dark at 37°C and the absorbance at 450 nm was measured. Each assay was performed three times.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWound healing assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe used the scratch assay to evaluate cell migration following wounding. Cells were seeded into a 6-well plate and transfected with NEIL3 siRNA and negative control siRNA, separately. Upon reaching confluency, a scratch was made in the monolayer of cells using a cell scratch spatula. After 48h, the relative migration distance to the scratch area was photographed.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTranswell assay\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTranswell plates with matrigel-coated upper chambers were used for the matrigel invasion assay. Transfected cells were plated to transwell plates of 8-μm pore size transwell plates (Corning, MA, USA). Cells that appeared on the undersurface of the filter were fixed with methanol, stained with 0.1 % crystal violet, and counted under a microscope approximately 24 hours after seeding.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRNA isolation and RNA-sequencing\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRNA was isolated from C4-2 cells using the CELL RNA kit (YEASEN, Shanghai, China). RNA quality was assessed by a microplate reader (Invitrogen, USA). RNA sequencing was performed between si-NC and si-NEIL3 group. Differential expression analysis after NEIL3 knockdown was performed using the DESeq2 R package (1.20.0). DEGs with |log2FC|\u0026gt;1 and \u003cem\u003eP\u003c/em\u003e-adjust \u0026lt;0.05 were considered to be significantly different expressed genes. A total of 293 DEGs was identified and then performed cluster analysis on DEGs. The GO and KEGG enrichment analysis of differential genes can explain the functional enrichment of DEGs and clarify the differences at the gene function level. We use cluster Profiler R software package for GO function enrichment and KEGG pathway enrichment analysis. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered that the GO or KEGG function is significantly enriched.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll statistics were analyzed using GraphPad Prism 9. Results are presented as mean ± SD. Mann-Whitney tests or one-way ANOVA were used to determine statistical significance. \u003cem\u003eP\u003c/em\u003e value ≤0.05 was considered to be significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003eNEIL3 is overexpression in PCa tissues and cell lines\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe found that the comparison of the NEIL3 gene\u0026nbsp;in 498 PCa tumor tissues and 52 adjacent non-tumor samples from TCGA dataset (Fig.1A). Meanwhile, based on TCGA database, PCa patients with high NEIL3 levels had poorer overall survival (OS) using Kaplan-Meier survival analysis (Fig.1B). In addition, we used western blot and qRT-PCR to determine the protein expression (Fig. 1C) and mRNA expression (Fig. 1D) of NEIL3 in PC-3M, DU145 and C4-2 cell lines in comparison to RWPE-1. The results showed that the NEIL3 was higher expression in PC-3M, DU145 and C4-2 cell lines compared with RWPE-1 cell line. Taken together, NEIL3 was increased in PCa which is associated with shorter OS.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKnockdown of NEIL3\u003c/em\u003e\u003cem\u003e\u0026nbsp;inhibits the proliferation of PCa cells\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo explore whether NEIL3 could influence the proliferation of PCa cells, cell viability (CCK-8) assay was used to detected cell growth, and the expression of the proliferation associated gene (Ki67) was assessed in C4-2 and PC-3M cells. According to the above results, the expression of NEIL3 was increased in C4-2 and PC-M cells, we therefore knocked down its expression in both the two cell lines (Fig. 2A and 2B). The result of CCK8 demonstrated that NEIL3 knockdown could significantly suppressed cell growth in both C4-2 and PC-M cells (Fig. 2C). In addition, the expression of Ki67 was decreased by knocking down NEIL3 with both mRNA (Fig. 2D) and protein (Fig. 2E and 2F) levels in C4-2 and PC-M cells. All of these results indicated knocking down NEIL3 can inhibit cell proliferation in PCa cells.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKnockdown of NEIL3 inhibits\u003c/em\u003e \u003cem\u003emigration and invasion of PCa cells\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the effects of NEIL3 on migratory and invasive properties of PCa cells, NEIL3 was knocked down in C4-2 and PC-M cells. Then we investigated the potential role of NEIL3 in modulating the migration and invasion abilities of C4-2 and PC-M cells by wound healing assay, transwell assay, as well as detecting the expressions of the matrix metalloproteinase (MMP) genes (MMP2 and MMP9). The results of wound healing assays showed that the migration rate of PCa cells (C4-2 and PC-M) with NEIL3 knockdown was lower than these cells without knocking down NEIL3, which suggested that knocking down NEIL3 suppressed the migration of C4-2 and PC-M cells (Figure 3A and 3B). Next, we used transwell assays with matrigel to determine the invasion abilities of C4-2 and PC-M cells with or without knocking down NEIL3. The results revealed that the invasion cell numbers of C4-2 or PC-M was more slowly with NEIL3 knockdown (Figure 3C and 3D). Besides, we also measured the expressions of MMP2 and MMP9 by qRT-PCR and Western blot to evaluate NEIL3-mediating the migration and invasion of C4-2 and PC-M cells. These results showed that si-NEIL3 could repress the mRNA and protein expressions of MMP2 and MMP9 in both C4-2 cells (Fig. 3E, 3G and 3H) and PC-M cells (Fig. 3F, 3G and 3I). The above results revealed that NEIL3 knockdown can inhibit the migration and invasion of PCa cells.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKnockdown of NEIL3 can inactivate PI3K/AKT/mTOR signaling\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs it is reported, the PI3K/AKT/mTOR pathway has been implicated in the development of many cancers, including prostate cancer [12]. As a consequence, Western blot was used to detect the expression levels of p-PI3K, PI3K, p-AKT, AKT, p-mTOR and mTOR in both C4-2 cells and PC-M cells to investigate whether NEIL3 can affect PI3K/AKT/mTOR signaling. The result showed NEIL3 knockdown inhibited the expressions of these proteins and the PI3K, AKT as well as mTOR phosphorylation levels in both C4-2 cells (Figure 4A and 4B) and PC-M cells (Figure 4C and 4D). Furthermore, pharmacological activation of PI3K/AKT/mTOR signaling by insulin growth factor-1 (IGF-1) (100ng/mL) enhanced si-NEIL3-inhibited AKT and mTOR phosphorylation levels, but it does not affect the expression of NEIL3 in C4-2 cells (Figure 5A and 5B) and PC-M cells (Figure 5C and 5D). Besides, we found that IGF-1 could also increase si-NEIL3-inhibited the expression of MMP2 and MMP9 proteins in C4-2 cells (Figure 5A and 5E) and PC-M cells (Figure 5C and 5F). All these results showed that knockdown of NEIL3 might inhibit the expression of MMP2 and MMP9 to repress the metastasis of PCa by inactivating PI3K/AKT/mTOR signaling.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKnockdown of NEIL3 suppresses the proliferation, migration and invasion of PCa cells by inactivating PI3K/AKT/mTOR signaling\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the potential mechanism of NEIL3-mediating the migration and invasion, we used CCK8, wound healing and transwell assays to detect the migration and invasion abilities in C4-2 and PC-M cells with or without SF79 by knocking down NEIL3. We found that this activator could increase siNEIL3-inhibited proliferation of C4-2 and PC-M cells (Figure 6A). The results of wound healing assays showed that this activator could increase siNEIL3-inhibited migration in both C4-2 (Figure 6B) and PC-M (Figure 6C) cells. Additionally, the results of transwell assays revealed that this activator could also increase siNEIL3-inhibited invasion in both C4-2 (Figure 6D). Collectively, according to these results, we could know that knockdown of NEIL3 suppresses the proliferation, migration and invasion of PCa cells by inactivating PI3K/AKT/mTOR signaling.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKnocking down NEIL3 inhibits the expression of androgen receptor (AR)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe collected the total RNAs of C4-2 cells with or without siNEIL3 for RNA sequencing. According to the results of RNA-sequencing, we found that there were 293 differentially expressed genes (DEGs) included 85 up-regulated genes and 208 down-regulated genes between siNC group and siNEIL3 group (Fig. 7A). Among them, the high-mobility gene group A2 (HMGA2) was significantly decreased in siNEIL3 group (Fig. 7C). Next, we found that downregulation of HMGA2 is associated with regulation of steroid hormone receptors according to the Gene Ontology Enrichment Analysis of DEGs (Fig. 7D and 7E), while androgens belong to the category of steroid receptors. Therefore, we used western blot to analyze the expression of HMGA2 and androgen receptor (AR). Their expression was significantly decreased in C4-2 cells with knockdown of NEIL3 (Fig. 7F and 7G). These results indicate that knockdown of NEIL3 can repress the expression of AR.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs a class of DNA glycosylases, NEIL3 is involved in DNA repair. It has reported that its abnormal expression is associated with cardiovascular diseases, neurological disorders and cancers [1]. NEIL3 was overexpressed in multiple types of human cancers, including glioblastoma multiforme, hepatocellular carcinoma, breast cancer, non-small cell lung cancer and pancreatic adenocarcinoma, etc.[5] [1]. It was also reported that patients with these cancers had poorer OS with NEIL3 overexpression[5]. In this study, we found that NEIL3 also overexpressed in patients with PCa by obtaining and analyzing the related\u0026nbsp;genetic data regarding PCa from TCGA. Besides, its overexpression predicted poorer survival, which was consistent with the role of NEIL3 in other cancers, such as colorectal cancer, liver cancer, lung cancer, etc.\u0026nbsp;[10]. All of these results suggested that NEIL3 may serve very important roles in PCa in the clinic. Research have reported that NEIL3 was down-regulated in castration-resistant and neuroendocrine PCa cell lines, and that deficiency of NEIL3 could enhance the chemotherapy and radiotherapy resistance of PCa cells (Wang, Xu et al. 2021)[11]. Nevertheless, we didn’t discuss the effects of NEIL3 in the chemotherapy and radiotherapy resistance. Here, we mainly discuss that the proliferation, metastasis and invasion of PCa cell lines were inhibited by knocking down NEIL3, which indicated that it may be a potential therapeutic target for PCa with NEIL3 knockdown.\u003c/p\u003e\n\u003cp\u003eIt has reported that NEIL3 can promote the progression of cancer via multiple molecular mechanisms [10]. In both lung cancer and liver cancer, NEIL3 mediates the carcinogenesis by modulating PI3K/AKT/mTOR signaling[13, 14]. According to the previous study, PI3K/AKT/mTOR signaling is activating in most of PCa patients, and it is a therapeutic approach for PCa by inhibiting this signaling pathway[15, 16].\u0026nbsp;Here, we found that the phosphorylation levels of PI3K, AKT and mTOR were significantly decreased in the two cell lines treated with knocking down NEIL3. This result implied that the expression of NEIL3 may be positively correlated with the activation of PI3K/AKT/mTOR signaling. Therefore, we next used IGF-1 to activate this signaling or not in C4-2 and PC-M cells NEIL3 knockdown. We found that IGF-1 could enhance siNEIL3-inhibited p-mTOR and p-AKT level, but not the protein level of NEIL3. Additionally, IGF-1 could increase siNEIL3-decreasd the proliferation, metastasis and invasion in both C4-2 and PC-3M cells. Similarly, we found that IGF-1 could increase siNEIL3-decreasd MMP2 and MMP9 expression in both C4-2 and PC-3M cells. According to this result, we supposed that NEIL3 may act as an upstream regulatory factor of PI3K/AKT/mTOR signaling to promote the progression of PCa.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAR, as the main driver of PCa progression, is positive in the majority of patients’ tissues[17-19]. In the present study, we found that knockdown of NEIL3 could inhibit the expression of AR protein in C4-2 cells. It has proved that PI3K-AKT-mTOR signaling could interact with other pathways to, including AR signaling[20, 21]. However, it needs furthermore experiments to verify whether NEIL3 regulates the expression of AR through PI3K/AKT/mTOR signaling.\u003c/p\u003e\n\u003cp\u003eIn summary, NEIL3 is overexpressed in PCa tissues and cell lines. Additionally, there are more aggressive clinical features and worse prognostic outcomes in PCa patients with NEIL3 overexpression. In vitro, PCa cell proliferation, invasion, and migration could be significantly inhibited with knocking down NEIL3 by inactivating PI3K/Akt/mTOR signaling, which indicates that NEIL3 could promotes the carcinogenesis of PCa by activating this pathway. Besides, based on the results of RNA-sequencing, we found that the protein expression of HMGA2 and AR were decreased in C4-2 cells treated with siNEIL3. This result suggests that NEIL3 regulates the progression of PCa by modulating the expression of AR. Meanwhile, this study has some limitations. It is still unknown whether NEIL3 regulates the expression of AR through PI3K/AKT/mTOR signaling. Therefore, we will conduct furthermore experiments to validate it.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Wei Zhang, Zihao Liu, Simeng Wen, Yuan Shao and Zhen Yang. The first draft of the manuscript was written by Wei Zhang and Yong Wang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData supporting Fig.1-7, Table1 are publicly available in the figshare repository.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen L, Huan X, Gao XD, Yu WH, Xiao GH, Li TF, Wang ZY and Zhang YC. Biological Functions of the DNA Glycosylase NEIL3 and Its Role in Disease Progression Including Cancer. Cancers. 2022;14:10.3390/cancers14235722\u003c/li\u003e\n\u003cli\u003eTidd-Johnson A, Sebastian SA, Co EL, Afaq M, Kochhar H, Sheikh M, Mago A, Poudel S, Fernandez JA, Rodriguez ID and Razdan S. Prostate cancer screening: Continued controversies and novel biomarker advancements. Current urology. 2022;16:197-206.10.1097/cu9.0000000000000145\u003c/li\u003e\n\u003cli\u003eAlbelazi MS, Martin PR, Mohammed S, Mutti L, Parsons JL and Elder RH. The Biochemical Role of the Human NEIL1 and NEIL3 DNA Glycosylases on Model DNA Replication Forks. Genes. 2019;10:10.3390/genes10040315\u003c/li\u003e\n\u003cli\u003eDickinson K, Hammond L, Akpa M, Chu LL, Lalonde CT, Goumba A and Goodyer P. WT1 regulates expression of DNA repair gene Neil3 during nephrogenesis. American journal of physiology Renal physiology. 2023;324:F245-f255.10.1152/ajprenal.00207.2022\u003c/li\u003e\n\u003cli\u003eTran OT, Tadesse S, Chu C and Kidane D. Overexpression of NEIL3 associated with altered genome and poor survival in selected types of human cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2020;42:1010428320918404.10.1177/1010428320918404\u003c/li\u003e\n\u003cli\u003eZhang F, Wang B, Zhang W, Xu Y, Zhang C and Xue X. Transcription Factor MAZ Potentiates the Upregulated NEIL3-mediated Aerobic Glycolysis, Thereby Promoting Angiogenesis in Hepatocellular Carcinoma. Current cancer drug targets. 2024;10.2174/0115680096265896231226062212\u003c/li\u003e\n\u003cli\u003eLai HH, Hung LY, Yen CJ, Hung HC, Chen RY, Ku YC, Lo HT, Tsai HW, Lee YP, Yang TH, Chen YY, Huang YS and Huang W. NEIL3 promotes hepatoma epithelial-mesenchymal transition by activating the BRAF/MEK/ERK/TWIST signaling pathway. The Journal of pathology. 2022;258:339-352.10.1002/path.6001\u003c/li\u003e\n\u003cli\u003eWang T, Zhu X, Wang K, Li J, Hu X, Lin P and Zhang J. Transcriptional factor MAZ promotes cisplatin-induced DNA damage repair in lung adenocarcinoma by regulating NEIL3. Pulmonary pharmacology \u0026amp; therapeutics. 2023;80:102217.10.1016/j.pupt.2023.102217\u003c/li\u003e\n\u003cli\u003eKlattenhoff AW, Thakur M, Chu CS, Ray D, Habib SL and Kidane D. Loss of NEIL3 DNA glycosylase markedly increases replication associated double strand breaks and enhances sensitivity to ATR inhibitor in glioblastoma cells. Oncotarget. 2017;8:112942-112958.10.18632/oncotarget.22896\u003c/li\u003e\n\u003cli\u003eWang Y, Xu L, Shi S, Wu S, Meng R, Chen H and Jiang Z. Deficiency of NEIL3 Enhances the Chemotherapy Resistance of Prostate Cancer. Int J Mol Sci. 2021;22:10.3390/ijms22084098\u003c/li\u003e\n\u003cli\u003eWang Q, Li Z, Yang J, Peng S, Zhou Q, Yao K, Cai W, Xie Z, Qin F, Li H, Chen X, Li K and Huang H. Loss of NEIL3 activates radiotherapy resistance in the progression of prostate cancer. Cancer biology \u0026amp; medicine. 2021;19:1193-1210.10.20892/j.issn.2095-3941.2020.0550\u003c/li\u003e\n\u003cli\u003eKaarb\u0026oslash; M, Mikkelsen OL, Maler\u0026oslash;d L, Qu S, Lobert VH, Akgul G, Halvorsen T, Maelandsmo GM and Saatcioglu F. PI3K-AKT-mTOR pathway is dominant over androgen receptor signaling in prostate cancer cells. Cellular oncology : the official journal of the International Society for Cellular Oncology. 2010;32:11-27.10.3233/clo-2009-0487\u003c/li\u003e\n\u003cli\u003eHuang H and Hua Q. NEIL3 Mediates Lung Cancer Progression and Modulates PI3K/AKT/mTOR Signaling: A Potential Therapeutic Target. International journal of genomics. 2022;2022:8348499.10.1155/2022/8348499\u003c/li\u003e\n\u003cli\u003eWang W, Yin Q, Guo S and Wang J. NEIL3 contributes toward the carcinogenesis of liver cancer and regulates PI3K/Akt/mTOR signaling. Experimental and therapeutic medicine. 2021;22:1053.10.3892/etm.2021.10487\u003c/li\u003e\n\u003cli\u003eRoudsari NM, Lashgari NA, Momtaz S, Abaft S, Jamali F, Safaiepour P, Narimisa K, Jackson G, Bishayee A, Rezaei N, Abdolghaffari AH and Bishayee A. Inhibitors of the PI3K/Akt/mTOR Pathway in Prostate Cancer Chemoprevention and Intervention. Pharmaceutics. 2021;13:10.3390/pharmaceutics13081195\u003c/li\u003e\n\u003cli\u003eShorning BY, Dass MS, Smalley MJ and Pearson HB. The PI3K-AKT-mTOR Pathway and Prostate Cancer: At the Crossroads of AR, MAPK, and WNT Signaling. Int J Mol Sci. 2020;21:10.3390/ijms21124507\u003c/li\u003e\n\u003cli\u003eEhsani M, David FO and Baniahmad A. Androgen Receptor-Dependent Mechanisms Mediating Drug Resistance in Prostate Cancer. Cancers (Basel). 2021;13:10.3390/cancers13071534\u003c/li\u003e\n\u003cli\u003ePisano C, Tucci M, Di Stefano RF, Turco F, Scagliotti GV, Di Maio M and Buttigliero C. Interactions between androgen receptor signaling and other molecular pathways in prostate cancer progression: Current and future clinical implications. Crit Rev Oncol Hematol. 2021;157:103185.10.1016/j.critrevonc.2020.103185\u003c/li\u003e\n\u003cli\u003eSakellakis M and Flores LJ. Androgen receptor signaling-mitochondrial DNA-oxidative phosphorylation: A critical triangle in early prostate cancer. Current urology. 2022;16:207-212.10.1097/cu9.0000000000000120\u003c/li\u003e\n\u003cli\u003eTortorella E, Giantulli S, Sciarra A and Silvestri I. AR and PI3K/AKT in Prostate Cancer: A Tale of Two Interconnected Pathways. Int J Mol Sci. 2023;24:10.3390/ijms24032046\u003c/li\u003e\n\u003cli\u003eRaith F, O\u0026apos;Donovan DH, Lemos C, Politz O and Haendler B. Addressing the Reciprocal Crosstalk between the AR and the PI3K/AKT/mTOR Signaling Pathways for Prostate Cancer Treatment. Int J Mol Sci. 2023;24:10.3390/ijms24032289\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 1 The primers for real-time PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"586\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 31.9617%;\"\u003e\n \u003cp\u003eqRT-PCR\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\u003cbr\u003ePrimer Sequences\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 7.779%;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49.7182%;\"\u003e\n \u003cp\u003eForward primer (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\n \u003cp\u003eReverse primer (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 7.779%;\"\u003e\n \u003cp\u003eKi67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49.7182%;\"\u003e\n \u003cp\u003eCTGACCCTGATGAGAGTGAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\n \u003cp\u003eTGGTTGAGGCTGTTCCTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 7.779%;\"\u003e\n \u003cp\u003eMMP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49.7182%;\"\u003e\n \u003cp\u003eACAAGTGGTCCGCGTAAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\n \u003cp\u003eAGTCTGTGGTGGAGGAGATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 7.779%;\"\u003e\n \u003cp\u003eMMP9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49.7182%;\"\u003e\n \u003cp\u003eGGAATTTGTTTAGGTTTGGGATTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\n \u003cp\u003eCCCTTCATCCACAAAAATACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 7.779%;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49.7182%;\"\u003e\n \u003cp\u003eGTTGCTATCCAGGCTGTGCT\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.4318%;\"\u003e\n \u003cp\u003eGAGGGCATACCCCTCGTAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"dion","sideBox":"Learn more about [Discover Oncology](https://www.springer.com/12672)","snPcode":"","submissionUrl":"","title":"Discover Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"NEIL3, Prostate cancer, PI3K, AR, HMGA2","lastPublishedDoi":"10.21203/rs.3.rs-5087118/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5087118/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProstate cancer (PCa) is one of the most common cancers worldwide. Nei endonuclease VIII-like 3 (NEIL3) plays important roles in diverse cancers. In this study, we found that NEIL3 was over-expressed in PCa tissues and cell lines. NEIL3 over-expression is associated with worse prognostic outcomes in PCa patients. In vitro, PCa cell proliferation, invasion, and migration could be significantly inhibited with knocking down NEIL3 by inactivating the phosphatidylinositol 3-kinase (PI3K)/AKT/mammalian target of the rapamycin (mTOR) signaling. Besides, based on the results of RNA-sequencing, we found that the protein expression of high-mobility gene group A2 and androgen receptor (AR) were decreased in C4-2 cells treated with siNEIL3. Therefore, this result suggests that NEIL3 regulates the progression of PCa by modulating the PI3K/AKT/mTOR signaling and the expression of AR.\u003c/p\u003e","manuscriptTitle":"NEIL3 Promotes the Carcinogenesis of Prostate Cancer by Activating PI3K/Akt/mTOR Signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-16 14:16:50","doi":"10.21203/rs.3.rs-5087118/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-16T07:43:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-14T16:09:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"224866326349114944841379706173548953128","date":"2024-10-11T14:37:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-10T16:21:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"303371694730948861740475249927405913597","date":"2024-10-09T15:34:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"66204960387819059811060570172562905934","date":"2024-10-09T11:39:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"226725673597592508218604780849379103461","date":"2024-10-03T18:38:15+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-01T18:35:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-30T08:21:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-26T10:12:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Oncology","date":"2024-09-14T05:26:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"dion","sideBox":"Learn more about [Discover Oncology](https://www.springer.com/12672)","snPcode":"","submissionUrl":"","title":"Discover Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ac72a721-afa6-46e5-aedb-bd346cedbc42","owner":[],"postedDate":"December 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-05-08T19:23:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-16 14:16:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5087118","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5087118","identity":"rs-5087118","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0