miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via PTEN/AKT/GSK3β/mTOR pathway

miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via PTEN/AKT/GSK3β/mTOR pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via PTEN/AKT/GSK3β/mTOR pathway Hongli Liu, Shuang Guo, Ya Li, Ting Lei, Qian Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3865730/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and purpose: Gastric cancer (GC) is the fifth most common cancer and the third leading cause of cancer-related deaths worldwide. CD73 has been found to be overexpressed in a variety of cancers including GC and is associated with poor cancer prognosis. However, its specific mechanisms regulating the progression of GC are not sufficiently clear. In this study, we aimed to investigate the function of CD73 in GC and to explore its upstream and downstream molecular mechanisms. Methods: Immunohistochemistry (IHC) and western blotting were used to detect the protein levels of CD73 and other proteins. Quantitative real-time PCR (RT-qPCR) was used to detect the RNA levels of CD73, miR-30b-5p, and other genes. CCK-8 and clonogenic assays were used to test cell proliferation. Scracth and Transwell were used to analyze the migration and invasion of GC cells. In addition, CD73 stable knockdown and overexpression cell lines were established to detect the expression of PTEN/AKT/GSK3β/mTOR pathway-related molecules. Dual luciferase reporter assay was used to detect the binding of CD73 and miR-30b-5p. Results: We found that miR-30b-5p targeted binding and inhibited CD73 overexpression, and suppressed GC cell proliferation, migration and invasion in GC cells. We further revealed that these effects were mediated through the PTEN/AKT/GSK3β/mTOR signalling pathway. Conclusions: In summary, our results reveal the relevance of the miR-30b-5p/CD73/PTEN/AKT/GSK3β /mTOR regulatory axis to migration and invasion in gastric cancer. Gastric cancer CD73 miR-30b-5p PTEN/AKT/GSK3β/mTOR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Gastric cancer is the third leading cause of cancer-related deaths worldwide [ 1 ]. The survival rate of patients with gastric cancer are closely related to the stage of their disease. Currently, early surgery is still the effective treatment. However, the majority of patients (> 70%) were already in advanced stage at the time of their first hospitalization [ 2 ]. Unfortunately, advanced GC has a poor prognosis due to the lack of effective treatment, with a 5-year overall survival rate (OS) of less than 5% [ 3 ]. Therefore, a better understanding of the molecular pathogenesis of GC and effective targeted therapies would be beneficial for the treatment of GC patients [ 4 ]. CD73 (5'nucleotidase, NT5E , extracellular 5'nucleotidase), a promising target involved in tumor immune escape identified in recent years, is a 70 kDa glycosylated protein encoded by the NT5E gene that binds to the outer plasma membrane through glycosylphosphatidylinositol (GPI) anchoring surface[ 5 ]. CD73 was found to be highly expressed in many human solid tumors. It was reported that CD73 expression was abnormally high in hepatocellular carcinoma and clinical data showed that abnormal CD73 expression was positively correlated with lymph node metastasis, poor tumor differentiation, and short five-year survival [ 6 – 7 ]. It was also found that CD73 may play an important role in pancreatic cancer proliferation and metastasis by regulating the expression of the TNDR2 gene, interfering with the activation of the AKT/MAPK signalling pathway and increasing the expression of cyclinD1 in the cell cycle [ 8 ]. CD73 is overexpressed in colon, lung, ovarian and breast cancer and its expression levels are associated with tumor neovascularization, aggressiveness and metastasis, as well as shorter patient survival times [ 9 – 12 ]. CD73 was also found to be overexpressed in GC tissues by immunohistochemical staining, however, the exact mechanism of action in GC is unclear. MicroRNAs (miRNAs) act as regulators of gene expression by directly binding to the 3'- UTR of their target mRNA, resulting in translation inhibition and/or mRNA degradation [ 13 ]. Many oncogenes and tumor suppressor genes are targets of miRNAs. We used bioinformatics analysis to find that miR-30b-5p binds to the 3′UTR of CD73 mRNA. miR-30b-5p, a member of the miR-30 family, has been reported to play an oncogenic role in GC[ 14 ]. However, the expression and function of miR-30b-5p in GC and the corresponding potential mechanisms remain unknown. In this study, we assessed the expression of CD73 in GC and its prognostic significance. Mechanistically, We explored the effects of miR-30b-5p targeting and binding to CD73 on proliferation, migration, and invasion of GC cells through the PTEN/AKT/GSK3β/mTOR pathway. Materials and methods Cell lines and cell culture The human GC cell lines MKN-45, SGC-7901, AGS and normal gastric wall cell line GES-1 were used in this study among which MKN-45 and GES-1 were obtained from the Central Laboratory of Xijing Hospital. SGC-7901 and AGS were obtained from the Institute of Molecular and Translational Medicine, Xi'an Jiaotong University. The human gastric cancer cell line MKN-45 was cultured in DMEM-high glucose medium containing 10% fetal bovine serum (FBS) and the rest of the cells were cultured in medium containing 10% fetal bovine serum (FBS) 1640 1% penicillin/streptomycin and kept in a 37°C 5% CO 2 incubator. Western blot Cells were lysed using RIPA lysis solution (Beyotime, Shanghai, China), 100× protease inhibitor, 50× phosphatase inhibitor mixture, and placed on ice for 20 min, centrifuged at 4 ℃, 12000 g for 20 min. Thereafter, the protein concentrations were measured by a BCA Protein Assay Kit. And then, the equal amounts of protein samples were separated by SDS-PAGE gel and transferred to PVDF. After blocking, the primary antibodies targeted CD73, P-AKT, AKT, BAX, BCL2, GSK3β, PTEN, mTOR and GAPDH proteins (1:1000) were incubated overnight at 4 ℃ and the protein bands were visualised using enhanced chemiluminescence reagents (Yarase) after incubation with HRP-conjugated secondary murine universal antibodies, and the bands were analysed in grey scale by Image J. GAPDH was standardized as a fold of loading control. Migration and invasion assays For the migration assay, 2×10 4 cells were seeded into the upper chamber of a Transwell insert, 600 µl medium containing 10% FBS was into the lower chamber and then incubated at 37°C for 24 h, according to the manufacturer's instructions. For the invasion assay, the inserts were coated with the Cultrex® Basement Membrane Extract and cells were diluted in serumfree medium before plating and incubated at 37°C for 24 h. the Basement Membrane Extract coating on the upper surface of the filter was wiped off using a cotton swab. In both assays,Cells adhering to the lower surface were fixed in 4% paraformaldehyde for 20 min, washed in PBS and stained with 0.5% crystal violet for 30 min, then counted under an inverted microscope to determine the relative number of cells, counting the number of cells in at least five random areas. Scratch test 6×10 5 cells were inoculated in a six-well plate and incubated for 24 h. Cells were grown to the bottom of the plate, the centre of the plate was scratched with the tip of a 200ul pipette tip, washed three times with PBS and replenished with fresh medium. Cells were observed under the microscope at 0, 6, 12, 24 h for migration status and photographed. Statistical analysis of the data. Colony formation assay GC cells were seeded into 6-well dishes at a density of 1000 cells/well and then cultured them in complete culture medium at 37°C for 14 d. culture media containing 1% penicillin/streptomycin was replaced every 3 ~ 4 days until visible colonies had developed.After the cells were washed with 1 × PBS, they were fixed with 4% paraformaldehyde for 30 min. Then 1% crystal violet was applied for staining the fixed cells for 30 min. ImageJ software was used to count the numbers of colonies. Three independent assays were performed to analyze cell proliferation abilities. CCK-8 Assay For the Cell Counting Kit-8 (CCK-8) assays, GC cells were inoculated into 96-well plates at 2,000 cells/well and 100 µl of 10% FBS 1640. At various time points (0, 24, 48,and 72 hours), 10 µl of CCK-8 solution diluted in 100 µl of complete culture medium was used to replace the original medium for each group, according to the CCK-8 solution protocol. After the cells were incubated for a further 3 hours at 37°C in the dark, we used absorbance at 450 nm to detect viable cells. RNA extraction, RT-qPCR Total RNA was extracted from gastric cancer cells using TRIzol® reagent (Invitrogen, Carlsbad, USA) and its concentration and quality were determined using Nanodrop. cDNA synthesis was performed on 5 µg of total RNA using the Transcriber First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer's instructions.RT-qPCR was performed using iQ5 (Bio-Rad, Hercules, USA) to detect target gene mRNA expression. For miRNA detection, cDNA was synthesized with the SPARKScript II miRNA 1st strand cDNA synthesis Kit(SparkJade), Quantification of miR-30b-5p levels in GC cells by using 2×miRNA SYBR Green qPCR Mix(SparkJade). CD73 mRNA and miR-30b-5p were normalized to β-actin and U6 as the internal control, respectively. All primers were synthesized by Biotech (Shanghai) and the primer sequences are shown in Table 1 . Table 1 Primer sequences used in the study Gene name Forward primer (5'-3') Reverse primer (5'-3') CD73 TCTTCTAAACAGCAGCATTCC CATTTCATCCGTGTGTCTCAG Hsa-miR-30b-5p-stem loop GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCTGA Hsa-miR-30b-5p GCCGCCTGTAAACATCCTACAC AGTGCAGGGTCCGAGGTATT PCDH-CD73 GCTGTGACCGGCGCCTACTCTAGACAACATGTGTCCCCGAGCCGCG GTACACTCGAGAGCGCTGGATCCTCACTTGTCATCGTCCGTCATCCTTGTAG U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT psiCHECK-CD73-3'UTR GGCCTAACTGGCCGGTACCCAACATGAGAACTTCTGCTGGAAAG AAGCTTACTTAGATCGCAGATCTTCATCTAATAGGATTTACCCTAT psiCHECK-mutant-CD73-3'UTR CTAATCCATCAAACAGCTTACCGCGCGGTAAAATTTTATCATTCACAA TTGTGAATGATAAAATTTTACCGCGCGGTAAGCTGTTTGATGGATTAG shRNA1-CD73 GATCCGAGGGCACTATCTGGTTCACCGTGTATTCAAGAGATACACGGT GAACCAGATAGTGCCCTTTTTTTG AATTCAAAAAAAGGGCACTATCTGGTTCACCGTGTATCTCTTGAATACACGGTGAACC AGATAGTGCCCTCG shRNA2-CD73 GATCCGCAACATGGGCAACCTGATTTGTGATTCAAGAGATCACAAAT CAGGTTGCCCATGTTGCTTTTTTG AATTCAAAAAAGCAACATGGGCAACCTGATTTGTGATCTCTTGAATCACAAATCAGGTTGCC CATGTTGCG shRNA3-CD73 GATCCGAGTGCCCAGTTATGACCCTCTCAATTCAAGAGATTGAGAGGGTCATAACTGGGCACTCTTTTTTG AATTCAAAAAAGAGTGCCCAGTTATGACCCTCTCAATCTCTTGAATTGAGAGGGTCATAAC TGGGCACTCG β-Actin GAGAAAATCTGGCACCACACC GGATAGCACAGCCTGGATAGCAA GAPDH CAAATTCCATGGCACCGTCA GACTCCACGACGTACTCAGC CD73, 5'nucleotidase, NT5E, extracellular5'nucleotidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse Immunochemistry (IHC) Gastric cancer tumour and control samples were obtained from patients who underwent surgery at Xijing Hospital, Fourth Military Medical University. All human liver tissue samples were approved by the hospital Ethics Committee and all relevant informed consents were obtained. The Gastric cancer tumour sections were stained for immunohistochemistry (IHC) according to standard protocols. Briefly, paraffin-embedded sections were dewaxed, rehydrated and subjected to antigen extraction. CD73 antibodies(ZENBIO, 1:150) were incubated overnight at 4°C, washed and followed by incubation with secondary antibodies at room temperature for 30 min. The reactions were developed using the SP Rabbit&Mouse HRP Kit (DAB) and the sections were counterstained with hematoxylin. Dual luciferase reporter analysis. Target gene prediction analysis revealed a potential miR-30b-5p binding site in the 3′-UTR of the CD73 mRNA sequence ( http://www.targetscan.org/ ). To determine this finding, we constructed a plasmid containing the CD73 3′-UTR (psiCHECK) fused to the 3′ end of a luciferase reporter, synthesized a 440-bp sequence containing the predicted miR-30b-5p target site, and ligated it into the psiCHECK vector. And the psiCHECK-mutant-CD73-3'UTR vector were also constructed in the same way. As the confluence of SGC-7901 cells reached 80–90%, the psiCHECK vector, psiCHECK-CD73-3′UTR vector and psiCHECK-mutant-CD73-3′UTR vector were transfected into SGC-7901 cells, respectively, simultaneously with miRNA small molecules via JetTime® (Polyplus Transformation S.A, Illkirch, France) after 48 hours. The cell lysates were collected and used the Dual-Luciferase® Reporter Assay System (Promega) to detect the luciferase activity. Based on the manufacturer’s instructions, the results of relative luciferase activity were shown as FL/RL. All primers and vector sequences were synthesized by Biotech (Shanghai Biotech) and the primer sequences are shown in Table 1 . Construction of lentiviral stable knockdown/overexpression cell lines Overexpression cell lines: First, we found the mRNA sequences of human CD73 in the NCBI nucleic acid database, and designed over-expression cloning primers for the CDS regions of CD73. the synthetic gene was amplified by PCR (the sequences are shown in Table 1 ) containing XbaI and BamH I restriction sites within the 5′and 3′ termini. The amplified fragments are subcloned into the pCDH EF1a-IRES-Puro BsrG1. Then, these recombinant plasmids were packaged in HEK-293 T cells by lentiviral packaging system to obtain lentiviral particles. Finally, GES cells infected with the lentiviral particles and screened with puromycin to obtain stable overexpressing cell lines. Knockdown cell lines: Three DNA fragments targeting for silencing CD73 and the corresponding negative control (the sequences are shown in Table 1 ) were subcloned into the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO (Hanheng Biotechnology Shanghai, China) containing the endonucleases EcoRI and BamhI. Then, these recombinant plasmids were packaged in HEK-293 T cells by lentiviral packaging system to obtain lentiviral particles, which were then infected with MKN45 and SGC7901 cells and screened with puromycin to obtain stable interference cell lines. Statistical analysis. All statistical analyses were performed using SPSS 23.0 software (SPSS, Chicago, IL, USA) or GraphPad PrismV7 (GraphPad Prism, La Jolla, CA, USA). Two groups were compared using Student's t-test, and three or more groups were compared using ANOVA. Pearson correlation test was used for correlation analysis. P < 0.05 was considered a statistically significant difference. Results The expression of CD73 increased in gastric cancer tissues and cell lines Using the GEPIA database, we found that the expression levels of CD73 were significantly higher in a variety of cancers compared with their corresponding normal tissues, including GC (STAD), esophageal carcinoma (ESCA), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), brain lower grade glioma (LGG), lung adenocarcinoma (LUAD) (Fig. 1 A), and in GC patients, survival curves of 192 cases showed that higher expression levels of CD73 were associated with lower survival rates (Fig. 1 B). To confirm the expression level of CD73 in GC, we collected 20 GC tissue sections (each included GC tissue and paired non-tumor tissue) and performed immunohistochemical staining and HE staining. The result showed that the expression levels of CD73 were elevated in GCs compared to pared non-tumor tissues, which is consistent with the information from the database (Fig. 1 C). We next examined CD73 expression levels in four GC cell lines at mRNA level and protein level (Fig. 1 D and 1 E), and the results showed that the expression levels of CD73 were higher in GC cell lines than that in normal cell lines. These results indicated that CD73 expression levels were elevated in GC tissues and cell lines. Knockdown of CD73 inhibits GC cell growth, invasion and migration To further determine the function of CD73 in GC, we constructed lentivirus containing CD73 short hairpin RNAs (shRNAs) to stably infect MKN45 and SGC7901 GC cells, the shRNA-3 with the highest knockdown efficiency (Supplementary Fig. 1A) and was used in the subsequent experiments. CD73 expression levels were significantly knocked down in GC cells at mRNA and protein levels (Fig. 2 A and 2 B), CCK8 assay and colony formation assay showed that GC cell growth and cell viability were significantly inhibited in CD73 knockdown cells (Fig. 2 C and 2 D), scratch assay and transwell assay showed that GC cell invasion and migration were also inhibits in CD73 knockdown cells (Fig. 2 E and 2 F). The PTEN/AKT/GSK3β/mTOR pathway was reported to be commonly dysregulated in cancer [ 15 ]. To valid this pathway also functions in GC and its relationship with CD73, we examined the expression levels of the major molecules in the PTEN/AKT/GSK3β/mTOR pathway as shown in Fig. 2 G, and the results showed that the expression levels of GSK3β, AKT, P-AKT, mTOR were decreased in CD73 knockdown cells, while PTEN expression levels were significantly increased in CD73 knockdown cells. We also examined apoptosis-related molecules and found that the expression of pro-apoptotic BAX was increased while the expression level of anti-apoptotic BCL-2 was significantly decreased in CD73 knockdown cells. Taken together, these results indicated that the proliferation, migration and invasion of GC cells were decreased after CD73 knockdown, suggesting that CD73 plays roles as an oncoprotein and is associated with poor prognosis of gastric cancer, therefore, CD73 maybe a potential target for GC treatment. Overexpression of CD73 can reverse migration and invasion of gastric cancer cells To further investigate the function of CD73 in GC development, we constructed lentivirus overexpressing CD73 and infected normal gastric cell line, GES-1, and CD73 expression level was significantly increased at mRNA and protein levels after lentivirus infection (Fig. 3 A and 3 B), and the gastric cells overexpressing CD73 possessed significantly higher proliferative capacity (Fig. 3 C and 3 D), increased migration and invasion ability (Fig. 3 E and 3 F). The expression levels of PTEN/AKT/GSK3β/mTOR pathway-related proteins after CD73 overexpression were exactly the opposite to CD73 knockdown results (Fig. 3 G). The above results further suggested that CD73 overexpression promoted the proliferation, migration and invasion of GC cells. miR-30b-5p directly targets CD73 mRNA and inhibits its expression It is well known that miRNAs involve into the process of cancer development, some of them play roles as oncogenes, while others play roles as tumor suppressor genes. We tried to found miRNAs that directly target CD73 and play roles as tumor suppressor genes. Using bioinformatic method (TargetScanHuman: http://www.targetscan.org/ ), we predicted miR-30b-5p can bind to 3′ UTR of CD73 (Fig. 4 A) Analysis of the TCGA gastric adenocarcinoma miRNA database also revealed that miR-30b-5p expression was downregulated in GC tissues, negative correlated to CD73 expression (Fig. 4 B). Next, to verify whether miR-30b-5p would directly bind and inhibit CD73 expression, we constructed psiCHECK-CD73-3' UTR vectors and psiCHECK-mut-CD73-3' UTR vectors, and cotranfected SGC-7901 cells with the constructs and miR-30b-5p mimics. This result showed that at the presence of miR-30b-5p mimics, the normalized relative luciferase activity decreased significantly in SGC-7901 cells transfected with psiCHECK-CD73-3′UTR vector, compared with that in SGC-7901 cells transfected with psiCHECK-vector or psiCHECK-mutant-CD73-3′UTR vector (Fig. 4 C).However, at the presence of miR-30b-5p inhibitor, the normalized relative luciferase activity increased significantly in SGC-7901 cells transfected with psiCHECK-CD73-3′UTR vector, compared with that in SGC-7901 cells transfected with psiCHECK-vector or psiCHECK-mutant-CD73-3′UTR vector (Fig. 4 D). We then examined the expression of miR-30b-5p in three GC cell lines, SGC-7901, MKN-45 and AGS, by RT-qPCR, and the results showed that miR-30b-5p expression was down-regulated in GC cell lines compared to the normal cell line GES-1 (Fig. 4 E). Furthermore, we detected CD73 mRNA and protein expression in MKN45 and SGC7901 cells transfected with miR-30b-5p or its inhibitor, respectively, and the results showed that CD73 expression significantly decreased in SGC-7901 cells overexpressing miR-30b-5p, and CD73 expression was also decreased but not significantly in MKN45 cells transfected with miR-30b-5p mimics. Consistently, CD73 expression significantly increased in SGC-7901 cells transfected with miR-30b-5p inhibitor (Fig. 4 F- 4 H). Taken together, the above results suggested that miR-30b-5p directly binds to CD73 mRNA and inhibits its expression. miR-30b-5p inhibits GC cell proliferation and migration via the PTEN/AKT/GSK3β/mTOR pathway As the mentioned results showed, CD73 involved in the PTEN/AKT/GSK3β/mTOR pathway, and CD73 is the direct target of miR-30b-5p. Therefore, we determined whether miR-30b-5p inhibits GC migration and invasion via the PTEN/AKT/GSK3β/mTOR pathway. As expected, CD73 expression was decreased in GC cells overexpressing miR-30b-5p by mimics, and CD73 expression was increased in GC cells downregulating miR-30b-5p by inhibitors. As a result, p-AKT, mTOR, GSK3β and BCL-2 kept same change trends with CD73, while Bax and PTEN showed opposite trends to CD73 (Fig. 5 A and 5 B). Consistently, SGC-7901 cells overexpressing miR-30b-5p showed lower proliferation capacity and lower migration capacity (Fig. 5 C). In contrast, SGC-7901 cells with lower miR-30b-5p expression showed higher proliferation capacity and higher migration capacity (Fig. 5 D). Transwell assay further confirmed the effect of miR-30b-5p in GC cells (Fig. 5Eand 5F). In conclusion, these observations corroborated each other and suggested that miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via the PTEN/AKT/GSK3β/mTOR pathway. Discussion Our study and others suggest that CD73 is a key factor in the development of metastasis in GC, and the mechanism is related to the PTEN/AKT/GSK3β/mTOR signalling pathway. This finding is consistent with the findings in other cancer types. CD73 is a multifunctional transmembrane glycoprotein anchored to cell membrane surface by glycosylphosphatidylinositol [ 16 ]. In addition to being a regulatory molecule involved in cancer invasion and metastasis, CD73 promotes neovascularization, neointima formation, by hydrolyzing and producing large amounts of adenosine, an important purinergic signal transducer thought to be involved in cancer progression, by tumor cell proliferation and tumor immune escape [ 17 ]. To date, a growing body of data suggests that CD73 is associated with tumor metastasis in both experimental models and clinical patients [ 18 ]. The role of CD73 in promoting metastasis in different cancers, including lung and breast cancer, has been reported successively in several papers where CD73 expression is commonly upregulated [ 19 – 20 ]. CD73 was strongly associated with tumor grade, patient clinical stage and survival prognosis in a variety of malignant tissues [ 21 ]. Consistently, database analysis in our study showed that CD73 expression was significantly negatively correlated with overall survival in GC patients. We further confirmed the expression of CD73 in 20 collected GC tissues and three GC cell lines, as expected, CD73 was significantly upregulated in GC tissues and cell lines. (Fig. 1 ). It was also reported that CD73 inhibition by shRNA or APCP can effectively inhibit tumor growth and metastasis in malignant cell lines and animals [ 22 ]. Our results showed that CD73 knockdown inhibited GC cell proliferation, migration and invasion. Taken together, these results suggest that CD73 plays an important role in promoting cancer development. However, one study reported that adenosine produced by CD73 protects the integrity of the epithelium in normal endometrium, whereas the absence of CD73 and the subsequent absence of intercellular adhesion promotes tumor progression, thus, CD73 expression was downregulated in endometrial cancer and its loss was associated with more severe disease and poorer overall survival [ 23 ]. This inconsistency urged more studies to demonstrate whether there is tissue heterogeneity in CD73. Although there is ample evidence supported that CD73 expression is upregulated in human cancers, the underlying mechanism is unclear. In the present study, we tried to determine whether miRNAs can epigenetically influence CD73 expression in GC cells and tissues, and miR-30b-5p levels were found to be reduced in GC cells and tissues, which is consistent with the results of other studies in other cancer types including breast cancer and non-small cell lung cancer [ 24 – 26 ] We further confirmed that CD73 is a direct target of miR-30b-5p by luciferase reporter assay, and miR-30b-5p ectopic expression can successfully inhibit CD73 expression, then inhibit GC cell proliferation, migration and invasion. This provides a strong experimental basis for the negative relationship of miR-30b-5p expression and CD73 expression in GC. miR-30b is encoded by a gene located on chromosome 8q24. In most types of tumors, miR-30b significantly inhibits cancer cell proliferation, migration and invasion by regulating target genes. Furthermore, miR-30b could inhibit the PI3K/AKT signaling pathway by regulating EGFR, AKT, Derlin-1, GNA13, SIX1 and other target genes, interfering with the EMT process in tumor cells and promoting apoptosis [ 27 ]. However, there were still studies showing the opposite results, for example, one study showed that miR-30b significantly reduced apoptosis and promoted retinal ganglion cell axon growth by inhibiting Sema3A and p38MAPK [ 28 ], another study found that in human melanoma, miR-30b-5p overexpression corresponds to increased metastasis, tumor thickness and stage of progression (I to III) and plays a key role in tumor cell invasion and immune regulation by inhibiting GALNT7 [ 29 ]. These results suggest that miR-30b-5p may play different or even opposite roles in different tumors, depending on its tissue specificity. To identify downstream regulatory molecules of CD73, we performed correlation analysis of CD73 with genes such as GSK3β, AKT, m-TOR, PTEN, BAX and BCL2 through the GEPIA database (Supplementary Fig. 2A-F). GSK3β was one of the first identified oncogenic kinase AKT substrates, and has been shown to phosphorylate multiple upstream and downstream components of the PI3K/AKT/mTOR signaling network [ 30 ]. PTEN, as a phosphatase that dephosphorylates AKT and reduces activation, can block AKT-regulated downstream signaling and is a negative regulator of PI3K [ 31 ]. In addition, activation of PI3K/AKT signaling can also promote cell survival by decreasing pro-apoptotic Bax and increasing anti-apoptotic BCL-2 levels. Studies in breast cancer showed that CD73 promoted breast cancer cell growth and metastasis through the GSK3β/AKT/mTOR pathway [ 32 ]. Our current study also showed the decrease of the expression of p-AKT, mTOR, and GSK3β after CD73 knockdown, correspondingly the increase of the expression after CD73 overexpression; however, miR-30b-5p overexpression can inhibit CD73 expression and thus inhibit the expression of p-AKT, mTOR, and GSK3β, and miR-30b-5p knockdown can flip the results. These results suggest that CD73 may be involved in GC pathogenesis through the PTEN/AKT/GSK3β/mTOR axis and play roles as an oncoprotein. Conclusion In summary, our results revealed the relevance of the miR-30b-5p/CD73/PTEN/AKT/GSK3β/mTOR regulatory axis to migration and invasion in GC, and this miR-30b-5p mediated CD73 downregulation provides new insights into the therapeutic strategy for GC. Declarations Ethics approval and consent to participate This study passed the review board of the Ethics Committee of the Clinical Laboratory Center, Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University. All participants or their relatives signed informed consent documentation. Consent for publication Not applicable. Competing Interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Author details 1 Clinical Laboratory Center, Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University, Xi'an 710004, China. 2 Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Center, Xi’an, Shaanxi,710061, P.R. China. Funding This study was supported by Research Incubation Fund of Xi'an People's Hospital (Xi'an Fourth Hospital)(Grant Nos. LH-11, CX-20). Author Contribution Ya Li and Hongli Liu designed the study. Shuang Guo and Ting Lei collated the data, carried out data analyses and produced the initial draft of the manuscript. Qian Chen contributed to drafting the manuscript. All authors read and approved the final manuscript. Acknowledgements We give our sincere gratitude to the reviewers for their valuable suggestions. Availability of data and materials All data generated or analyzed during this study are included in this article. References Ajani JA, D'Amico TA, Bentrem DJ, Chao J, Cooke D, Corvera C, et al. Gastric Cancer, Version 2.2022, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw. 2022;20(2):167–92. Song Z, Wu Y, Yang J, Yang D, Fang X. Progress in the treatment of advanced gastric cancer. Tumour Biol. 2017;39(7):1010428317714626. Charalampakis N, Economopoulou P, Kotsantis I, Tolia M, Schizas D, Liakakos T, et al. Medical management of gastric cancer: a2017 update. Cancer Med. 2018;7:123–33. Sun P, Zheng X, Li X. The Effects of CD73 on Gastrointestinal Cancer Progression and Treatment. J Oncol. 2022;2022:4330329. Roh M, Wainwright DA, Wu JD, Wan Y, Zhang B. Targeting CD73 to augment cancer immunotherapy. Curr Opin Pharmacol. 2020;53:66–76. Sciarra A, Monteiro I, Ménétrier-Caux C, Caux C, Gilbert B, Halkic N, et al. CD73 expression in normal and pathological human hepatobiliopancreatic tissues. Cancer Immunol Immunother. 2019;68(3):467–78. Ma XL, Shen MN, Hu B, Wang BL, Yang WJ, Lv LH, et al. CD73 promotes hepatocellular carcinoma progression and metastasis via activating PI3K/AKT signaling by inducing Rap1-mediated membrane localization of P110β and predicts poor prognosis. J Hematol Oncol. 2019;12(1):37. Zhou L, Jia S, Chen Y, Wang W, Wu Z, Yu W, et al. The distinct role of CD73 in the progression of pancreatic cancer. J Mol Med (Berl). 2019;97(6):803–15. Noh JY, Lee IP, Han NR, Kim M, Min YK, Lee SY, et al. Additive Effect of CD73 Inhibitor in Colorectal Cancer Treatment With CDK4/6 Inhibitor Through Regulation of PD-L1. Cell Mol Gastroenterol Hepatol. 2022;14(4):769–88. Gao ZW, Liu C, Yang L, Chen HC, Yang LF, Zhang HZ, et al. CD73 Severed as a Potential Prognostic Marker and Promote Lung Cancer Cells Migration via Enhancing EMT Progression. Front Genet. 2021;12:728200. Lupia M, Angiolini F, Bertalot G, Freddi S, Sachsenmeier KF, Chisci E, et al. CD73 Regulates Stemness and Epithelial-Mesenchymal Transition in Ovarian Cancer-Initiating Cells. Stem Cell Reports. 2018;10(4):1412–25. Soleimani A, Taghizadeh E, Shahsavari S, Amini Y, Rashidpour H, Azadian E et al. CD73; a key ectonucleotidase in the development of breast cancer: recent advances and perspectives. J Cell Physiol. 2019 Jan 28. John B, Enright AJ, Aravin A, Tuschl T. Sander C and Marks DS: Human microRNA targets. PLoS Biol. 2004;2:e363. Qiao F, Zhang K, Gong P, Wang L, Hu J, Lu S, et al. Decreased miR-30b-5p expression by DNMT1 methylation regulation involved in gastric cancer metastasis. Mol Biol Rep. 2014;41(9):5693–700. Duda P, Akula SM, Abrams SL, Steelman LS, Martelli AM, Cocco L, et al. Targeting GSK3 and Associated Signaling Pathways Involved in Cancer. Cells. 2020;9(5):1110. Resta R, Yamashita Y, Thompson LF. Ecto-enzyme and signaling functions of lymphocyte CD73. Immunol Rev. 1998;161:95–109. Takedachi M, Oohara H, Smith BJ, Iyama M, Kobashi M, Maeda K, et al. CD73-generated adenosine promotes osteoblast differentiation. J Cell Physiol. 2012;227(6):2622–31. Sun P, Zheng X, Li X. The Effects of CD73 on Gastrointestinal Cancer Progression and Treatment. J Oncol. 2022;2022:4330329. Gao ZW, Liu C, Yang L, Chen HC, Yang LF, Zhang HZ, et al. CD73 Severed as a Potential Prognostic Marker and Promote Lung Cancer Cells Migration via Enhancing EMT Progression. Enhancing EMT Progression. Front Genet. 2021;12:728200. Choi HR, Oh HK, Park SH, Jeong YJ. Expression of CD73 is associated with tumor progression and intratumoral inflammation in breast cancer. Asia Pac J Clin Oncol. 2022;18(1):35–43. Buisseret L, Pommey S, Allard B, Garaud S, Bergeron M, Cousineau I. Clinical significance of CD73 in triple-negative breast cancer: multiplex analysis of a phase III clinical trial. Ann Oncol Oncol. 2018;29(4):1056–62. Petruk N, Tuominen S, Åkerfelt M, Mattsson J, Sandholm J, Nees M, et al. CD73 facilitates EMT progression and promotes lung metastases in triple-negative breast cancer. Sci Rep. 2021;11(1):6035. Bowser JL, Blackburn MR, Shipley GL, Molina JG, Dunner K Jr, Broaddus RR. Loss of CD73-mediated actin polymerization promotes endometrial tumor progression. j Clin Invest. 2016;126:220–38. Liu W, Li H, Wang Y, Zhao X, Guo Y, Jin J, et al. MiR-30b-5p functions as a tumor suppressor in cell proliferation, metastasis and epithelial-to-mesenchymal transition by targeting G-protein subunit α-13 in renal cell carcinoma. Gene. 2017;626:275–81. Wu T, Song H, Xie D, Hua K, Hu J, Deng Y, et al. Mir-30b-5p Promotes Proliferation, Migration, and Invasion of Breast Cancer Cells via Targeting ASPP2. Biomed Res Int. 2020;2020:7907269. Zhu J, Zeng Y, Li W, Qin H, Lei Z, Shen D, et al. CD73/NT5E is a target of miR-30a-5p and plays an important role in the pathogenesis of non-small cell lung cancer. Mol Cancer. 2017;16(1):34. Fu ZJ, Chen Y, Xu YQ, Lin MA, Wen H, Chen YT et al. Regulation of miR-30b in cancer development, apoptosis, and drug resistance. Open Life Sci. 2022 Feb. 28;17(1):102–106. Han F, Huo Y, Huang CJ, Chen CL, Ye J. MicroRNA-30b promotes axon outgrowth of retinal ganglion cells by inhibiting Semaphorin3A expression. Brain Res. 2015;1611:65–73. Gaziel-Sovran A, Segura MF, Di Micco R, Collins MK, Hanniford D, Vega-Saenz de Miera E, et al. miR-30b/30d regulation of GalNAc transferases enhances invasion and immunosuppression during metastasis. Cancer Cell. 2011;20(1):104–18. Hermida MA, Dinesh Kumar J, Leslie NR. GSK3 and its interactions with the PI3K/AKT/mTOR signalling network. Adv Biol Regul. 2017;65:5–15. Haddadi N, Lin Y, Travis G, Simpson AM, Nassif NT, McGowan EM. PTEN/PTENP1: 'Regulating the regulator of RTK-dependent PI3K/Akt signalling', new targets for cancer therapy. Mol Cancer. 2018;17(1):37. Yu J, Wang X, Lu Q, Wang J, Li L, Liao X, et al. Extracellular 5'-nucleotidase (CD73) promotes human breast cancer cells growth through AKT/GSK-3β/β-catenin/cyclinD1 signaling pathway. Int J Cancer. 2018;142(5):959–67. Additional Declarations No competing interests reported. Supplementary Files Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3865730","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268762214,"identity":"9bcfd45d-e13b-4f98-a5d8-a70376e29ca7","order_by":0,"name":"Hongli Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYBACPmYGNhAtw8bewMCQUMDAwNgA4rPh1sIG1cLDxnMAqMUAqKWNkBaoLA+DRAKQMoCpxqeFncfswccdtTx8kq8TPzwwYEhsnt9jwPCh7DAD/+wGHA7jMTeceeY4D5t07mYJoMOMGdt4DBhnnDvMIHHnAC4tZtK8bcdAWjaAtMiBtDDzth1mMAA7FZ8WybObfwC18IC1/CWspYaHTYJ3G8IWRrxa2MokZ7YdAAZy7jaLBAMJoF/SCg72nEvnkbiBXQs//+FtEh/b6uTk289uvvmjwiZxY/PhjQ9+lFnL8c/ArgUKDsMYEgyGDQwMBxhAMYUf1CGY8gSUjoJRMApGwcgDAJqeTBAZmGQJAAAAAElFTkSuQmCC","orcid":"","institution":"Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University","correspondingAuthor":true,"prefix":"","firstName":"Hongli","middleName":"","lastName":"Liu","suffix":""},{"id":268762215,"identity":"8353fbaa-fde7-4d8f-9dd2-d530a940b9be","order_by":1,"name":"Shuang Guo","email":"","orcid":"","institution":"Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Guo","suffix":""},{"id":268762216,"identity":"c97ae4fd-0300-4cd6-bd11-f1e2496dfe4e","order_by":2,"name":"Ya Li","email":"","orcid":"","institution":"Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University","correspondingAuthor":false,"prefix":"","firstName":"Ya","middleName":"","lastName":"Li","suffix":""},{"id":268762217,"identity":"60299031-6964-4e99-be6f-2cf960ab4fd1","order_by":3,"name":"Ting Lei","email":"","orcid":"","institution":"Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Lei","suffix":""},{"id":268762218,"identity":"6d8622ba-f668-4f42-b30a-b1cfbf03ce36","order_by":4,"name":"Qian Chen","email":"","orcid":"","institution":"Xi’an Jiaotong University Health Center","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-01-15 07:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3865730/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3865730/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50156802,"identity":"0f36743b-b808-4f7c-9dc1-6df47483341a","added_by":"auto","created_at":"2024-01-25 11:53:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":443741,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of CD73 increased in gastric cancer tissues and cell lines. a \u003c/strong\u003eCD73 expression in several cancers and paired normal tissues in the GEPIA database. \u003cstrong\u003eb \u003c/strong\u003esurvival curve of human cancers with high and low CD73 expression analyzed by the GEPIA database.\u003cstrong\u003e c \u003c/strong\u003eTwenty formalin-fixed and paraffin-embedded gastric tissues were subjected to H \u0026amp; E Staining and IHC analyses of the CD73 proteins. \u003cstrong\u003ed \u003c/strong\u003eThe mRNA levels of CD73 in human gastric cancer cells were detected by RT-qPCR. \u003cstrong\u003ee\u003c/strong\u003e The protein level of CD73 in human gastric cancer cells was detected by western blot.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/989a0acb3de3573ac3004831.png"},{"id":50157910,"identity":"cbd053a0-9222-40d8-9ec9-e6afe953a103","added_by":"auto","created_at":"2024-01-25 12:09:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":771342,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of CD73 inhibits GC cell growth, invasion and migration. a-b \u003c/strong\u003eThe CD73 mRNA and protein levels in stable MKN45 and SGC7901 cells. \u003cstrong\u003ec \u003c/strong\u003eCCK-8 assay of cell viability in gastric cancer cell lines; cell viability was determined at 0, 24, 48 and 72 h. \u003cstrong\u003ed\u003c/strong\u003e Representative images of clonogenic analysis of cell proliferation in gastric cancer cells. Bar charts showing clonogenic growth of cells.\u003cstrong\u003ee \u003c/strong\u003escratch test was performed to assess the migration capacity of CD73 in gastric cancer cells and relative migration rate was shown (mean ± SD, unpaired t test). *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. \u003cstrong\u003ef \u003c/strong\u003eTranswell analysis of cell migration in MKN45 and SGC7901 cells transfected with shCD73 for 24 h. The number of invaded cells in GC cells were counted and shown as mean ± SD (n = 5), and unpaired t test were used. \u003cstrong\u003eg \u003c/strong\u003eThe expression of proteins in the CD73 and PTEN/AKT/GSK3β/mTOR signaling pathways were detected in the stable SGC7901 cell lines. Our data showed that mTOR,p-AKT,AKT,GSK3β and BCL2 expression is significantly decreased in CD73-silenced cell lines. however, the protein expression of PTEN and BAX was increased, compared with the control cells .\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/59d4a03f2ff405dfee8674c9.png"},{"id":50157911,"identity":"b088f8ae-8239-4ec4-9585-d565971752ec","added_by":"auto","created_at":"2024-01-25 12:09:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":470214,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverexpression of CD73 can reverse migration and invasion of gastric cancer cells. a-b \u003c/strong\u003eEV:empty vector. Protein and mRNA levels (mean ± SD, n = 3, unpaired t test) of CD73 with stable overexpression of GES cells. \u003cstrong\u003ec \u003c/strong\u003eCCK-8 assay of cell viability in gastric cancer cell lines; cell viability was determined at 0,24, 48 and 72 h. \u003cstrong\u003ed \u003c/strong\u003eRepresentative images of clonogenic analysis of cell proliferation in gastric cancer cells. Bar charts showing clonogenic growth of cells. \u003cstrong\u003ee \u003c/strong\u003escratch test was performed to assess the migration capacity of CD73 in gastric cancer cells and relative migration rate was shown. \u003cstrong\u003ef \u003c/strong\u003eTranswell analysis of cell migration and invasion in GES-1 cells transfected with CD73 for 24 h. \u003cstrong\u003eg\u003c/strong\u003e The results showed that the expression of GSK3β/AKT/mTOR signaling pathway-related proteins increased and decreased PTEN expression after CD73 overexpression.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/0db608fd3c34cea48c3fa36d.png"},{"id":50157571,"identity":"3b979a57-1cae-4a6f-ba15-1c293bf9382a","added_by":"auto","created_at":"2024-01-25 12:01:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":213145,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-30b-5p directly targets CD73 mRNA and inhibits its expression. a\u003c/strong\u003e Schematic of luciferase structure of CD73 3′UTR-predicted miR-30b-5p binding site subcloning onto psiCHECK vector. three luciferase reporter constructs: psiCHECK-vector (empty vector as control), psiCHECK-CD73-3′UTR vector with wild 3′UTR of CD73 mRNA, and psiCHECK-mutant CD73-3′UTR vector with mutant 3′UTR of CD73 mRNA. \u003cstrong\u003eb \u003c/strong\u003eScatter diagram showing relative miR-30b-5p mRNA expression in Stomach adenocarcinoma and adjacent normal tissues from TCGA a public data. \u003cstrong\u003ec-d \u003c/strong\u003eSGC7901 cells were transiently cotransfected with luciferase reporter constructs and miR-30b-5p mimics (c) or inhibitors (d). Luciferase activities were detected after transient transfection for 48 h and normalized to the luciferase activities from the control psiCHECK-vector. The data were expressed as means ± SD from 3 independent experiments. * and ** represent \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 and 0.01, respectively,compared to the control psiCHECK-vector. \u003cstrong\u003ee \u003c/strong\u003eThe mRNA levels of miR-30b-5p in human gastric cancer cells were detected by RT-qPCR\u003cstrong\u003e. f-g\u003c/strong\u003e Transient co-transfection of mimics and inhibitors of miR-30b-5p in MKN45 and SGC7901 cell lines to detect protein and mRNA expression levels of CD73. \u003cstrong\u003eh \u003c/strong\u003emRNA expression levels of miR-30b-5p were detected by transient cotransfection of mimics and inhibitors of miR-30b-5p in MKN45 and SGC7901 cell lines, respectively. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/c2be350fabcbf50f103beab9.png"},{"id":50156804,"identity":"89f899b9-dc96-4c6e-a006-bca7a23a0c8e","added_by":"auto","created_at":"2024-01-25 11:53:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":707469,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-30b-5p inhibits GC cell proliferation and migration via the PTEN/AKT/GSK3β/mTOR pathway\u003c/strong\u003e. \u003cstrong\u003ea-b \u003c/strong\u003eTransient co-transfection of mimics and inhibitors of miR-30b-5p in MKN45 and SGC7901 cell lines, and detection of associated proteins in the CD73 and PTEN/AKT/GSK3β/mTOR signaling pathways. \u003cstrong\u003ec-d \u003c/strong\u003edetermination of cell viability of gastric cancer cell lines by CCK-8 after transient co-transfection of mimics and inhibitors of miR-30b-5p in the 7901 cell line was measured at 0, 24, 48, and 72 h. After transient transfection of mimics and inhibitors of miR-30b-5p, wound healing analysis was used to evaluate the migration ability of CD73 in gastric cancer cells, and the relative mobility rate was calculated\u003cstrong\u003e. e-f \u003c/strong\u003eTranswell was used to analyze cell migration and invasion after transient transfection of mimics and inhibitors of miR-30b-5p. The number of GC cell infiltrates is expressed as a mean ± SD (n = 5), and unpaired t test was used.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/3bd07763f876ca0e5ffd773a.png"},{"id":67583556,"identity":"18309724-b12f-4449-baa0-4dcba3dc57f3","added_by":"auto","created_at":"2024-10-27 15:46:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3349299,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/6fcd71d8-38ff-415e-9acc-877264d34d1d.pdf"},{"id":50156807,"identity":"61c20302-5238-4ec8-822a-358c9fd96c37","added_by":"auto","created_at":"2024-01-25 11:53:35","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":210495,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-3865730/v1/3b5b917fb8b568ee1695d43f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via PTEN/AKT/GSK3β/mTOR pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGastric cancer is the third leading cause of cancer-related deaths worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The survival rate of patients with gastric cancer are closely related to the stage of their disease. Currently, early surgery is still the effective treatment. However, the majority of patients (\u0026gt;\u0026thinsp;70%) were already in advanced stage at the time of their first hospitalization [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Unfortunately, advanced GC has a poor prognosis due to the lack of effective treatment, with a 5-year overall survival rate (OS) of less than 5% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, a better understanding of the molecular pathogenesis of GC and effective targeted therapies would be beneficial for the treatment of GC patients [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCD73 (5'nucleotidase, \u003cem\u003eNT5E\u003c/em\u003e, extracellular 5'nucleotidase), a promising target involved in tumor immune escape identified in recent years, is a 70 kDa glycosylated protein encoded by the \u003cem\u003eNT5E\u003c/em\u003e gene that binds to the outer plasma membrane through glycosylphosphatidylinositol (GPI) anchoring surface[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. CD73 was found to be highly expressed in many human solid tumors. It was reported that CD73 expression was abnormally high in hepatocellular carcinoma and clinical data showed that abnormal CD73 expression was positively correlated with lymph node metastasis, poor tumor differentiation, and short five-year survival [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It was also found that CD73 may play an important role in pancreatic cancer proliferation and metastasis by regulating the expression of the TNDR2 gene, interfering with the activation of the AKT/MAPK signalling pathway and increasing the expression of cyclinD1 in the cell cycle [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. CD73 is overexpressed in colon, lung, ovarian and breast cancer and its expression levels are associated with tumor neovascularization, aggressiveness and metastasis, as well as shorter patient survival times [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. CD73 was also found to be overexpressed in GC tissues by immunohistochemical staining, however, the exact mechanism of action in GC is unclear.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) act as regulators of gene expression by directly binding to the 3'- UTR of their target mRNA, resulting in translation inhibition and/or mRNA degradation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Many oncogenes and tumor suppressor genes are targets of miRNAs. We used bioinformatics analysis to find that miR-30b-5p binds to the 3\u0026prime;UTR of CD73 mRNA. miR-30b-5p, a member of the miR-30 family, has been reported to play an oncogenic role in GC[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, the expression and function of miR-30b-5p in GC and the corresponding potential mechanisms remain unknown. In this study, we assessed the expression of CD73 in GC and its prognostic significance. Mechanistically, We explored the effects of miR-30b-5p targeting and binding to CD73 on proliferation, migration, and invasion of GC cells through the PTEN/AKT/GSK3β/mTOR pathway.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eCell lines and cell culture\u003c/h2\u003e\n \u003cp\u003eThe human GC cell lines MKN-45, SGC-7901, AGS and normal gastric wall cell line GES-1 were used in this study among which MKN-45 and GES-1 were obtained from the Central Laboratory of Xijing Hospital. SGC-7901 and AGS were obtained from the Institute of Molecular and Translational Medicine, Xi\u0026apos;an Jiaotong University. The human gastric cancer cell line MKN-45 was cultured in DMEM-high glucose medium containing 10% fetal bovine serum (FBS) and the rest of the cells were cultured in medium containing 10% fetal bovine serum (FBS) 1640 1% penicillin/streptomycin and kept in a 37\u0026deg;C 5% CO\u003csub\u003e2\u003c/sub\u003e incubator.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eWestern blot\u003c/h2\u003e\n \u003cp\u003eCells were lysed using RIPA lysis solution (Beyotime, Shanghai, China), 100\u0026times; protease inhibitor, 50\u0026times; phosphatase inhibitor mixture, and placed on ice for 20 min, centrifuged at 4 ℃, 12000 g for 20 min. Thereafter, the protein concentrations were measured by a BCA Protein Assay Kit. And then, the equal amounts of protein samples were separated by SDS-PAGE gel and transferred to PVDF. After blocking, the primary antibodies targeted CD73, P-AKT, AKT, BAX, BCL2, GSK3\u0026beta;, PTEN, mTOR and GAPDH proteins (1:1000) were incubated overnight at 4 ℃ and the protein bands were visualised using enhanced chemiluminescence reagents (Yarase) after incubation with HRP-conjugated secondary murine universal antibodies, and the bands were analysed in grey scale by Image J. GAPDH was standardized as a fold of loading control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eMigration and invasion assays\u003c/h2\u003e\n \u003cp\u003eFor the migration assay, 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells were seeded into the upper chamber of a Transwell insert, 600 \u0026micro;l medium containing 10% FBS was into the lower chamber and then incubated at 37\u0026deg;C for 24 h, according to the manufacturer\u0026apos;s instructions. For the invasion assay, the inserts were coated with the Cultrex\u0026reg; Basement Membrane Extract and cells were diluted in serumfree medium before plating and incubated at 37\u0026deg;C for 24 h. the Basement Membrane Extract coating on the upper surface of the filter was wiped off using a cotton swab. In both assays,Cells adhering to the lower surface were fixed in 4% paraformaldehyde for 20 min, washed in PBS and stained with 0.5% crystal violet for 30 min, then counted under an inverted microscope to determine the relative number of cells, counting the number of cells in at least five random areas.\u003c/p\u003e\n \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e\n \u003ch2\u003eScratch test\u003c/h2\u003e\n \u003cp\u003e6\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells were inoculated in a six-well plate and incubated for 24 h. Cells were grown to the bottom of the plate, the centre of the plate was scratched with the tip of a 200ul pipette tip, washed three times with PBS and replenished with fresh medium. Cells were observed under the microscope at 0, 6, 12, 24 h for migration status and photographed. Statistical analysis of the data.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eColony formation assay\u003c/h2\u003e\n \u003cp\u003eGC cells were seeded into 6-well dishes at a density of 1000 cells/well and then cultured them in complete culture medium at 37\u0026deg;C for 14 d. culture media containing 1% penicillin/streptomycin was replaced every 3\u0026thinsp;~\u0026thinsp;4 days until visible colonies had developed.After the cells were washed with 1 \u0026times; PBS, they were fixed with 4% paraformaldehyde for 30 min. Then 1% crystal violet was applied for staining the fixed cells for 30 min. ImageJ software was used to count the numbers of colonies. Three independent assays were performed to analyze cell proliferation abilities.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eCCK-8 Assay\u003c/h2\u003e\n \u003cp\u003eFor the Cell Counting Kit-8 (CCK-8) assays, GC cells were inoculated into 96-well plates at 2,000 cells/well and 100 \u0026micro;l of 10% FBS 1640. At various time points (0, 24, 48,and 72 hours), 10 \u0026micro;l of CCK-8 solution diluted in 100 \u0026micro;l of complete culture medium was used to replace the original medium for each group, according to the CCK-8 solution protocol. After the cells were incubated for a further 3 hours at 37\u0026deg;C in the dark, we used absorbance at 450 nm to detect viable cells.\u003c/p\u003e\n \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\n \u003ch2\u003eRNA extraction, RT-qPCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA was extracted from gastric cancer cells using TRIzol\u0026reg; reagent (Invitrogen, Carlsbad, USA) and its concentration and quality were determined using Nanodrop. cDNA synthesis was performed on 5 \u0026micro;g of total RNA using the Transcriber First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer\u0026apos;s instructions.RT-qPCR was performed using iQ5 (Bio-Rad, Hercules, USA) to detect target gene mRNA expression. For miRNA detection, cDNA was synthesized with the SPARKScript II miRNA 1st strand cDNA synthesis Kit(SparkJade), Quantification of miR-30b-5p levels in GC cells by using 2\u0026times;miRNA SYBR Green qPCR Mix(SparkJade). CD73 mRNA and miR-30b-5p were normalized to \u0026beta;-actin and U6 as the internal control, respectively. All primers were synthesized by Biotech (Shanghai) and the primer sequences are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequences used in the study\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward primer (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse primer (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCTTCTAAACAGCAGCATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATTTCATCCGTGTGTCTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHsa-miR-30b-5p-stem loop\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHsa-miR-30b-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCGCCTGTAAACATCCTACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTGCAGGGTCCGAGGTATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePCDH-CD73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTGTGACCGGCGCCTACTCTAGACAACATGTGTCCCCGAGCCGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTACACTCGAGAGCGCTGGATCCTCACTTGTCATCGTCCGTCATCCTTGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTTCGGCAGCACATATACTAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGCTTCACGAATTTGCGTGTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epsiCHECK-CD73-3\u0026apos;UTR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCCTAACTGGCCGGTACCCAACATGAGAACTTCTGCTGGAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGCTTACTTAGATCGCAGATCTTCATCTAATAGGATTTACCCTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epsiCHECK-mutant-CD73-3\u0026apos;UTR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTAATCCATCAAACAGCTTACCGCGCGGTAAAATTTTATCATTCACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGTGAATGATAAAATTTTACCGCGCGGTAAGCTGTTTGATGGATTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eshRNA1-CD73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATCCGAGGGCACTATCTGGTTCACCGTGTATTCAAGAGATACACGGT GAACCAGATAGTGCCCTTTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAATTCAAAAAAAGGGCACTATCTGGTTCACCGTGTATCTCTTGAATACACGGTGAACC AGATAGTGCCCTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eshRNA2-CD73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATCCGCAACATGGGCAACCTGATTTGTGATTCAAGAGATCACAAAT CAGGTTGCCCATGTTGCTTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAATTCAAAAAAGCAACATGGGCAACCTGATTTGTGATCTCTTGAATCACAAATCAGGTTGCC CATGTTGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eshRNA3-CD73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATCCGAGTGCCCAGTTATGACCCTCTCAATTCAAGAGATTGAGAGGGTCATAACTGGGCACTCTTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAATTCAAAAAAGAGTGCCCAGTTATGACCCTCTCAATCTCTTGAATTGAGAGGGTCATAAC TGGGCACTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-Actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGAAAATCTGGCACCACACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGATAGCACAGCCTGGATAGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAATTCCATGGCACCGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACTCCACGACGTACTCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\"\u003eCD73, 5\u0026apos;nucleotidase, NT5E, extracellular5\u0026apos;nucleotidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunochemistry (IHC)\u003c/h2\u003e\n \u003cp\u003eGastric cancer tumour and control samples were obtained from patients who underwent surgery at Xijing Hospital, Fourth Military Medical University. All human liver tissue samples were approved by the hospital Ethics Committee and all relevant informed consents were obtained. The Gastric cancer tumour sections were stained for immunohistochemistry (IHC) according to standard protocols. Briefly, paraffin-embedded sections were dewaxed, rehydrated and subjected to antigen extraction. CD73 antibodies(ZENBIO, 1:150) were incubated overnight at 4\u0026deg;C, washed and followed by incubation with secondary antibodies at room temperature for 30 min. The reactions were developed using the SP Rabbit\u0026amp;Mouse HRP Kit (DAB) and the sections were counterstained with hematoxylin.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eDual luciferase reporter analysis.\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTarget gene prediction analysis revealed a potential miR-30b-5p binding site in the 3\u0026prime;-UTR of the CD73 mRNA sequence (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/\u003c/span\u003e\u003c/span\u003e). To determine this finding, we constructed a plasmid containing the CD73 3\u0026prime;-UTR (psiCHECK) fused to the 3\u0026prime; end of a luciferase reporter, synthesized a 440-bp sequence containing the predicted miR-30b-5p target site, and ligated it into the psiCHECK vector. And the psiCHECK-mutant-CD73-3\u0026apos;UTR vector were also constructed in the same way. As the confluence of SGC-7901 cells reached 80\u0026ndash;90%, the psiCHECK vector, psiCHECK-CD73-3\u0026prime;UTR vector and psiCHECK-mutant-CD73-3\u0026prime;UTR vector were transfected into SGC-7901 cells, respectively, simultaneously with miRNA small molecules via JetTime\u0026reg; (Polyplus Transformation S.A, Illkirch, France) after 48 hours. The cell lysates were collected and used the Dual-Luciferase\u0026reg; Reporter Assay System (Promega) to detect the luciferase activity. Based on the manufacturer\u0026rsquo;s instructions, the results of relative luciferase activity were shown as FL/RL. All primers and vector sequences were synthesized by Biotech (Shanghai Biotech) and the primer sequences are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eConstruction of lentiviral stable knockdown/overexpression cell lines\u003c/h2\u003e\n \u003cp\u003eOverexpression cell lines: First, we found the mRNA sequences of human CD73 in the NCBI nucleic acid database, and designed over-expression cloning primers for the CDS regions of CD73. the synthetic gene was amplified by PCR (the sequences are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) containing XbaI and BamH I restriction sites within the 5\u0026prime;and 3\u0026prime; termini. The amplified fragments are subcloned into the pCDH EF1a-IRES-Puro BsrG1. Then, these recombinant plasmids were packaged in HEK-293 T cells by lentiviral packaging system to obtain lentiviral particles. Finally, GES cells infected with the lentiviral particles and screened with puromycin to obtain stable overexpressing cell lines.\u003c/p\u003e\n \u003cp\u003eKnockdown cell lines: Three DNA fragments targeting for silencing CD73 and the corresponding negative control (the sequences are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) were subcloned into the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO (Hanheng Biotechnology Shanghai, China) containing the endonucleases EcoRI and BamhI. Then, these recombinant plasmids were packaged in HEK-293 T cells by lentiviral packaging system to obtain lentiviral particles, which were then infected with MKN45 and SGC7901 cells and screened with puromycin to obtain stable interference cell lines.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis.\u003c/h2\u003e\n \u003cp\u003eAll statistical analyses were performed using SPSS 23.0 software (SPSS, Chicago, IL, USA) or GraphPad PrismV7 (GraphPad Prism, La Jolla, CA, USA). Two groups were compared using Student\u0026apos;s t-test, and three or more groups were compared using ANOVA. Pearson correlation test was used for correlation analysis. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered a statistically significant difference.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eThe expression of CD73 increased in gastric cancer tissues and cell lines\u003c/h2\u003e \u003cp\u003eUsing the GEPIA database, we found that the expression levels of CD73 were significantly higher in a variety of cancers compared with their corresponding normal tissues, including GC (STAD), esophageal carcinoma (ESCA), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), brain lower grade glioma (LGG), lung adenocarcinoma (LUAD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), and in GC patients, survival curves of 192 cases showed that higher expression levels of CD73 were associated with lower survival rates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To confirm the expression level of CD73 in GC, we collected 20 GC tissue sections (each included GC tissue and paired non-tumor tissue) and performed immunohistochemical staining and HE staining. The result showed that the expression levels of CD73 were elevated in GCs compared to pared non-tumor tissues, which is consistent with the information from the database (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). We next examined CD73 expression levels in four GC cell lines at mRNA level and protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), and the results showed that the expression levels of CD73 were higher in GC cell lines than that in normal cell lines. These results indicated that CD73 expression levels were elevated in GC tissues and cell lines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of CD73 inhibits GC cell growth, invasion and migration\u003c/h2\u003e \u003cp\u003eTo further determine the function of CD73 in GC, we constructed lentivirus containing CD73 short hairpin RNAs (shRNAs) to stably infect MKN45 and SGC7901 GC cells, the shRNA-3 with the highest knockdown efficiency (Supplementary Fig.\u0026nbsp;1A) and was used in the subsequent experiments. CD73 expression levels were significantly knocked down in GC cells at mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), CCK8 assay and colony formation assay showed that GC cell growth and cell viability were significantly inhibited in CD73 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), scratch assay and transwell assay showed that GC cell invasion and migration were also inhibits in CD73 knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eThe PTEN/AKT/GSK3β/mTOR pathway was reported to be commonly dysregulated in cancer [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. To valid this pathway also functions in GC and its relationship with CD73, we examined the expression levels of the major molecules in the PTEN/AKT/GSK3β/mTOR pathway as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, and the results showed that the expression levels of GSK3β, AKT, P-AKT, mTOR were decreased in CD73 knockdown cells, while PTEN expression levels were significantly increased in CD73 knockdown cells. We also examined apoptosis-related molecules and found that the expression of pro-apoptotic BAX was increased while the expression level of anti-apoptotic BCL-2 was significantly decreased in CD73 knockdown cells. Taken together, these results indicated that the proliferation, migration and invasion of GC cells were decreased after CD73 knockdown, suggesting that CD73 plays roles as an oncoprotein and is associated with poor prognosis of gastric cancer, therefore, CD73 maybe a potential target for GC treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of CD73 can reverse migration and invasion of gastric cancer cells\u003c/h2\u003e \u003cp\u003eTo further investigate the function of CD73 in GC development, we constructed lentivirus overexpressing CD73 and infected normal gastric cell line, GES-1, and CD73 expression level was significantly increased at mRNA and protein levels after lentivirus infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), and the gastric cells overexpressing CD73 possessed significantly higher proliferative capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), increased migration and invasion ability (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). The expression levels of PTEN/AKT/GSK3β/mTOR pathway-related proteins after CD73 overexpression were exactly the opposite to CD73 knockdown results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). The above results further suggested that CD73 overexpression promoted the proliferation, migration and invasion of GC cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003emiR-30b-5p directly targets CD73 mRNA and inhibits its expression\u003c/h2\u003e \u003cp\u003eIt is well known that miRNAs involve into the process of cancer development, some of them play roles as oncogenes, while others play roles as tumor suppressor genes. We tried to found miRNAs that directly target CD73 and play roles as tumor suppressor genes. Using bioinformatic method (TargetScanHuman:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), we predicted miR-30b-5p can bind to 3\u0026prime; UTR of CD73 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) Analysis of the TCGA gastric adenocarcinoma miRNA database also revealed that miR-30b-5p expression was downregulated in GC tissues, negative correlated to CD73 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Next, to verify whether miR-30b-5p would directly bind and inhibit CD73 expression, we constructed psiCHECK-CD73-3' UTR vectors and psiCHECK-mut-CD73-3' UTR vectors, and cotranfected SGC-7901 cells with the constructs and miR-30b-5p mimics. This result showed that at the presence of miR-30b-5p mimics, the normalized relative luciferase activity decreased significantly in SGC-7901 cells transfected with psiCHECK-CD73-3\u0026prime;UTR vector, compared with that in SGC-7901 cells transfected with psiCHECK-vector or psiCHECK-mutant-CD73-3\u0026prime;UTR vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).However, at the presence of miR-30b-5p inhibitor, the normalized relative luciferase activity increased significantly in SGC-7901 cells transfected with psiCHECK-CD73-3\u0026prime;UTR vector, compared with that in SGC-7901 cells transfected with psiCHECK-vector or psiCHECK-mutant-CD73-3\u0026prime;UTR vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). We then examined the expression of miR-30b-5p in three GC cell lines, SGC-7901, MKN-45 and AGS, by RT-qPCR, and the results showed that miR-30b-5p expression was down-regulated in GC cell lines compared to the normal cell line GES-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Furthermore, we detected CD73 mRNA and protein expression in MKN45 and SGC7901 cells transfected with miR-30b-5p or its inhibitor, respectively, and the results showed that CD73 expression significantly decreased in SGC-7901 cells overexpressing miR-30b-5p, and CD73 expression was also decreased but not significantly in MKN45 cells transfected with miR-30b-5p mimics. Consistently, CD73 expression significantly increased in SGC-7901 cells transfected with miR-30b-5p inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Taken together, the above results suggested that miR-30b-5p directly binds to CD73 mRNA and inhibits its expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003emiR-30b-5p inhibits GC cell proliferation and migration via the PTEN/AKT/GSK3β/mTOR pathway\u003c/h2\u003e \u003cp\u003eAs the mentioned results showed, CD73 involved in the PTEN/AKT/GSK3β/mTOR pathway, and CD73 is the direct target of miR-30b-5p. Therefore, we determined whether miR-30b-5p inhibits GC migration and invasion via the PTEN/AKT/GSK3β/mTOR pathway. As expected, CD73 expression was decreased in GC cells overexpressing miR-30b-5p by mimics, and CD73 expression was increased in GC cells downregulating miR-30b-5p by inhibitors. As a result, p-AKT, mTOR, GSK3β and BCL-2 kept same change trends with CD73, while Bax and PTEN showed opposite trends to CD73 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Consistently, SGC-7901 cells overexpressing miR-30b-5p showed lower proliferation capacity and lower migration capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In contrast, SGC-7901 cells with lower miR-30b-5p expression showed higher proliferation capacity and higher migration capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Transwell assay further confirmed the effect of miR-30b-5p in GC cells (Fig.\u0026nbsp;5Eand 5F). In conclusion, these observations corroborated each other and suggested that miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via the PTEN/AKT/GSK3β/mTOR pathway.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study and others suggest that CD73 is a key factor in the development of metastasis in GC, and the mechanism is related to the PTEN/AKT/GSK3β/mTOR signalling pathway. This finding is consistent with the findings in other cancer types. CD73 is a multifunctional transmembrane glycoprotein anchored to cell membrane surface by glycosylphosphatidylinositol [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In addition to being a regulatory molecule involved in cancer invasion and metastasis, CD73 promotes neovascularization, neointima formation, by hydrolyzing and producing large amounts of adenosine, an important purinergic signal transducer thought to be involved in cancer progression, by tumor cell proliferation and tumor immune escape [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo date, a growing body of data suggests that CD73 is associated with tumor metastasis in both experimental models and clinical patients [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The role of CD73 in promoting metastasis in different cancers, including lung and breast cancer, has been reported successively in several papers where CD73 expression is commonly upregulated [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. CD73 was strongly associated with tumor grade, patient clinical stage and survival prognosis in a variety of malignant tissues [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Consistently, database analysis in our study showed that CD73 expression was significantly negatively correlated with overall survival in GC patients. We further confirmed the expression of CD73 in 20 collected GC tissues and three GC cell lines, as expected, CD73 was significantly upregulated in GC tissues and cell lines. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). It was also reported that CD73 inhibition by shRNA or APCP can effectively inhibit tumor growth and metastasis in malignant cell lines and animals [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Our results showed that CD73 knockdown inhibited GC cell proliferation, migration and invasion. Taken together, these results suggest that CD73 plays an important role in promoting cancer development. However, one study reported that adenosine produced by CD73 protects the integrity of the epithelium in normal endometrium, whereas the absence of CD73 and the subsequent absence of intercellular adhesion promotes tumor progression, thus, CD73 expression was downregulated in endometrial cancer and its loss was associated with more severe disease and poorer overall survival [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This inconsistency urged more studies to demonstrate whether there is tissue heterogeneity in CD73.\u003c/p\u003e \u003cp\u003eAlthough there is ample evidence supported that CD73 expression is upregulated in human cancers, the underlying mechanism is unclear. In the present study, we tried to determine whether miRNAs can epigenetically influence CD73 expression in GC cells and tissues, and miR-30b-5p levels were found to be reduced in GC cells and tissues, which is consistent with the results of other studies in other cancer types including breast cancer and non-small cell lung cancer [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] We further confirmed that CD73 is a direct target of miR-30b-5p by luciferase reporter assay, and miR-30b-5p ectopic expression can successfully inhibit CD73 expression, then inhibit GC cell proliferation, migration and invasion. This provides a strong experimental basis for the negative relationship of miR-30b-5p expression and CD73 expression in GC. miR-30b is encoded by a gene located on chromosome 8q24. In most types of tumors, miR-30b significantly inhibits cancer cell proliferation, migration and invasion by regulating target genes. Furthermore, miR-30b could inhibit the PI3K/AKT signaling pathway by regulating EGFR, AKT, Derlin-1, GNA13, SIX1 and other target genes, interfering with the EMT process in tumor cells and promoting apoptosis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, there were still studies showing the opposite results, for example, one study showed that miR-30b significantly reduced apoptosis and promoted retinal ganglion cell axon growth by inhibiting Sema3A and p38MAPK [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], another study found that in human melanoma, miR-30b-5p overexpression corresponds to increased metastasis, tumor thickness and stage of progression (I to III) and plays a key role in tumor cell invasion and immune regulation by inhibiting GALNT7 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These results suggest that miR-30b-5p may play different or even opposite roles in different tumors, depending on its tissue specificity.\u003c/p\u003e \u003cp\u003eTo identify downstream regulatory molecules of CD73, we performed correlation analysis of CD73 with genes such as GSK3β, AKT, m-TOR, PTEN, BAX and BCL2 through the GEPIA database (Supplementary Fig.\u0026nbsp;2A-F). GSK3β was one of the first identified oncogenic kinase AKT substrates, and has been shown to phosphorylate multiple upstream and downstream components of the PI3K/AKT/mTOR signaling network [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. PTEN, as a phosphatase that dephosphorylates AKT and reduces activation, can block AKT-regulated downstream signaling and is a negative regulator of PI3K [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In addition, activation of PI3K/AKT signaling can also promote cell survival by decreasing pro-apoptotic Bax and increasing anti-apoptotic BCL-2 levels. Studies in breast cancer showed that CD73 promoted breast cancer cell growth and metastasis through the GSK3β/AKT/mTOR pathway [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our current study also showed the decrease of the expression of p-AKT, mTOR, and GSK3β after CD73 knockdown, correspondingly the increase of the expression after CD73 overexpression; however, miR-30b-5p overexpression can inhibit CD73 expression and thus inhibit the expression of p-AKT, mTOR, and GSK3β, and miR-30b-5p knockdown can flip the results. These results suggest that CD73 may be involved in GC pathogenesis through the PTEN/AKT/GSK3β/mTOR axis and play roles as an oncoprotein.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, our results revealed the relevance of the miR-30b-5p/CD73/PTEN/AKT/GSK3β/mTOR regulatory axis to migration and invasion in GC, and this miR-30b-5p mediated CD73 downregulation provides new insights into the therapeutic strategy for GC.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003e This study passed the review board of the Ethics Committee of the Clinical Laboratory Center, Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University. All participants or their relatives signed informed consent documentation.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting Interests\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eAuthor details\u003c/h2\u003e \u003cp\u003e \u003csup\u003e1\u003c/sup\u003eClinical Laboratory Center, Xi'an People's Hospital (Xi'an Fourth Hospital), Affiliated People's Hospital of Northwest University, Xi'an 710004, China. \u003csup\u003e2\u003c/sup\u003eDepartment of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi\u0026rsquo;an Jiaotong University Health Center, Xi\u0026rsquo;an, Shaanxi,710061, P.R. China.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was supported by Research Incubation Fund of Xi'an People's Hospital (Xi'an Fourth Hospital)(Grant Nos. LH-11, CX-20).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYa Li and Hongli Liu designed the study. Shuang Guo and Ting Lei collated the data, carried out data analyses and produced the initial draft of the manuscript. Qian Chen contributed to drafting the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003e We give our sincere gratitude to the reviewers for their valuable suggestions.\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eAll data generated or analyzed during this study are included in this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAjani JA, D'Amico TA, Bentrem DJ, Chao J, Cooke D, Corvera C, et al. Gastric Cancer, Version 2.2022, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw. 2022;20(2):167\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Z, Wu Y, Yang J, Yang D, Fang X. Progress in the treatment of advanced gastric cancer. Tumour Biol. 2017;39(7):1010428317714626.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCharalampakis N, Economopoulou P, Kotsantis I, Tolia M, Schizas D, Liakakos T, et al. Medical management of gastric cancer: a2017 update. Cancer Med. 2018;7:123\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun P, Zheng X, Li X. The Effects of CD73 on Gastrointestinal Cancer Progression and Treatment. J Oncol. 2022;2022:4330329.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoh M, Wainwright DA, Wu JD, Wan Y, Zhang B. Targeting CD73 to augment cancer immunotherapy. Curr Opin Pharmacol. 2020;53:66\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSciarra A, Monteiro I, M\u0026eacute;n\u0026eacute;trier-Caux C, Caux C, Gilbert B, Halkic N, et al. CD73 expression in normal and pathological human hepatobiliopancreatic tissues. Cancer Immunol Immunother. 2019;68(3):467\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa XL, Shen MN, Hu B, Wang BL, Yang WJ, Lv LH, et al. CD73 promotes hepatocellular carcinoma progression and metastasis via activating PI3K/AKT signaling by inducing Rap1-mediated membrane localization of P110β and predicts poor prognosis. J Hematol Oncol. 2019;12(1):37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou L, Jia S, Chen Y, Wang W, Wu Z, Yu W, et al. The distinct role of CD73 in the progression of pancreatic cancer. J Mol Med (Berl). 2019;97(6):803\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoh JY, Lee IP, Han NR, Kim M, Min YK, Lee SY, et al. Additive Effect of CD73 Inhibitor in Colorectal Cancer Treatment With CDK4/6 Inhibitor Through Regulation of PD-L1. Cell Mol Gastroenterol Hepatol. 2022;14(4):769\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao ZW, Liu C, Yang L, Chen HC, Yang LF, Zhang HZ, et al. CD73 Severed as a Potential Prognostic Marker and Promote Lung Cancer Cells Migration via Enhancing EMT Progression. Front Genet. 2021;12:728200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLupia M, Angiolini F, Bertalot G, Freddi S, Sachsenmeier KF, Chisci E, et al. CD73 Regulates Stemness and Epithelial-Mesenchymal Transition in Ovarian Cancer-Initiating Cells. Stem Cell Reports. 2018;10(4):1412\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoleimani A, Taghizadeh E, Shahsavari S, Amini Y, Rashidpour H, Azadian E et al. CD73; a key ectonucleotidase in the development of breast cancer: recent advances and perspectives. J Cell Physiol. 2019 Jan 28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohn B, Enright AJ, Aravin A, Tuschl T. Sander C and Marks DS: Human microRNA targets. PLoS Biol. 2004;2:e363.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao F, Zhang K, Gong P, Wang L, Hu J, Lu S, et al. Decreased miR-30b-5p expression by DNMT1 methylation regulation involved in gastric cancer metastasis. Mol Biol Rep. 2014;41(9):5693\u0026ndash;700.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuda P, Akula SM, Abrams SL, Steelman LS, Martelli AM, Cocco L, et al. Targeting GSK3 and Associated Signaling Pathways Involved in Cancer. Cells. 2020;9(5):1110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eResta R, Yamashita Y, Thompson LF. Ecto-enzyme and signaling functions of lymphocyte CD73. Immunol Rev. 1998;161:95\u0026ndash;109.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakedachi M, Oohara H, Smith BJ, Iyama M, Kobashi M, Maeda K, et al. CD73-generated adenosine promotes osteoblast differentiation. J Cell Physiol. 2012;227(6):2622\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun P, Zheng X, Li X. The Effects of CD73 on Gastrointestinal Cancer Progression and Treatment. J Oncol. 2022;2022:4330329.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao ZW, Liu C, Yang L, Chen HC, Yang LF, Zhang HZ, et al. CD73 Severed as a Potential Prognostic Marker and Promote Lung Cancer Cells Migration \u003cem\u003evia Enhancing EMT Progression.\u003c/em\u003e Enhancing EMT Progression. Front Genet. 2021;12:728200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi HR, Oh HK, Park SH, Jeong YJ. Expression of CD73 is associated with tumor progression and intratumoral inflammation in breast cancer. Asia Pac J Clin Oncol. 2022;18(1):35\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuisseret L, Pommey S, Allard B, Garaud S, Bergeron M, Cousineau I. Clinical significance of CD73 in triple-negative breast cancer: multiplex analysis of a phase III clinical trial. Ann Oncol Oncol. 2018;29(4):1056\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetruk N, Tuominen S, \u0026Aring;kerfelt M, Mattsson J, Sandholm J, Nees M, et al. CD73 facilitates EMT progression and promotes lung metastases in triple-negative breast cancer. Sci Rep. 2021;11(1):6035.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBowser JL, Blackburn MR, Shipley GL, Molina JG, Dunner K Jr, Broaddus RR. Loss of CD73-mediated actin polymerization promotes endometrial tumor progression. j Clin Invest. 2016;126:220\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Li H, Wang Y, Zhao X, Guo Y, Jin J, et al. MiR-30b-5p functions as a tumor suppressor in cell proliferation, metastasis and epithelial-to-mesenchymal transition by targeting G-protein subunit α-13 in renal cell carcinoma. Gene. 2017;626:275\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T, Song H, Xie D, Hua K, Hu J, Deng Y, et al. Mir-30b-5p Promotes Proliferation, Migration, and Invasion of Breast Cancer Cells via Targeting ASPP2. Biomed Res Int. 2020;2020:7907269.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Zeng Y, Li W, Qin H, Lei Z, Shen D, et al. CD73/NT5E is a target of miR-30a-5p and plays an important role in the pathogenesis of non-small cell lung cancer. Mol Cancer. 2017;16(1):34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu ZJ, Chen Y, Xu YQ, Lin MA, Wen H, Chen YT et al. Regulation of miR-30b in cancer development, apoptosis, and drug resistance. Open Life Sci. 2022 Feb. 28;17(1):102\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan F, Huo Y, Huang CJ, Chen CL, Ye J. MicroRNA-30b promotes axon outgrowth of retinal ganglion cells by inhibiting Semaphorin3A expression. Brain Res. 2015;1611:65\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaziel-Sovran A, Segura MF, Di Micco R, Collins MK, Hanniford D, Vega-Saenz de Miera E, et al. miR-30b/30d regulation of GalNAc transferases enhances invasion and immunosuppression during metastasis. Cancer Cell. 2011;20(1):104\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHermida MA, Dinesh Kumar J, Leslie NR. GSK3 and its interactions with the PI3K/AKT/mTOR signalling network. Adv Biol Regul. 2017;65:5\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaddadi N, Lin Y, Travis G, Simpson AM, Nassif NT, McGowan EM. PTEN/PTENP1: 'Regulating the regulator of RTK-dependent PI3K/Akt signalling', new targets for cancer therapy. Mol Cancer. 2018;17(1):37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Wang X, Lu Q, Wang J, Li L, Liao X, et al. Extracellular 5'-nucleotidase (CD73) promotes human breast cancer cells growth through AKT/GSK-3β/β-catenin/cyclinD1 signaling pathway. Int J Cancer. 2018;142(5):959\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Gastric cancer, CD73, miR-30b-5p, PTEN/AKT/GSK3β/mTOR","lastPublishedDoi":"10.21203/rs.3.rs-3865730/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3865730/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eBackground and purpose:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eGastric cancer (GC) is the fifth most common cancer and the third leading cause of cancer-related deaths worldwide. CD73 has been found to be overexpressed in a variety of cancers including GC and is associated with poor cancer prognosis. However, its specific mechanisms regulating the progression of GC are not sufficiently clear. In this study, we aimed to investigate the function of CD73 in GC and to explore its upstream and downstream molecular mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMethods:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eImmunohistochemistry (IHC) and western blotting were used to detect the protein levels of CD73 and other proteins. Quantitative real-time PCR (RT-qPCR) was used to detect the RNA levels of CD73, miR-30b-5p, and other genes. CCK-8 and clonogenic assays were used to test cell proliferation. Scracth and Transwell were used to analyze the migration and invasion of GC cells. In addition, CD73 stable knockdown and overexpression cell lines were established to detect the expression of PTEN/AKT/GSK3β/mTOR pathway-related molecules. Dual luciferase reporter assay was used to detect the binding of CD73 and miR-30b-5p.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eResults:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eWe found that miR-30b-5p targeted binding and inhibited CD73 overexpression, and suppressed GC cell proliferation, migration and invasion in GC cells. We further revealed that these effects were mediated through the PTEN/AKT/GSK3β/mTOR signalling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConclusions:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eIn summary, our results reveal the relevance of the miR-30b-5p/CD73/PTEN/AKT/GSK3β /mTOR regulatory axis to migration and invasion in gastric cancer.\u003c/p\u003e","manuscriptTitle":"miR-30b-5p targets CD73 and inhibits gastric cancer migration and invasion via PTEN/AKT/GSK3β/mTOR pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 11:53:30","doi":"10.21203/rs.3.rs-3865730/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"065c20f5-4d27-44b6-84eb-d467e1ef21f5","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-27T15:38:30+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-25 11:53:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3865730","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3865730","identity":"rs-3865730","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}