Assessment of pyrethroid resistance and Wolbachia prevalence in pathogen-related mosquito species from south west Germany.

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 122,406 characters · extracted from preprint-html · click to expand
Assessment of pyrethroid resistance and Wolbachia prevalence in pathogen-related mosquito species from south west Germany. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Assessment of pyrethroid resistance and Wolbachia prevalence in pathogen-related mosquito species from south west Germany. Natalie M Portwood, Theresa Schwan, Arianna Pugglioli, Norbert Becker, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5632644/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Dec, 2025 Read the published version in Journal of the European Mosquito Control Association → Version 1 posted You are reading this latest preprint version Abstract Background: The increasing incidence of arboviral diseases in Europe, driven by the expansion of mosquito vectors due to globalisation and global warming, poses a growing threat to public health. Notably, the invasive tiger mosquito Aedes albopictus , a primary vector of dengue, has been rapidly expanding its range, with outbreaks becoming more frequent in various parts of the world. Insecticides targeting adult mosquitoes are commonly employed as response and protective measures for vector control, but the effectiveness of such interventions may be undermined by rising insecticide resistance, a phenomenon increasingly reported worldwide. Another promising avenue for vector control is the use of Wolbachia , an endosymbiotic bacterium capable of reproductive manipulation in mosquitoes, offering potential for population suppression. Methods: We evaluated permethrin (a pyrethroid insecticide) resistance in key mosquito species, including Aedes and Culex , collected from Germany and Italy through generation of LC 50 curves utilising topical exposure assays. Additionally, the prevalence of Wolbachia in these populations was determined via PCR amplification of the 16S rRNA gene, followed by sequencing of selected samples. Results: All Aedes populations tested exhibited susceptibility to permethrin, whilst a potential trend toward resistance was observed in the Culex pipiens complex, a vector of West Nile virus. Furthermore, Wolbachia was detected across all tested mosquito populations, marking the first recorded presence of Wolbachia in Aedes japonicus . Conclusion: These findings highlight the continued efficacy of pyrethroids against Aedes populations in Germany and underscore the need for ongoing surveillance of insecticide resistance, particularly in Culex species. Additionally, the detection of Wolbachia in native and invasive mosquito populations opens new avenues for the exploration of biological vector control strategies in Europe. This study provides crucial preliminary data supporting the strategic use of pyrethroids and Wolbachia for arboviral outbreak prevention in Germany. German mosquitoes Aedes Culex vector control pyrethroids insecticide resistance Wolbachia Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Over the past two decades, Europe has witnessed the increasing emergence and spread of arboviruses, along with their mosquito vectors, some of which were previously restricted to tropical and subtropical regions [ 1 ]. This trend is largely attributed to the establishment of invasive mosquito species, particularly Aedes albopictus , which have successfully adapted to temperate climates [ 2 ]. A lesser-known invasive Aedes species, Ae. japonicus , is also a capable vector [ 3 – 5 ]. Key drivers behind this phenomenon include ongoing globalisation, climate change characterised by rising temperatures and altered precipitation patterns, as well as rapid urbanisation [ 1 ]. Together, these factors have created more favourable habitats for mosquitoes, enabling them to expand their geographical range across the continent. In addition to invasive mosquitoes, native mosquitoes such as Culex pipiens sp are capable of carrying several viruses including West Nile Virus (WNV)[ 6 ] and Usutu Virus (USUV) [ 7 ], whilst Aedes vexans is a potential vector of WNV and Rift Valley Fever [ 8 ]. Ae. albopictus is capable of transmitting over 26 different arboviruses and has been linked to several outbreaks across southern Europe [ 9 ]. As a result, Europe is now facing a heightened threat of vector-borne diseases [ 9 ], including dengue (DENV), WNV, Zika virus (ZIKV), and chikungunya virus (CHIKV) [ 9 , 10 ]. This growing risk underscores the urgent need for enhanced vector surveillance, public health preparedness, and the development of effective control strategies to mitigate the spread of these diseases. In recent years, the Ae. albopictus populations have been expanding rapidly in Germany [ 11 ]. The growth in population is being driven, at least in part, by globalisation, as Ae. albopictus is frequently transported to new regions through the movement of goods and increased human travel. These factors heighten the risk of local populations becoming involved in autochthonous transmission of disease [ 12 ]. Climate change also plays a critical role, with hotter summer months and extreme rainfall accelerating the mosquito’s development by shortening its generation time and boosting population size [ 11 ]. Efforts to prevent the spread of mosquitoes, particularly Ae. albopictus , have been implemented in various regions, including the Upper Rhine in southwestern Germany. Here, two key control strategies are employed: Bacillus thuringiensis subsp. israelensis ( Bti ), which targets mosquito larvae, and the Sterile Insect Technique (SIT), which reduces mosquito reproduction [ 13 ]. Whilst both methods are effective in curbing mosquito populations, they are not sufficient to control acute arboviral outbreaks [ 13 ]. In Germany, although thus far no autochthonous dengue cases have been reported to date [ 14 ], WNV has been detected[ 15 , 16 ] and an outbreak of Usutu virus recently caused significant mortality among local bird populations [ 17 ]. Another common approach for mosquito control is the use of pyrethroids, a class of fast-acting insecticides widely deployed for vector control, particularly in efforts to combat malaria [ 18 ] and arboviruses in south and central America and Asia [ 19 , 20 ]. In several European countries, pyrethroids have been employed to manage mosquito populations [ 21 – 23 ]. However, their use for vector control in Germany is currently prohibited, with exceptions potentially allowed during acute arboviral outbreaks [ 24 ]. Despite this restriction, biocidal products containing pyrethroids, are available for public use in the form of insecticide sprays [ 25 ]. The extensive use of pyrethroid insecticides worldwide, including in public health and in agricultural use has led to the emergence of resistance in mosquito populations, a phenomenon now observed globally [ 26 , 27 ] and increasingly reported in Europe [ 28 – 31 ]. Pyrethroid resistance has been documented in Ae. albopictus populations in Italy [ 30 ], with potential resistance detected in field populations from Greece [ 30 ]. Additionally, Culex pipiens populations in Italy and Belgium have shown resistance to pyrethroids [ 28 , 31 ]. However, the status of permethrin resistance in mosquito species relevant to Germany remains largely unknown, warranting further investigation. In addition to insecticide use, an innovative strategy for vector control is the use of the endosymbiotic bacterium Wolbachia , which naturally infects up to 40% of arthropod species, including many mosquito vectors [ 32 ]. Wolbachia manipulates mosquito reproduction through a process known as cytoplasmic incompatibility [ 33 ] and has also been shown to affect the transmission of arboviruses [ 34 – 36 ]. Ae. albopictus is commonly infected with two Wolbachia strains, w AlbA and w AlbB [ 37 ], whilst the Cx. pipiens complex carries the w Pip strain [ 38 ]. Wolbachia has also been detected in Ae. vexans [ 39 ], but so far, no Wolbachia infection has been found in Ae. japonicus [ 40 ]. The use of Wolbachia for population suppression and to reduce virus transmission presents a promising avenue for vector control in Europe, based on successful use in Australia, Brazil and the USA [ 41 – 43 ]. In this study we determine the resistance status of local mosquito vectors including Ae. albopictus, Ae. vexans, Cx. pipiens s.l. and Cx. pipiens molestus compared to well characterised insecticide susceptible and resistant mosquitoes from the African An. gambiae complex. We further explore the Wolbachia prevalence and sequence diversity in these local mosquitoes. Methods Collection sites of field mosquitoes Adult and immature stages of the field mosquitoes were collected in the summer of 2023 in Baden-Württemberg, Germany (Fig. 1 ). For the field population of Ae. albopictus and Ae. japonicus , eggs were collected using ovitraps (black plastic cups, half covered with water and a wooden stick for oviposition) in the upper Rhine region (Heidelberg and Lörrach). Larvae of the Cx. pipiens complex were collected from an old decommissioned septic tank in South Baden. As the collection site is the natural habitat of the below ground ecotype of Cx. pipiens , the larvae were classified as Cx. pipiens molestus [ 44 ]. Cx. pipiens s.l. larvae were collected from natural and artificial water containers in Heidelberg. Adult Ae. vexans mosquitos were collected by CO 2 traps after a flood of the Rhine River in Oberhausen-Rheinhausen. In each case, the species was distinguished based on morphological key [ 45 ]. Anopheles gambiae reference strains Two An. gambiae complex laboratory strains were used as reference strains for permethrin in this study: an An. gambiae susceptible (SUS) strain originally from Kisumu/Kenya; and An. gambiae sl pyrethroid resistant (RES) strain originally from Tiassalé/Côte d’Ivoire [ 46 ]. The Tiassalé strain was maintained under consistent selection pressure as previously described [ 46 ]. Mosquito rearing The Cx. pipiens complex, Ae. japonicus and Ae. albopictus were reared at Heidelberg University Hospital under local conditions and natural light cycles from the beginning of summer till mid-autumn. An. gambiae strains were reared at Heidelberg University Hospital in standard insectary conditions (27°C, 80% humidity, 12:12 light:dark cycle, with one hour dawn and dusk). All mosquitoes were reared in large trays and fed on TetraMin fish food (Tetra, Melle, Germany). Adults were fed on a 10% sucrose solution from emergence. All mosquitoes used in this study are presumed mated. Insecticide exposures Topical exposure assays were performed as previously described [ 47 ] to generate a dose-response curve to estimate the lethal concentration of 50% of the mosquitoes dying (LC 50 ) to permethrin of each mosquito populations (Table 1 ). For the field populations, the F 0 generations were tested, except for Cx. pipiens molestus where the F 1 generation was additionally used. For Ae. albopictus ITALY, the F 24 and for Ae. albopictus GERMANY, the F 38 generation were tested. Table 1 Tested mosquito species and their respective populations and collection site. Mosquito species Strain Ae. albopictus ITALY, laboratory strain from Emilia-Romagna Ae. albopictus GERMANY, laboratory strain from Heidelberg Ae. albopictus Field population from Heidelberg/Lörrach Ae. japonicus Field population from Heidelberg/Lörrach Ae. vexans Field population from Oberhausen-Rheinhausen Cx. pipiens sensus lato (s.l.) Field population from Heidelberg Cx. pipiens molestus Field population from South Baden An. gambiae sensus stricto (s.s.) Kisumu, laboratory strain from Kenya An. gambiae sensus lato (s.l.) Tiassalé, laboratory strain from Ivory Coast For topical application a range from 3–25 female mosquitoes were used for one permethrin concentration; the low numbers in some instances are due to limited availability of the field mosquitoes. For both reference strains and Ae. albopictus GERMANY, 20–25 mosquitoes were tested each concentration. The age of the mosquitoes was between 2–5 days old, except for Ae. vexans , which were undetermined as adult field mosquitoes were collected. Concentrations were prepared from a 10% stock solution of permethrin (PESTANAL® analytical standard, Sigma-Aldrich) by serial dilutions with acetone (Thermo Fischer Scientific) and acetone was used for the control. All mosquito populations were anesthetized by CO 2 , except for the reference strains which were knocked down by cold at 4°C. 0.5 µl of the respective permethrin concentrations were dispensed directly on the surface of the back of the thorax [ 47 ]. Mosquitoes were put back into cups and 10% sucrose solution pads were placed on the top of the net of the cups. The reference mosquito strains and the laboratory Ae. albopictus strains were held at standard insectary conditions (27°C, 80% humidity). All other mosquitoes were left at ambient temperature. Mortality was recorded after 24 hours, and mosquitoes were classified as either dead or alive. Mosquitoes considered dead include dead and immobile mosquitoes. Generation of dose-response curves and calculations of LC50 values Dose-response curves were produced by a non-linear regression analysis per mosquito population using GraphPad Prism version 10.0.2. Lethal doses for 50% with 95% confidence intervals were calculated using GraphPad Prism. Dose-response curves were compared by statistical analysis using extra-sum-of-square F tests in GraphPad Prism. Resistance ratios were calculated by dividing the LC 50 of each population with the susceptible An. gambiae SUS strain. Screening of Wolbachia prevalence in mosquito populations All mosquito populations were tested for Wolbachia using polymerase chain reaction (PCR), by amplification of the Wolbachia specific 16S rRNA gene. Briefly, individual mosquitoes stored at -20°C were homogenised in 100 µl STE buffer (Sigma-Aldrich) with a pestle. Samples of Ae. japonicus were kept in ethanol and were washed with Phosphate-buffered saline (PBS) (Sigma-Adrich) before homogenising. Homogenates were incubated at 95°C for 10 min and centrifugated at 16,000 xg for 3 min. Each supernatant containing gDNA was removed and stored in a new tube. The 438 bp fragment of the 16S rRNA gene was amplified in a 25 µl PCR containing 1 µl gDNA, 2.5 µl of 10x DreamTaq Green buffer (Thermo Fisher Scientific), 0.5 µl of 10 nm dNTPs (Thermo Fisher Scientific), 0.25 µl DreamTaq polymerase (Thermo Fisher Scientific), 18.75 µl UltraPure Distilled Water (Invitrogen) and 1 µl each of the forward primer (CATACCTATTCGAAGGGATAG) and reverse primer (AGCTTCGAGTGAAACCAATTC) [ 48 ]. Instead of the 1 µl sample gDNA, 1 µl UltraPure Distilled Water was added for the negative control. For the positive control, 1 µl genomic DNA from Drosophila melanogaster known to be wMel positive was added, generously donated by Prof Steffen Lemke. PCR was performed under the following thermocycler conditions: initial denaturation at 95°C for 5 min, followed by 2 cycles of denaturation at 95°C for 2 min, annealing at 60°C for 1 min and 72°C for 1 min. After, 35 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds and 72°C for 1 min. A final extension step at 72°C for 10 min. Wolbachia species identification A subset of Wolbachia positive PCR samples were sent for sequencing. These samples were purified using the commercially available QIAquick PCR Purification Kit (Qiagen), using 30 µl of water for elution. The samples were sent to GENEWIZ Germany for Sanger sequencing. Wolbachia sequences were trimmed with FinchTV (v1.5.0) [ 49 ]. Consensus sequences and the alignment was created using Geneious Prime (v2024.0.5) [ 50 ]. A phylogenetic tree of the alignment was calculated with Bayesian estimation of phylogeny using MrBayes (v3.2.6) in Phylogeny.fr[ 51 ] and was modified with the webtool iTOL (v6.8.1) [ 52 ]. Results Permethrin dose-response bioassay The susceptibility to permethrin was assessed for all mosquito populations and the dose-response curves are shown in Fig. 2 . A total of 4146 female mosquitoes were tested; Ae. albopictus ITALY, n = 726; Ae. albopictus GERMANY, n = 487; Ae. albopictus field population, n = 37; Ae japonicus , n = 35; Ae. vexans , n = 597; Cx. pipiens s.l., n = 614: Cx. pipiens molestus , n = 159 (Supplementary Table 1). LC 50 values of each population and the resistance ratios (RRs) are shown in Table 2 . For all tested Aedes populations, no permethrin resistance was observed, with RRs < 1 and significantly lower LC 50 values compared to the An. gambiae susceptible control (p < 0.0001). In contrast, the Culex pipiens populations exhibited elevated LC 50 values of 0.018% (95% CI [0.0012–0.0024]; p = 0.0001) for Cx pipiens molestus and 0.015% (95% CI [0.0013–0.0017]; p = 0.0002) for Cx. pipiens s.l. The RR values were > 1 compared to the susceptible An. gambiae SUS strain with an LC 50 of 0.00097% (95% CI [0.00085–0.0011]) suggesting some level of pyrethroid tolerance. However, when compared to the highly resistant An. gambiae RES strain, all tested Culex populations had significantly lower resistance (p < 0.0001). Due to limited numbers of Ae. japonicus and Ae. albopictus field populations, not enough data was generated to create dose-response curves. However, three different concentrations were tested for Ae. albopictus field population and two concentrations for Ae. japonicus (Supplementary Fig. 1A, B). From the three concentrations of Ae. albopictus the data indicates that all mosquitoes were dead at 0.009% but not at 0.00001%. However, for each concentration only four to ten mosquitoes were tested (Supplementary Fig. 1A). Similarly for Ae. japonicus , 100% mortality was observed at a concentration of 0.0015% permethrin, but only eight mosquitoes were exposed at this concentration (Supplementary Fig. 1B). Table 2 LC 50 mortality values, 95% confidence interval (CI) and resistance ratios (RRs) of tested populations after 24 hours topical exposure. LC 50 were generated using dose-response curves (Fig. 2 ). LC 50 and 95% CI intervals were calculated with GraphPad Prism. RRs were obtained by dividing LC 50 of each population with the susceptible An. gambiae SUS strain. Mosquito population LC50 (%) 95% CI (%) Resistance ratio (RR) An. gambiae SUS 0.00097 0.00085–0.0011 An. gambiae RES 0.038 0.035–0.040 38.5 Cx. pipiens molestus 0.0018 0.0012–0.0024 1.9 Cx. pipiens s.I. 0.0015 0.0014–0.0017 1.6 Ae. vexans 0.00030 0.00025–0.00035 0.31 Ae. albopcitus ITALY 0.00035 0.00031–0.00039 0.36 Ae. albopicitus GERMANY 0.00056 0.00051–0.00062 0.57 Table 3 Comparison of reference strains to tested populations using extra-sum-of-square F tests. Each tested population was compared to the susceptible and resistance An. gambiae strain. p-values and F-values were calculated with extra-sum-of-square F test and generated with GraphPad Prism. A p-value < 0.05 was taken as significant. Mosquito population P-value An. gambiae SUS P-value An. gambiae RES F (DFn, DFd) value An. gambiae SUS F (DFn, DFd) value An. gambiae RES An. gambiae SUS < 0.0001 242 (2, 49) Cx. pipiens molestus 0.0012 < 0.0001 8.26 (2, 34) 129 (2, 33) Cx. pipiens s.I. 0.0002 < 0.0001 10.2 (2, 48) 220 (2, 47) Ae. vexans < 0.0001 < 0.0001 58.9 (2, 51) 298 (2, 50) Ae. albopictus ITALY < 0.0001 < 0.0001 55.2 (2, 52) 262 (2, 51) Ae. albopictus GERMANY < 0.0001 < 0.0001 17.9 (2,44) 293 (2, 43) Wolbachia prevalence Detection of Wolbachia in all collected mosquito populations was performed with PCR by amplification of the conserved Wolbachia S16 rRNA gene. All populations were found to be infected with Wolbachia of different frequencies see Fig. 3 and Supplementary Table 2. Highest rates of Wolbachia were found in Ae. albopictus and Culex species. All Ae. albopictus populations showed similar frequencies of Wolbachia infections, except for Ae. albopictus F 0 males which were found to be infected at a lower frequency. In contrast, only 10% females were found to be infected with Wolbachia in Ae. vexans. Interestingly, Ae. japonicus show a female bias towards infection. Wolbachia was detected for the first time in Ae. japonicus with a frequency of 20% for males and 70% for females. Wolbachia phylogenetic tree A subset of Wolbachia positive samples were sequenced and adequate sequences aligned to generate a phylogenetic tree with bayesian estimation. For reference, sequences of w Mel (LC108848.1), w Pip (U23709.1) and T.urticae (MN123078.1, due to high similarity) were used (Fig. 4 ). Overall, all sequences showed high similarities with Ae. japonicus , Ae. vexans and the Cx. pipiens complex grouped together with w Pip and T.urticae Wolbachia . In contrast, Wolbachia sequences from all Ae. albopictus populations were grouped together in one clade. Discussion Little is known about the toxicity of pyrethroid insecticides to different German mosquito species. Here we show that field-caught Culex pipiens sp. show a tendency towards resistance whilst the Aedes tested here show high levels of susceptibility to pyrethroid insecticides. All mosquito species tested show infection with Wolbachia , highlighting its potential use for mosquito control in southwestern Germany. Both Cx. pipiens s.l. and Cx. pipiens molestus show increased resistance to pyrethroid insecticides, in line with data showing resistance to permethrin and deltamethrin in Italy, Spain and Belgium [ 28 , 29 , 31 ]. Nevertheless, the resistance level here is likely much lower than these populations where survival to exposure of diagnostic doses of 0.05% and 0.75% deltamethrin and permethrin respectively is high [ 28 , 31 ]. In this study we see that Cx. pipiens molestus is more resistant than Cx. pipiens s.l., which could be due to different habitats. The Cx. pipiens molestus used here were found in an old decommissioned septic tank; therefore, it is more exposed to chemicals and thus more likely to be resistant to toxins [ 53 , 54 ]. The Aedes populations tested here had higher susceptibility to pyrethroids when compared to a lab susceptible An. gambiae population; however, this data must be interpreted with caution as these mosquitoes have been kept in the laboratory with no insecticide exposure for numerous generations. Due to the associated fitness cost of pyrethroid resistance [ 55 ], it is likely any resistance was lost in colony [ 56 ]. The reports of high levels of resistance in Ae. albopictus in Italy supports this hypothesis. Despite managing to acquire field-caught Ae. albopictus and Ae. japonicus we were unable to ascertain resistance levels due to high levels of death during rearing. Wolbachia screening revealed that all species tested here contained the bacteria. Ae. albopictus had high levels of prevalence in line with expectations. Further, Culex species had high prevalence of infection, an increase on a prior study showing 10–100% infection [ 57 ]. The prevalence in Ae. japonicus was lower than other species; however, Wolbachia infection of this species has never before been reported [ 40 ]. The final species showing the lowest prevalence is Ae. vexans and no data exists describing infection in Europe; however, it has been reported to be infected with Wolbachia in Thailand [ 39 ]. Interestingly, the Wolbachia found in native Culex mosquitoes and Ae. japonicus are very similar despite large evolutionary and ecological differences. Indeed, the first reported case of Ae. japonicus in Germany was in 2008 [ 58 ]. indicating local acquisition of Wolbachia . Taken together, this data indicates that Wolbachia- mediated control of mosquito vectors has high potential in Germany. The results here have several limitations: 16S is not sufficient alone for species characterization and ftsZ or similar should be used [ 59 ]; further, some sequence quality was low necessitating trimming. Thus, more studies are needed to confirm the close phylogenetic relationship posed here. Conclusions The expanding geographic range of mosquito species with the associated risk of arboviral infection [ 1 , 2 ] necessitates characterising resistance to difference insecticide classes which can be used in emergency scenarios. As resistance to pyrethroids is increasingly being observed in European mosquito populations, notably in Ae. albopictus and Cx. pipiens [ 28 – 31 ], we must understand the distribution and spread of this phenotype in order to deploy insecticides efficiently when required. Further, exploration of alternative control strategies, including the use of Wolbachia to suppress mosquito populations and reduce arbovirus transmission is critical. Given the potential for future arboviral outbreaks, especially as mosquito vectors continue to adapt to changing environmental conditions, a multifaceted approach combining chemical, biological, and genetic strategies will be crucial for effective vector control and the prevention of disease transmission across Europe. Abbreviations Ae ., Aedes ; An ., Anopheles ; Bti , Bacillus thuringiensis subsp. Israelensis ; CHIKV, Chikungunya virus; CI, confidence interval, Cx., Culex ; DENV, dengue virus; gDNA, genomic DNA; LC, lethal dose; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RRs, resistance ratios; SD, standard deviation; SIT, Sterile Insect Technique; s.I., sensus lato; s.s., sensus stricto; WNV, West Nile virus; ZIKV, Zika virus Declarations Funding This study was funded by Deutsches Zentrum für Infektionsforschung (DZIF, TTU03.705) to VAI as well as financially supported by the German Federal Ministry of Food and Agriculture (BMEL) within the framework of the CuliFo3 project “Mosquitoes and mosquito-borne zoonoses (project no. 2819107D22). Availability of data and materials All data are provided in the manuscript or in the supplementary files. Raw data from all assays are available in the supplementary tables. The DNA Sequences generated in this study have been deposited in the NCBI GeneBank data base under accession numbers: PQ073087, PQ073088, PQ073089, PQ073091, PQ073092, PQ073093, PQ073094, PQ073095, PQ073096, PQ073097, PQ083098, PQ073099, PQ073100, PQ073101, PQ073102, and PQ073103. Acknowledgements We would like to thank Prof Steffen Lemke, COS Heidelberg, for the Drosophila melanogaster gDNA, Liverpool Insect Testing Establishment (part of iiDiagnostics Ltd.) for originally providing the An. gambiae colonies. Our grateful thanks go to Prof. Jonas Schmidt-Chanasit, Bernhard-Nocht-Institute, Hamburg, coordinator of CuliFo3. We would like to thank Artin Tokatlian, Selina Stöferle and Thomas Weitzel for providing and collecting the German field mosquito larvae. We would also like to thank Juliane Hartke for her assistance with the construction of the phylogenetic tree. Author contributions NP and TS carried out all rearing and laboratory experiments in the study. NB and AP carried out and coordinated all collections. AP provided the Ae. albopictus ITALY and Ae. albopictus GERMANY eggs and VAI and NB conceived the study. VAI provided guidance throughout. NP, TS, VAI and NB drafted the manuscript. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Gould EA, Higgs S. Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg. 2009;103:109–21. Paupy C, Delatte H, Bagny L, Corbel V, Fontenille D. Aedes albopictus , an arbovirus vector: From the darkness to the light. Microbes Infect. 2009;11:1177–85. Schaffner F, Vazeille M, Kaufmann C, Failloux A-B, Mathis A. Vector competence of Aedes japonicus for chikungunya and dengue viruses. J Eur Mosq Control Assoc. 2011;29:141–2. Sardelis MR, Turell MJ. Ochlerotatus j. japonicus in Frederick County, Mayland: discovery, distribution and vector competence for West Nile virus. J Am Mosq Control Assoc. 2001;17(2):137-41. Outammassine A, Zouhair S, Loqman S. Global potential distribution of three underappreciated arboviruses vectors ( Aedes japonicus , Aedes vexans and Aedes vittatus ) under current and future climate conditions. Transbound Emerg Dis. 2022;69:e1160–71. Ciota A, Kramer L. Vector-virus interactions and transmission dynamics of West Nile virus. Viruses. 2013;5:3021–47. Holicki CM, Scheuch DE, Ziegler U, Lettow J, Kampen H, Werner D, et al. German Culex pipiens biotype molestus and Culex torrentium are vector-competent for Usutu virus. Parasit Vectors. 2020;13:625. Ndiaye EH, Fall G, Gaye A, Bob NS, Talla C, Diagne CT, et al. Vector competence of Aedes vexans (Meigen), Culex poicilipes (Theobald) and Cx. quinquefasciatus Say from Senegal for West and East African lineages of Rift Valley fever virus. Parasit Vectors. 2016;9:94. Gossner CM, Ducheyne E, Schaffner F. Increased risk for autochthonous vector-borne infections transmitted by Aedes albopictus in continental Europe. Euro Surveill. 2018;23(24). Barrett ADT. West Nile in Europe: an increasing public health problem. J Travel Med. 2018;25(1). Becker, N. Wetterextreme: Invasive Stechmücken nehmen zu. In: Lozán JL, Grasßl H, Kasang D, Quante M, Sillmann J, editors. Warnsignal Klima – Herausforderung Wetterextreme – Ursachen, Auswirkungen & Handlungsoptionen. Wissenschaftl. Auswertung; 2024. p.205-13. Becker N, Geier M, Balczun C, Bradersen U, Huber K, Kiel E, et al. Repeated introduction of Aedes albopictus into Germany, July to October 2012. Parasitol Res. 2013;112:1787–90. Becker N, Langentepe-Kong SM, Tokatlian Rodriguez A, Oo TT, Reichle D, Lühken R, et al. Integrated control of Aedes albopictus in Southwest Germany supported by the Sterile Insect Technique. Parasit Vectors. 2022;15:9. ECDC. Local transmission of dengue virus in mainland EU/EEA, 2010-present. https://www.ecdc.europa.eu/en/all-topics-z/dengue/surveillance-and-disease-data/autochthonous-transmission-dengue-virus-eueea (2024). Accessed 28 Nov 2024. Ziegler U, Santos PD, Groschup MH, Hattendorf C, Eiden M, Höper D, et al. West Nile virus epidemic in Germany triggered by epizootic emergence, 2019. Viruses. 2020;12:448. Fynmore N, Lühken R, Maisch H, Risch T, Merz S, Kliemke K, et al. Rapid assessment of West Nile virus circulation in a German zoo based on honey-baited FTA cards in combination with box gravid traps. Parasit Vectors. 2021;14:449. Becker N, Jöst H, Ziegler U, Eiden M, Höper D, Emmerich P, et al. Epizootic emergence of Usutu virus in wild and captive birds in Germany. PLoS One. 2012;7:e32604. World Health Organization. World malaria report 2023. World Health Organization, 2023. van den Berg H, da Silva Bezerra HS, Al-Eryani S, Chanda E, Nagpal BN, Knox TB, et al. Recent trends in global insecticide use for disease vector control and potential implications for resistance management. Sci Rep. 2021;11:23867. World Health Organization. Global arbovirus initiative - preparing for the next pandemic by tackling mosquito-borne viruses with epidemic and pandemic potential. World Health Organization, 2024. Flacio E, Engeler L, Tonolla M, Lüthy P, Patocchi N. Strategies of a thirteen year surveillance programme on Aedes albopictus ( Stegomyia albopicta ) in southern Switzerland. Parasit Vectors. 2015;8:208. BONDS JAS. Ultra‐low‐volume space sprays in mosquito control: a critical review. Med Vet Entomol. 2012;26:121–30. Scholte EJ, Den Hartog W, Dik M, Schoelitsz B, Brooks M, Schaffner F, et al. Introduction and control of three invasive mosquito species in the Netherlands, July-October 2010. Euro Surveill. 2010;15(45). Becker, N. Wetterextreme: Invasive Stechmücken nehmen zu. In: Lozán JL, Grasßl H, Kasang D, Quante M, Sillmann J, editors. Warnsignal Klima – Herausforderung Wetterextreme – Ursachen, Auswirkungen & Handlungsoptionen. Wissenschaftl. Auswertung; 2024. p.205-13. Nationale Expertenkommission für Stechmücken, Friedrich-Loeffler-Institut, editors. Integriertes Management von vektorkompetenten Stechmücken in Deutschland unter Berücksichtigung der Anwendung von Adultiziden. In Empfehlungen der Nationalen Expertenkommission für Stechmücken am FLI. Greifswald - Insel Riems: Friedrich-Loeffler-Institut, 2022. European Chemicals Agency. Information on biocides. https://www.echa.europa.eu/web/guest/information-on-chemicals/biocidal-products?p_p_id=dissbiocidalproducts_WAR_dissbiocidalproductsportlet&p_p_lifecycle=1&p_p_state=normal&p_p_mode =view&_dissbiocidalproducts_WAR_dissbiocidalproductsportlet_javax.portlet.action=dissBiocidalProductsAction (2024). Accessed 28 Nov 2024. Smith LB, Kasai S, Scott JG. Pyrethroid resistance in Aedes aegypti and A edes albopictus : important mosquito vectors of human diseases. Pestic Biochem Physiol. 2016;133:1-12. Scott JG, Yoshimizu MH, Kasai S. Pyrethroid resistance in Culex pipiens mosquitoes. Pestic Biochem Physiol. 2015;120:68–76. Pichler V, Giammarioli C, Bellini R, Veronesi R, Arnoldi D, Rizzoli A, et al. First evidence of pyrethroid resistance in Italian populations of West Nile virus vector Culex pipiens . Med Vet Entomol. 2022;36:390–5. Bengoa M, Eritja R, Delacour S, Miranda MÁ, Sureda A, Lucientes J. First data on resistance to pyrethroids in wild populations of Aedes albopictus from Spain. J Am Mosq Control Assoc. 2017;33:246–9. Pichler V, Bellini R, Veronesi R, Arnoldi D, Rizzoli A, Lia RP, et al. First evidence of resistance to pyrethroid insecticides in Italian Aedes albopictus populations 26 years after invasion. Pest Manag Sci. 2018;74:1319–27. Vereecken S, Vanslembrouck A, Kramer IM, Müller R. Phenotypic insecticide resistance status of the Culex pipiens complex: a European perspective. Parasit Vectors. 2022;15:423. Zug R, Hammerstein P. Still a host of hosts for Wolbachia : analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7:e38544. Wang W, Cui W, Yang H. Toward an accurate mechanistic understanding of Wolbachia ‐ induced cytoplasmic incompatibility. Environ Microbiol. 2022;24:4519–32. Bian G, Xu Y, Lu P, Xie Y, Xi Z. The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti . PLoS Pathog. 2010;6:e1000833. van den Hurk AF, Hall-Mendelin S, Pyke AT, Frentiu FD, McElroy K, Day A, et al. Impact of Wolbachia on infection with chikungunya and yellow fever viruses in the mosquito vector Aedes aegypti . PLoS Negl Trop Dis. 2012;6:e1892. Bourtzis K, Dobson SL, Xi Z, Rasgon JL, Calvitti M, Moreira LA, et al. Harnessing mosquito- Wolbachia symbiosis for vector and disease control. Acta Trop. 2014;132:S150-63. Zhou W, Rousset F, O’Neill S. Phylogeny and PCR–based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B Biol Sci. 1998;265:509–15. Atyame CM, Delsuc F, Pasteur N, Weill M, Duron O. Diversification of Wolbachia endosymbiont in the Culex pipiens mosquito. Mol Biol Evol. 2011;28:2761–72. Wiwatanaratanabutr I. Geographic distribution of wolbachial infections in mosquitoes from Thailand. J Invertebr Pathol. 2013;114:337–40. Huber K, Jansen S, Leggewie M, Badusche M, Schmidt-Chanasit J, Becker N, et al. Aedes japonicus japonicus (Diptera: Culicidae) from Germany have vector competence for Japan encephalitis virus but are refractory to infection with West Nile virus. Parasitol Res. 2014;113:3195–9. Hoffmann AA, Iturbe-Ormaetxe I, Callahan AG, Phillips BL, Billington K, Axford JK, et al. Stability of the w Mel Wolbachia infection following invasion into Aedes aegypti populations. PLoS Negl Trop Dis. 2014;8:e3115. Pinto SB, Riback TIS, Sylvestre G, Costa G, Peixoto J, Dias FBS, et al. Effectiveness of Wolbachia -infected mosquito deployments in reducing the incidence of dengue and other Aedes -borne diseases in Niterói, Brazil: A quasi-experimental study. PLoS Negl Trop Dis. 2021;15:e0009556. Mains JW, Brelsfoard CL, Rose RI, Dobson SL. Female adult Aedes albopictus suppression by Wolbachia -infected male mosquitoes. Sci Rep. 2016;6:33846. Haba Y, McBride L. Origin and status of Culex pipiens mosquito ecotypes. Current Biology. 2022;32(5):R237-46. Becker N, Petric D, Zgomba M, Boase C, Madon M, Dahl C, et al. Mosquitoes -identification, ecology and control. 3rd ed. Cham: Springer; 2020. Williams J, Flood L, Praulins G, Ingham VA, Morgan J, Lees RS, et al. Characterisation of Anopheles strains used for laboratory screening of new vector control products. Parasit Vectors. 2019;12:522. Lees R, Praulins G, Davies R, Brown F, Parsons G, White A, et al. A testing cascade to identify repurposed insecticides for next-generation vector control tools: screening a panel of chemistries with novel modes of action against a malaria vector. Gates Open Res. 2019;3:1464. Werren JH, Windsor DM. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc R Soc Lond B Biol Sci. 2000;267:1277–85. FinchTV, v1.5.0. https://digitalworldbiology.com/FinchTV. Geneious Prime, v2024.0.5. https://www.geneious.com. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, et al. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008;36:465-9. Letunic I, Bork P. Interactive tree of life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52:78-82. Nkya TE, Poupardin R, Laporte F, Akhouayri I, Mosha F, Magesa S, et al. Impact of agriculture on the selection of insecticide resistance in the malaria vector Anopheles gambiae : a multigenerational study in controlled conditions. Parasit Vectors. 2014;7:480. Philbert A, Lyantagaye SL, Nkwengulila G. A. Review of agricultural pesticides use and the selection for resistance to insecticides in malaria mectors. Adv Entomol . 2014;02:120–8. Martins AJ, Ribeiro CD e M, Bellinato DF, Peixoto AA, Valle D, Lima JBP. Effect of insecticide resistance on development, longevity and reproduction of field or laboratory selected Aedes aegypti populations. PLoS One. 2012;7:e31889. Grossman MK, Uc-Puc V, Rodriguez J, Cutler DJ, Morran LT, Manrique-Saide P, et al. Restoration of pyrethroid susceptibility in a highly resistant Aedes aegypti population. Biol Lett. 2018;14:20180022. Mahilum MM, Storch V, Becker N. Molecular and electron microscopic identification of Wolbachia in Culex pipiens complex populations from the Upper Rhine Valley, Germany, and Cebu City, Philippines. J Am Mosq Control Assoc. 2003;19:206–10. Koban MB, Kampen H, Scheuch DE, Frueh L, Kuhlisch C, Janssen N, et al. The Asian bush mosquito Aedes japonicus japonicus (Diptera: Culicidae) in Europe, 17 years after its first detection, with a focus on monitoring methods. Parasit Vectors. 2019;12:109. Inácio da Silva LM, Dezordi FZ, Paiva MHS, Wallau GL. Systematic Review of Wolbachia symbiont detection in Mosquitoes: an entangled topic about methodological power and true symbiosis. Pathogens . 2021;10(1):39. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.tif Supplementary Figure 1. Dose responses for field populations with low n. A.Field-caught Ae. albopictus mortality (y-axis) comparing a control to three doses of permethrin (x-axis). B. Field-caught Ae. japonicus mortality (y-axis) comparing a control and two concentrations of permethrin (x-axis). n represents number of adult females. Graphicalabstract.png Graphical abstract Cite Share Download PDF Status: Published Journal Publication published 11 Dec, 2025 Read the published version in Journal of the European Mosquito Control Association → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5632644","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":399388724,"identity":"33c350b9-98e9-43c6-99e3-9a961b5de067","order_by":0,"name":"Natalie M Portwood","email":"","orcid":"","institution":"University Hospital Heidelberg","correspondingAuthor":false,"prefix":"","firstName":"Natalie","middleName":"M","lastName":"Portwood","suffix":""},{"id":399388725,"identity":"9c92ff73-79ec-471f-b670-86ecf7b940da","order_by":1,"name":"Theresa Schwan","email":"","orcid":"","institution":"University Hospital Heidelberg","correspondingAuthor":false,"prefix":"","firstName":"Theresa","middleName":"","lastName":"Schwan","suffix":""},{"id":399388726,"identity":"d5f4f60d-c065-48c3-8f9b-2851a0f417ee","order_by":2,"name":"Arianna Pugglioli","email":"","orcid":"","institution":"Centro Agricoltura Ambiente (Italy)","correspondingAuthor":false,"prefix":"","firstName":"Arianna","middleName":"","lastName":"Pugglioli","suffix":""},{"id":399388727,"identity":"d5b7ea0e-ea0c-4a2f-bbc7-c2c6f53177bb","order_by":3,"name":"Norbert Becker","email":"","orcid":"","institution":"Institut für Dipterologie","correspondingAuthor":false,"prefix":"","firstName":"Norbert","middleName":"","lastName":"Becker","suffix":""},{"id":399388728,"identity":"1fe22bb1-7746-4cd3-bf6a-be243b691098","order_by":4,"name":"Victoria A Ingham","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABTElEQVRIie2RP2uDQByGTw7Mcup6DjZfIXKQBtrSr9Ij0EyFjBlCOBHM0sZVv4VTp0IUIV3SPWCHQKAdshgKpX9C6KkFazSdC/XhOF7eu8efcADU1PxFYLrjNCT5CACB8YAF1kDpmcBKSlLlCskVeED5WSUKZd/hoNK6h8/LzV2nCRpSuO4Pb3teZDLYH3Q0G0rBavABNHtPCUXdcJ6wzqB8eeLMoivvMWDQmWPimnJXf5gA4hbHqCYSTOSnf94mSOTKgo4/JQtTL0Rt1bgG1PMrlfNM2UW91oIyKO0wnYbo+D1RpkVFgZnCryGykqzoIlMYn8I/IrA3PgXsKaLuOj7uWvwClCaR7iYKmmHihHJXNRgPxSmiEi7j2B+d2cqcvKDXqCkvekuIhiPNHt8EG7Y91ezyw2QuX7hcC1ZFmQPjinL7m1FTU1PzP/gCGDFy2m4EsV0AAAAASUVORK5CYII=","orcid":"","institution":"University Hospital Heidelberg","correspondingAuthor":true,"prefix":"","firstName":"Victoria","middleName":"A","lastName":"Ingham","suffix":""}],"badges":[],"createdAt":"2024-12-12 15:08:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5632644/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5632644/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.52004/2054930X-20251030","type":"published","date":"2025-12-12T00:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":73739268,"identity":"3de06742-7970-4974-b940-0f2ca4dba033","added_by":"auto","created_at":"2025-01-14 07:42:44","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":158746,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMap to show the state of Baden-Württemberg in south west Germany including the location of collections sites of mosquito collection sites within Baden-Württemberg. \u003c/strong\u003eFigure created using BioRender.com.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/6e97a59ced6877cbf1ac0aab.jpg"},{"id":73739551,"identity":"5e22fe48-a48e-4010-b069-739d807b31af","added_by":"auto","created_at":"2025-01-14 07:50:44","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":207723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDose-response curves with permethrin by topical exposure of mosquito populations.\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eAn. gambiae \u003c/em\u003esusceptible (SUS, orange) and \u003cem\u003eAn. gambiae \u003c/em\u003eresistant (RES, green) are shown in bold, dashed as susceptible and resistance resistant comparator strains. \u003cem\u003eCx. pipiens \u003c/em\u003es.l.\u003cem\u003e \u003c/em\u003e(pink), \u003cem\u003eCx. pipiens molestus \u003c/em\u003e(black), \u003cem\u003eAe. albopictus \u003c/em\u003eITALY (light blue), \u003cem\u003eAe. albopictus \u003c/em\u003eGERMANY (dark blue) and \u003cem\u003eAe. vexans \u003c/em\u003e(yellow) are shown. Permethrin concentration in percentage (%) in a logarithmic scale (x axis) and 24-hour post permethrin exposure mortality rate in percentage (%) (y-axis). Error bars show 95% confidence interval, data is constrained at 0 and 100%.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/8dca812fb792c255390fc5c3.jpg"},{"id":73739274,"identity":"e3e90127-cc48-4bed-b982-d073f328e2f3","added_by":"auto","created_at":"2025-01-14 07:42:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":76542,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eWolbachia \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eprevalence in percentage (%) in different mosquito populations. \u003c/strong\u003eFemales (blue) and males (orange) of each species (x-axis) were tested for \u003cem\u003eWolbachia \u003c/em\u003eprevalence (y-axis). No males for \u003cem\u003eCx. pipiens\u003c/em\u003e s.l were tested. Number of mosquitoes tested is shown above the bars.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/7c5014f09eba6c60209b4f16.png"},{"id":73739276,"identity":"d9cf5fee-f644-44c3-87e4-7e36a86e11ae","added_by":"auto","created_at":"2025-01-14 07:42:45","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":147752,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of aligned \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eWolbachia \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esequences. \u003c/strong\u003ePhylogenetic tree of Wolbachia sequences produced here with references of sequences of \u003cem\u003ew\u003c/em\u003eMel (LC108848.1), \u003cem\u003ew\u003c/em\u003ePip (U23709.1) and \u003cem\u003eT.urticae\u003c/em\u003e(MN123078.1). Branch lengths correspond to number of substitutions per site. Phylogenetic tree of the alignment was calculated with Bayesian estimated of phylogeny using Mr Bayes in Phylogeny.fr and figure created using iTOL (v.6.8.1).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/c59daddf4492638f98cabcca.png"},{"id":104984129,"identity":"ecc27b05-88eb-431e-85a3-8c8fb3f5484d","added_by":"auto","created_at":"2026-03-19 14:05:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1746795,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/57e0b1ad-b249-42fb-99af-4ed4f82384ee.pdf"},{"id":73739553,"identity":"535feea0-3292-4a20-acec-a71e42e50cf2","added_by":"auto","created_at":"2025-01-14 07:50:44","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7371308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 1. Dose responses for field populations with low n.\u003c/strong\u003e \u003cstrong\u003eA.\u003c/strong\u003eField-caught \u003cem\u003eAe. albopictus \u003c/em\u003emortality (y-axis) comparing a control to three doses of permethrin (x-axis). \u003cstrong\u003eB.\u003c/strong\u003e Field-caught \u003cem\u003eAe. japonicus \u003c/em\u003emortality (y-axis) comparing a control and two concentrations of permethrin (x-axis). n represents number of adult females.\u003c/p\u003e","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/4ed6f67429670f2c6acf95b4.tif"},{"id":73739269,"identity":"ee6d8178-81dc-42b8-a131-62443d4d7fb6","added_by":"auto","created_at":"2025-01-14 07:42:44","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":270205,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract\u003c/p\u003e","description":"","filename":"Graphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-5632644/v1/047a92d84936049dbd142a04.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Assessment of pyrethroid resistance and Wolbachia prevalence in pathogen-related mosquito species from south west Germany.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOver the past two decades, Europe has witnessed the increasing emergence and spread of arboviruses, along with their mosquito vectors, some of which were previously restricted to tropical and subtropical regions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This trend is largely attributed to the establishment of invasive mosquito species, particularly \u003cem\u003eAedes albopictus\u003c/em\u003e, which have successfully adapted to temperate climates [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. A lesser-known invasive \u003cem\u003eAedes\u003c/em\u003e species, \u003cem\u003eAe. japonicus\u003c/em\u003e, is also a capable vector [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Key drivers behind this phenomenon include ongoing globalisation, climate change characterised by rising temperatures and altered precipitation patterns, as well as rapid urbanisation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Together, these factors have created more favourable habitats for mosquitoes, enabling them to expand their geographical range across the continent. In addition to invasive mosquitoes, native mosquitoes such as \u003cem\u003eCulex pipiens\u003c/em\u003e sp are capable of carrying several viruses including West Nile Virus (WNV)[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and Usutu Virus (USUV) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], whilst \u003cem\u003eAedes vexans\u003c/em\u003e is a potential vector of WNV and Rift Valley Fever [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. \u003cem\u003eAe. albopictus\u003c/em\u003e is capable of transmitting over 26 different arboviruses and has been linked to several outbreaks across southern Europe [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. As a result, Europe is now facing a heightened threat of vector-borne diseases [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], including dengue (DENV), WNV, Zika virus (ZIKV), and chikungunya virus (CHIKV) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This growing risk underscores the urgent need for enhanced vector surveillance, public health preparedness, and the development of effective control strategies to mitigate the spread of these diseases. In recent years, the \u003cem\u003eAe. albopictus\u003c/em\u003e populations have been expanding rapidly in Germany [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The growth in population is being driven, at least in part, by globalisation, as \u003cem\u003eAe. albopictus\u003c/em\u003e is frequently transported to new regions through the movement of goods and increased human travel. These factors heighten the risk of local populations becoming involved in autochthonous transmission of disease [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Climate change also plays a critical role, with hotter summer months and extreme rainfall accelerating the mosquito\u0026rsquo;s development by shortening its generation time and boosting population size [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEfforts to prevent the spread of mosquitoes, particularly \u003cem\u003eAe. albopictus\u003c/em\u003e, have been implemented in various regions, including the Upper Rhine in southwestern Germany. Here, two key control strategies are employed: \u003cem\u003eBacillus thuringiensis\u003c/em\u003e subsp. \u003cem\u003eisraelensis\u003c/em\u003e (\u003cem\u003eBti\u003c/em\u003e), which targets mosquito larvae, and the Sterile Insect Technique (SIT), which reduces mosquito reproduction [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Whilst both methods are effective in curbing mosquito populations, they are not sufficient to control acute arboviral outbreaks [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In Germany, although thus far no autochthonous dengue cases have been reported to date [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], WNV has been detected[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and an outbreak of Usutu virus recently caused significant mortality among local bird populations [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnother common approach for mosquito control is the use of pyrethroids, a class of fast-acting insecticides widely deployed for vector control, particularly in efforts to combat malaria [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and arboviruses in south and central America and Asia [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In several European countries, pyrethroids have been employed to manage mosquito populations [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. However, their use for vector control in Germany is currently prohibited, with exceptions potentially allowed during acute arboviral outbreaks [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Despite this restriction, biocidal products containing pyrethroids, are available for public use in the form of insecticide sprays [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe extensive use of pyrethroid insecticides worldwide, including in public health and in agricultural use has led to the emergence of resistance in mosquito populations, a phenomenon now observed globally [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] and increasingly reported in Europe [\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Pyrethroid resistance has been documented in \u003cem\u003eAe. albopictus\u003c/em\u003e populations in Italy [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], with potential resistance detected in field populations from Greece [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Additionally, \u003cem\u003eCulex pipiens\u003c/em\u003e populations in Italy and Belgium have shown resistance to pyrethroids [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, the status of permethrin resistance in mosquito species relevant to Germany remains largely unknown, warranting further investigation.\u003c/p\u003e \u003cp\u003eIn addition to insecticide use, an innovative strategy for vector control is the use of the endosymbiotic bacterium \u003cem\u003eWolbachia\u003c/em\u003e, which naturally infects up to 40% of arthropod species, including many mosquito vectors [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. \u003cem\u003eWolbachia\u003c/em\u003e manipulates mosquito reproduction through a process known as cytoplasmic incompatibility [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and has also been shown to affect the transmission of arboviruses [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. \u003cem\u003eAe. albopictus\u003c/em\u003e is commonly infected with two \u003cem\u003eWolbachia\u003c/em\u003e strains, \u003cem\u003ew\u003c/em\u003eAlbA and \u003cem\u003ew\u003c/em\u003eAlbB [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], whilst the \u003cem\u003eCx. pipiens\u003c/em\u003e complex carries the \u003cem\u003ew\u003c/em\u003ePip strain [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. \u003cem\u003eWolbachia\u003c/em\u003e has also been detected in \u003cem\u003eAe. vexans\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], but so far, no \u003cem\u003eWolbachia\u003c/em\u003e infection has been found in \u003cem\u003eAe. japonicus\u003c/em\u003e [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The use of \u003cem\u003eWolbachia\u003c/em\u003e for population suppression and to reduce virus transmission presents a promising avenue for vector control in Europe, based on successful use in Australia, Brazil and the USA [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study we determine the resistance status of local mosquito vectors including \u003cem\u003eAe. albopictus, Ae. vexans, Cx. pipiens\u003c/em\u003e s.l. and \u003cem\u003eCx. pipiens molestus\u003c/em\u003e compared to well characterised insecticide susceptible and resistant mosquitoes from the African \u003cem\u003eAn. gambiae\u003c/em\u003e complex. We further explore the \u003cem\u003eWolbachia\u003c/em\u003e prevalence and sequence diversity in these local mosquitoes.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCollection sites of field mosquitoes\u003c/h2\u003e \u003cp\u003eAdult and immature stages of the field mosquitoes were collected in the summer of 2023 in Baden-W\u0026uuml;rttemberg, Germany (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). For the field population of \u003cem\u003eAe. albopictus\u003c/em\u003e and \u003cem\u003eAe. japonicus\u003c/em\u003e, eggs were collected using ovitraps (black plastic cups, half covered with water and a wooden stick for oviposition) in the upper Rhine region (Heidelberg and L\u0026ouml;rrach). Larvae of the \u003cem\u003eCx. pipiens\u003c/em\u003e complex were collected from an old decommissioned septic tank in South Baden. As the collection site is the natural habitat of the below ground ecotype of \u003cem\u003eCx. pipiens\u003c/em\u003e, the larvae were classified as \u003cem\u003eCx. pipiens molestus\u003c/em\u003e [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. \u003cem\u003eCx. pipiens\u003c/em\u003e s.l. larvae were collected from natural and artificial water containers in Heidelberg. Adult \u003cem\u003eAe. vexans\u003c/em\u003e mosquitos were collected by CO\u003csub\u003e2\u003c/sub\u003e traps after a flood of the Rhine River in Oberhausen-Rheinhausen. In each case, the species was distinguished based on morphological key [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnopheles gambiae\u003c/b\u003e \u003cb\u003ereference strains\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTwo \u003cem\u003eAn. gambiae\u003c/em\u003e complex laboratory strains were used as reference strains for permethrin in this study: an \u003cem\u003eAn. gambiae\u003c/em\u003e susceptible (SUS) strain originally from Kisumu/Kenya; and \u003cem\u003eAn. gambiae\u003c/em\u003e sl pyrethroid resistant (RES) strain originally from Tiassal\u0026eacute;/C\u0026ocirc;te d\u0026rsquo;Ivoire [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The Tiassal\u0026eacute; strain was maintained under consistent selection pressure as previously described [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMosquito rearing\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eCx. pipiens\u003c/em\u003e complex, \u003cem\u003eAe. japonicus\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e were reared at Heidelberg University Hospital under local conditions and natural light cycles from the beginning of summer till mid-autumn. \u003cem\u003eAn. gambiae\u003c/em\u003e strains were reared at Heidelberg University Hospital in standard insectary conditions (27\u0026deg;C, 80% humidity, 12:12 light:dark cycle, with one hour dawn and dusk). All mosquitoes were reared in large trays and fed on TetraMin fish food (Tetra, Melle, Germany). Adults were fed on a 10% sucrose solution from emergence. All mosquitoes used in this study are presumed mated.\u003c/p\u003e\n\u003ch3\u003eInsecticide exposures\u003c/h3\u003e\n\u003cp\u003eTopical exposure assays were performed as previously described [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] to generate a dose-response curve to estimate the lethal concentration of 50% of the mosquitoes dying (LC\u003csub\u003e50\u003c/sub\u003e) to permethrin of each mosquito populations (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). For the field populations, the F\u003csub\u003e0\u003c/sub\u003e generations were tested, except for \u003cem\u003eCx. pipiens molestus\u003c/em\u003e where the F\u003csub\u003e1\u003c/sub\u003e generation was additionally used. For \u003cem\u003eAe. albopictus\u003c/em\u003e ITALY, the F\u003csub\u003e24\u003c/sub\u003e and for \u003cem\u003eAe. albopictus\u003c/em\u003e GERMANY, the F\u003csub\u003e38\u003c/sub\u003e generation were tested.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTested mosquito species and their respective populations and collection site.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMosquito species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITALY, laboratory strain from Emilia-Romagna\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGERMANY, laboratory strain from Heidelberg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eField population from Heidelberg/L\u0026ouml;rrach\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. japonicus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eField population from Heidelberg/L\u0026ouml;rrach\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. vexans\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eField population from Oberhausen-Rheinhausen\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e sensus lato (s.l.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eField population from Heidelberg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens molestus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eField population from South Baden\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e sensus stricto (s.s.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKisumu, laboratory strain from Kenya\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e sensus lato (s.l.)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTiassal\u0026eacute;, laboratory strain from Ivory Coast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor topical application a range from 3\u0026ndash;25 female mosquitoes were used for one permethrin concentration; the low numbers in some instances are due to limited availability of the field mosquitoes. For both reference strains and \u003cem\u003eAe. albopictus\u003c/em\u003e GERMANY, 20\u0026ndash;25 mosquitoes were tested each concentration. The age of the mosquitoes was between 2\u0026ndash;5 days old, except for \u003cem\u003eAe. vexans\u003c/em\u003e, which were undetermined as adult field mosquitoes were collected. Concentrations were prepared from a 10% stock solution of permethrin (PESTANAL\u0026reg; analytical standard, Sigma-Aldrich) by serial dilutions with acetone (Thermo Fischer Scientific) and acetone was used for the control. All mosquito populations were anesthetized by CO\u003csub\u003e2\u003c/sub\u003e, except for the reference strains which were knocked down by cold at 4\u0026deg;C. 0.5 \u0026micro;l of the respective permethrin concentrations were dispensed directly on the surface of the back of the thorax [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Mosquitoes were put back into cups and 10% sucrose solution pads were placed on the top of the net of the cups. The reference mosquito strains and the laboratory \u003cem\u003eAe. albopictus\u003c/em\u003e strains were held at standard insectary conditions (27\u0026deg;C, 80% humidity). All other mosquitoes were left at ambient temperature. Mortality was recorded after 24 hours, and mosquitoes were classified as either dead or alive. Mosquitoes considered dead include dead and immobile mosquitoes.\u003c/p\u003e\n\u003ch3\u003eGeneration of dose-response curves and calculations of LC50 values\u003c/h3\u003e\n\u003cp\u003eDose-response curves were produced by a non-linear regression analysis per mosquito population using GraphPad Prism version 10.0.2. Lethal doses for 50% with 95% confidence intervals were calculated using GraphPad Prism. Dose-response curves were compared by statistical analysis using extra-sum-of-square F tests in GraphPad Prism. Resistance ratios were calculated by dividing the LC\u003csub\u003e50\u003c/sub\u003e of each population with the susceptible \u003cem\u003eAn. gambiae\u003c/em\u003e SUS strain.\u003c/p\u003e \u003cp\u003e \u003cb\u003eScreening of\u003c/b\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003eprevalence in mosquito populations\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAll mosquito populations were tested for \u003cem\u003eWolbachia\u003c/em\u003e using polymerase chain reaction (PCR), by amplification of the \u003cem\u003eWolbachia\u003c/em\u003e specific 16S rRNA gene. Briefly, individual mosquitoes stored at -20\u0026deg;C were homogenised in 100 \u0026micro;l STE buffer (Sigma-Aldrich) with a pestle. Samples of \u003cem\u003eAe. japonicus\u003c/em\u003e were kept in ethanol and were washed with Phosphate-buffered saline (PBS) (Sigma-Adrich) before homogenising. Homogenates were incubated at 95\u0026deg;C for 10 min and centrifugated at 16,000 xg for 3 min. Each supernatant containing gDNA was removed and stored in a new tube.\u003c/p\u003e \u003cp\u003eThe 438 bp fragment of the 16S rRNA gene was amplified in a 25 \u0026micro;l PCR containing 1 \u0026micro;l gDNA, 2.5 \u0026micro;l of 10x DreamTaq Green buffer (Thermo Fisher Scientific), 0.5 \u0026micro;l of 10 nm dNTPs (Thermo Fisher Scientific), 0.25 \u0026micro;l DreamTaq polymerase (Thermo Fisher Scientific), 18.75 \u0026micro;l UltraPure Distilled Water (Invitrogen) and 1 \u0026micro;l each of the forward primer (CATACCTATTCGAAGGGATAG) and reverse primer (AGCTTCGAGTGAAACCAATTC) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Instead of the 1 \u0026micro;l sample gDNA, 1 \u0026micro;l UltraPure Distilled Water was added for the negative control. For the positive control, 1 \u0026micro;l genomic DNA from \u003cem\u003eDrosophila melanogaster\u003c/em\u003e known to be \u003cem\u003ewMel\u003c/em\u003e positive was added, generously donated by Prof Steffen Lemke. PCR was performed under the following thermocycler conditions: initial denaturation at 95\u0026deg;C for 5 min, followed by 2 cycles of denaturation at 95\u0026deg;C for 2 min, annealing at 60\u0026deg;C for 1 min and 72\u0026deg;C for 1 min. After, 35 cycles of denaturation at 94\u0026deg;C for 30 seconds, annealing at 54\u0026deg;C for 30 seconds and 72\u0026deg;C for 1 min. A final extension step at 72\u0026deg;C for 10 min.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003especies identification\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA subset of \u003cem\u003eWolbachia\u003c/em\u003e positive PCR samples were sent for sequencing. These samples were purified using the commercially available QIAquick PCR Purification Kit (Qiagen), using 30 \u0026micro;l of water for elution. The samples were sent to GENEWIZ Germany for Sanger sequencing. \u003cem\u003eWolbachia\u003c/em\u003e sequences were trimmed with FinchTV (v1.5.0) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Consensus sequences and the alignment was created using Geneious Prime (v2024.0.5) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. A phylogenetic tree of the alignment was calculated with Bayesian estimation of phylogeny using MrBayes (v3.2.6) in Phylogeny.fr[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] and was modified with the webtool iTOL (v6.8.1) [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePermethrin dose-response bioassay\u003c/h2\u003e \u003cp\u003eThe susceptibility to permethrin was assessed for all mosquito populations and the dose-response curves are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A total of 4146 female mosquitoes were tested; \u003cem\u003eAe. albopictus\u003c/em\u003e ITALY, n\u0026thinsp;=\u0026thinsp;726; \u003cem\u003eAe. albopictus\u003c/em\u003e GERMANY, n\u0026thinsp;=\u0026thinsp;487; \u003cem\u003eAe. albopictus\u003c/em\u003e field population, n\u0026thinsp;=\u0026thinsp;37; \u003cem\u003eAe japonicus\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;35; \u003cem\u003eAe. vexans\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;597; \u003cem\u003eCx. pipiens\u003c/em\u003e s.l., n\u0026thinsp;=\u0026thinsp;614: \u003cem\u003eCx. pipiens molestus\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;159 (Supplementary Table\u0026nbsp;1). LC\u003csub\u003e50\u003c/sub\u003e values of each population and the resistance ratios (RRs) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eFor all tested \u003cem\u003eAedes\u003c/em\u003e populations, no permethrin resistance was observed, with RRs\u0026thinsp;\u0026lt;\u0026thinsp;1 and significantly lower LC\u003csub\u003e50\u003c/sub\u003e values compared to the \u003cem\u003eAn. gambiae\u003c/em\u003e susceptible control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). In contrast, the \u003cem\u003eCulex pipiens\u003c/em\u003e populations exhibited elevated LC\u003csub\u003e50\u003c/sub\u003e values of 0.018% (95% CI [0.0012\u0026ndash;0.0024]; p\u0026thinsp;=\u0026thinsp;0.0001) for \u003cem\u003eCx pipiens molestus\u003c/em\u003e and 0.015% (95% CI [0.0013\u0026ndash;0.0017]; p\u0026thinsp;=\u0026thinsp;0.0002) for \u003cem\u003eCx. pipiens\u003c/em\u003e s.l. The RR values were \u0026gt;\u0026thinsp;1 compared to the susceptible \u003cem\u003eAn. gambiae\u003c/em\u003e SUS strain with an LC\u003csub\u003e50\u003c/sub\u003e of 0.00097% (95% CI [0.00085\u0026ndash;0.0011]) suggesting some level of pyrethroid tolerance. However, when compared to the highly resistant \u003cem\u003eAn. gambiae RES\u003c/em\u003e strain, all tested Culex populations had significantly lower resistance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e \u003cp\u003eDue to limited numbers of \u003cem\u003eAe. japonicus\u003c/em\u003e and \u003cem\u003eAe. albopictus\u003c/em\u003e field populations, not enough data was generated to create dose-response curves. However, three different concentrations were tested for \u003cem\u003eAe. albopictus\u003c/em\u003e field population and two concentrations for \u003cem\u003eAe. japonicus\u003c/em\u003e (Supplementary Fig.\u0026nbsp;1A, B). From the three concentrations of \u003cem\u003eAe. albopictus\u003c/em\u003e the data indicates that all mosquitoes were dead at 0.009% but not at 0.00001%. However, for each concentration only four to ten mosquitoes were tested (Supplementary Fig.\u0026nbsp;1A). Similarly for \u003cem\u003eAe. japonicus\u003c/em\u003e, 100% mortality was observed at a concentration of 0.0015% permethrin, but only eight mosquitoes were exposed at this concentration (Supplementary Fig.\u0026nbsp;1B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eLC\u003c/b\u003e\u003csub\u003e\u003cb\u003e50\u003c/b\u003e\u003c/sub\u003e \u003cb\u003emortality values, 95% confidence interval (CI) and resistance ratios (RRs) of tested populations after 24 hours topical exposure.\u003c/b\u003e LC\u003csub\u003e50\u003c/sub\u003e were generated using dose-response curves (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). LC\u003csub\u003e50\u003c/sub\u003e and 95% CI intervals were calculated with GraphPad Prism. RRs were obtained by dividing LC\u003csub\u003e50\u003c/sub\u003e of each population with the susceptible \u003cem\u003eAn. gambiae\u003c/em\u003e SUS strain.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMosquito population\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLC50 (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95% CI (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eResistance ratio (RR)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e SUS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00085\u0026ndash;0.0011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e RES\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.035\u0026ndash;0.040\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e38.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens molestus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0012\u0026ndash;0.0024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e s.I.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0015\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0014\u0026ndash;0.0017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. vexans\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00030\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00025\u0026ndash;0.00035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopcitus\u003c/em\u003e ITALY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00031\u0026ndash;0.00039\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopicitus\u003c/em\u003e GERMANY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00056\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00051\u0026ndash;0.00062\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.57\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eComparison of reference strains to tested populations using extra-sum-of-square F tests.\u003c/b\u003e Each tested population was compared to the susceptible and resistance \u003cem\u003eAn. gambiae\u003c/em\u003e strain. p-values and F-values were calculated with extra-sum-of-square F test and generated with GraphPad Prism. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was taken as significant.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMosquito population\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP-value \u003cem\u003eAn. gambiae\u003c/em\u003e SUS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP-value \u003cem\u003eAn. gambiae\u003c/em\u003e RES\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF (DFn, DFd) value \u003cem\u003eAn. gambiae\u003c/em\u003e SUS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF (DFn, DFd) value \u003cem\u003eAn. gambiae\u003c/em\u003e RES\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e SUS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e242 (2, 49)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens molestus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8.26 (2, 34)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e129 (2, 33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCx. pipiens\u003c/em\u003e s.I.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.2 (2, 48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e220 (2, 47)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. vexans\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58.9 (2, 51)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e298 (2, 50)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e ITALY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55.2 (2, 52)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e262 (2, 51)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e GERMANY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17.9 (2,44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e293 (2, 43)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003eprevalence\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDetection of \u003cem\u003eWolbachia\u003c/em\u003e in all collected mosquito populations was performed with PCR by amplification of the conserved \u003cem\u003eWolbachia\u003c/em\u003e S16 rRNA gene. All populations were found to be infected with \u003cem\u003eWolbachia\u003c/em\u003e of different frequencies see Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Supplementary Table\u0026nbsp;2. Highest rates of \u003cem\u003eWolbachia\u003c/em\u003e were found in \u003cem\u003eAe. albopictus\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e species. All \u003cem\u003eAe. albopictus\u003c/em\u003e populations showed similar frequencies of \u003cem\u003eWolbachia\u003c/em\u003e infections, except for \u003cem\u003eAe. albopictus\u003c/em\u003e F\u003csub\u003e0\u003c/sub\u003e males which were found to be infected at a lower frequency. In contrast, only 10% females were found to be infected with \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAe. vexans.\u003c/em\u003e Interestingly, \u003cem\u003eAe. japonicus\u003c/em\u003e show a female bias towards infection. \u003cem\u003eWolbachia\u003c/em\u003e was detected for the first time in \u003cem\u003eAe. japonicus\u003c/em\u003e with a frequency of 20% for males and 70% for females.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003ephylogenetic tree\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA subset of \u003cem\u003eWolbachia\u003c/em\u003e positive samples were sequenced and adequate sequences aligned to generate a phylogenetic tree with bayesian estimation. For reference, sequences of \u003cem\u003ew\u003c/em\u003eMel (LC108848.1), \u003cem\u003ew\u003c/em\u003ePip (U23709.1) and \u003cem\u003eT.urticae\u003c/em\u003e (MN123078.1, due to high similarity) were used (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Overall, all sequences showed high similarities with \u003cem\u003eAe. japonicus\u003c/em\u003e, \u003cem\u003eAe. vexans\u003c/em\u003e and the \u003cem\u003eCx. pipiens\u003c/em\u003e complex grouped together with \u003cem\u003ew\u003c/em\u003ePip and \u003cem\u003eT.urticae Wolbachia\u003c/em\u003e. In contrast, \u003cem\u003eWolbachia\u003c/em\u003e sequences from all \u003cem\u003eAe. albopictus\u003c/em\u003e populations were grouped together in one clade.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLittle is known about the toxicity of pyrethroid insecticides to different German mosquito species. Here we show that field-caught \u003cem\u003eCulex pipiens\u003c/em\u003e sp. show a tendency towards resistance whilst the \u003cem\u003eAedes\u003c/em\u003e tested here show high levels of susceptibility to pyrethroid insecticides. All mosquito species tested show infection with \u003cem\u003eWolbachia\u003c/em\u003e, highlighting its potential use for mosquito control in southwestern Germany.\u003c/p\u003e \u003cp\u003eBoth \u003cem\u003eCx. pipiens\u003c/em\u003e s.l. and \u003cem\u003eCx. pipiens molestus\u003c/em\u003e show increased resistance to pyrethroid insecticides, in line with data showing resistance to permethrin and deltamethrin in Italy, Spain and Belgium [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Nevertheless, the resistance level here is likely much lower than these populations where survival to exposure of diagnostic doses of 0.05% and 0.75% deltamethrin and permethrin respectively is high [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In this study we see that \u003cem\u003eCx. pipiens molestus\u003c/em\u003e is more resistant than \u003cem\u003eCx. pipiens\u003c/em\u003e s.l., which could be due to different habitats. The \u003cem\u003eCx. pipiens molestus\u003c/em\u003e used here were found in an old decommissioned septic tank; therefore, it is more exposed to chemicals and thus more likely to be resistant to toxins [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The \u003cem\u003eAedes\u003c/em\u003e populations tested here had higher susceptibility to pyrethroids when compared to a lab susceptible \u003cem\u003eAn. gambiae\u003c/em\u003e population; however, this data must be interpreted with caution as these mosquitoes have been kept in the laboratory with no insecticide exposure for numerous generations. Due to the associated fitness cost of pyrethroid resistance [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], it is likely any resistance was lost in colony [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The reports of high levels of resistance in \u003cem\u003eAe. albopictus\u003c/em\u003e in Italy supports this hypothesis. Despite managing to acquire field-caught \u003cem\u003eAe. albopictus\u003c/em\u003e and \u003cem\u003eAe. japonicus\u003c/em\u003e we were unable to ascertain resistance levels due to high levels of death during rearing.\u003c/p\u003e \u003cp\u003e \u003cem\u003eWolbachia\u003c/em\u003e screening revealed that all species tested here contained the bacteria. \u003cem\u003eAe. albopictus\u003c/em\u003e had high levels of prevalence in line with expectations. Further, \u003cem\u003eCulex\u003c/em\u003e species had high prevalence of infection, an increase on a prior study showing 10\u0026ndash;100% infection [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The prevalence in \u003cem\u003eAe. japonicus\u003c/em\u003e was lower than other species; however, \u003cem\u003eWolbachia\u003c/em\u003e infection of this species has never before been reported [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The final species showing the lowest prevalence is \u003cem\u003eAe. vexans\u003c/em\u003e and no data exists describing infection in Europe; however, it has been reported to be infected with \u003cem\u003eWolbachia\u003c/em\u003e in Thailand [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Interestingly, the \u003cem\u003eWolbachia\u003c/em\u003e found in native \u003cem\u003eCulex\u003c/em\u003e mosquitoes and \u003cem\u003eAe. japonicus\u003c/em\u003e are very similar despite large evolutionary and ecological differences. Indeed, the first reported case of \u003cem\u003eAe. japonicus\u003c/em\u003e in Germany was in 2008 [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. indicating local acquisition of \u003cem\u003eWolbachia\u003c/em\u003e. Taken together, this data indicates that \u003cem\u003eWolbachia-\u003c/em\u003emediated control of mosquito vectors has high potential in Germany. The results here have several limitations: 16S is not sufficient alone for species characterization and \u003cem\u003eftsZ\u003c/em\u003e or similar should be used [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]; further, some sequence quality was low necessitating trimming. Thus, more studies are needed to confirm the close phylogenetic relationship posed here.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe expanding geographic range of mosquito species with the associated risk of arboviral infection [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] necessitates characterising resistance to difference insecticide classes which can be used in emergency scenarios. As resistance to pyrethroids is increasingly being observed in European mosquito populations, notably in \u003cem\u003eAe. albopictus\u003c/em\u003e and \u003cem\u003eCx. pipiens\u003c/em\u003e [\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], we must understand the distribution and spread of this phenotype in order to deploy insecticides efficiently when required. Further, exploration of alternative control strategies, including the use of \u003cem\u003eWolbachia\u003c/em\u003e to suppress mosquito populations and reduce arbovirus transmission is critical. Given the potential for future arboviral outbreaks, especially as mosquito vectors continue to adapt to changing environmental conditions, a multifaceted approach combining chemical, biological, and genetic strategies will be crucial for effective vector control and the prevention of disease transmission across Europe.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eAe\u003c/em\u003e., \u003cem\u003eAedes\u003c/em\u003e; \u003cem\u003eAn\u003c/em\u003e., \u003cem\u003eAnopheles\u003c/em\u003e; \u003cem\u003eBti\u003c/em\u003e,\u0026nbsp;\u003cem\u003eBacillus thuringiensis\u003c/em\u003e subsp. \u003cem\u003eIsraelensis\u003c/em\u003e;\u0026nbsp;CHIKV, Chikungunya virus; CI, confidence interval, Cx., \u003cem\u003eCulex\u003c/em\u003e; DENV, dengue virus; gDNA, genomic DNA; LC, lethal dose; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RRs, resistance ratios; SD, standard deviation; SIT, Sterile Insect Technique; s.I., sensus lato; s.s., sensus stricto; WNV, West Nile virus; ZIKV, Zika virus\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Deutsches Zentrum für Infektionsforschung (DZIF, TTU03.705) to VAI as well as\u0026nbsp;financially supported by the German Federal Ministry of Food and Agriculture (BMEL) within the framework of the CuliFo3 project “Mosquitoes and mosquito-borne zoonoses (project no. 2819107D22).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are provided in the manuscript or in the supplementary files. Raw data from all assays are available in the supplementary tables. The DNA Sequences generated in this study have been deposited in the NCBI GeneBank data base under accession numbers: PQ073087, PQ073088, PQ073089, PQ073091, PQ073092, PQ073093, PQ073094, PQ073095, PQ073096, PQ073097, PQ083098, PQ073099, PQ073100, PQ073101, PQ073102, and PQ073103.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Prof Steffen Lemke, COS Heidelberg, for the \u003cem\u003eDrosophila melanogaster\u0026nbsp;\u003c/em\u003egDNA, Liverpool Insect Testing Establishment (part of iiDiagnostics Ltd.) for originally providing the \u003cem\u003eAn. gambiae\u0026nbsp;\u003c/em\u003ecolonies. Our grateful thanks go to Prof. Jonas Schmidt-Chanasit, Bernhard-Nocht-Institute, Hamburg, coordinator of CuliFo3. We would like to thank Artin Tokatlian, Selina Stöferle and Thomas Weitzel for providing and collecting the German field mosquito larvae. We would also like to thank Juliane Hartke for her assistance with the construction of the phylogenetic tree.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNP and TS carried out all rearing and laboratory experiments in the study. NB and AP carried out and coordinated all collections. AP provided the \u003cem\u003eAe. albopictus\u0026nbsp;\u003c/em\u003eITALY and \u003cem\u003eAe. albopictus\u0026nbsp;\u003c/em\u003eGERMANY eggs and VAI and NB conceived the study. VAI provided guidance throughout. NP, TS, VAI and NB drafted the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGould EA, Higgs S. Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg. 2009;103:109\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003ePaupy C, Delatte H, Bagny L, Corbel V, Fontenille D. \u003cem\u003eAedes albopictus\u003c/em\u003e, an arbovirus vector: From the darkness to the light. Microbes Infect. 2009;11:1177\u0026ndash;85. \u003c/li\u003e\n\u003cli\u003eSchaffner F, Vazeille M, Kaufmann C, Failloux A-B, Mathis A. Vector competence of \u003cem\u003eAedes japonicus\u003c/em\u003e for chikungunya and dengue viruses. J Eur Mosq Control Assoc. 2011;29:141\u0026ndash;2. \u003c/li\u003e\n\u003cli\u003eSardelis MR, Turell MJ. \u003cem\u003eOchlerotatus j. japonicus\u003c/em\u003e in Frederick County, Mayland: discovery, distribution and vector competence for West Nile virus. J Am Mosq Control Assoc. 2001;17(2):137-41. \u003c/li\u003e\n\u003cli\u003eOutammassine A, Zouhair S, Loqman S. Global potential distribution of three underappreciated arboviruses vectors (\u003cem\u003eAedes japonicus\u003c/em\u003e, \u003cem\u003eAedes vexans\u003c/em\u003e and \u003cem\u003eAedes vittatus\u003c/em\u003e) under current and future climate conditions. Transbound Emerg Dis. 2022;69:e1160\u0026ndash;71. \u003c/li\u003e\n\u003cli\u003eCiota A, Kramer L. Vector-virus interactions and transmission dynamics of West Nile virus. Viruses. 2013;5:3021\u0026ndash;47. \u003c/li\u003e\n\u003cli\u003eHolicki CM, Scheuch DE, Ziegler U, Lettow J, Kampen H, Werner D, et al. German \u003cem\u003eCulex pipiens \u003c/em\u003ebiotype \u003cem\u003emolestus\u003c/em\u003e and \u003cem\u003eCulex torrentium\u003c/em\u003e are vector-competent for Usutu virus. Parasit Vectors. 2020;13:625. \u003c/li\u003e\n\u003cli\u003eNdiaye EH, Fall G, Gaye A, Bob NS, Talla C, Diagne CT, et al. Vector competence of \u003cem\u003eAedes vexans\u003c/em\u003e (Meigen), \u003cem\u003eCulex poicilipes\u003c/em\u003e (Theobald) and \u003cem\u003eCx. quinquefasciatus\u003c/em\u003e Say from Senegal for West and East African lineages of Rift Valley fever virus. Parasit Vectors. 2016;9:94. \u003c/li\u003e\n\u003cli\u003eGossner CM, Ducheyne E, Schaffner F. Increased risk for autochthonous vector-borne infections transmitted by \u003cem\u003eAedes albopictus\u003c/em\u003e in continental Europe. Euro Surveill. 2018;23(24).\u003c/li\u003e\n\u003cli\u003eBarrett ADT. West Nile in Europe: an increasing public health problem. J Travel Med. 2018;25(1). \u003c/li\u003e\n\u003cli\u003eBecker, N. Wetterextreme: Invasive Stechm\u0026uuml;cken nehmen zu. In: Loz\u0026aacute;n JL, Gras\u0026szlig;l H, Kasang D, Quante M, Sillmann J, editors. Warnsignal Klima \u0026ndash; Herausforderung Wetterextreme \u0026ndash; Ursachen, Auswirkungen \u0026amp; Handlungsoptionen. Wissenschaftl. Auswertung; 2024. p.205-13. \u003c/li\u003e\n\u003cli\u003eBecker N, Geier M, Balczun C, Bradersen U, Huber K, Kiel E, et al. Repeated introduction of \u003cem\u003eAedes albopictus\u003c/em\u003e into Germany, July to October 2012. Parasitol Res. 2013;112:1787\u0026ndash;90. \u003c/li\u003e\n\u003cli\u003eBecker N, Langentepe-Kong SM, Tokatlian Rodriguez A, Oo TT, Reichle D, L\u0026uuml;hken R, et al. Integrated control of \u003cem\u003eAedes albopictus\u003c/em\u003e in Southwest Germany supported by the Sterile Insect Technique. Parasit Vectors. 2022;15:9. \u003c/li\u003e\n\u003cli\u003eECDC. Local transmission of dengue virus in mainland EU/EEA, 2010-present. https://www.ecdc.europa.eu/en/all-topics-z/dengue/surveillance-and-disease-data/autochthonous-transmission-dengue-virus-eueea (2024). Accessed 28 Nov 2024.\u003c/li\u003e\n\u003cli\u003eZiegler U, Santos PD, Groschup MH, Hattendorf C, Eiden M, H\u0026ouml;per D, et al. West Nile virus epidemic in Germany triggered by epizootic emergence, 2019. Viruses. 2020;12:448. \u003c/li\u003e\n\u003cli\u003eFynmore N, L\u0026uuml;hken R, Maisch H, Risch T, Merz S, Kliemke K, et al. Rapid assessment of West Nile virus circulation in a German zoo based on honey-baited FTA cards in combination with box gravid traps. Parasit Vectors. 2021;14:449. \u003c/li\u003e\n\u003cli\u003eBecker N, J\u0026ouml;st H, Ziegler U, Eiden M, H\u0026ouml;per D, Emmerich P, et al. Epizootic emergence of Usutu virus in wild and captive birds in Germany. PLoS One. 2012;7:e32604. \u003c/li\u003e\n\u003cli\u003eWorld Health Organization. World malaria report 2023. World Health Organization, 2023.\u003c/li\u003e\n\u003cli\u003evan den Berg H, da Silva Bezerra HS, Al-Eryani S, Chanda E, Nagpal BN, Knox TB, et al. Recent trends in global insecticide use for disease vector control and potential implications for resistance management. Sci Rep. 2021;11:23867. \u003c/li\u003e\n\u003cli\u003eWorld Health Organization. Global arbovirus initiative - preparing for the next pandemic by tackling mosquito-borne viruses with epidemic and pandemic potential. World Health Organization, 2024. \u003c/li\u003e\n\u003cli\u003eFlacio E, Engeler L, Tonolla M, L\u0026uuml;thy P, Patocchi N. Strategies of a thirteen year surveillance programme on \u003cem\u003eAedes albopictus\u003c/em\u003e (\u003cem\u003eStegomyia albopicta\u003c/em\u003e) in southern Switzerland. Parasit Vectors. 2015;8:208. \u003c/li\u003e\n\u003cli\u003eBONDS JAS. Ultra‐low‐volume space sprays in mosquito control: a critical review. Med Vet Entomol. 2012;26:121\u0026ndash;30. \u003c/li\u003e\n\u003cli\u003eScholte EJ, Den Hartog W, Dik M, Schoelitsz B, Brooks M, Schaffner F, et al. Introduction and control of three invasive mosquito species in the Netherlands, July-October 2010. Euro Surveill. 2010;15(45). \u003c/li\u003e\n\u003cli\u003eBecker, N. Wetterextreme: Invasive Stechm\u0026uuml;cken nehmen zu. In: Loz\u0026aacute;n JL, Gras\u0026szlig;l H, Kasang D, Quante M, Sillmann J, editors. Warnsignal Klima \u0026ndash; Herausforderung Wetterextreme \u0026ndash; Ursachen, Auswirkungen \u0026amp; Handlungsoptionen. Wissenschaftl. Auswertung; 2024. p.205-13. \u003c/li\u003e\n\u003cli\u003eNationale Expertenkommission f\u0026uuml;r Stechm\u0026uuml;cken, Friedrich-Loeffler-Institut, editors. Integriertes Management von vektorkompetenten Stechm\u0026uuml;cken in Deutschland unter Ber\u0026uuml;cksichtigung der Anwendung von Adultiziden. In Empfehlungen der Nationalen Expertenkommission f\u0026uuml;r Stechm\u0026uuml;cken am FLI. Greifswald - Insel Riems: Friedrich-Loeffler-Institut, 2022. \u003c/li\u003e\n\u003cli\u003eEuropean Chemicals Agency. Information on biocides. https://www.echa.europa.eu/web/guest/information-on-chemicals/biocidal-products?p_p_id=dissbiocidalproducts_WAR_dissbiocidalproductsportlet\u0026amp;p_p_lifecycle=1\u0026amp;p_p_state=normal\u0026amp;p_p_mode\u003cbr\u003e=view\u0026amp;_dissbiocidalproducts_WAR_dissbiocidalproductsportlet_javax.portlet.action=dissBiocidalProductsAction (2024). Accessed 28 Nov 2024. \u003c/li\u003e\n\u003cli\u003eSmith LB, Kasai S, Scott JG. Pyrethroid resistance in \u003cem\u003eAedes aegypti\u003c/em\u003e and A\u003cem\u003eedes albopictus\u003c/em\u003e: important mosquito vectors of human diseases. Pestic Biochem Physiol. 2016;133:1-12.\u003c/li\u003e\n\u003cli\u003eScott JG, Yoshimizu MH, Kasai S. Pyrethroid resistance in \u003cem\u003eCulex pipiens\u003c/em\u003e mosquitoes. Pestic Biochem Physiol. 2015;120:68\u0026ndash;76. \u003c/li\u003e\n\u003cli\u003ePichler V, Giammarioli C, Bellini R, Veronesi R, Arnoldi D, Rizzoli A, et al. First evidence of pyrethroid resistance in Italian populations of West Nile virus vector \u003cem\u003eCulex pipiens\u003c/em\u003e. Med Vet Entomol. 2022;36:390\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eBengoa M, Eritja R, Delacour S, Miranda M\u0026Aacute;, Sureda A, Lucientes J. First data on resistance to pyrethroids in wild populations of \u003cem\u003eAedes albopictus\u003c/em\u003e from Spain. J Am Mosq Control Assoc. 2017;33:246\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003ePichler V, Bellini R, Veronesi R, Arnoldi D, Rizzoli A, Lia RP, et al. First evidence of resistance to pyrethroid insecticides in Italian\u003cem\u003e Aedes albopictus\u003c/em\u003e populations 26\u0026thinsp;years after invasion. Pest Manag Sci. 2018;74:1319\u0026ndash;27. \u003c/li\u003e\n\u003cli\u003eVereecken S, Vanslembrouck A, Kramer IM, M\u0026uuml;ller R. Phenotypic insecticide resistance status of the Culex pipiens complex: a European perspective. Parasit Vectors. 2022;15:423. \u003c/li\u003e\n\u003cli\u003eZug R, Hammerstein P. Still a host of hosts for \u003cem\u003eWolbachia\u003c/em\u003e: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7:e38544.\u003c/li\u003e\n\u003cli\u003eWang W, Cui W, Yang H. Toward an accurate mechanistic understanding of \u003cem\u003eWolbachia\u003c/em\u003e\u003cem\u003e‐\u003c/em\u003e induced cytoplasmic incompatibility. Environ Microbiol. 2022;24:4519\u0026ndash;32. \u003c/li\u003e\n\u003cli\u003eBian G, Xu Y, Lu P, Xie Y, Xi Z. The endosymbiotic bacterium \u003cem\u003eWolbachia\u003c/em\u003e induces resistance to dengue virus in \u003cem\u003eAedes aegypti\u003c/em\u003e. PLoS Pathog. 2010;6:e1000833. \u003c/li\u003e\n\u003cli\u003evan den Hurk AF, Hall-Mendelin S, Pyke AT, Frentiu FD, McElroy K, Day A, et al. Impact of \u003cem\u003eWolbachia\u003c/em\u003e on infection with chikungunya and yellow fever viruses in the mosquito vector \u003cem\u003eAedes aegypti\u003c/em\u003e. PLoS Negl Trop Dis. 2012;6:e1892. \u003c/li\u003e\n\u003cli\u003eBourtzis K, Dobson SL, Xi Z, Rasgon JL, Calvitti M, Moreira LA, et al. Harnessing mosquito-\u003cem\u003eWolbachia \u003c/em\u003esymbiosis for vector and disease control. Acta Trop. 2014;132:S150-63.\u003c/li\u003e\n\u003cli\u003eZhou W, Rousset F, O\u0026rsquo;Neill S. Phylogeny and PCR\u0026ndash;based classification of \u003cem\u003eWolbachia \u003c/em\u003estrains using \u003cem\u003ewsp\u003c/em\u003e gene sequences. Proc R Soc Lond B Biol Sci. 1998;265:509\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eAtyame CM, Delsuc F, Pasteur N, Weill M, Duron O. Diversification of \u003cem\u003eWolbachia \u003c/em\u003eendosymbiont in the \u003cem\u003eCulex pipiens\u003c/em\u003e mosquito. Mol Biol Evol. 2011;28:2761\u0026ndash;72. \u003c/li\u003e\n\u003cli\u003eWiwatanaratanabutr I. Geographic distribution of wolbachial infections in mosquitoes from Thailand. J Invertebr Pathol. 2013;114:337\u0026ndash;40.\u003c/li\u003e\n\u003cli\u003eHuber K, Jansen S, Leggewie M, Badusche M, Schmidt-Chanasit J, Becker N, et al. \u003cem\u003eAedes japonicus japonicus\u003c/em\u003e (Diptera: Culicidae) from Germany have vector competence for Japan encephalitis virus but are refractory to infection with West Nile virus. Parasitol Res. 2014;113:3195\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eHoffmann AA, Iturbe-Ormaetxe I, Callahan AG, Phillips BL, Billington K, Axford JK, et al. Stability of the \u003cem\u003ew\u003c/em\u003eMel \u003cem\u003eWolbachia \u003c/em\u003einfection following invasion into \u003cem\u003eAedes aegypti\u003c/em\u003e populations. PLoS Negl Trop Dis. 2014;8:e3115. \u003c/li\u003e\n\u003cli\u003ePinto SB, Riback TIS, Sylvestre G, Costa G, Peixoto J, Dias FBS, et al. Effectiveness of \u003cem\u003eWolbachia\u003c/em\u003e-infected mosquito deployments in reducing the incidence of dengue and other \u003cem\u003eAedes\u003c/em\u003e-borne diseases in Niter\u0026oacute;i, Brazil: A quasi-experimental study. PLoS Negl Trop Dis. 2021;15:e0009556. \u003c/li\u003e\n\u003cli\u003eMains JW, Brelsfoard CL, Rose RI, Dobson SL. Female adult \u003cem\u003eAedes albopictus\u003c/em\u003e suppression by \u003cem\u003eWolbachia\u003c/em\u003e-infected male mosquitoes. Sci Rep. 2016;6:33846. \u003c/li\u003e\n\u003cli\u003eHaba Y, McBride L. Origin and status of \u003cem\u003eCulex pipiens\u003c/em\u003e mosquito ecotypes. Current Biology. 2022;32(5):R237-46. \u003c/li\u003e\n\u003cli\u003eBecker N, Petric D, Zgomba M, Boase C, Madon M, Dahl C, et al. Mosquitoes -identification, ecology and control. 3rd ed. Cham: Springer; 2020. \u003c/li\u003e\n\u003cli\u003eWilliams J, Flood L, Praulins G, Ingham VA, Morgan J, Lees RS, et al. Characterisation of \u003cem\u003eAnopheles\u003c/em\u003e strains used for laboratory screening of new vector control products. Parasit Vectors. 2019;12:522. \u003c/li\u003e\n\u003cli\u003eLees R, Praulins G, Davies R, Brown F, Parsons G, White A, et al. A testing cascade to identify repurposed insecticides for next-generation vector control tools: screening a panel of chemistries with novel modes of action against a malaria vector. Gates Open Res. 2019;3:1464. \u003c/li\u003e\n\u003cli\u003eWerren JH, Windsor DM. \u003cem\u003eWolbachia\u003c/em\u003e infection frequencies in insects: evidence of a global equilibrium? Proc R Soc Lond B Biol Sci. 2000;267:1277\u0026ndash;85.\u003c/li\u003e\n\u003cli\u003eFinchTV, v1.5.0. https://digitalworldbiology.com/FinchTV. \u003c/li\u003e\n\u003cli\u003eGeneious Prime, v2024.0.5. https://www.geneious.com. \u003c/li\u003e\n\u003cli\u003eDereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, et al. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008;36:465-9. \u003c/li\u003e\n\u003cli\u003eLetunic I, Bork P. Interactive tree of life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52:78-82. \u003c/li\u003e\n\u003cli\u003eNkya TE, Poupardin R, Laporte F, Akhouayri I, Mosha F, Magesa S, et al. Impact of agriculture on the selection of insecticide resistance in the malaria vector \u003cem\u003eAnopheles gambiae\u003c/em\u003e: a multigenerational study in controlled conditions. Parasit Vectors. 2014;7:480. \u003c/li\u003e\n\u003cli\u003ePhilbert A, Lyantagaye SL, Nkwengulila G. A. Review of agricultural pesticides use and the selection for resistance to insecticides in malaria mectors. Adv Entomol\u003cstrong\u003e. \u003c/strong\u003e2014;02:120\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eMartins AJ, Ribeiro CD e M, Bellinato DF, Peixoto AA, Valle D, Lima JBP. Effect of insecticide resistance on development, longevity and reproduction of field or laboratory selected \u003cem\u003eAedes aegypti\u003c/em\u003e populations. PLoS One. 2012;7:e31889. \u003c/li\u003e\n\u003cli\u003eGrossman MK, Uc-Puc V, Rodriguez J, Cutler DJ, Morran LT, Manrique-Saide P, et al. Restoration of pyrethroid susceptibility in a highly resistant \u003cem\u003eAedes aegypti\u003c/em\u003e population. Biol Lett. 2018;14:20180022. \u003c/li\u003e\n\u003cli\u003eMahilum MM, Storch V, Becker N. Molecular and electron microscopic identification of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eCulex pipiens\u003c/em\u003e complex populations from the Upper Rhine Valley, Germany, and Cebu City, Philippines. J Am Mosq Control Assoc. 2003;19:206\u0026ndash;10. \u003c/li\u003e\n\u003cli\u003eKoban MB, Kampen H, Scheuch DE, Frueh L, Kuhlisch C, Janssen N, et al. The Asian bush mosquito \u003cem\u003eAedes japonicus japonicus\u003c/em\u003e (Diptera: Culicidae) in Europe, 17 years after its first detection, with a focus on monitoring methods. Parasit Vectors. 2019;12:109. \u003c/li\u003e\n\u003cli\u003eIn\u0026aacute;cio da Silva LM, Dezordi FZ, Paiva MHS, Wallau GL. Systematic Review of \u003cem\u003eWolbachia\u003c/em\u003e symbiont detection in Mosquitoes: an entangled topic about methodological power and true symbiosis. \u003cem\u003ePathogens\u003c/em\u003e. 2021;10(1):39. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"German mosquitoes, Aedes, Culex, vector control, pyrethroids, insecticide resistance, Wolbachia","lastPublishedDoi":"10.21203/rs.3.rs-5632644/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5632644/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground:\u003c/h2\u003e \u003cp\u003eThe increasing incidence of arboviral diseases in Europe, driven by the expansion of mosquito vectors due to globalisation and global warming, poses a growing threat to public health. Notably, the invasive tiger mosquito \u003cem\u003eAedes albopictus\u003c/em\u003e, a primary vector of dengue, has been rapidly expanding its range, with outbreaks becoming more frequent in various parts of the world. Insecticides targeting adult mosquitoes are commonly employed as response and protective measures for vector control, but the effectiveness of such interventions may be undermined by rising insecticide resistance, a phenomenon increasingly reported worldwide. Another promising avenue for vector control is the use of \u003cem\u003eWolbachia\u003c/em\u003e, an endosymbiotic bacterium capable of reproductive manipulation in mosquitoes, offering potential for population suppression.\u003c/p\u003e\u003ch2\u003eMethods:\u003c/h2\u003e \u003cp\u003eWe evaluated permethrin (a pyrethroid insecticide) resistance in key mosquito species, including \u003cem\u003eAedes\u003c/em\u003e and \u003cem\u003eCulex\u003c/em\u003e, collected from Germany and Italy through generation of LC\u003csub\u003e50\u003c/sub\u003e curves utilising topical exposure assays. Additionally, the prevalence of \u003cem\u003eWolbachia\u003c/em\u003e in these populations was determined via PCR amplification of the 16S rRNA gene, followed by sequencing of selected samples.\u003c/p\u003e\u003ch2\u003eResults:\u003c/h2\u003e \u003cp\u003eAll \u003cem\u003eAedes\u003c/em\u003e populations tested exhibited susceptibility to permethrin, whilst a potential trend toward resistance was observed in the \u003cem\u003eCulex pipiens\u003c/em\u003e complex, a vector of West Nile virus. Furthermore, \u003cem\u003eWolbachia\u003c/em\u003e was detected across all tested mosquito populations, marking the first recorded presence of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAedes japonicus\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusion:\u003c/h2\u003e \u003cp\u003eThese findings highlight the continued efficacy of pyrethroids against \u003cem\u003eAedes\u003c/em\u003e populations in Germany and underscore the need for ongoing surveillance of insecticide resistance, particularly in \u003cem\u003eCulex\u003c/em\u003e species. Additionally, the detection of Wolbachia in native and invasive mosquito populations opens new avenues for the exploration of biological vector control strategies in Europe. This study provides crucial preliminary data supporting the strategic use of pyrethroids and Wolbachia for arboviral outbreak prevention in Germany.\u003c/p\u003e","manuscriptTitle":"Assessment of pyrethroid resistance and Wolbachia prevalence in pathogen-related mosquito species from south west Germany.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-14 07:42:40","doi":"10.21203/rs.3.rs-5632644/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"08073093-85e1-4856-95b7-1c44668e813c","owner":[],"postedDate":"January 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-19T14:04:54+00:00","versionOfRecord":{"articleIdentity":"rs-5632644","link":"https://doi.org/10.52004/2054930X-20251030","journal":{"identity":"journal-of-the-european-mosquito-control-association","isVorOnly":true,"title":"Journal of the European Mosquito Control Association"},"publishedOn":"2025-12-12 00:00:00","publishedOnDateReadable":"December 12th, 2025"},"versionCreatedAt":"2025-01-14 07:42:40","video":"","vorDoi":"10.52004/2054930X-20251030","vorDoiUrl":"https://doi.org/10.52004/2054930X-20251030","workflowStages":[]},"version":"v1","identity":"rs-5632644","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5632644","identity":"rs-5632644","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-24T02:00:01.246996+00:00
License: CC-BY-4.0