Maternal Effects on Postembryonic Neuroblast Migration in C. elegans

Maternal Effects on Postembryonic Neuroblast Migration in C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Maternal Effects on Postembryonic Neuroblast Migration in C. elegans Hoikiu Poon , View ORCID Profile Chaogu Zheng doi: https://doi.org/10.1101/2025.03.17.643740 Hoikiu Poon School of Biological Sciences, The University of Hong Kong , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Chaogu Zheng School of Biological Sciences, The University of Hong Kong , Hong Kong SAR, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Chaogu Zheng For correspondence: cgzheng{at}hku.hk Abstract Full Text Info/History Metrics Preview PDF Abstract Maternal effect genes mostly regulate early embryogenesis as their mRNAs or proteins are deposited into the oocytes to function during early embryonic development before the onset of zygotic transcription. Here, we report a case where a maternal effect gene regulates postembryonic neuroblast migration long after the early embryonic stages. We found that the defects of the Q neuroblast migration in C. elegans mannosyltransferase dpy-19 mutants can be rescued by a maternal copy of the gene. Maternal dpy-19 mRNAs are deposited into the oocytes and persist throughout embryonic development into the Q cells to regulate their migration in early larval stages. These mRNAs appeared to be remarkably stable, since long-term developmental arrest, changing the 3’UTR sequence, and mutations in genes involved in RNA binding and modification all had weak effects on the maternal rescue of the neuroblast migration defects. Since the defects can also be rescued by a zygotic copy of dpy-19(+) , our results suggest that postembryonic neurodevelopment is redundantly regulated by maternal and zygotic copies of the same gene. Introduction Maternal effect refers to a phenomenon in which the phenotype of an organism is controlled not by its own genotype but by the genotype of its mother. Maternal effect genes are often essential for early developmental processes, since they code for RNAs and proteins important for early embryonic development before zygotic transcription takes place ( WOLF AND WADE 2009 ; MITCHELL 2022 ). A subset of maternal effect genes does extend their influence into postembryonic development by controlling germline development. For example, maternally deposited oskar mRNAs in Drosophila eggs ( LEHMANN 2016 ) and bucky ball mRNAs in Zebrafish oocyte ( BONTEMS et al . 2009 ) help establish the germ plasm which is critical for germ cell specification. In C. elegans , maternal pie-1 prevents somatic differentiation in early embryonic germline cells by repressing transcription ( SEYDOUX et al . 1996 ) and the maternal mes-2/3/6 genes regulate H3K27 methylation and are essential for germ-line development ( XU et al . 2001 ; BENDER et al . 2004 ). Loss of these genes in the mother results in sterility in the offspring. However, very few studies reported maternal effect genes that regulate somatic cell differentiation in postembryonic development. One example is the clk-1 gene in C. elegans , which codes for a hydroxylase involved in the biosynthesis of ubiquinone (coenzyme Q10). The clk-1 mutants have slower developmental rate due to the lack of ubiquinone, but the homozygous mutants produced by a heterozygous mother had a normal growth rate because the persistence of maternally deposited CLK-1 proteins enabled the synthesis of sufficient amounts of ubiquinone during development ( BURGESS et al . 2003 ). In mammals, maternal nutrition during gestation affects postnatal development ( KUSIN et al . 1992 ; HOFFMAN et al . 2016 ) and placenta-specific insulin-like growth factor 2 (IGF2) expression modulates fetal growth and contributes to postnatal metabolic homeostasis ( CONSTANCIA et al . 2002 ; LOPEZ-TELLO et al . 2023 ). While these examples are mostly related to metabolism, instances of maternal effect genes regulating neuronal differentiation in postembryonic development are rare. In this study, we report one such case where a maternal effect gene regulates postembryonic neuroblast migration in C. elegans . Previous studies of Q lineage development established a model for neuroblast migration in C. elegans , as the Q neuroblasts migrate, divide, and give rise to three types of neurons, including the mechanosensory touch receptor neurons (TRNs), oxygen-sensing neurons, and two interneurons ( MIDDELKOOP AND KORSWAGEN 2014 ) ( Fig. 1A ). dpy-19 , which codes for a mannosyltransferase, is required for the initial polarization of the Q cells by mediating the C-mannosylation of MIG-21 (a homolog of semaphorin-5A) and UNC-5 (a homolog of netrin receptor); C-mannosylation is essential for the secretion of soluble MIG-21 ( HONIGBERG AND KENYON 2000 ; BUETTNER et al . 2013 ). The loss of dpy-19 led to the mispositioning of the neurons derived from the Q lineage, including the TRN subtype PVM neuron. Through some serendipities, we found that the dpy-19 homozygous mutants derived from the heterozygous mothers showed normal positioning of Q lineage descendants, indicating normal Q cell migration. We found that the dpy-19 mRNAs but not proteins were maternally deposited into the oocytes and were passed down to the Q cells during embryonic development. Moreover, these maternal dpy-19 mRNA appeared to be remarkably stable, since long-term developmental arrest, swapping the 3’UTR with non-maternal effect genes, and mutations in RNA stabilizing genes had only minor effects on the maternal rescue of the neuroblast migration defects. Overall, our study demonstrates that postembryonic neuronal development is safeguarded by the persistence of maternally deposited mRNAs. Download figure Open in new tab Figure 1. PVM positioning defects in dpy-19 mutants are maternally rescued. (A) A schematic cartoon depicting the Q lineage and the migratory route of the Q neuroblasts and their descendants. (B) PVM is mispositioned to a more anterior position in dpy-19(unk88) mutants compared to the wild-type animals. This defect is rescued by an extrachromosomal array carrying a wild-type copy of dpy-19 . TRNs are visualized using the reporter transgene uIs115[mec-17p::TagRFP] . (C) Percentage of animals showing PVM and AVM mispositioning phenotype as a result of QL and QR migration defects, respectively. (D) Gene structure of dpy-19 and the molecular lesion caused by various alleles. (E) A cross scheme for maternal rescue experiment. uIs31[mec-17p::GFP] is integrated on chrIII and used as a marker for chrIII not carrying the dpy-19 mutation. (F) Percentage of animals showing PVM mispositioning in each generation according to the labeling in (E) for various dpy-19 alleles. Results A transposon insertion in dpy-19 led to Q cell migration defects In the process of studying the genetic control of TRN development, we analyzed the ham-2(n1332) allele, which was previously reported to affect HSN development ( DESAI et al . 1988 ). We crossed the MT3149 ham-2(n1332) strain with the TRN marker uIs115[mec-17p::TagRFP] and segregated an autosomal allele that caused the mispositioning of the PVM neuron, which is a postembryonic TRN subtype derived from the QL cell lineage ( Fig. 1A ). In the wild-type animals, the PVM cell body was in the posterior half of the body, whereas in the mutants, ∼40% of the PVM was anteriorly displaced to a position close to the AVM cell body ( Fig. 1B and C ). This result was unexpected because ham-2 is an X-linked gene, but the PVM phenotype was not X-linked. Using a combination of SNP mapping ( DAVIS et al . 2005 ) and whole-genome resequencing, we mapped the mutation that caused PVM mispositioning to dpy-19 and found a Tc1 insertion at the beginning of exon 7 ( Fig. 1D and S1). The Tc1 transposon was found to be excised at a low frequency, which generates small indels (typically a 4-nucleotide insertion) in exon 7 (Fig. S1A). Interestingly, Tc1 was removed from the pre-mRNA likely due to the use of a cryptic splice site, which caused a frameshift deletion of 49 bp in exon 7 (Fig. S1B). We named the dpy-19 allele unk88 . Tracing back to its origin, we found that the ham-2(n1332) allele was reported as a transposon insertion allele generated in the mut-2 background ( DESAI et al . 1988 ). One of the popular mut-2 strains used in mutagenesis studies was MT3126 mut-2(r459); dpy-19(n1347) ( RUSHFORTH et al. 1993 ). We genotyped dpy-19 in MT3126 and found a Tc1 insertion at the same site as unk88 , suggesting that unk88 was likely to be n1347 . Nevertheless, to avoid confusion, we still use unk88 to refer to the dpy-19 allele isolated from MT3149. Previous results suggest that both QL and QR lacked clear polarization in dpy-19 mutants ( HONIGBERG AND KENYON 2000 ), suggesting that the positioning of the descendants of both QL and QR lineages may be similarly affected. We found that dpy-19(unk88) mutants mostly caused anterior displacement of the PVM cell body but rarely affected AVM positioning, suggesting that the QL migration may be more strongly disrupted by mutations in dpy-19 than QR. To confirm that dpy-19(unk88) was indeed the phenotype-causing mutation, we injected a DNA construct containing the genomic fragment of dpy-19(+) into the mutants and found that the PVM mispositioning phenotype was fully rescued in the transformants ( Fig. 1B and C ). Maternal rescue of the Q migration defects in dpy-19 mutants In the process of analyzing the unk88 allele, we noticed a maternal rescue of the PVM phenotype in the dpy-19 mutants, where homozygous dpy-19(unk88) animals (F2) produced by the dpy-19(unk88)/+ heterozygous mothers (F1) did not show the PVM mispositioning. We only started to observe the PVM phenotype in the homozygous F3 generation ( Fig. 1E ). Interestingly, dpy-19(unk88)/+ heterozygotes produced by crossing homozygous hermaphrodites (P0) and wild-type males did not show the mispositioning of PVM cell body, suggesting that the phenotype was also rescued by the zygotic copy of dpy-19(+) . Moreover, dpy-19(unk88) animals produced by crossing dpy-19 homozygous hermaphrodites with dpy-19/+ heterozygous males showed the PVM phenotype, indicating the lack of paternal rescue (Fig. S2A). Since the PVM mispositioning phenotype had incomplete penetrance (∼40%) in dpy-19 mutants, we also assessed whether the maternal phenotype of homozygous mothers (F3 generation) had an influence on the penetrance of the offspring and found no clear difference between the progeny of dpy-19 mothers with and without the PVM phenotype (Fig. S2B-C). Next, we compared unk88 with two reference dpy-19 alleles, e1259 and e1314 , for their phenotypes on Q neuroblast migration. e1259 (G185D) is a missense allele in exon 4, and e1314 is a splice acceptor mutation that affects the splicing of exon 10 ( Fig. 1D ). Both e1259 and e1314 alleles showed strong defects in QL migration, indicated by the anterior displacement of the PVM cell body in 60-90% of the animals ( Fig. 1C ). About 10-20% of AVM cell body was mispositioned to the posterior half of the animal in the mutants, suggesting that QR migration was also affected, although to a lesser extent. We also observed the maternal rescue of the PVM positioning defects in e1259 and e1314 mutants, since F2 homozygotes from the F1 dpy-19/+ heterozygotes did not show any PVM phenotype ( Fig. 1F ). dpy-19 was originally identified by Brenner (1974) as a gene that, when mutated, causes the animals to be short and dumpy. Indeed, e1259 and e1314 mutants resulted in a temperature-dependent dumpy phenotype; when animals were grown at 20°C or above, their lengths were significantly lower than the wild type (Fig. S3A and B). Importantly, the dumpy phenotype of dpy-19 mutants was also maternally rescued (Fig. S3C). Nevertheless, we did not observe an obvious dumpy phenotype in unk88 mutants, suggesting that unk88 may be a weaker allele than e1258 and e1314 . RT-PCR results showed that the dpy-19 transcripts levels were comparable among the wild-type, the unk88 mutants, and the e1259 missense mutants, but were reduced in the e1314 splice acceptor mutants (Fig. S3D). In addition to AVM and PVM, the Q lineages also give rise to four other neurons: the oxygen-sensing neuron AQR and PQR, and the interneurons SDQL and SDQR. Defects in Q cell migration would also lead to the mispositioning of these neurons. Indeed, we observed the anterior displacement of PQR and SDQL cell bodies in ∼40% of the dpy-19(unk88) mutants and the posterior displacement of AQR and SDQR in 5∼10% of the mutants ( Fig. 2A and B ). As expected, the QL descendants (PQR, SDQL, and PVM) were often displaced together in the same animal, and the QR descendants (AQR, SDQR, and AVM) were also displaced together, confirming that mutations in dpy-19 affected the initial migration of the Q neuroblasts. We also confirmed the maternal rescue of dpy-19 mutants on the PQR and SDQL mispositioning phenotype, suggesting that the postembryonic development of the entire Q lineage is regulated by maternal DPY-19 ( Fig. 2B ). Download figure Open in new tab Figure 2. Maternal effects of dpy-19 affect the positioning of all Q lineage descendants. (A) The positions of QL descendants (PVM, PQR, and SDQL) were all affected by dpy-19(unk88) mutation in the same animal. PQR, labeled by iaIs25[gcy-37p::GFP] , was normally positioned around the tail and was mispositioned to the head in dpy-19 mutants; SDQL, labeled by uIs130[lad-2p::GFP] , was normally positioned in the posterior half of the animal and was mispositioned to the anterior in dpy-19 mutants. Z1 and Z2 showed two focal planes of the same animal. (B) Percentage of dpy-19(unk88) animals showing PQR, SDQL, AQR, and SDQR cell body mispositioning phenotypes. Percentage of animals showing PQR and SDQL mispositioning in each generation in a cross similar to the one in Figure 1E . P0 and F3 animals were dpy-19(unk88; M-) , whereas F2 animals were dpy-19(unk88; M+) . (C) Test for maternal effects of four other genes involved in QL migration using a cross similar to the one in Figure 1E . mig-21(u787) , cdh-4(hd40) , ptp-3(mu256) , and unc-40(n324) alleles were used. The C-mannosyltransferase DPY-19 promotes Q cell polarization by promoting the mannosylation and solubilization of the thrombospondin type-1 repeat (TSR)-containing membrane protein MIG-21 ( BUETTNER et al . 2013 ). Mutations in mig-21 caused a similar PVM displacement as dpy-19 mutants ( MIDDELKOOP et al . 2012 ), but the PVM phenotype in mig-21 mutants were not maternally rescued ( Fig. 2C ). Moreover, UNC-40/DCC receptor, PTP-3/LAR-like receptor tyrosine phosphatase, and CDH-4/Cadherin also function in the same pathway as MIG-21 in regulating Q polarization ( SUNDARARAJAN AND LUNDQUIST 2012 ; SUNDARARAJAN et al . 2014 ). Although their mutants all showed PVM mispositioning, none of them had maternal rescues ( Fig. 2C ). So far, to our knowledge, dpy-19 appears to be the only Q cell regulating gene that displays maternal effects. dpy-19 mRNAs are maternally deposited into embryos Maternal effects are generally mediated by maternal deposits of proteins or mRNAs or epigenetic modifications, such as DNA methylation and histone modifications ( MITCHELL 2022 ). To explore these mechanisms, we first examined a strain with GFP knock-in at the endogenous dpy-19 locus ( EBBING et al . 2019 ) and found no DPY-19::GFP signal in the early embryos, suggesting that there is no maternal deposition of DPY-19 proteins ( Fig. 3A ). Download figure Open in new tab Figure 3. Maternally deposited dpy-19 mRNAs persisted throughout development. (A) DPY-19::GFP expressed from an endogenous GFP knock-in allele hu257[dpy-19::gfp::SEC::3xflag] did not show any GFP signal in early embryos. (B) smFISH staining against dpy-19 in wild-type, unk88 , and unk184 (the dpy-19 deletion allele; Figure 1D ) animals at early embryonic stages before the onset of zygotic transcription. Scale bars = 20 μm. (C) The number of all smFISH signals (i.e., fluorescence puncta) in each embryo counted through a Z stack of 10-15 pictures. Double asterisks indicate significant difference ( p < 0.01) between the wild type animals and each of the two mutants in a post-ANOVA Dunnett’s test. (D) RT-PCR of dpy-19 in the cDNA library of early embryos (unlaid eggs at 32-cell stage or earlier). (E) dpy-19 expression levels extracted from published single-cell transcriptomic data of the embryos ( TINTORI et al . 2016 ; PACKER et al . 2019 ). ABpl and ABpr lineages that give rise to QL and QR, respectively, are grouped into the same embryonic cell types as ABpx. (F) The cross scheme to examine the maternal dpy-19 mRNAs using smFISH; dpy-19(unk184) was used as the dpy-19(-) knockout allele. We included the transgene ayIs9[egl-17p::GFP] , a Q cell marker, in the background to facilitate the identification of the Q cells. (G) smFISH against dpy-19 in the Q cells of dpy-19(-) animals with or without maternal rescue according to the cross in (F). The wild-type and unk88 animals served as controls; GFP signal from ayIs9 was pseudo-colored in red to allow the visualization of smFISH signals (in cyan and indicated by arrow heads). (H) Quantification of the smFISH results from (G). Double asterisks indicate statistical significance ( p < 0.01) in a post-ANOVA Tukey’s test. To check for maternal deposition of dpy-19 mRNAs, we performed single-molecule fluorescent in situ hybridization (smFISH) to quantitatively detect dpy-19 mRNAs in early embryos before zygotic transcription occurs. For a negative control, we generated a dpy-19 knockout mutant ( unk184 ) through CRISPR/Cas9-mediated gene editing ( Fig. 1D ). The unk184 allele was used as dpy-19(-) in the following studies. Using smFISH, we could clearly detect >200 dpy-19 mRNAs in early embryos (i.e., zygote, 2-cell stage, and 4-cell stage embryos) in the wild-type animals, much reduced mRNAs levels (∼20 per embryo) in unk88 animals, and virtually no mRNA signal in the dpy-19 knockout mutants ( Fig. 3B and C ). We also conducted RT-PCR on the early embryos of up to the 8-cell stage and found dpy-19 expression in the wild-type embryos; unk88 and e1314 mutants showed reduced embryonic mRNA levels ( Fig. 3D ). The above results indicate that dpy-19 mRNAs are maternally deposited into the oocyte to mediate maternal effects. Single-cell transcriptomic studies ( TINTORI et al . 2016 ; PACKER et al . 2019 ) also confirmed dpy-19 expression in all early embryonic cells from zygote to 4-cell stage, as well as most of the lineage precursors that give rise to the Q neuroblasts ( Fig. 3E ). These results at the single-cell level mapped out the lineage routes through which maternally deposited dpy-19 mRNA could be passed to the Q neuroblasts of the offspring to produce DPY-19 proteins. To confirm this inheritance, we used smFISH to detect maternally deposited dpy-19 mRNAs in the Q cells of dpy-19(-) animals produced by the dpy-19(-)/+ heterozygous mothers and, indeed, found mRNA signals that overlap with the Q cells (QL and QR), labeled by ayIs9[egl-17p::GFP] ( Fig. 3F-H ). These results suggested that the absence of Q cell migration defects in the F2 dpy-19(-) homozygous animals was due to the deposition of wild-type dpy-19 mRNA from the heterozygous mother ( Fig. 3F-H ). In addition to maternal deposit, dpy-19 is also likely to be transcribed zygotically, because the mRNA level of dpy-19 is higher in mid- and late-stage embryos compared to the 1-cell embryo according to the modENCODE data (WormBase WS287). By studying embryonic transcriptomes, QUARATO et al . (2021) classified dpy-19 as a “maternal stable” and “maternal and zygotic” gene, whose mRNAs level is detected in 1-cell embryos, is stably maintained in early embryos, and increases in late embryos. Zygotic expression of dpy-19 is consistent with the zygotic rescue of PVM mispositioning phenotype in the cross progeny of dpy-19 homozygous mothers and wild-type fathers ( Fig. 1E ). Lastly, to explore whether DPY-19 may act through epigenetic modifications, we searched for potential DPY-19 substrates by scanning the C. elegans proteomes for the “WXXWXXW” motif, which is the glycosylation target recognized by DPY-19 ( BUETTNER et al . 2013 ). The search yielded 41 possible DPY-19 targets, including MIG-21 and UNC-5, but none of them had direct connections with DNA methylation or histone modification (Table S1). Thus, we reason that DPY-19 is unlikely to produce maternal influence via epigenetic modifications. Maternal dpy-19 mRNAs are likely stabilized via multiple mechanisms throughout development The passage of maternally deposited dpy-19 mRNA from oocyte to the Q cells suggests unusual stability of the mRNAs over a period of at least 14 hours (the time from fertilization to hatching, given that Q cells polarize and start to migrate shortly after hatching). We next attempted to identify the possible mechanisms that help stabilize dpy-19 mRNA throughout embryogenesis. Inspired by a previous study ( BURGESS et al . 2003 ), we first tested whether long-term developmental arrest at the L1 stage could destabilize maternal dpy-19 mRNA and thus disallow the maternal rescue in dpy-19(-) mutants. Surprisingly, arresting the dpy-19(-) mutants derived from heterozygous mother at L1 stage for ≤ 30 days before recovery did not affect the maternal rescue at all, and we observed only ∼9% of the F2 mutants showing the PVM mispositioning phenotypes after 32 days of L1 arrest, compared to the ∼70% penetrance of the phenotype among the mutants derived from homozygous mothers ( Fig. 4A ). We reason that either dpy-19 mRNA is incredibly stable, or the maternal dpy-19 mRNA is only needed in the very early stage of L1 development before the starvation-induced arrest takes effect. Download figure Open in new tab Figure 4. Maternal effect of dpy-19 is robust against various perturbations. (A) An experimental scheme to test the effect of long-term developmental arrest on the maternal rescue of dpy-19(unk184) mutants. (B) Gene structure of dpy-19(unk184) , referred to as dpy-19(-) , and dpy-19(syb8232) , referred to as dpy-19(mig-21 3’UTR) , in which the dpy-19 3’UTR is replaced by mig-21 3’UTR at the endogenous locus. (C) A cross scheme to test the effects of the 3’UTR swap on the maternal rescue of the PVM mispositioning defects in dpy-19(unk184) mutants. (D) A representative scheme to test various genetic backgrounds for their impact on the dpy-19 maternal rescue using pab-2 as an example. (E) The percentage of animals with PVM mispositioning defects at different generations (P0 and F3 represented M-, while F2 represented M+) under pab-2(ok1851) , gtbp-1(ax2029) , imph-1(tm1623) , and cey-4(ok858) backgrounds using the cross schemes detailed in (D). Since the 3’UTR often regulates the stability of mRNAs, including maternally deposited mRNAs ( MISHIMA AND TOMARI 2016 ; DAI et al . 2019 ), we next tested whether dpy-19 3’UTR has similar effects. We swapped the 96-bp sequence encoding the dpy-19 3’UTR with a 73-bp fragment encoding the mig-21 3’UTR at the endogenous dpy-19 locus through CRISPR/Cas9-mediated gene editing ( Fig. 4B ). The rationale was that the mig-21 mutants caused similar PVM phenotypes but did not show any maternal effects. This swap did not affect dpy-19 function, since we did not observe any phenotypes in the dpy-19 mutants with mig-21 3’UTR. We then generated heterozygotes carrying one dpy-19 (3’UTR swapped) allele and one dpy-19(-) allele and found that among their dpy-19(-) homozygous mutant progeny, only 2.6% (n = 228) showed the PVM positioning defects, suggesting that the 3’UTR of the gene does not contribute significantly to the maternal rescue ( Fig. 4C ). Furthermore, the starvation-induced L1 arrest did not cause any stronger effects on the phenotype in the dpy-19(-) animals produced by the dpy-19(-)/dpy-19(3’UTR swapped) heterozygotes compared to the mutants derived from dpy-19(-)/+ mothers (8% vs. 9%), supporting the idea that the dpy-19 3’UTR does not play a significant role in stabilizing its mRNA. Lastly, we hypothesized that certain RNA-binding proteins may be involved in stabilizing the maternal dpy-19 mRNA and preventing it from degradation during embryogenesis. We chose to test four genes, including cey-4 (homolog of mammalian YBX1 and YBX2), gtbp-1 (homolog of G3BP1), imph-1 (homolog of IGF2BP), and pab-2 (homolog of PABPC1), because of their functions in stabilizing target mRNA and interacting with m 6 A or m 5 C modified RNAs ( BOO AND KIM 2020 ; NOMBELA et al . 2021 ). Although whether these RNA modifications exist on the mRNA of C. elegans is still under debate, recent studies found that m 6 A modification on the pre-mRNA of sams-3 regulates mRNA splicing ( MENDEL et al . 2021 ; WATABE et al . 2021 ). Thus, although these modifications may not be widely present in mRNAs, they may still occur on selected mRNA species. We first crossed the null alleles of the above genes with dpy-19(-) and confirmed that the PVM mispositioning phenotype was not affected in the double mutants. We then conducted the test for maternal rescue in the genetic background that is depleted of these RNA-binding proteins ( Fig. 4D ). We found that only the depletion of pab-2 suppressed the maternal rescue in ∼4% (n = 152) of F2 dpy-19(-) mutants arising from heterozygous mothers, while the loss of the other three had no effects ( Fig. 4E ). pab-2 codes for a homolog of PABPC1, which not only binds to the 3’ poly(A) tail of mRNAs ( SACHS AND DAVIS 1989 ) but also interacts with m 6 A and m 5 C modified mRNAs through IGF2BP and YBX1, respectively ( YANG et al . 2019 ; ZHANG et al . 2021 ). The fact that the loss of imph-1/IGF2BP and cey-4/YBX1 did not produce similar effects suggests that the two RNA modifications may not be involved in stabilizing the dpy-19 mRNAs, or each alone is not sufficient. The weak effects of pab-2 may also be due to the redundancy with pab-1 , which is an essential gene. Given that the various treatment and genetic perturbations above did not significantly disrupt the maternal rescue of dpy-19(-) mutants, we reason that the maternal dpy-19 mRNA may be stabilized by multiple and potentially redundant mechanisms or some unknown factors. Discussion By tracking the Q lineage descendants in C. elegans , we showed that neuroblast migration in postembryonic neurodevelopment is regulated by maternally deposited dpy-19 mRNAs. These mRNAs are so stable that they can be passed down from the zygote all the way to the embryonically born Q neuroblasts through ten rounds of cell divisions that take ∼720 minutes. These mRNAs then persist throughout the rest of embryonic development and the first few hours of larval development to regulate the initial polarization of the Q cells. Thus, the maternal dpy-19 mRNAs can carry out their functions 15-16 hours after the cleavage of the zygote, which suggests remarkable perdurance given that the life cycle of the animal is merely 3 days. Although we found that the 3’UTR of dpy-19 and the poly(A)-binding protein PAB-2 contribute to dpy-19 mRNA stability, their contributions were relatively minor. It remains unclear what mechanisms allow dpy-19 mRNA to survive the maternal mRNA clearance and persist throughout development. Interestingly, a zygotic copy of dpy-19(+) can also rescue the Q neuroblast migration defects in dpy-19 mutants, suggesting that the maternal dpy-19 mRNA is sufficient but not necessary for Q cell migration. This finding also suggests that the postembryonic neuronal development is a robust process redundantly regulated by both maternal and zygotic genes. A few other examples of maternal genes regulating postembryonic development came from early screens for maternal-effect viable mutants in C. elegans ( HEKIMI et al . 1995 ). For instance, the clk genes regulate embryonic and post-embryonic development, reproduction, and rhythmic behaviors, and their mutant phenotypes are fully rescued by maternal contributions ( BENARD et al . 2001 ; BURGESS et al . 2003 ); clk-1 codes for a 5-demethoxyubiquinone hydroxylase and clk-2 codes for a telomere maintenance protein. Another example is the gene mau-2 , which codes for a protein with predicted sister chromatid cohesin loading and dsDNA binding activities. mau-2 mutants showed defects in larval development, locomotion, neuronal migration, and axonal guidance, which were all rescued by maternally deposited mau-2 mRNAs ( TAKAGI et al . 1997 ). MAU-2 regulates the positioning and axonal guidance of both embryonically and post-embryonically derived neurons including the TRN subtype AVM, and the AVM guidance defects in mau-2 can also be rescued through a zygotic copy of the gene expressed cell-autonomously ( BENARD et al . 2004 ). Given that 80 of the 302 neurons in the C. elegans adult hermaphrodite are derived post-embryonically, we suspect that the differentiation of many neurons in the nervous system may be subjected to both maternal and zygotic controls. dpy-19 codes for a conserved C-mannosyltransferase that attaches an α-mannose to the tryptophan residue in the TSR domain of the substrate ( BUETTNER et al . 2013 ). C-mannosylation regulates protein folding and secretion ( INAI et al . 2020 ). In the Q cells, DPY-19 glycosylates the TSRs in UNC-5/Netrin receptor and MIG-21/Sema5A for their stability and secretion ( BUETTNER et al . 2013 ), which subsequently regulate Q cell polarization and migration. Interestingly, the DPY-19 function in neuronal migration appears to be conserved across species, as WATANABE et al . (2011) showed that the mouse homolog DPY19L1 is highly expressed in the developing glutamatergic neurons in the mouse embryonic cerebral cortex and regulates their radial migration. In humans, the deletion of DPY19L2 causes globozoospermia, a male infertility condition characterized by round-headed spermatozoa due to defective sperm head elongation and acrosome formation ( HARBUZ et al . 2011 ; KOSCINSKI et al . 2011 ). Mechanistic studies in mice found that DPY-19L2 was located to the inner nuclear membrane of the spermatids and helped anchor acroplaxome to the nuclear envelope ( PIERRE et al . 2012 ). Whether mammalian dpy-19 homologs also show unusual mRNA stability and have maternal effects await further investigations. Materials and Methods Strains and transgenes C. elegans wild-type (N2) and mutant strains were maintained as previously described ( BRENNER 1974 ). Most of the experiments were performed at 20°C on NGM plates seeded with E. coli (OP50) as food source unless otherwise indicated. Transgene uIs115[mec-17p::TagRFP] was used to visualize the TRNs and the transgene uIs130[lad-2p::GFP] was used to visualize SDQ neurons. uIs31[mec-17p::GFP] , which is integrated on chromosome III and labels the TRNs in green, was used as a chr III marker. dpy-19(e1259) , dpy-19(e1314) , mig-21(u787) , cdh-4(hd40) , ptp-3(mu256), unc-40(n324), pab-2(ok1851), and other mutants were obtained from the Caenorhabditis Genetics Center. A list of strains used in this study can be found in Table S2. Genomic mapping of unk88 We first used a set of chromosome markers to test their linkage with unk88 and found that the allele was located on chr III. We then used a previously published single-nucleotide polymorphism (SNP) two-point mapping method ( DAVIS et al . 2005 ) to narrow down the genomic location of unk88 by crossing the mutant strain with the genetically divergent CB4856 strain. This approach allowed us to map unk88 between −19 and 4 on chr III. We then outcrossed the strain against the wild-type animals carrying uIs115 and conducted whole-genome resequencing of the outcrossed strain and identified a 4-nt insertion (III: 8661495 GTA => GTACATA) in dpy-19 . Genotyping of the dpy-19 locus revealed the Tc1 transposon insertion and the 4-nt insertion appeared to have resulted from the self-excision of the transposon. To rescue the dpy-19(unk88) mutant phenotype, we cloned a 11.7-kb genomic fragment including a 3-kb dpy-19 promoter and the entire coding region and a 1-kb sequence downstream of the stop codon into pUC57. We then injected the dpy-19(+) construct into dpy-19(unk88); uIs115 to obtain the transgenic animals with extrachromosomal array and examined the PVM positions. CRISPR/Cas9-mediated gene editing To create the dpy-19 deletion allele, we used CRISPR/Cas9-mediated gene editing to make cuts at two separate sites (exon 2 and exon 13) of the endogenous dpy-19 locus. The two target sequences were 5’-GGTAGTTGATGTATCCAACG-3’ and 5’-ATGTGTTTATCGTGGAATGT-3’, respectively. The single guide RNAs (sgRNAs) were synthesized using the NEB EnGen sgRNA Synthesis Kit (E3322V) and were injected together with recombinant Cas9 (EnGen S. pyogenes Cas9 NLS from NEB, M0646T) into the C. elegans . We used pCFJ104 ( myo-3p::mCherry ) as the co-injection marker, and the transformants with red muscles were genotyped for any deletion in dpy-19 . The allele that deleted the sequence between the two cut sites was named unk184 . To create the dpy-19 ( mig-21 3’UTR ) allele, we chose the CRISPR/Cas9 target sequence 5’-AAATAGTTTATAATGCTAAT-3’ close to the stop codon of dpy-19 and created sgRNA targeting the site and co-injected repair template that replaced the dpy-19 3’UTR (5’-tttttttctattttgttttt aaatttatttatttagttccagtatttttctgtaattccaaaacgatgaaatcaaatgaaccggtactgtatgttg-3’) with the mig-21 3’UTR (5’-atttcggatgctttcgagaacagtctctgtctgcccatttctcacgccacgataataaaagttatcattgatc-3’). The gene editing experiment was performed by SunyBiotech (Fuzhou, China) and the resulted allele was named syb8232 . We verified the sequence through genotyping after receiving the strain. RT-PCR Young embryos of N2, unk88 , and e1314 were collected in multiple batches. Animals were bleached to synchronize growth and grown on OP50-seeded 100mm NGM plates under 15°C to ensure abundant eggs were produced. When eggs were visible inside the gonad and ideally before gastrulation (and there were little to no eggs on the plate), worms were washed and bleached to collect the eggs. RNA extraction was performed using TRIzol reagent (Thermo Fisher) according to standard protocol. cDNAs from different samples were normalized using their tba-1 expression pattern visualized on a gel. PCR against dpy-19 was conducted using primers that bind to the exon 1-2 and exon 12-13 junctions. The PCR products were visualized on an agarose gel after electrophoresis and semi-quantitatively measured by comparison between the dpy-19 mutants and the wild type. Primer information can be found in Table S2. Similar RT-PCR experiments were also conducted on mixed stage samples. Single-molecule in situ hybridization (smFISH) To visualize the endogenous dpy-19 mRNAs, we designed the smFISH probes against the dpy-19 transcript using the Stellaris RNA FISH Probe Designer from Biosearch Technologies (Petaluma, CA) and synthesized the probes with Quasar 670 dye. The staining was conducted according to the procedures detailed in “Stellaris RNA FISH Protocol for C. elegans ” by Biosearch Technologies. Eggs were obtained from gravid adults of N2, unk88 and unk184 strains. Samples were fixed in 37% formaldehyde, stored in 70% ethanol overnight, hybridized with a probe-containing hybridization buffer overnight, and then washed and imaged using the Leica DMi8 Inverted Microscope. 1-cell, 2-cell, and 4-cell stage eggs were visualized and quantified for the number of RNA signals detected. Each egg was imaged using the Z-stack function and one image was captured every 1.5 µm. A total of 10-15 images were taken for each sample. As each fluorescent puncta represents individual RNA molecules, we counted all puncta from the stack of images to obtain the total number of dpy-19 transcripts in each sample. To observe the presence of maternal dpy-19 mRNAs in the Q lineage, we first conducted smFISH against dpy-19 in a strain carrying a Q cell marker ayIs9[egl-17p::GFP] and the colocalization of the smFISH signal with GFP served as a positive control to show that dpy-19 is indeed expressed in the Q cell. We then grew many dpy-19(unk184)/uIs31 III heterozygous animals to obtain F2 animals, which could be either non-fluorescent dpy-19(unk184) or fluorescent dpy-19(unk184)/uIs31 and uIs31 . We then bleached the F2 animals to get F3 eggs, which were grown to L1 and subjected to smFISH staining for dpy-19 . The F3 animals that are derived from the non-fluorescent F2 dpy-19(unk184) animals did not inherit maternal dpy-19 mRNA (i.e., M-), and the ones from F2 dpy-19(unk184)/uIs31 animals inherited maternal dpy-19 mRNA (i.e., M+). In fact, in the non-fluorescent F3 animals, any dpy-19 transcripts in the Q cells should be derived from maternally deposited dpy-19 mRNAs. Tests of Maternal Rescue under various conditions A typical maternal cross was carried out between dpy-19 mutant hermaphrodites and wild-type males carrying the uIs31[mec-17p::GFP] transgene, which is located on the same chromosome as dpy-19 . The green F1 heterozygous dpy-19/uIs31 mutants were allowed to self-fertilize and produce non-green F2 dpy-19 homozygotes, which were analyzed for PVM positioning. Both P0 parents carried uIs115[mec-17p::TagRFP] for the visualization of TRNs. Some F2 dpy-19 homozygotes were picked onto fresh plates to produce F3 homozygotes, which were also examined. In the starvation experiment ( BURGESS et al . 2003 ), we bleached the F1 animals to obtain F2 eggs, which were hatched in M9 and arrested at L1 stage on NGM plates, containing no food but ampicillin (100 µg/mL), kanamycin (50 µg/mL), and streptomycin (100 µg/mL) to prevent contamination for 3, 6, 9, 12, 15, 18, 30 and 32 days at 15°C. On the day of experiment, we flooded the plates with OP50-cotaining M9 to allow a thin layer of bacteria to form evenly, on which surviving animals fed until they reached day 1 adults. We examined the F2 dpy-19 homozygous animals without green fluorescence for PVM positioning defects. To test the effects of dpy-19 3’UTR, we first crossed dpy-19(mig-21 3’UTR) with dpy-19(unk184) to obtain the heterozygotes and then examined the dpy-19(unk184) homozygotes (by genotyping or observing dumpy animals in the F3) for potential PVM mispositioning phenotypes. To detect the effects of mutating genes that may regulate mRNA stability, we first crossed pab-2(ok1851) and gtbp-1(ax2029) with dpy-19(unk184) to create the double mutants. Since cey-4 and imph-1 are located on the same chromosome as dpy-19 , we generated double mutants by deleting dpy-19 in cey-4(ok858) and imph-1(tm1623) mutants using the same gene editing method described above. We then crossed the double mutants with the corresponding single mutants (i.e., pab-2 , gtbp-1 , cey-4 , and imph-1 , respectively) and analyzed the F2 progeny for potential disruption of maternal rescue. Quantification of PVM mispositioning The AQR, AVM, and SDQR neurons in the wild-type animals reside in the anterior half of the worm’s body, while PQR, PVM and SDQL reside in the posterior half. “Anterior” is defined as any point anterior to the vulva, while “posterior” is defined as posterior to the vulva. In this study, “mispositioning” of a neuron means that an anterior neuron was observed in the posterior half of the body, or a posterior neuron was observed in an anterior half. We counted the number of animals showing mispositioned neurons in a population to obtain the penetrance of a mutant phenotype. Microscopic imaging was done on a Leica DMi8 inverted microscope equipped with a with a Leica K5 monochrome camera, and images were analyzed using the Leica Application Suite X software. In general, QL migration was more severely affected than that of QR in dpy-19 mutant animals. So, we focused on the mispositioning of PVM, PQR, and SDQL neurons. To compare the penetrance across strains, we calculated the average percentage of animals showing the PVM mispositioning phenotype across at least three biological replicates and used a one-way ANOVA followed by either Dunnett’s test or Tukey’s honestly significant difference (HSD) test to find out statistical significance in multiple comparison. AUTHOR CONTRIBUTIONS C.Z. and H.P. conceived the study and wrote the manuscript. H.P. carried out most of the experiments. C.Z. did the initial characterization of the phenotype, secured funding, and supervised the project. Both authors read and approved the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. Acknowledgement We thank Prof. Hendrik Korswagen at the Hubrecht Institute for providing the dpy-19::GFP strain and Prof. Erik Lundquist at the University of Kansas for providing the Q cell marker ayIs9[egl-17p::GFP] strain. This study is supported by funds from the National Natural Science Foundation of China (Excellent Young Scientists Fund for Hong Kong and Macau, 32122002), the Health Bureau of Hong Kong (HMRF 09201426 to C.Z.), and the Research Grant Council of Hong Kong (GRF 17105523, GRF 17106322, GRF 17107021, and CRF C7026-20G). Some strains used in this study were provided by the Caenorhabditis Genetics Center, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). References ↵ Benard , C. , B. McCright , Y. Zhang , S. Felkai , B. Lakowski et al. , 2001 The C. elegans maternal-effect gene clk-2 is essential for embryonic development, encodes a protein homologous to yeast Tel2p and affects telomere length . Development 128 : 4045 – 4055 . OpenUrl Abstract / FREE Full Text ↵ Benard , C. Y. , H. Kebir , S. Takagi and S. Hekimi , 2004 mau-2 acts cell-autonomously to guide axonal migrations in Caenorhabditis elegans . Development 131 : 5947 – 5958 . OpenUrl Abstract / FREE Full Text ↵ Bender , L. B. , R. Cao , Y. Zhang and S. Strome , 2004 The MES-2/MES-3/MES-6 complex and regulation of histone H3 methylation in C. elegans . Curr Biol 14 : 1639 – 1643 . OpenUrl CrossRef PubMed ↵ Bontems , F. , A. Stein , F. Marlow , J. Lyautey , T. Gupta et al. , 2009 Bucky ball organizes germ plasm assembly in zebrafish . Curr Biol 19 : 414 – 422 . OpenUrl CrossRef PubMed Web of Science ↵ Boo , S. H. , and Y. K. Kim , 2020 The emerging role of RNA modifications in the regulation of mRNA stability . Exp Mol Med 52 : 400 – 408 . OpenUrl CrossRef PubMed ↵ Brenner , S. , 1974 The genetics of Caenorhabditis elegans . Genetics 77 : 71 – 94 . OpenUrl Abstract / FREE Full Text ↵ Buettner , F. F. , A. Ashikov , B. Tiemann , L. Lehle and H. Bakker , 2013 C. elegans DPY-19 is a C-mannosyltransferase glycosylating thrombospondin repeats . Mol Cell 50 : 295 – 302 . OpenUrl CrossRef PubMed Web of Science ↵ Burgess , J. , A. K. Hihi , C. Y. Benard , R. Branicky and S. Hekimi , 2003 Molecular mechanism of maternal rescue in the clk-1 mutants of Caenorhabditis elegans . J Biol Chem 278 : 49555 – 49562 . OpenUrl Abstract / FREE Full Text ↵ Constancia , M. , M. Hemberger , J. Hughes , W. Dean , A. Ferguson-Smith et al. , 2002 Placental-specific IGF-II is a major modulator of placental and fetal growth . Nature 417 : 945 – 948 . OpenUrl CrossRef PubMed Web of Science ↵ Dai , X. X. , J. C. Jiang , Q. Q. Sha , Y. Jiang , X. H. Ou et al. , 2019 A combinatorial code for mRNA 3’-UTR-mediated translational control in the mouse oocyte . Nucleic Acids Res 47 : 328 – 340 . OpenUrl CrossRef PubMed ↵ Davis , M. W. , M. Hammarlund , T. Harrach , P. Hullett , S. Olsen et al. , 2005 Rapid single nucleotide polymorphism mapping in C. elegans . BMC Genomics 6 : 118 . OpenUrl CrossRef PubMed ↵ Desai , C. , G. Garriga , S. L. McIntire and H. R. Horvitz , 1988 A genetic pathway for the development of the Caenorhabditis elegans HSN motor neurons . Nature 336 : 638 – 646 . OpenUrl CrossRef PubMed Web of Science ↵ Ebbing , A. , T. C. Middelkoop , M. C. Betist , E. Bodewes and H. C. Korswagen , 2019 Partially overlapping guidance pathways focus the activity of UNC-40/DCC along the anteroposterior axis of polarizing neuroblasts . Development 146 . ↵ Harbuz , R. , R. Zouari , V. Pierre , M. Ben Khelifa , M. Kharouf et al. , 2011 A recurrent deletion of DPY19L2 causes infertility in man by blocking sperm head elongation and acrosome formation . Am J Hum Genet 88 : 351 – 361 . OpenUrl CrossRef PubMed Web of Science ↵ Hekimi , S. , P. Boutis and B. Lakowski , 1995 Viable maternal-effect mutations that affect the development of the nematode Caenorhabditis elegans . Genetics 141 : 1351 – 1364 . OpenUrl Abstract / FREE Full Text ↵ Hoffman , M. L. , K. N. Peck , M. E. Forella , A. R. Fox , K. E. Govoni et al. , 2016 The effects of poor maternal nutrition during gestation on postnatal growth and development of lambs . J Anim Sci 94 : 789 – 799 . OpenUrl PubMed ↵ Honigberg , L. , and C. Kenyon , 2000 Establishment of left/right asymmetry in neuroblast migration by UNC-40/DCC, UNC-73/Trio and DPY-19 proteins in C. elegans . Development 127 : 4655 – 4668 . OpenUrl Abstract ↵ Inai , Y. , K. Ueda , I. L. Matsui , M. Tajiri , S. Minakata et al. , 2020 Role of C-mannosylation in the secretion of mindin . Biochim Biophys Acta Gen Subj 1864 : 129632 . OpenUrl PubMed ↵ Koscinski , I. , E. Elinati , C. Fossard , C. Redin , J. Muller et al. , 2011 DPY19L2 deletion as a major cause of globozoospermia . Am J Hum Genet 88 : 344 – 350 . OpenUrl CrossRef PubMed ↵ Kusin , J. A. , S. Kardjati , J. M. Houtkooper and U. H. Renqvist , 1992 Energy supplementation during pregnancy and postnatal growth . Lancet 340 : 623 – 626 . OpenUrl CrossRef PubMed Web of Science ↵ Lehmann , R. , 2016 Germ Plasm Biogenesis--An Oskar-Centric Perspective . Curr Top Dev Biol 116 : 679 – 707 . OpenUrl CrossRef PubMed ↵ Lopez-Tello , J. , H. E. J. Yong , I. Sandovici , G. K. C. Dowsett , E. R. Christoforou et al. , 2023 Fetal manipulation of maternal metabolism is a critical function of the imprinted Igf2 gene . Cell Metab 35 : 1195 – 1208 e1196. OpenUrl CrossRef PubMed ↵ Mendel , M. , K. Delaney , R. R. Pandey , K. M. Chen , J. M. Wenda et al. , 2021 Splice site m(6)A methylation prevents binding of U2AF35 to inhibit RNA splicing . Cell 184 : 3125 – 3142 e3125. OpenUrl CrossRef PubMed ↵ Middelkoop , T. C. , and H. C. Korswagen , 2014 Development and migration of the C. elegans Q neuroblasts and their descendants . WormBook : 1 – 23 . ↵ Middelkoop , T. C. , L. Williams , P. T. Yang , J. Luchtenberg , M. C. Betist et al. , 2012 The thrombospondin repeat containing protein MIG-21 controls a left-right asymmetric Wnt signaling response in migrating C. elegans neuroblasts . Dev Biol 361 : 338 – 348 . OpenUrl CrossRef PubMed ↵ Mishima , Y. , and Y. Tomari , 2016 Codon Usage and 3’ UTR Length Determine Maternal mRNA Stability in Zebrafish . Mol Cell 61 : 874 – 885 . OpenUrl CrossRef PubMed ↵ Mitchell , L. E. , 2022 Maternal effect genes: Update and review of evidence for a link with birth defects . HGG Adv 3 : 100067 . OpenUrl PubMed ↵ Nombela , P. , B. Miguel-Lopez and S. Blanco , 2021 The role of m(6)A, m(5)C and Psi RNA modifications in cancer: Novel therapeutic opportunities . Mol Cancer 20 : 18 . OpenUrl CrossRef PubMed ↵ Packer , J. S. , Q. Zhu , C. Huynh , P. Sivaramakrishnan , E. Preston et al. , 2019 A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution . Science 365 . ↵ Pierre , V. , G. Martinez , C. Coutton , J. Delaroche , S. Yassine et al. , 2012 Absence of Dpy19l2, a new inner nuclear membrane protein, causes globozoospermia in mice by preventing the anchoring of the acrosome to the nucleus . Development 139 : 2955 – 2965 . OpenUrl Abstract / FREE Full Text ↵ Quarato , P. , M. Singh , E. Cornes , B. Li , L. Bourdon et al. , 2021 Germline inherited small RNAs facilitate the clearance of untranslated maternal mRNAs in C. elegans embryos . Nat Commun 12 : 1441 . OpenUrl CrossRef PubMed ↵ Rushforth , A. M. , B. Saari and P. Anderson , 1993 Site-selected insertion of the transposon Tc1 into a Caenorhabditis elegans myosin light chain gene . Mol Cell Biol 13 : 902 – 910 . OpenUrl Abstract / FREE Full Text ↵ Sachs , A. B. , and R. W. Davis , 1989 The poly(A) binding protein is required for poly(A) shortening and 60S ribosomal subunit-dependent translation initiation . Cell 58 : 857 – 867 . OpenUrl CrossRef PubMed Web of Science ↵ Seydoux , G. , C. C. Mello , J. Pettitt , W. B. Wood , J. R. Priess et al. , 1996 Repression of gene expression in the embryonic germ lineage of C. elegans . Nature 382 : 713 – 716 . OpenUrl CrossRef PubMed ↵ Sundararajan , L. , and E. A. Lundquist , 2012 Transmembrane proteins UNC-40/DCC, PTP-3/LAR, and MIG-21 control anterior-posterior neuroblast migration with left-right functional asymmetry in Caenorhabditis elegans . Genetics 192 : 1373 – 1388 . OpenUrl Abstract / FREE Full Text ↵ Sundararajan , L. , M. L. Norris , S. Schoneich , B. D. Ackley and E. A. Lundquist , 2014 The fat-like cadherin CDH-4 acts cell-non-autonomously in anterior-posterior neuroblast migration . Dev Biol 392 : 141 – 152 . OpenUrl CrossRef PubMed ↵ Takagi , S. , C. Benard , J. Pak , D. Livingstone and S. Hekimi , 1997 Cellular and axonal migrations are misguided along both body axes in the maternal-effect mau-2 mutants of Caenorhabditis elegans . Development 124 : 5115 – 5126 . OpenUrl Abstract ↵ Tintori , S. C. , E. Osborne Nishimura , P. Golden , J. D. Lieb and B. Goldstein , 2016 A Transcriptional Lineage of the Early C. elegans Embryo . Dev Cell 38 : 430 – 444 . OpenUrl CrossRef PubMed ↵ Watabe , E. , M. Togo-Ohno , Y. Ishigami , S. Wani , K. Hirota et al. , 2021 m(6) A-mediated alternative splicing coupled with nonsense-mediated mRNA decay regulates SAM synthetase homeostasis . EMBO J 40 : e106434 . OpenUrl PubMed ↵ Watanabe , K. , H. Takebayashi , A. K. Bepari , S. Esumi , Y. Yanagawa et al. , 2011 Dpy19l1, a multi-transmembrane protein, regulates the radial migration of glutamatergic neurons in the developing cerebral cortex . Development 138 : 4979 – 4990 . OpenUrl Abstract / FREE Full Text ↵ Wolf , J. B. , and M. J. Wade , 2009 What are maternal effects (and what are they not)? Philos Trans R Soc Lond B Biol Sci 364 : 1107 – 1115 . OpenUrl CrossRef PubMed ↵ Xu , L. , Y. Fong and S. Strome , 2001 The Caenorhabditis elegans maternal-effect sterile proteins, MES-2, MES-3, and MES-6, are associated in a complex in embryos . Proc Natl Acad Sci U S A 98 : 5061 – 5066 . OpenUrl Abstract / FREE Full Text ↵ Yang , Y. , L. Wang , X. Han , W. L. Yang , M. Zhang et al. , 2019 RNA 5-Methylcytosine Facilitates the Maternal-to-Zygotic Transition by Preventing Maternal mRNA Decay . Mol Cell 75 : 1188 – 1202 e1111. OpenUrl CrossRef PubMed ↵ Zhang , L. , Y. Wan , Z. Zhang , Y. Jiang , Z. Gu et al. , 2021 IGF2BP1 overexpression stabilizes PEG10 mRNA in an m6A-dependent manner and promotes endometrial cancer progression . Theranostics 11 : 1100 – 1114 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted March 17, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Maternal Effects on Postembryonic Neuroblast Migration in C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Maternal Effects on Postembryonic Neuroblast Migration in C. elegans Hoikiu Poon , Chaogu Zheng bioRxiv 2025.03.17.643740; doi: https://doi.org/10.1101/2025.03.17.643740 Share This Article: Copy Citation Tools Maternal Effects on Postembryonic Neuroblast Migration in C. elegans Hoikiu Poon , Chaogu Zheng bioRxiv 2025.03.17.643740; doi: https://doi.org/10.1101/2025.03.17.643740 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18589) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)