A dual-functional laccase gene CsLAC17 from tea plant: Insights from VIGS and heterologous expression into lignin-mediated resistance and direct antifungal activity

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 136,169 characters · extracted from preprint-html · click to expand
A dual-functional laccase gene CsLAC17 from tea plant: Insights from VIGS and heterologous expression into lignin-mediated resistance and direct antifungal activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A dual-functional laccase gene CsLAC17 from tea plant: Insights from VIGS and heterologous expression into lignin-mediated resistance and direct antifungal activity YuFeng Hu, Yichen Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9122877/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Tea ( Camellia sinensis (L.) O. Kuntze) is a globally significant beverage crop, yet its production is frequently compromised by various fungal diseases, therefore, enhancing its natural disease resistance is of great importance. Laccases (LACs) are key enzymes in plant defense responses. Here, we identified and functionally characterized a tea laccase gene, CsLAC17 , which has a full length of 1758 bp and encodes 585 amino acids. Silencing CsLAC17 in tea via virus-induced gene silencing (VIGS) significantly compromised resistance to anthracnose, accompanied by elevated MDA content. Its overexpression in tobacco increased lignin content and boosted resistance to Botrytis cinerea . Furthermore, the purified CsLAC17 protein, heterologously expressed in yeast, directly inhibited the growth of B. cinerea in vitro. These results indicate that CsLAC17 enhances plant systemic resistance by regulating lignin biosynthesis, and that its encoded protein also possesses direct antifungal activity. This finding not only provides new insights into tea disease resistance mechanisms but also offers a dual target for breeding disease-resistant cultivars and developing novel green fungicides. Camellia sinensis laccase Heterologous expression Pichia pastoris VIGS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Key message This study first expresses CsLAC17 protein, functionally characterizing its dual role in enhancing disease resistance via lignin biosynthesis and direct antifungal activity, offering a target for breeding and green fungicides. 1 Introduction The tea plant ( Camellia sinensis (L.) O. Kuntze) is an evergreen woody species of the genus Camellia in the family Theaceae, native to Southwest China (Xia et al. 2017; Lu et al. 2021; Fang et al. 2021). Its young shoots and leaves are the primary raw materials for tea, the world’s most widely consumed non-alcoholic beverage (Wei et al. 2018; She et al. 2022). Consequently, the tea industry serves as a vital economic pillar for numerous producing nations and holds multifaceted significance in economic, medicinal, and cultural spheres (Xu et al. 2021; Pan et al. 2022). For numerous tea-producing countries, holding profound importance in economic, pharmaceutical, and cultural spheres. However, sustainable tea production is severely threatened by fungal and bacterial pathogens that cause devastating diseases such as tea anthracnose ( Colletotrichum spp.), blister blight ( Exobasidium vexans ), and brown blight ( Pestalotiopsis spp.). These diseases lead to drastic reductions in both yield and quality, resulting in substantial economic losses (Chen et al. 2025; Pandey et al. 2021; Samynathan et al. 2021). Currently, chemical fungicides are predominantly used in tea plantations to control tea plant diseases. This practice increases resistance and fungicides residues, leading to environmental pollution and compromising the safety of tea products (Yamada et al. 2016; Borah et al. 2022). Therefore, elucidating the mechanisms of disease resistance in tea plants and developing novel, eco-friendly control agents represent critical priorities for the sustainable advancement of the tea industry. Laccases, the largest subfamily of multicopper oxidases (MCOs), are widely distributed in plants, fungi, bacteria, and insects (Yu et al. 2021). Laccases possess three conserved catalytic domains (Cu-oxidase, Cu-oxidase_2, and Cu-oxidase_3) that bind four copper ions and exhibit broad substrate specificity (Arregui et al. 2019; Giardina et al. 2010). In nature, laccases play pivotal roles in organic matter cycling and ecosystem balance by mediating wood degradation, pigment formation, and antioxidant processes (Mayer and Staples 2002; Baldrian 2006). Their robust oxidative capacity also confers significant industrial application value, particularly in the textile, paper industry, and food processing sectors, where they are utilized for pollutant degradation, pulp bleaching, decolorization of dye wastewater, and product quality enhancement (Khatami et al. 2022; Bhardwaj et al. 2022). Plant laccases are localized in the cell walls of various higher plants. They were first identified in 1883 from the exudates of the Japanese lacquer tree Rhus vernicifera , and their presence in fungi was confirmed shortly thereafter (Yoshida 1883; Bertrand 1896). Laccases have been extensively reported to participate in lignin biosynthesis and enhance plant defense against stress, playing indispensable roles in plant growth and development. For instance, AtLAC4 and AtLAC17 are involved in the constitutive lignification of Arabidopsis thaliana stems. Simultaneous disruption of AtLAC4 , AtLAC11 , and AtLAC17 almost completely abolished lignin deposition, resulting in severe growth stagnation, reduced root diameter, indehiscent anthers, and impaired lignified vascular development (Berthet et al. 2011; Zhao et al. 2013). In Gossypium hirsutum , overexpression of GhLAC1 and GhLAC15 increased lignin accumulation, thereby enhancing cotton's resistance to the fungal pathogen Verticillium dahliae (Hu et al. 2018; Zhang et al. 2019). Overexpression of Phyllostachys edulis PeLAC10 in Arabidopsis elevated lignin content in transgenic plants, improving their drought tolerance and resistance to phenolic acids (Li et al. 2020b). Silencing of wheat TaLAC4 using VIGS increased susceptibility to Fusarium graminearum and reduced total lignin deposition, suggesting a potential role for TaLAC4 in defense-induced guaiacyl (G) lignin synthesis (Soni et al. 2020). Furthermore, PlLAC4 participates in lignin biosynthesis in Paeonia lactiflora , promoting dry lignin accumulation and secondary cell wall thickening (Tang et al. 2023). Transformation of tobacco with EuLAC1 from Eucommia ulmoides resulted in transgenic plants with higher lignin content and enhanced resistance to B. cinerea (Zhao et al. 2022). Collectively, these studies demonstrate that laccases play critical roles in plant growth, development, and stress responses primarily through the regulation of lignin biosynthesis. Laccase-mediated lignification is a crucial defense strategy for broad-spectrum disease resistance in plants. However, in the economically important crop tea plant, the disease resistance functions of the laccase gene family remain to be systematically elucidated. Previous studies have shown that the overexpression of CsLAC17 significantly increases lignin content and enhances resistance to gray blight in transgenic Arabidopsis (Yang et al. 2024). Additionally, the laccase gene CsLAC37 has been implicated in the tea plant’s response to fungal infection (Li et al. 2024). These findings suggest that laccase genes play crucial roles in tea plant disease resistance. Nevertheless, systematic studies on the protein expression and functional mechanisms of plant laccase proteins remain scarce. In this study, we focused on CsLAC17 , obtaining its purified protein through gene cloning and in vitro heterologous expression to explore the protein's resistance to anthracnose in tea plant. Furthermore, we systematically validated the biological function of CsLAC17 through heterologous expression in tobacco and gene silencing techniques in tea plant. These findings will contribute to a deeper understanding of the role of CsLAC17 protein in tea plant disease resistance, providing a scientific basis for developing laccase-based green pesticides, and ultimately promote the coordinated development of disease resistance and quality in tea plant. 2 Materials and Methods 2.1 Experimental materials The materials used in this experiment include two-year-old "Fudingdabai" tea plant cultivated at the College of Tea Science of Guizhou University. Additional experimental materials consist of Nicotiana benthamiana , Pichia pastoris strain GS115, Agrobacterium tumefaciens strain GV3101, Escherichia coli strain DH5α , viral vectors pTRV1 and pTRV2, as well as the plant expression vector pCAMBIA1300-35S-GUS, all provided by the Biotechnology Laboratory of Guizhou University. The pathogens utilized in this experiment include B. cinerea , a gray mold fungus from the genus Botrytis , and Glomerella cingulata , which is the causative agent of anthracnose. 2.2 Gene cloning Primers were designed based on the reference sequence of laccase gene from the tea plant transcriptome database. Using tea plant cDNA as a template, amplification was performed with Platinum® Taq DNA High Fidelity Polymerase (Invitrogen). The amplification primers were: Forward Primer (F): ATGGCTACTTATGTTCTTCTCT and Reverse Primer (R): ACATTTCGGAAGATCAGACG. The reaction system consisted of 25.0 µL 2× High Fidelity PCR Buffer, 1.0 µL dNTP mix (10 mM), 2.0 µL 50 mM MgSO 4 , 1.5 µL forward and reverse primers (10 µM), 5.0 µL cDNA, 1.0 µL Platinum® Taq High Fidelity (1 U/µL), and 13.0 µL PCR-grade water. The reaction program was as follows: pre-denaturation at 95 ℃ for 2 min, denaturation at 95 ℃ for 25 s, annealing at 55 ℃ for 25 s, extension at 68 ℃ for 90 s, for a total of 35 cycles, and finally extension at 68 ℃ for 5 min. 2.3 VIGS vector construction and tea plant infection This study employed Tobacco rattle virus (TRV) as a vector for Virus-Induced Gene Silencing (VIGS) to create a silencing vector targeting the CsLAC17 gene in tea plant. A 300 bp segment of CsLAC17 gene was chosen as the target sequence, and specific primers with homologous arms were designed for amplification using high-fidelity polymerase PCR. Concurrently, the pTRV2 empty vector underwent double digestion with EcoR I and Xho I. The purified PCR product was ligated to the linearized pTRV2 vector, which was then transformed into competent Escherichia coli cells. Following plasmid extraction and PCR verification, the recombinant plasmid was introduced into Agrobacterium tumefaciens strain GV3101 through electroporation. After colony PCR confirmation, the transformed bacteria were stored at -80°C for further use.The VIGS experiment was conducted according to the method described by Li et al. (2022). 2.4 Nicotiana benthamiana plant transformation and identification Design primers with homologous arms to clone laccase gene and perform double digestion with Sac I and Xba I on the pCAMBIA1300-35S-GUS vector. The digested laccase gene was ligated with the vector, and the recombinant vector, along with empty vector (EV), was transferred into Agrobacterium GV3101 using the freeze-thaw method. Colony PCR was then executed to verify positive clones. Co-cultivate the leaf discs with the Agrobacterium infection solution to generate transgenic tobacco explants. Further selection of resistant tobacco leaves was achieved through GUS histochemical staining. qRT-PCR was used to screen for transgenic lines with the highest expression levels of CsLAC17 , and tissue culture propagation of tobacco leaf segments was conducted to obtain plants with the same genetic background, ensuring the accuracy of subsequent experiments. 2.5 qRT-PCR analysis Leaves from the transgenic tobacco lines TP1 to TP11 were collected. To ensure sample quality and the accuracy of subsequent experiments, the leaf samples were rapidly frozen in liquid nitrogen and stored in a − 80 ℃ freezer. Total RNA was extracted and reverse transcribed into cDNA. According to the manufacturer's instructions, qRT-PCR was performed using the SYBR® Select Master Mix kit (Applied Biosystems Inc., Foster, CA, USA). The β-actin gene was used as the reference gene, and each sample included three biological replicates and three technical replicates. 2.6 Enzyme Activity Detection Infected tea plant and tobacco leaves were used to detect the activities of peroxidase (POD), catalase (CAT), superoxide dismutase (SOD), and malondialdehyde (MDA). The POD assay kit (BC0090), CAT assay kit (BC0200), SOD assay kit (BC5165), and MDA assay kit (BC0020) were used for the assays, following the manufacturer’s instructions (Beijing Solarbio Science & Technology Co., Ltd). In brief, 0.1 g sample was weighed and placed on ice, followed by the addition of 1 ml of extraction buffer for homogenization on ice. The mixture was then centrifuged at 8000 g for 10 min at 4°C, and the supernatant was collected for subsequent analysis. 2.7 Pathogen Inoculation and Treatment The preserved strains were inoculated onto PDA solid medium and incubated in the darkness at 28°C for 5–7 d. Appropriate leaves were selected, and their surfaces were disinfected with 75% ethanol and sterile distilled water. 5 mm thick colonies were then obtained from the edge of the fungal growth area and inoculated onto scratched leaf surface with the mycelium facing downward. Sterile PDA medium blocks and non-inoculated pathogens were used as control. Inoculated leaves were enclosed with plastic wrap and placed in a constant temperature incubator at 26°C for subsequent assessment of disease development at different leaf positions. The size of the leaf lesions was measured using Image J 1.53t software, with three biological replicates established for each treatment and at least 10 leaves inoculated per replicate. 2.8 Codon optimization DNA 2.0 software was used to optimize the codon of the tea plant CsLAC17 gene based on the Pichia pastoris codon usage preference table (Zhang et al. 2021). The optimized gene sequence was synthesized by GenScript Biology Company. 2.9 Vector construction and preparation of yeast engineering bacteria Restriction endonuclease sites EcoR I and Not I with protective bases were added to both ends of the tea plant CsLAC17 gene sequence, and the signal peptide encoding the first 33 amino acids at the N-terminus was removed. The vector pPIC9K and the gene were double-digested, and T4 DNA ligase was used for ligation. The resulting products were transformed into Escherichia coli . For detailed methodologies, refer to Liu et al. (2021b). Following the method of Pei et al. (2018), the constructed vector was digested with Sac I single enzyme, and the linear plasmid was transferred into competent yeast GS115 cells via electroporation. Single colonies grown on MD plate were subsequently inoculated onto MM plate and incubated at 30 ℃ for three days. Colonies that grow normally on MD plate but poor or no growth on MM plate are Muts type, while the remaining are Mut + type. After screening for Mut + recombinant Pichia pastoris , genomic DNA was extracted for PCR verification. 2.10 Induced expression of recombinant Pichia pastoris Ten positive clones were selected and inoculated in 10 mL YPD medium, and cultured at 28.5 ℃ with shaking at 220 rpm until reaching the logarithmic growth phase to prepare seed solution. A portion of 200 µL liquid was inoculated into 200 mL of BMGY medium, and continued to be cultured at the same condition until OD600 = 5. After centrifugation, the obtained cells were resuspended in 200 mL of BMMY medium and induced at 220 rpm and 28.5 ℃ in the presence of 1% methanol for 70 h. Protein expression was analyzed using the SDS-PAGE method, with results recorded by a Bio-Rad gel electrophoresis imager. 2.11 Fermentation condition optimization An appropriate volume of seed solution was inoculated into 100 mL of BMGY medium in a shake flask and incubated at 30 ℃ with shaking at 250 rpm for 20 h. After centrifugation, the cells were transferred to 100 mL of BMMY medium, adjusting the initial OD600 = 1. To induce laccase gene expression, Cu 2+ was added to achieve a final concentration of 0.5 mM, and methanol was added every 24 h to a final concentration of 1%. The culture was maintained at 250 rpm. To optimize fermentation conditions, various factors were considered, including induction time (0 h, 24 h, 48 h, 72 h, 96 h, 120 h, 144 h), initial induction pH (2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6), induction temperature (20 ℃, 28 ℃, 30 ℃), and methanol concentration (0.25%, 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%). 2.12 Isolation and purification of CsLAC17 Protein To preserve protein activity, the protein was concentrated via ammonium sulfate precipitation. The target protein was precipitated by slowly adding ammonium sulfate solution to the supernatant to achieve 65% saturation. The mixture was sealed and incubated at 4 ℃ overnight for complete precipitation. The precipitate was then collected by centrifugation at 10,000 rpm for 10 min at 4 ℃ and redissolved in ddH₂O. To remove excess salt ions that could interfere with subsequent purification, the solution was dialyzed using a dialysis bag with a molecular weight cutoff of 3000 Mw, following the protocol described by Scheich et al. (2003). As the expression vector contained a histidine tag, the recombinant protein was further purified using a nickel-affinity column according to the method outlined by Sun (2020). 2.13 Laccase Enzyme Assay Laccase activity was determined using ABTS as the substrate. The reaction mixture contained 100 mM sodium acetate buffer (pH 4.0) and 0.5 mM ABTS. The reaction was initiated by adding 100 µL of appropriately diluted enzyme solution to 900 µL of the reaction mixture. The increase in absorbance at 420 nm was recorded every 30 s for 3 min using a spectrophotometer. One unit (U) of enzyme activity was defined as the amount of enzyme required to oxidize 1 µmol of ABTS per minute. The molar extinction coefficient of ABTS at 420 nm was taken as 36,000 M⁻¹ cm⁻¹. All assays were performed in triplicate. To evaluate the effect of metal ions on laccase activity, buffers containing different metal ions (Mg 2+ , K + , Fe 2+ , Cu 2+ , Zn 2+ , Fe 3+ ) at a concentration of 10 mmol/L were prepared. The tea plant laccase solution, prepared in citric acid buffer, was mixed with the respective metal ion buffers and incubated in a water bath at 40 ℃ for 30 min. A control group without the addition of any metal ions was included. All experiments were performed in triplicate. The enzyme activity of the control group was defined as 100%, and the activity of the experimental groups was expressed as a percentage relative to the control. 2.14 Statistical analysis All experiments were performed with at least three independent biological replicates. The value of each physiological index was expressed as the mean ± standard error (± SE). All data were verified by the Shapiro-Wilk test and the Levene test confirmed homogeneity of variance. Data that match normality and homogeneity of variance were compared between groups using one-way ANOVA (assuming test significance level α = 0.05) and were supplemented with the Tukey HSD test for post hoc multiple comparison corrections. 3 Results 3.1 Silencing of CsLAC17 compromises tea plant resistance to anthracnose In this study, we cloned the laccase gene CsLAC17 from the cDNA of tea plants, with a complete coding sequence (CDS) of 1758 bp, encoding 585 amino acids (Fig. S1). We employed Virus-Induced Gene Silencing (VIGS) to explore the role of laccase gene CsLAC17 in tea plant defense against anthracnose. The pTRV2- CsLAC17 vector was constructed using a specific fragment from a conserved region of the gene (Fig. S2). The VIGS system was first validated by the typical albino phenotype on new leaves (Fig. 1a), and the successful silencing of CsLAC17 was confirmed by qRT-PCR, which showed a significant reduction in its transcript levels compared to empty vector controls (Fig. 1b). Pathogenicity assays demonstrated that CsLAC17 -silenced plants were more susceptible to the pathogen, exhibiting significantly larger lesions than controls (Fig. 1c). To investigate the underlying physiological mechanism, we measured the activities of key protective enzymes. We found that the activities of SOD, POD, and CAT were significantly decreased, whereas MDA content, a marker of membrane damage, was significantly elevated in silenced plants (Fig. 1d). These findings indicate that CsLAC17 silencing weakens the plant’s reactive oxygen species (ROS) scavenging ability, thereby exacerbating pathogen-induced oxidative damage and ultimately compromising disease resistance. 3.2 CsLAC17 overexpression boosts tobacco resistance to B. cinerea To investigate the functional role of CsLAC17 in plant defense, we generated transgenic tobacco lines. Transgene integration was preliminarily confirmed by GUS staining (Fig. S3a), and the line with the highest expression level, designated tp-6, was identified by qPCR and propagated for subsequent analyses (Fig. S3b). Consistent with its elevated transcript level, the tp-6 line exhibited significantly higher laccase activity compared to wild-type (WT) and empty vector control (CK) plants, confirming the successful expression of functional CsLAC17 protein (Fig. 2a). We then evaluated the resistance of these plants to B. cinerea . Following inoculation, WT and CK plants developed typical water-soaked lesions that expanded rapidly over 1, 3, 5, and 7 dpi (Fig. 2b). In contrast, the TP displayed markedly milder disease symptoms and smaller lesion diameters at 7 dpi compared to controls (Fig. 2c). To elucidate the underlying mechanisms, we examined two key defense pathways. qPCR analysis showed that the transcript levels of key genes in the lignin biosynthesis pathway were significantly upregulated in TP plants compared to WT and CK (Fig. 2d). This finding corresponded with higher lignin content (Fig. 2f), suggesting that CsLAC17 may reinforce the cell wall by promoting lignin deposition. Simultaneously, the activities of protective enzymes (SOD, POD, CAT) were significantly elevated, while MDA content was notably reduced (Fig. 2e). This suggests that transgenic plants may suffer less membrane damage and lipid peroxidation induced by pathogens compared to control group. Collectively, these findings demonstrate that overexpressing CsLAC17 in tobacco confers enhanced resistance to B. cinerea through a dual mechanism: strengthening the physical barrier via lignin biosynthesis and enhancing biochemical defenses through the antioxidant system. 3.3 Codon optimization of CsLAC17 gene To accommodate the codon usage preferences of Pichia pastoris , we optimized the nucleotide sequence of the gene while maintaining the amino acid sequence unchanged. The specific optimization sites are indicated in the red regions of Fig. S4a, where an EcoR I restriction site was introduced at the N-terminus and a Not I restriction site was introduced at the C-terminus. The optimized sequence was synthesized by GenScript Biology Company. Subsequently, we constructed a recombinant plasmid of the target gene using the pPIC9K vector and transformed it into Escherichia coli . The successful construction of the recombinant vector was confirmed through double digestion analysis (Fig. S4b). 3.4 Induced expression of yeast The target protein was expressed using Pichia pastoris . The recombinant plasmid containing the target gene was successfully introduced into Pichia pastoris GS115 receptor cells, yielding a distinct PCR band of 1500–2000 bp, which confirmed the presence of multiple Mut + positive clones (Fig. S5). Following this, the engineered yeast cells were induced for protein expression, and the crude enzyme produced during fermentation was concentrated and dialyzed, followed by protein separation and purification using Ni-NTA. The purified protein was then analyzed by SDS-PAGE, which revealed a single band, indicating effective protein expression and confirming the successful preparation of the engineered yeast strain (Fig. 3). Moreover, the molecular weight of the expressed target protein was between 53–73 kDa, with an approximate value of 61 kDa, which aligns with the predicted molecular weight of 61 kDa. 3.5 Optimization of fermentation conditions of recombinant Pichia pastoris We determined the optimal conditions for expressing laccase in Pichia pastoris by optimizing induction time, initial pH, induction temperature, and methanol usage, while considering both the OD600-based growth profile and the enzyme activity (Fig. 4). Through systematic optimization of fermentation parameters, the optimal conditions for inducing laccase expression in Pichia pastoris were as follows: induction time of 96 h, initial pH of 4.5, induction temperature of 20°C, and methanol addition of 1.0%. The activity of the laccase expressed in Pichia pastoris under optimized conditions was determined by the ABTS assay. The enzyme showed a maximum activity of 2.58 U/mL, confirming the functionality of the purified protein . 3.6 Effect of metal ions on CsLAC17 activity and the antifungal effect of the enzyme preparation The effects of different metal ions on the activity of recombinant CsLAC17 were investigated. Cu 2+ significantly enhanced enzyme activity by 11.0%, whereas Fe 3+ , Zn 2+ and Fe 2+ strongly inhibited the enzymatic activity. Notably, Zn 2+ exhibited the most pronounced inhibitory effect, reducing the activity by 69.9%. Substantial inhibition was also observed with Fe 3+ and Fe 2+ (Fig. 5a). To evaluate the inhibitory effect of the laccase reagent prepared with copper sulfate, a filter paper inhibition assay was conducted. The treatments were as follows: (1) positive control treated with 1 mg/mL fluorescein solution; (2) 10 mg/mL laccase solution prepared with 0.01 M copper sulfate, which significantly inhibited B. cinerea growth; (3) 0.02 M copper sulfate solution alone, which showed no significant effect; and (4) 10 mg/mL laccase solution alone, which also had no significant effect on B. cinerea growth (Fig. 5b). These results demonstrate that the 10 mg/mL laccase reagent formulated with 0.01 M copper sulfate possesses inhibitory activity against B. cinerea . 4 Discussion As a vital economic crop, the healthy growth and disease resistance of the tea plant are crucial for the sustainable development of the tea industry. Lignin serves as a critical physical barrier against pathogens, and our previous research identified laccases—the key enzymes catalyzing lignin polymerization—as essential players in this defense mechanism (Zhao et al. 2022). Accordingly, we hypothesized that CsLAC17 also contributes to the plant’s defense responses. However, functional characterization in tea plants is challenging due to their perennial nature, self-incompatibility, and the lack of reliable stable transformation systems (Mukhopadhyay et al. 2016). Traditional breeding cycles are long, further limiting breeding efficiency. VIGS has emerged as a powerful tool for functional genomics in species recalcitrant to transformation, having been successfully applied in species such as Populus euphratica , Narcissus tazetta L., Jatropha curcas , and Malus crabapple (Li et al. 2022), yet it remains underutilized in tea. In this study, we successfully employed a VIGS system to dissect the function of CsLAC17 . Findings from both overexpression in tobacco and silencing in tea plants consistently demonstrate that CsLAC17 is essential for fortifying plant defenses by positively regulating lignin synthesis. Upon stress exposure, plants initiate a complex defense network, in which an early signal response centered on a reactive oxygen species (ROS) burst plays a crucial role (Tyagi et al. 2022). Since ROS are both key defense signals and cytotoxic, maintaining redox homeostasis between their production and scavenging is essential. This homeostasis is primarily regulated by antioxidant enzymes such as SOD, POD, and CAT. The extent of oxidative imbalance can be quantified by measuring MDA, a product of membrane lipid peroxidation (Mhamdi et al. 2018). In this study, we demonstrate that overexpression of CsLAC17 in transgenic tobacco significantly bolsters antioxidant capacity following pathogen infection. This was evidenced by markedly increased activities of SOD, POD, and CAT, coupled with reduced MDA content. Conversely, silencing CsLAC17 in tea plants compromised their defense, manifesting as diminished antioxidant enzyme activities and severe membrane lipid peroxidation. This phenomenon is not merely an isolated case in tea plants but points to a conserved function of the laccase gene family. For instance, silencing another tea plant laccase gene, CsLAC37 , using antisense oligonucleotide (AsODN) technology similarly resulted in increased H₂O₂ content and decreased POD activity, suggesting that laccases may play a conserved and important role in tea plant defense against anthracnose (Li et al. 2024). Overexpression of PeuLAC2 in poplar enhanced the antioxidant system’s activity, effectively protecting cell membranes from damage and improving the plant’s stress resistance (Niu et al. 2021). Similarly, tobacco plants overexpressing CsLAC18 exhibited significantly higher activities of CAT, SOD, and POD following cold stress compared to wild-type plants. Notably, the overexpression lines also exhibited higher laccase activity and lignin content, whereas silencing this gene in trifoliate orange ( Poncirus trifoliata ) via VIGS presented the opposite phenotype (Xu et al. 2022). Lignin deposition in the secondary cell wall provides a critical physical barrier against pathogen invasion (Boerjan et al. 2003). Its biosynthesis is a complex, multi-step process that begins with the phenylpropanoid pathway, generating three monolignols (H, G, and S) that are subsequently oxidatively polymerized by peroxidases and laccases to form the final lignin polymer (Vanholme et al. 2010; Zhao and Dixon 2011). In this study, we observed a significant upregulation of multiple key genes in the lignin biosynthesis pathway. The coordinated induction of these genes strongly suggests that the entire lignification process is activated as a defense response. The role of PAL and C4H in defense is well-established. For example, overexpression of CsPAL enhances resistance to blister blight infection (Nisha et al. 2018). In pear, PbC4H1 and PbC4H3 play key roles in lignin biosynthesis (Li et al. 2020a). Similarly, 4CL mediates the activation of various hydroxycinnamic acids, and suppression of Os4CL3 expression results in a significant reduction in lignin content, impaired plant growth, and other morphological changes (Gui et al. 2011). COMT and CCoAOMT are essential for methylation steps; in maize, ZmCCoAOMT2 is potentially involved in the biosynthesis of lignin and other phenylpropanoid metabolites (Yang et al. 2017). Overexpression of OsCOMT5 promotes lignin accumulation in rice and enhances tolerance to R. solani (Kaur et al. 2025). CCR and CAD catalyze the final stages of monolignol synthesis; overexpression of BnCCR2 in B. napus increases lignin content in the stem, thereby enhancing resistance to S. sclerotiorum (Liu et al. 2021a). Likewise, overexpression of TaCAD12 significantly enhances resistance to sharp eyespot in transgenic wheat lines (Rong et al. 2016). Taken together, the upregulation of this suite of genes in the present study indicates a comprehensive reinforcement of the lignin biosynthesis pathway, thereby fortifying the cell wall as a primary defense strategy against pathogen invasion. Plant laccases are ubiquitous polyphenol oxidases that contain four copper ions in their catalytic center. In this study, a laccase gene was cloned from tea plant and expressed in Pichia pastoris . Through the optimization of fermentation conditions to achieve high-level production of the recombinant protein, purified laccase was successfully obtained, which exhibited direct inhibitory activity against B. cinerea . As an integral component of the laccase active center, copper ions exert a significant influence on both the expression and activity of the enzyme. To further investigate the effects of inorganic ions on tea plant laccase activity, the enzyme solution was incubated with buffers containing various metal ions. The results indicated that Mg²⁺, Cu²⁺, and K⁺ activated the laccase, whereas Zn²⁺, Fe²⁺, and Fe³⁺ inhibited its activity. Consistent with these findings, previous research has shown that supplementing the culture medium of the white-rot fungus Pleurotus ostreatus with copper ions (0.5–5 mM) significantly enhances laccase activity and stability, with 1 mM Cu²⁺ resulting in an 8-fold increase in activity (Baldrian and Gabriel 2002). Similarly, Kang et al. (2024) demonstrated that 10 mM K⁺ improved the activity of Hericium erinaceus laccase, whereas 5 mM Fe²⁺ exhibited an inhibitory effect. Furthermore, Mg²⁺ and Cu²⁺ have been shown to promote the activity of DcLac1 and DcLac2 enzymes purified from carrot ( Daucus carota L.)(Ma et al. 2015). Notably, Mg²⁺ and K⁺ may maintain or enhance laccase activity by preserving the charge balance and the three-dimensional conformation of the protein structure. Conversely, Fe²⁺ and Fe³⁺ function as competitive inhibitors with similar modes of action; they can bind to the T1 site of laccase, thereby inhibiting enzyme activity by blocking substrate access to the T1 site or hindering electron transfer to the T1 active site (Umar et al, 2022). Collectively, our study positions CsLAC17 as a key node linking cell wall fortification and redox homeostasis in the plant defense network. For practical application, enhancing tea plant disease resistance relies on a combined approach: integrating traditional breeding with modern tools like Molecular Marker-Assisted Selection (MAS) and CRISPR/Cas9 gene editing for targeted cultivar improvement. 5 Conclusion In this study, we cloned CsLAC17 from Camellia sinensis and demonstrated, through complementary loss- and gain-of-function analyses, that CsLAC17 positively regulates antifungal resistance by coordinating cell-wall reinforcement and oxidative stress control. We further established a codon-optimized Pichia pastoris expression system to produce active CsLAC17 and characterize its regulation by metal ions. Notably, Cu²⁺ acted as a key activator, enabling the enzyme preparation to exhibit antifungal activity. This highlights a Cu-responsive laccase module with potential applications in resistance engineering and laccase-based biocontrol development. Collectively, these findings provide a promising target for breeding disease-resistant tea cultivars and developing eco-friendly control measures. Declarations Data availability All data presented in this research are available in the article and supplementary materials, further inquiries can be directed to the corresponding author. Funding This work was supported by the National Natural Science Foundation of China (Grant numbers [32160077]) and by the National Guiding Foundation for Local Science and Technology Development of China (Grant numbers [2023–009]). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions Yufeng Hu: Writing-original draft, Conceptualization, Methodology, Investigation, Formal analysis, Data curation. Yichen Zhao: Writing-review & editing, Writing-original draft, Conceptualization, Methodology, Project administration, Funding acquisition. References Arregui L, Ayala M, Gómez-Gil X, Gutiérrez-Soto G, Hernández-Luna CE, Herrera de Los Santos M, Levin L, Rojo-Domínguez A, Romero-Martínez D, Saparrat MCN, Trujillo-Roldán MA, Valdez-Cruz NA (2019) Laccases: structure, function, and potential application in water bioremediation. Microb Cell Fact 18:200. https://doi.org/10.1186/s12934-019-1248-0 Baldrian P (2006) Fungal laccases - occurrence and properties. FEMS Microbiol Rev 30:215–242. https://doi.org/10.1111/j.1574-4976.2005.00010.x Baldrian P, Gabriel J (2002) Copper and cadmium increase laccase activity in Pleurotus ostreatus . FEMS Microbiol Lett 206:69–74. https://doi.org/10.1111/j.1574-6968.2002.tb10988.x Berthet S, Demont-Caulet N, Pollet B, Bidzinski P, Cézard L, Le Bris P, Borrega N, Hervé J, Blondet E, Balzergue S, Lapierre C, Jouanin L (2011) Disruption of LACCASE4 and 17 results in tissue-specific alterations to lignification of Arabidopsis thaliana stems. Plant Cell 23:1124–1137. https://doi.org/10.1105/tpc.110.082792 Bertrand G (1896) Sur la presence simultanee de la laccase et de la tyrosinase dans le suc de quelques champignons. CR Hebd Seances Acad Sci 123:463–465 Bhardwaj P, Kaur N, Selvaraj M, Ghramh HA, Al-Shehri BM, Singh G, Arya SK, Bhatt K, Ghotekar S, Mani R, Chang SW, Ravindran B, Awasthi MK (2022) Laccase-assisted degradation of emerging recalcitrant compounds-a review. Bioresour Technol 364:128031. https://doi.org/10.1016/j.biortech.2022.128031 Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu Rev Plant Biol 54:519–546. https://doi.org/10.1146/annurev.arplant.54.031902.134938 Borah A, Hazarika SN, Thakur D (2022) Potentiality of actinobacteria to combat against biotic and abiotic stresses in tea [ Camellia sinensis (L) O. Kuntze]. J Appl Microbiol 133:2314–2330. https://doi.org/10.1111/jam.15734 Chen Z, Sui Y, Wisniewski M (2025) Current and future perspectives on tea production. Ind Crops Prod 235:121663. https://doi.org/10.1016/j.indcrop.2025.121663 Fang K, Xia Z, Li H, Jiang X, Qin D, Wang Q, Wang Q, Pan C, Li B, Wu H (2021) Genome-wide association analysis identified molecular markers associated with important tea flavor-related metabolites. Hortic Res 8:42. https://doi.org/10.1038/s41438-021-00477-3 Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G (2010) Laccases: a never - ending story. Cell Mol Life Sci 67:369–385. https://doi.org/10.1007/s00018-009-0169-1 Gui J, Shen J, Li L (2011) Functional characterization of evolutionarily divergent 4-coumarate:coenzyme a ligases in rice. Plant Physiol 157:574–586. https://doi.org/10.1104/pp.111.178301 Hu Q, Min L, Yang X, Jin S, Zhang L, Li Y, Ma Y, Qi X, Li D, Liu H, Lindsey K, Zhu L, Zhang X (2018) Laccase GhLac1 Modulates Broad-Spectrum Biotic Stress Tolerance via Manipulating Phenylpropanoid Pathway and Jasmonic Acid Synthesis. Plant Physiol 176:1808–1823. https://doi.org/10.1104/pp.17.01628 Kang J, La TV, Kim MJ, Bae JH, Sung BH, Kim S, Sohn JH (2024) Secretory Production of the Hericium erinaceus Laccase from Saccharomyces cerevisiae . J Microbiol Biotechnol 34:930–939. https://doi.org/10.4014/jmb.2312.12043 Kaur G, Sidhu GK, Singh A, Dhar-Ray S, Lenka SK, Reddy PM (2025) Overexpression of OsCCR1 , OsCOMT5 , OsCAD2 and OsCCoAOMT1 Genes Enhances Lignin Accumulation and Confers Tolerance Against Rhizoctonia solani in Rice ( Oryza sativa ). Mol Biotechnol. https://doi.org/10.1007/s12033-025-01436-2 Khatami SH, Vakili O, Movahedpour A, Ghesmati Z, Ghasemi H, Taheri-Anganeh M (2022) Laccase: Various types and applications. Biotechnol Appl Biochem 69:2658–2672. https://doi.org/10.1002/bab.2313 Li D, Zhang H, Zhou Q, Tao Y, Wang S, Wang P, Wang A, Wei C, Liu S (2024) The Laccase Family Gene CsLAC37 Participates in Resistance to Colletotrichum gloeosporioides Infection in Tea Plants. Plants 13:884. https://doi.org/10.3390/plants13060884 Li G, Li Y, Yao X, Lu L (2022) Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of CsTCS1 . Int J Mol Sci 24:392. https://doi.org/10.3390/ijms24010392 Li G, Liu X, Zhang Y, Muhammad A, Han W, Li D, Cheng X, Cai Y (2020a) Cloning and functional characterization of two cinnamate 4-hydroxylase genes from Pyrus bretschneideri . Plant Physiol Biochem 156:135–145. https://doi.org/10.1016/j.plaphy.2020.07.035 Li L, Yang K, Wang S, Lou Y, Zhu C, Gao Z (2020b) Genome-wide analysis of laccase genes in moso bamboo highlights PeLAC10 involved in lignin biosynthesis and in response to abiotic stresses. Plant Cell Rep 39:751–763. https://doi.org/10.1007/s00299-020-02528-w Liu D, Wu J, Lin L, Li P, Li S, Wang Y, Li J, Sun Q, Liang J, Wang Y (2021a) Overexpression of Cinnamoyl-CoA Reductase 2 in Brassica napus Increases Resistance to Sclerotinia sclerotiorum by Affecting Lignin Biosynthesis. Front Plant Sci 12:732733. https://doi.org/10.3389/fpls.2021.732733 Liu Z, Qu J, Zhang L, Liu X, Yang G, Pei Y (2021b) Cloning of cucumber LCD and DES gene and their response to abiotic stress. Sci Hortic 278:109802. https://doi.org/10.1016/j.scienta.2020.109802 Lu L, Chen H, Wang X, Zhao Y, Yao X, Xiong B, Deng Y, Zhao D (2021) Genome-level diversification of eight ancient tea populations in the Guizhou and Yunnan regions identifies candidate genes for core agronomic traits. Hortic Res 8:190. https://doi.org/10.1038/s41438-021-00617-9 Ma J, Xu ZS, Wang F, Xiong AS (2015) Isolation, Purification and Characterization of Two Laccases from Carrot ( Daucus carota L.) and Their Response to Abiotic and Metal Ions Stresses. Protein J 34:444–452. https://doi.org/10.1007/s10930-015-9639-5 Mayer AM, Staples RC (2002) Laccase: new functions for an old enzyme. Phytochemistry 60:551–565. https://doi.org/10.1016/s0031-9422(02)00171-1 Mhamdi A, Van Breusegem F (2018) Reactive oxygen species in plant development. Development 145:dev164376. https://doi.org/10.1242/dev.164376 Mukhopadhyay M, Mondal TK, Chand PK (2016) Biotechnological advances in tea ( Camellia sinensis [L.] O. Kuntze): a review. Plant Cell Rep 35:255–287. https://doi.org/10.1007/s00299-015-1884-8 Nisha SN, Prabu G, Mandal AKA (2018) Biochemical and molecular studies on the resistance mechanisms in tea [ Camellia sinensis (L.) O. Kuntze] against blister blight disease. Physiol Mol Biol Plants 24:867–880. https://doi.org/10.1007/s12298-018-0565-9 Niu Z, Li G, Hu H, Lv J, Zheng Q, Liu J, Wan D (2021) A gene that underwent adaptive evolution, LAC2 (LACCASE), in Populus euphratica improves drought tolerance by improving water transport capacity. Hortic Res 8:88. https://doi.org/10.1038/s41438-021-00518-x Pan SY, Nie Q, Tai HC, Song XL, Tong YF, Zhang LJ, Wu XW, Lin ZH, Zhang YY, Ye DY, Zhang Y, Wang XY, Zhu PL, Chu ZS, Yu ZL, Liang C (2022) Tea and tea drinking: China’s outstanding contributions to the mankind. Chin Med 17:27. https://doi.org/10.1186/s13020-022-00571-1 Pandey AK, Sinniah GD, Babu A, Tanti A (2021) How the Global Tea Industry Copes With Fungal Diseases-Challenges and Opportunities. Plant Dis 105:1868–1879. https://doi.org/10.1094/PDIS-09-20-1945-FE Pei Y, Liu M, Chen H, Li Q, Yu X, Zhang L (2018) Optimization for conditions of high-efficient electroporation transformation of Rhodosporidium toruloides . J Guangdong Ocean Univ 38:48–54 Rong W, Luo M, Shan T, Wei X, Du L, Xu H, Zhang Z (2016) A Wheat Cinnamyl Alcohol Dehydrogenase TaCAD12 Contributes to Host Resistance to the Sharp Eyespot Disease. Front Plant Sci 7:1723. https://doi.org/10.3389/fpls.2016.01723 Samynathan R, Shanmugam K, Nagarajan C, Murugasamy H, Ilango RVJ, Shanmugam A, Venkidasamy B, Thiruvengadam M (2021) The effect of abiotic and biotic stresses on the production of bioactive compounds in tea ( Camellia sinensis (L.) O. Kuntze). Plant Gene 27:100316. https://doi.org/10.1016/j.plgene.2021.100316 Scheich C, Sievert V, Büssow K (2003) An automated method for high-throughput protein purification applied to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnol 3:12. https://doi.org/10.1186/1472-6750-3-12 She G, Yu S, Li Z, Peng A, Li P, Li Y, Chang M, Liu L, Chen Q, Shi C, Sun J, Zhao J, Wan X (2022) Characterization of CsTSI in the Biosynthesis of Theanine in Tea Plants ( Camellia sinensis ). J Agric Food Chem 70:826–836. https://doi.org/10.1021/acs.jafc.1c04816 Soni N, Hegde N, Dhariwal A, Kushalappa AC (2020) Role of laccase gene in wheat NILs differing at QTL-Fhb1 for resistance against Fusarium head blight. Plant Sci 298:110574. https://doi.org/10.1016/j.plantsci.2020.110574 Sun M (2020) Study on the preparation and purification of antioxidant peptides from whey protein and its in vitro antioxidant activities. https://doi.org/10.27345/d.cnki.gsnyu.2019.000365 . Sichuan Agricultural University Tang Y, Lu L, Sheng Z, Zhao D, Tao J (2023) An R2R3-MYB network modulates stem strength by regulating lignin biosynthesis and secondary cell wall thickening in herbaceous peony. Plant J 113:1237–1258. https://doi.org/10.1111/tpj.16107 Tyagi S, Shah A, Karthik K, Rathinam M, Rai V, Chaudhary N, Sreevathsa R (2022) Reactive oxygen species in plants: an invincible fulcrum for biotic stress mitigation. Appl Microbiol Biotechnol 106:5945–5955. https://doi.org/10.1007/s00253-022-12138-z Umar A, Ahmed S (2022) Optimization, purification and characterization of laccase from Ganoderma leucocontextum along with its phylogenetic relationship. Sci Rep 12:2416. https://doi.org/10.1038/s41598-022-06111-z Vanholme R, Demedts B, Morreel K, Ralph J, Boerjan W (2010) Lignin biosynthesis and structure. Plant Physiol 153:895–905. https://doi.org/10.1104/pp.110.155119 Wei C, Yang H, Wang S, Zhao J, Liu C, Gao L, Xia E, Lu Y, Tai Y, She G, Sun J, Cao H, Tong W, Gao Q, Li Y, Deng W, Jiang X, Wang W, Chen Q, Zhang S, Li H, Wu J, Wang P, Li P, Shi C, Zheng F, Jian J, Huang B, Shan D, Shi M, Fang C, Yue Y, Li F, Li D, Wei S, Han B, Jiang C, Yin Y, Xia T, Zhang Z, Bennetzen JL, Zhao S, Wan X (2018) Draft genome sequence of Camellia sinensis var. sinensis provides insights into the evolution of the tea genome and tea quality. Proc Natl Acad Sci USA 115:E4151–E4158. https://doi.org/10.1073/pnas.1719622115 Xia EH, Zhang HB, Sheng J, Li K, Zhang QJ, Kim C, Zhang Y, Liu Y, Zhu T, Li W, Huang H, Tong Y, Nan H, Shi C, Shi C, Jiang JJ, Mao SY, Jiao JY, Zhang D, Zhao Y, Zhao YJ, Zhang LP, Liu YL, Liu BY, Yu Y, Shao SF, Ni DJ, Eichler EE, Gao LZ (2017) The Tea Tree Genome Provides Insights into Tea Flavor and Independent Evolution of Caffeine Biosynthesis. Mol Plant 10:866–877. https://doi.org/10.1016/j.molp.2017.04.002 Xu Q, Yang Y, Hu K, Chen J, Djomo SN, Yang X, Knudsen MT (2021) Economic, environmental, and emergy analysis of China's green tea production. Sustain Prod Consum 28:269–280. https://doi.org/10.1016/j.spc.2021.04.019 Xu X, Zhang Y, Liang M, Kong W, Liu J (2022) The Citrus Laccase Gene CsLAC18 Contributes to Cold Tolerance. Int J Mol Sci 23:14509. https://doi.org/10.3390/ijms232314509 Yamada K, Sonoda R, Ishikawa K (2016) Population Genetic Structure of QoI-Resistant Pestalotiopsis longiseta Isolates Causing Tea Gray Blight. Plant Dis 100:1686–1691. https://doi.org/10.1094/PDIS-09-15-1114-RE Yang H, Jia X, Gao T, Gong S, Xia L, Zhang P, Qi Y, Liu S, Yu Y, Wang W (2024) The CsmiR397a - CsLAC17 module regulates lignin biosynthesis to balance the tenderness and gray blight resistance in young tea shoots. Hortic Res 11:uhae085. https://doi.org/10.1093/hr/uhae085 Yang Q, He Y, Kabahuma M, Chaya T, Kelly A, Borrego E, Bian Y, El Kasmi F, Yang L, Teixeira P, Kolkman J, Nelson R, Kolomiets M, Dangl JL, Wisser R, Caplan J, Li X, Lauter N, Balint-Kurti P (2017) A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens. Nat Genet 49:1364–1372. https://doi.org/10.1038/ng.3919 Yoshida H (1883) Chemistry of Lacquer (Urushi). Part I. J Chem Soc 43:472–486. https://doi.org/10.1039/ct8834300472 Yu Y, Xing Y, Liu F, Zhang X, Li X, Zhang J, Sun X (2021) The Laccase Gene Family Mediate Multi-Perspective Trade-Offs during Tea Plant ( Camellia sinensis ) Development and Defense Processes. Int J Mol Sci 22:12554. https://doi.org/10.3390/ijms222212554 Zhang SN, Shi LJ, Liao ZY, Wang Z, Wang SF (2021) High expression in pichia pastoris and modification of codon-optimization egg white lysozyme. J Zhejiang Univ (Sci Ed) 47:476–483 Zhang Y, Wu L, Wang X, Chen B, Zhao J, Cui J, Li Z, Yang J, Wu L, Wu J, Zhang G, Ma Z (2019) The cotton laccase gene GhLAC15 enhances Verticillium wilt resistance via an increase in defence-induced lignification and lignin components in the cell walls of plants. Mol Plant Pathol 20:309–322. https://doi.org/10.1111/mpp.12755 Zhao Q, Dixon RA (2011) Transcriptional networks for lignin biosynthesis: more complex than we thought? Trends Plant Sci 16:227–233. https://doi.org/10.1016/j.tplants.2010.12.005 Zhao Q, Nakashima J, Chen F, Yin Y, Fu C, Yun J, Shao H, Wang X, Wang ZY, Dixon RA (2013) Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis . Plant Cell 25:3976–3987. https://doi.org/10.1105/tpc.113.117770 Zhao Y, Liu Y, Dong X, Liu JJ, Zhao DG (2022) Identification of a novel laccase gene EuLAC1 and its potential resistance against Botrytis cinerea . Transgenic Res 31:215–225. https://doi.org/10.1007/s11248-022-00297-8 Additional Declarations No competing interests reported. Supplementary Files 1Supplementarymaterial.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 16 May, 2026 Reviewers agreed at journal 05 May, 2026 Reviewers agreed at journal 29 Apr, 2026 Reviews received at journal 13 Apr, 2026 Reviewers agreed at journal 13 Apr, 2026 Reviewers invited by journal 23 Mar, 2026 Editor assigned by journal 17 Mar, 2026 Submission checks completed at journal 17 Mar, 2026 First submitted to journal 14 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9122877","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":610768483,"identity":"4d28f550-0b60-40cb-b3f0-bdd4a427b38d","order_by":0,"name":"YuFeng Hu","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"prefix":"","firstName":"YuFeng","middleName":"","lastName":"Hu","suffix":""},{"id":610768484,"identity":"1d9dde4a-e2bf-4d71-9955-b112b232e044","order_by":1,"name":"Yichen Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxElEQVRIiWNgGAWjYHACNiC2gTB5SNCSRrqWwyRoMTh+/NmDHxXn7ebPSGB88LaNQd6coJYzCemGPWduJzfOSGA2nNvGYLizgZCWGwzHJHjbbiczSySwSfO2MSQYHCCohbFN8m/buWQ2iQT230RqYQYZfsCOB2gLM1FaJM+ksUnLnElOkOB52Cw555yE4QZCWviAISb5psLOXr49+eCHN2U28gRtUYAqSGxgYGwA0hIE1AOBfAOEtiesdBSMglEwCkYsAAAaEDy6E5JzGwAAAABJRU5ErkJggg==","orcid":"","institution":"Guizhou University","correspondingAuthor":true,"prefix":"","firstName":"Yichen","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2026-03-14 13:25:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9122877/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9122877/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105381942,"identity":"59a8bab5-91dc-4841-8002-8485b1ca0f3d","added_by":"auto","created_at":"2026-03-25 11:29:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":770492,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of silencing \u003cem\u003eCsLAC17\u003c/em\u003e on tea plant susceptibility to \u003cem\u003eGlomerella cingulata\u003c/em\u003e. (\u003cstrong\u003ea\u003c/strong\u003e) Phenotype of \u003cem\u003eCsLAC17\u003c/em\u003e-silenced tea plants. TRV:\u003cem\u003eCsPDS\u003c/em\u003e(Positive Control), WT (wild-type), TRV:EV (Negative Control), TRV:\u003cem\u003eCsLAC17. \u003c/em\u003e(b) Disease symptoms on WT, EV, and \u003cem\u003eCsLAC17\u003c/em\u003e-silenced tea plants at 7 dpi with \u003cem\u003eGlomerella cingulata\u003c/em\u003e. (c)Verification of \u003cem\u003eCsLAC17\u003c/em\u003e gene silencing efficiency by qRT-PCR. (d) Measurement of protective enzyme (SOD, POD, CAT) activities and MDA content in silenced, WT, and control plants. Note: Different lowercase letters represent significant differences (\u003cem\u003eP\u003c/em\u003e<0.05)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/792110f8ae9d442ceef849c2.png"},{"id":105381947,"identity":"a576abeb-5e33-4eb3-8219-8468a1025c4c","added_by":"auto","created_at":"2026-03-25 11:29:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2069845,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eCsLAC17\u003c/em\u003e overexpression confers enhanced resistance to gray mold in transgenic tobacco. (a) Measurement of laccase activity in transgenic tobacco. (b) Disease symptoms on WT, CK, and TP plants at 1, 3, 5, and 7 dpi with \u003cem\u003eBotrytis cinerea\u003c/em\u003e. (c) Lesion diameter on tobacco leaves at 7 dpi with \u003cem\u003eBotrytis cinerea\u003c/em\u003e. (d) qRT-PCR analysis of key genes in the lignin biosynthesis pathway. (e) Enzymatic activities of SOD, POD, and CAT, along with MDA content. (f) Lignin contents in leaves of wild-type and transgenic tobacco plants. Note: Different lowercase letters represent significant differences (\u003cem\u003eP\u003c/em\u003e<0.05)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/7d16ec66853800e2e696d0f6.png"},{"id":105565387,"identity":"df5cdb16-3a20-4994-a99c-3e3c31ff5fe3","added_by":"auto","created_at":"2026-03-27 12:53:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":137477,"visible":true,"origin":"","legend":"\u003cp\u003eExpression and identification of \u003cem\u003eCsLAC17\u003c/em\u003e laccase protein. Note: M: Protein marker; 1: Purified protein bands\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/f0d8d9d4d372b5a39dbf8118.png"},{"id":105381944,"identity":"af08e6f5-0b6f-4ce7-8d8b-5d4f32c9c68d","added_by":"auto","created_at":"2026-03-25 11:29:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":355754,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of induction time (\u003cstrong\u003ea\u003c/strong\u003e), fermentation temperature (\u003cstrong\u003eb\u003c/strong\u003e), initial PH (\u003cstrong\u003ec\u003c/strong\u003e), and methanol addition (\u003cstrong\u003ed\u003c/strong\u003e) on the growth and enzyme production of \u003cem\u003epichia pastoris\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase letters represent significant differences (\u003cem\u003eP\u003c/em\u003e<0.05)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/539d77af9df6b2a88b321b94.png"},{"id":105565980,"identity":"95d310a4-99a1-42bf-9fe9-6ca415855b33","added_by":"auto","created_at":"2026-03-27 12:54:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":286198,"visible":true,"origin":"","legend":"\u003cp\u003eResults of expanded culture of\u0026nbsp; \u003cem\u003eCsLAC17\u003c/em\u003e laccase produced by yeast engineering bacteria. (\u003cstrong\u003ea\u003c/strong\u003e) Effect of metal ions on the activity of tea plant laccase. (\u003cstrong\u003eb\u003c/strong\u003e) Study on antifungal effect of laccase by filter paper method Note: 1: 1 mg/ml fluconazole; 2: 0.01M CuSO\u003csub\u003e4\u003c/sub\u003e 10 mg/mL laccase; 3: 0.01M CuSO\u003csub\u003e4\u003c/sub\u003e; 4: 10mg/mL laccase; Bar: 1 cm\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/a6d98e3972b41973a58df5ea.png"},{"id":105570074,"identity":"56cf307b-b71f-42ba-bafd-9c36ddf89ccb","added_by":"auto","created_at":"2026-03-27 13:14:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5419643,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/0a30b3c3-2af0-4d2f-8b27-ca82e6eb910e.pdf"},{"id":105381945,"identity":"84294336-48b7-4779-aa1d-3507b7396ce4","added_by":"auto","created_at":"2026-03-25 11:29:09","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":836629,"visible":true,"origin":"","legend":"","description":"","filename":"1Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-9122877/v1/c82370fa30cb6c7b7faa0d8f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"A dual-functional laccase gene CsLAC17 from tea plant: Insights from VIGS and heterologous expression into lignin-mediated resistance and direct antifungal activity","fulltext":[{"header":"Key message","content":"\u003cp\u003eThis study first expresses CsLAC17 protein, functionally characterizing its dual role in enhancing disease resistance via lignin biosynthesis and direct antifungal activity, offering a target for breeding and green fungicides.\u003c/p\u003e"},{"header":"1 Introduction","content":"\u003cp\u003eThe tea plant (\u003cem\u003eCamellia sinensis\u003c/em\u003e (L.) O. Kuntze) is an evergreen woody species of the genus Camellia in the family Theaceae, native to Southwest China (Xia et al. 2017; Lu et al. 2021; Fang et al. 2021). Its young shoots and leaves are the primary raw materials for tea, the world\u0026rsquo;s most widely consumed non-alcoholic beverage (Wei et al. 2018; She et al. 2022). Consequently, the tea industry serves as a vital economic pillar for numerous producing nations and holds multifaceted significance in economic, medicinal, and cultural spheres (Xu et al. 2021; Pan et al. 2022). For numerous tea-producing countries, holding profound importance in economic, pharmaceutical, and cultural spheres. However, sustainable tea production is severely threatened by fungal and bacterial pathogens that cause devastating diseases such as tea anthracnose (\u003cem\u003eColletotrichum\u003c/em\u003e spp.), blister blight (\u003cem\u003eExobasidium vexans\u003c/em\u003e), and brown blight (\u003cem\u003ePestalotiopsis\u003c/em\u003e spp.). These diseases lead to drastic reductions in both yield and quality, resulting in substantial economic losses (Chen et al. 2025; Pandey et al. 2021; Samynathan et al. 2021). Currently, chemical fungicides are predominantly used in tea plantations to control tea plant diseases. This practice increases resistance and fungicides residues, leading to environmental pollution and compromising the safety of tea products (Yamada et al. 2016; Borah et al. 2022). Therefore, elucidating the mechanisms of disease resistance in tea plants and developing novel, eco-friendly control agents represent critical priorities for the sustainable advancement of the tea industry.\u003c/p\u003e \u003cp\u003eLaccases, the largest subfamily of multicopper oxidases (MCOs), are widely distributed in plants, fungi, bacteria, and insects (Yu et al. 2021). Laccases possess three conserved catalytic domains (Cu-oxidase, Cu-oxidase_2, and Cu-oxidase_3) that bind four copper ions and exhibit broad substrate specificity (Arregui et al. 2019; Giardina et al. 2010). In nature, laccases play pivotal roles in organic matter cycling and ecosystem balance by mediating wood degradation, pigment formation, and antioxidant processes (Mayer and Staples 2002; Baldrian 2006). Their robust oxidative capacity also confers significant industrial application value, particularly in the textile, paper industry, and food processing sectors, where they are utilized for pollutant degradation, pulp bleaching, decolorization of dye wastewater, and product quality enhancement (Khatami et al. 2022; Bhardwaj et al. 2022). Plant laccases are localized in the cell walls of various higher plants. They were first identified in 1883 from the exudates of the Japanese lacquer tree \u003cem\u003eRhus vernicifera\u003c/em\u003e, and their presence in fungi was confirmed shortly thereafter (Yoshida 1883; Bertrand 1896). Laccases have been extensively reported to participate in lignin biosynthesis and enhance plant defense against stress, playing indispensable roles in plant growth and development. For instance, \u003cem\u003eAtLAC4\u003c/em\u003e and \u003cem\u003eAtLAC17\u003c/em\u003e are involved in the constitutive lignification of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e stems. Simultaneous disruption of \u003cem\u003eAtLAC4\u003c/em\u003e, \u003cem\u003eAtLAC11\u003c/em\u003e, and \u003cem\u003eAtLAC17\u003c/em\u003e almost completely abolished lignin deposition, resulting in severe growth stagnation, reduced root diameter, indehiscent anthers, and impaired lignified vascular development (Berthet et al. 2011; Zhao et al. 2013). In \u003cem\u003eGossypium hirsutum\u003c/em\u003e, overexpression of \u003cem\u003eGhLAC1\u003c/em\u003e and \u003cem\u003eGhLAC15\u003c/em\u003e increased lignin accumulation, thereby enhancing cotton's resistance to the fungal pathogen \u003cem\u003eVerticillium dahliae\u003c/em\u003e (Hu et al. 2018; Zhang et al. 2019). Overexpression of \u003cem\u003ePhyllostachys edulis PeLAC10\u003c/em\u003e in \u003cem\u003eArabidopsis\u003c/em\u003e elevated lignin content in transgenic plants, improving their drought tolerance and resistance to phenolic acids (Li et al. 2020b). Silencing of wheat \u003cem\u003eTaLAC4\u003c/em\u003e using VIGS increased susceptibility to \u003cem\u003eFusarium graminearum\u003c/em\u003e and reduced total lignin deposition, suggesting a potential role for \u003cem\u003eTaLAC4\u003c/em\u003e in defense-induced guaiacyl (G) lignin synthesis (Soni et al. 2020). Furthermore, \u003cem\u003ePlLAC4\u003c/em\u003e participates in lignin biosynthesis in \u003cem\u003ePaeonia lactiflora\u003c/em\u003e, promoting dry lignin accumulation and secondary cell wall thickening (Tang et al. 2023). Transformation of tobacco with \u003cem\u003eEuLAC1\u003c/em\u003e from \u003cem\u003eEucommia ulmoides\u003c/em\u003e resulted in transgenic plants with higher lignin content and enhanced resistance to \u003cem\u003eB. cinerea\u003c/em\u003e (Zhao et al. 2022). Collectively, these studies demonstrate that laccases play critical roles in plant growth, development, and stress responses primarily through the regulation of lignin biosynthesis.\u003c/p\u003e \u003cp\u003eLaccase-mediated lignification is a crucial defense strategy for broad-spectrum disease resistance in plants. However, in the economically important crop tea plant, the disease resistance functions of the laccase gene family remain to be systematically elucidated. Previous studies have shown that the overexpression of \u003cem\u003eCsLAC17\u003c/em\u003e significantly increases lignin content and enhances resistance to gray blight in transgenic \u003cem\u003eArabidopsis\u003c/em\u003e (Yang et al. 2024). Additionally, the laccase gene \u003cem\u003eCsLAC37\u003c/em\u003e has been implicated in the tea plant\u0026rsquo;s response to fungal infection (Li et al. 2024). These findings suggest that laccase genes play crucial roles in tea plant disease resistance. Nevertheless, systematic studies on the protein expression and functional mechanisms of plant laccase proteins remain scarce. In this study, we focused on \u003cem\u003eCsLAC17\u003c/em\u003e, obtaining its purified protein through gene cloning and in vitro heterologous expression to explore the protein's resistance to anthracnose in tea plant. Furthermore, we systematically validated the biological function of \u003cem\u003eCsLAC17\u003c/em\u003e through heterologous expression in tobacco and gene silencing techniques in tea plant. These findings will contribute to a deeper understanding of the role of CsLAC17 protein in tea plant disease resistance, providing a scientific basis for developing laccase-based green pesticides, and ultimately promote the coordinated development of disease resistance and quality in tea plant.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental materials\u003c/h2\u003e \u003cp\u003eThe materials used in this experiment include two-year-old \"Fudingdabai\" tea plant cultivated at the College of Tea Science of Guizhou University. Additional experimental materials consist of \u003cem\u003eNicotiana benthamiana\u003c/em\u003e, \u003cem\u003ePichia pastoris\u003c/em\u003e strain GS115, \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain GV3101, \u003cem\u003eEscherichia coli\u003c/em\u003e strain \u003cem\u003eDH5α\u003c/em\u003e, viral vectors pTRV1 and pTRV2, as well as the plant expression vector pCAMBIA1300-35S-GUS, all provided by the Biotechnology Laboratory of Guizhou University. The pathogens utilized in this experiment include \u003cem\u003eB. cinerea\u003c/em\u003e, a gray mold fungus from the genus \u003cem\u003eBotrytis\u003c/em\u003e, and \u003cem\u003eGlomerella cingulata\u003c/em\u003e, which is the causative agent of anthracnose.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Gene cloning\u003c/h2\u003e \u003cp\u003ePrimers were designed based on the reference sequence of laccase gene from the tea plant transcriptome database. Using tea plant cDNA as a template, amplification was performed with Platinum\u0026reg; Taq DNA High Fidelity Polymerase (Invitrogen). The amplification primers were: Forward Primer (F): ATGGCTACTTATGTTCTTCTCT and Reverse Primer (R): ACATTTCGGAAGATCAGACG. The reaction system consisted of 25.0 \u0026micro;L 2\u0026times; High Fidelity PCR Buffer, 1.0 \u0026micro;L dNTP mix (10 mM), 2.0 \u0026micro;L 50 mM MgSO\u003csub\u003e4\u003c/sub\u003e, 1.5 \u0026micro;L forward and reverse primers (10 \u0026micro;M), 5.0 \u0026micro;L cDNA, 1.0 \u0026micro;L Platinum\u0026reg; Taq High Fidelity (1 U/\u0026micro;L), and 13.0 \u0026micro;L PCR-grade water. The reaction program was as follows: pre-denaturation at 95 ℃ for 2 min, denaturation at 95 ℃ for 25 s, annealing at 55 ℃ for 25 s, extension at 68 ℃ for 90 s, for a total of 35 cycles, and finally extension at 68 ℃ for 5 min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 VIGS vector construction and tea plant infection\u003c/h2\u003e \u003cp\u003eThis study employed Tobacco rattle virus (TRV) as a vector for Virus-Induced Gene Silencing (VIGS) to create a silencing vector targeting the \u003cem\u003eCsLAC17\u003c/em\u003e gene in tea plant. A 300 bp segment of \u003cem\u003eCsLAC17\u003c/em\u003e gene was chosen as the target sequence, and specific primers with homologous arms were designed for amplification using high-fidelity polymerase PCR. Concurrently, the pTRV2 empty vector underwent double digestion with \u003cem\u003eEcoR\u003c/em\u003e I and \u003cem\u003eXho\u003c/em\u003e I. The purified PCR product was ligated to the linearized pTRV2 vector, which was then transformed into competent \u003cem\u003eEscherichia coli\u003c/em\u003e cells. Following plasmid extraction and PCR verification, the recombinant plasmid was introduced into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain GV3101 through electroporation. After colony PCR confirmation, the transformed bacteria were stored at -80\u0026deg;C for further use.The VIGS experiment was conducted according to the method described by Li et al. (2022).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 \u003cem\u003eNicotiana benthamiana\u003c/em\u003e plant transformation and identification\u003c/h2\u003e \u003cp\u003eDesign primers with homologous arms to clone laccase gene and perform double digestion with \u003cem\u003eSac\u003c/em\u003e I and \u003cem\u003eXba\u003c/em\u003e I on the pCAMBIA1300-35S-GUS vector. The digested laccase gene was ligated with the vector, and the recombinant vector, along with empty vector (EV), was transferred into \u003cem\u003eAgrobacterium\u003c/em\u003e GV3101 using the freeze-thaw method. Colony PCR was then executed to verify positive clones. Co-cultivate the leaf discs with the \u003cem\u003eAgrobacterium\u003c/em\u003e infection solution to generate transgenic tobacco explants. Further selection of resistant tobacco leaves was achieved through GUS histochemical staining. qRT-PCR was used to screen for transgenic lines with the highest expression levels of \u003cem\u003eCsLAC17\u003c/em\u003e, and tissue culture propagation of tobacco leaf segments was conducted to obtain plants with the same genetic background, ensuring the accuracy of subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 qRT-PCR analysis\u003c/h2\u003e \u003cp\u003eLeaves from the transgenic tobacco lines TP1 to TP11 were collected. To ensure sample quality and the accuracy of subsequent experiments, the leaf samples were rapidly frozen in liquid nitrogen and stored in a\u0026thinsp;\u0026minus;\u0026thinsp;80 ℃ freezer. Total RNA was extracted and reverse transcribed into cDNA. According to the manufacturer's instructions, qRT-PCR was performed using the SYBR\u0026reg; Select Master Mix kit (Applied Biosystems Inc., Foster, CA, USA). The β-actin gene was used as the reference gene, and each sample included three biological replicates and three technical replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Enzyme Activity Detection\u003c/h2\u003e \u003cp\u003eInfected tea plant and tobacco leaves were used to detect the activities of peroxidase (POD), catalase (CAT), superoxide dismutase (SOD), and malondialdehyde (MDA). The POD assay kit (BC0090), CAT assay kit (BC0200), SOD assay kit (BC5165), and MDA assay kit (BC0020) were used for the assays, following the manufacturer\u0026rsquo;s instructions (Beijing Solarbio Science \u0026amp; Technology Co., Ltd). In brief, 0.1 g sample was weighed and placed on ice, followed by the addition of 1 ml of extraction buffer for homogenization on ice. The mixture was then centrifuged at 8000 g for 10 min at 4\u0026deg;C, and the supernatant was collected for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Pathogen Inoculation and Treatment\u003c/h2\u003e \u003cp\u003eThe preserved strains were inoculated onto PDA solid medium and incubated in the darkness at 28\u0026deg;C for 5\u0026ndash;7 d. Appropriate leaves were selected, and their surfaces were disinfected with 75% ethanol and sterile distilled water. 5 mm thick colonies were then obtained from the edge of the fungal growth area and inoculated onto scratched leaf surface with the mycelium facing downward. Sterile PDA medium blocks and non-inoculated pathogens were used as control. Inoculated leaves were enclosed with plastic wrap and placed in a constant temperature incubator at 26\u0026deg;C for subsequent assessment of disease development at different leaf positions. The size of the leaf lesions was measured using Image J 1.53t software, with three biological replicates established for each treatment and at least 10 leaves inoculated per replicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Codon optimization\u003c/h2\u003e \u003cp\u003eDNA 2.0 software was used to optimize the codon of the tea plant \u003cem\u003eCsLAC17\u003c/em\u003e gene based on the \u003cem\u003ePichia pastoris\u003c/em\u003e codon usage preference table (Zhang et al. 2021). The optimized gene sequence was synthesized by GenScript Biology Company.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Vector construction and preparation of yeast engineering bacteria\u003c/h2\u003e \u003cp\u003eRestriction endonuclease sites \u003cem\u003eEcoR\u003c/em\u003e I and \u003cem\u003eNot\u003c/em\u003e I with protective bases were added to both ends of the tea plant \u003cem\u003eCsLAC17\u003c/em\u003e gene sequence, and the signal peptide encoding the first 33 amino acids at the N-terminus was removed. The vector pPIC9K and the gene were double-digested, and T4 DNA ligase was used for ligation. The resulting products were transformed into \u003cem\u003eEscherichia coli\u003c/em\u003e. For detailed methodologies, refer to Liu et al. (2021b). Following the method of Pei et al. (2018), the constructed vector was digested with \u003cem\u003eSac\u003c/em\u003e I single enzyme, and the linear plasmid was transferred into competent yeast GS115 cells via electroporation. Single colonies grown on MD plate were subsequently inoculated onto MM plate and incubated at 30 ℃ for three days. Colonies that grow normally on MD plate but poor or no growth on MM plate are Muts type, while the remaining are Mut\u003csup\u003e+\u003c/sup\u003e type. After screening for Mut\u003csup\u003e+\u003c/sup\u003e recombinant \u003cem\u003ePichia pastoris\u003c/em\u003e, genomic DNA was extracted for PCR verification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Induced expression of recombinant \u003cem\u003ePichia pastoris\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eTen positive clones were selected and inoculated in 10 mL YPD medium, and cultured at 28.5 ℃ with shaking at 220 rpm until reaching the logarithmic growth phase to prepare seed solution. A portion of 200 \u0026micro;L liquid was inoculated into 200 mL of BMGY medium, and continued to be cultured at the same condition until OD600\u0026thinsp;=\u0026thinsp;5. After centrifugation, the obtained cells were resuspended in 200 mL of BMMY medium and induced at 220 rpm and 28.5 ℃ in the presence of 1% methanol for 70 h. Protein expression was analyzed using the SDS-PAGE method, with results recorded by a Bio-Rad gel electrophoresis imager.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Fermentation condition optimization\u003c/h2\u003e \u003cp\u003eAn appropriate volume of seed solution was inoculated into 100 mL of BMGY medium in a shake flask and incubated at 30 ℃ with shaking at 250 rpm for 20 h. After centrifugation, the cells were transferred to 100 mL of BMMY medium, adjusting the initial OD600\u0026thinsp;=\u0026thinsp;1. To induce laccase gene expression, Cu\u003csup\u003e2+\u003c/sup\u003e was added to achieve a final concentration of 0.5 mM, and methanol was added every 24 h to a final concentration of 1%. The culture was maintained at 250 rpm. To optimize fermentation conditions, various factors were considered, including induction time (0 h, 24 h, 48 h, 72 h, 96 h, 120 h, 144 h), initial induction pH (2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6), induction temperature (20 ℃, 28 ℃, 30 ℃), and methanol concentration (0.25%, 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Isolation and purification of CsLAC17 Protein\u003c/h2\u003e \u003cp\u003eTo preserve protein activity, the protein was concentrated via ammonium sulfate precipitation. The target protein was precipitated by slowly adding ammonium sulfate solution to the supernatant to achieve 65% saturation. The mixture was sealed and incubated at 4 ℃ overnight for complete precipitation. The precipitate was then collected by centrifugation at 10,000 rpm for 10 min at 4 ℃ and redissolved in ddH₂O. To remove excess salt ions that could interfere with subsequent purification, the solution was dialyzed using a dialysis bag with a molecular weight cutoff of 3000 Mw, following the protocol described by Scheich et al. (2003). As the expression vector contained a histidine tag, the recombinant protein was further purified using a nickel-affinity column according to the method outlined by Sun (2020).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Laccase Enzyme Assay\u003c/h2\u003e \u003cp\u003eLaccase activity was determined using ABTS as the substrate. The reaction mixture contained 100 mM sodium acetate buffer (pH 4.0) and 0.5 mM ABTS. The reaction was initiated by adding 100 \u0026micro;L of appropriately diluted enzyme solution to 900 \u0026micro;L of the reaction mixture. The increase in absorbance at 420 nm was recorded every 30 s for 3 min using a spectrophotometer. One unit (U) of enzyme activity was defined as the amount of enzyme required to oxidize 1 \u0026micro;mol of ABTS per minute. The molar extinction coefficient of ABTS at 420 nm was taken as 36,000 M⁻\u0026sup1; cm⁻\u0026sup1;. All assays were performed in triplicate.\u003c/p\u003e \u003cp\u003eTo evaluate the effect of metal ions on laccase activity, buffers containing different metal ions (Mg\u003csup\u003e2+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, Fe\u003csup\u003e2+\u003c/sup\u003e, Cu\u003csup\u003e2+\u003c/sup\u003e, Zn\u003csup\u003e2+\u003c/sup\u003e, Fe\u003csup\u003e3+\u003c/sup\u003e) at a concentration of 10 mmol/L were prepared. The tea plant laccase solution, prepared in citric acid buffer, was mixed with the respective metal ion buffers and incubated in a water bath at 40 ℃ for 30 min. A control group without the addition of any metal ions was included. All experiments were performed in triplicate. The enzyme activity of the control group was defined as 100%, and the activity of the experimental groups was expressed as a percentage relative to the control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll experiments were performed with at least three independent biological replicates. The value of each physiological index was expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (\u0026plusmn;\u0026thinsp;SE). All data were verified by the Shapiro-Wilk test and the Levene test confirmed homogeneity of variance. Data that match normality and homogeneity of variance were compared between groups using one-way ANOVA (assuming test significance level α\u0026thinsp;=\u0026thinsp;0.05) and were supplemented with the Tukey HSD test for post hoc multiple comparison corrections.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003e3.1 Silencing of \u003cem\u003eCsLAC17\u003c/em\u003e compromises tea plant resistance to anthracnose\u003c/h2\u003e\n \u003cp\u003eIn this study, we cloned the laccase gene \u003cem\u003eCsLAC17\u003c/em\u003e from the cDNA of tea plants, with a complete coding sequence (CDS) of 1758 bp, encoding 585 amino acids (Fig. S1). We employed Virus-Induced Gene Silencing (VIGS) to explore the role of laccase gene \u003cem\u003eCsLAC17\u003c/em\u003e in tea plant defense against anthracnose. The pTRV2-\u003cem\u003eCsLAC17\u003c/em\u003e vector was constructed using a specific fragment from a conserved region of the gene (Fig. S2). The VIGS system was first validated by the typical albino phenotype on new leaves (Fig. 1a), and the successful silencing of \u003cem\u003eCsLAC17\u003c/em\u003e was confirmed by qRT-PCR, which showed a significant reduction in its transcript levels compared to empty vector controls (Fig. 1b). Pathogenicity assays demonstrated that \u003cem\u003eCsLAC17\u003c/em\u003e-silenced plants were more susceptible to the pathogen, exhibiting significantly larger lesions than controls (Fig. 1c). To investigate the underlying physiological mechanism, we measured the activities of key protective enzymes. We found that the activities of SOD, POD, and CAT were significantly decreased, whereas MDA content, a marker of membrane damage, was significantly elevated in silenced plants (Fig. 1d). These findings indicate that \u003cem\u003eCsLAC17\u003c/em\u003e silencing weakens the plant’s reactive oxygen species (ROS) scavenging ability, thereby exacerbating pathogen-induced oxidative damage and ultimately compromising disease resistance.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\"\u003e\n \u003ch2\u003e3.2 CsLAC17 overexpression boosts tobacco resistance to \u003cem\u003eB. cinerea\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eTo investigate the functional role of \u003cem\u003eCsLAC17\u003c/em\u003e in plant defense, we generated transgenic tobacco lines. Transgene integration was preliminarily confirmed by GUS staining (Fig. S3a), and the line with the highest expression level, designated tp-6, was identified by qPCR and propagated for subsequent analyses (Fig. S3b). Consistent with its elevated transcript level, the tp-6 line exhibited significantly higher laccase activity compared to wild-type (WT) and empty vector control (CK) plants, confirming the successful expression of functional CsLAC17 protein (Fig. 2a). We then evaluated the resistance of these plants to \u003cem\u003eB. cinerea\u003c/em\u003e. Following inoculation, WT and CK plants developed typical water-soaked lesions that expanded rapidly over 1, 3, 5, and 7 dpi (Fig. 2b). In contrast, the TP displayed markedly milder disease symptoms and smaller lesion diameters at 7 dpi compared to controls (Fig. 2c). To elucidate the underlying mechanisms, we examined two key defense pathways. qPCR analysis showed that the transcript levels of key genes in the lignin biosynthesis pathway were significantly upregulated in TP plants compared to WT and CK (Fig. 2d). This finding corresponded with higher lignin content (Fig. 2f), suggesting that \u003cem\u003eCsLAC17\u003c/em\u003e may reinforce the cell wall by promoting lignin deposition. Simultaneously, the activities of protective enzymes (SOD, POD, CAT) were significantly elevated, while MDA content was notably reduced (Fig. 2e). This suggests that transgenic plants may suffer less membrane damage and lipid peroxidation induced by pathogens compared to control group. Collectively, these findings demonstrate that overexpressing \u003cem\u003eCsLAC17\u003c/em\u003e in tobacco confers enhanced resistance to \u003cem\u003eB. cinerea\u003c/em\u003e through a dual mechanism: strengthening the physical barrier via lignin biosynthesis and enhancing biochemical defenses through the antioxidant system.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\"\u003e\n \u003ch2\u003e3.3 Codon optimization of \u003cem\u003eCsLAC17\u003c/em\u003e gene\u003c/h2\u003e\n \u003cp\u003eTo accommodate the codon usage preferences of \u003cem\u003ePichia pastoris\u003c/em\u003e, we optimized the nucleotide sequence of the gene while maintaining the amino acid sequence unchanged. The specific optimization sites are indicated in the red regions of Fig. S4a, where an \u003cem\u003eEcoR\u003c/em\u003e I restriction site was introduced at the N-terminus and a \u003cem\u003eNot\u003c/em\u003e I restriction site was introduced at the C-terminus. The optimized sequence was synthesized by GenScript Biology Company. Subsequently, we constructed a recombinant plasmid of the target gene using the pPIC9K vector and transformed it into \u003cem\u003eEscherichia coli\u003c/em\u003e. The successful construction of the recombinant vector was confirmed through double digestion analysis (Fig. S4b).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\"\u003e\n \u003ch2\u003e3.4 Induced expression of yeast\u003c/h2\u003e\n \u003cp\u003eThe target protein was expressed using \u003cem\u003ePichia pastoris\u003c/em\u003e. The recombinant plasmid containing the target gene was successfully introduced into \u003cem\u003ePichia pastoris\u003c/em\u003e GS115 receptor cells, yielding a distinct PCR band of 1500–2000 bp, which confirmed the presence of multiple Mut\u003csup\u003e+\u003c/sup\u003e positive clones (Fig. S5). Following this, the engineered yeast cells were induced for protein expression, and the crude enzyme produced during fermentation was concentrated and dialyzed, followed by protein separation and purification using Ni-NTA. The purified protein was then analyzed by SDS-PAGE, which revealed a single band, indicating effective protein expression and confirming the successful preparation of the engineered yeast strain (Fig. 3). Moreover, the molecular weight of the expressed target protein was between 53–73 kDa, with an approximate value of 61 kDa, which aligns with the predicted molecular weight of 61 kDa.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\"\u003e\n \u003ch2\u003e3.5 Optimization of fermentation conditions of recombinant \u003cem\u003ePichia pastoris\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eWe determined the optimal conditions for expressing laccase in \u003cem\u003ePichia pastoris\u003c/em\u003e by optimizing induction time, initial pH, induction temperature, and methanol usage, while considering both the OD600-based growth profile and the enzyme activity (Fig. 4). Through systematic optimization of fermentation parameters, the optimal conditions for inducing laccase expression in \u003cem\u003ePichia pastoris\u003c/em\u003e were as follows: induction time of 96 h, initial pH of 4.5, induction temperature of 20°C, and methanol addition of 1.0%. The activity of the laccase expressed in \u003cem\u003ePichia pastoris\u003c/em\u003e under optimized conditions was determined by the ABTS assay. The enzyme showed a maximum activity of 2.58 U/mL, confirming the functionality of the purified protein .\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e3.6 Effect of metal ions on\u003c/strong\u003e \u003cstrong\u003eCsLAC17\u003c/strong\u003e \u003cstrong\u003eactivity and the antifungal effect of the enzyme preparation\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe effects of different metal ions on the activity of recombinant CsLAC17 were investigated. Cu\u003csup\u003e2+\u003c/sup\u003e significantly enhanced enzyme activity by 11.0%, whereas Fe\u003csup\u003e3+\u003c/sup\u003e, Zn\u003csup\u003e2+\u003c/sup\u003e and Fe\u003csup\u003e2+\u003c/sup\u003e strongly inhibited the enzymatic activity. Notably, Zn\u003csup\u003e2+\u003c/sup\u003e exhibited the most pronounced inhibitory effect, reducing the activity by 69.9%. Substantial inhibition was also observed with Fe\u003csup\u003e3+\u003c/sup\u003e and Fe\u003csup\u003e2+\u003c/sup\u003e (Fig. 5a). To evaluate the inhibitory effect of the laccase reagent prepared with copper sulfate, a filter paper inhibition assay was conducted. The treatments were as follows: (1) positive control treated with 1 mg/mL fluorescein solution; (2) 10 mg/mL laccase solution prepared with 0.01 M copper sulfate, which significantly inhibited \u003cem\u003eB. cinerea\u003c/em\u003e growth; (3) 0.02 M copper sulfate solution alone, which showed no significant effect; and (4) 10 mg/mL laccase solution alone, which also had no significant effect on \u003cem\u003eB. cinerea\u003c/em\u003e growth (Fig. 5b). These results demonstrate that the 10 mg/mL laccase reagent formulated with 0.01 M copper sulfate possesses inhibitory activity against \u003cem\u003eB. cinerea\u003c/em\u003e.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eAs a vital economic crop, the healthy growth and disease resistance of the tea plant are crucial for the sustainable development of the tea industry. Lignin serves as a critical physical barrier against pathogens, and our previous research identified laccases\u0026mdash;the key enzymes catalyzing lignin polymerization\u0026mdash;as essential players in this defense mechanism (Zhao et al. 2022). Accordingly, we hypothesized that \u003cem\u003eCsLAC17\u003c/em\u003e also contributes to the plant\u0026rsquo;s defense responses. However, functional characterization in tea plants is challenging due to their perennial nature, self-incompatibility, and the lack of reliable stable transformation systems (Mukhopadhyay et al. 2016). Traditional breeding cycles are long, further limiting breeding efficiency. VIGS has emerged as a powerful tool for functional genomics in species recalcitrant to transformation, having been successfully applied in species such as \u003cem\u003ePopulus euphratica\u003c/em\u003e, \u003cem\u003eNarcissus tazetta\u003c/em\u003e L., \u003cem\u003eJatropha curcas\u003c/em\u003e, and \u003cem\u003eMalus crabapple\u003c/em\u003e (Li et al. 2022), yet it remains underutilized in tea. In this study, we successfully employed a VIGS system to dissect the function of \u003cem\u003eCsLAC17\u003c/em\u003e. Findings from both overexpression in tobacco and silencing in tea plants consistently demonstrate that \u003cem\u003eCsLAC17\u003c/em\u003e is essential for fortifying plant defenses by positively regulating lignin synthesis.\u003c/p\u003e \u003cp\u003eUpon stress exposure, plants initiate a complex defense network, in which an early signal response centered on a reactive oxygen species (ROS) burst plays a crucial role (Tyagi et al. 2022). Since ROS are both key defense signals and cytotoxic, maintaining redox homeostasis between their production and scavenging is essential. This homeostasis is primarily regulated by antioxidant enzymes such as SOD, POD, and CAT. The extent of oxidative imbalance can be quantified by measuring MDA, a product of membrane lipid peroxidation (Mhamdi et al. 2018). In this study, we demonstrate that overexpression of \u003cem\u003eCsLAC17\u003c/em\u003e in transgenic tobacco significantly bolsters antioxidant capacity following pathogen infection. This was evidenced by markedly increased activities of SOD, POD, and CAT, coupled with reduced MDA content. Conversely, silencing \u003cem\u003eCsLAC17\u003c/em\u003e in tea plants compromised their defense, manifesting as diminished antioxidant enzyme activities and severe membrane lipid peroxidation. This phenomenon is not merely an isolated case in tea plants but points to a conserved function of the laccase gene family. For instance, silencing another tea plant laccase gene, \u003cem\u003eCsLAC37\u003c/em\u003e, using antisense oligonucleotide (AsODN) technology similarly resulted in increased H₂O₂ content and decreased POD activity, suggesting that laccases may play a conserved and important role in tea plant defense against anthracnose (Li et al. 2024). Overexpression of \u003cem\u003ePeuLAC2\u003c/em\u003e in poplar enhanced the antioxidant system\u0026rsquo;s activity, effectively protecting cell membranes from damage and improving the plant\u0026rsquo;s stress resistance (Niu et al. 2021). Similarly, tobacco plants overexpressing \u003cem\u003eCsLAC18\u003c/em\u003e exhibited significantly higher activities of CAT, SOD, and POD following cold stress compared to wild-type plants. Notably, the overexpression lines also exhibited higher laccase activity and lignin content, whereas silencing this gene in trifoliate orange (\u003cem\u003ePoncirus trifoliata\u003c/em\u003e) via VIGS presented the opposite phenotype (Xu et al. 2022).\u003c/p\u003e \u003cp\u003eLignin deposition in the secondary cell wall provides a critical physical barrier against pathogen invasion (Boerjan et al. 2003). Its biosynthesis is a complex, multi-step process that begins with the phenylpropanoid pathway, generating three monolignols (H, G, and S) that are subsequently oxidatively polymerized by peroxidases and laccases to form the final lignin polymer (Vanholme et al. 2010; Zhao and Dixon 2011). In this study, we observed a significant upregulation of multiple key genes in the lignin biosynthesis pathway. The coordinated induction of these genes strongly suggests that the entire lignification process is activated as a defense response. The role of PAL and C4H in defense is well-established. For example, overexpression of \u003cem\u003eCsPAL\u003c/em\u003e enhances resistance to blister blight infection (Nisha et al. 2018). In pear, \u003cem\u003ePbC4H1\u003c/em\u003e and \u003cem\u003ePbC4H3\u003c/em\u003e play key roles in lignin biosynthesis (Li et al. 2020a). Similarly, 4CL mediates the activation of various hydroxycinnamic acids, and suppression of \u003cem\u003eOs4CL3\u003c/em\u003e expression results in a significant reduction in lignin content, impaired plant growth, and other morphological changes (Gui et al. 2011). COMT and CCoAOMT are essential for methylation steps; in maize, \u003cem\u003eZmCCoAOMT2\u003c/em\u003e is potentially involved in the biosynthesis of lignin and other phenylpropanoid metabolites (Yang et al. 2017). Overexpression of \u003cem\u003eOsCOMT5\u003c/em\u003e promotes lignin accumulation in rice and enhances tolerance to \u003cem\u003eR. solani\u003c/em\u003e (Kaur et al. 2025). CCR and CAD catalyze the final stages of monolignol synthesis; overexpression of \u003cem\u003eBnCCR2\u003c/em\u003e in \u003cem\u003eB. napus\u003c/em\u003e increases lignin content in the stem, thereby enhancing resistance to \u003cem\u003eS. sclerotiorum\u003c/em\u003e (Liu et al. 2021a). Likewise, overexpression of \u003cem\u003eTaCAD12\u003c/em\u003e significantly enhances resistance to sharp eyespot in transgenic wheat lines (Rong et al. 2016). Taken together, the upregulation of this suite of genes in the present study indicates a comprehensive reinforcement of the lignin biosynthesis pathway, thereby fortifying the cell wall as a primary defense strategy against pathogen invasion.\u003c/p\u003e \u003cp\u003ePlant laccases are ubiquitous polyphenol oxidases that contain four copper ions in their catalytic center. In this study, a laccase gene was cloned from tea plant and expressed in \u003cem\u003ePichia pastoris\u003c/em\u003e. Through the optimization of fermentation conditions to achieve high-level production of the recombinant protein, purified laccase was successfully obtained, which exhibited direct inhibitory activity against \u003cem\u003eB. cinerea\u003c/em\u003e. As an integral component of the laccase active center, copper ions exert a significant influence on both the expression and activity of the enzyme. To further investigate the effects of inorganic ions on tea plant laccase activity, the enzyme solution was incubated with buffers containing various metal ions. The results indicated that Mg\u0026sup2;⁺, Cu\u0026sup2;⁺, and K⁺ activated the laccase, whereas Zn\u0026sup2;⁺, Fe\u0026sup2;⁺, and Fe\u0026sup3;⁺ inhibited its activity. Consistent with these findings, previous research has shown that supplementing the culture medium of the white-rot fungus \u003cem\u003ePleurotus ostreatus\u003c/em\u003e with copper ions (0.5\u0026ndash;5 mM) significantly enhances laccase activity and stability, with 1 mM Cu\u0026sup2;⁺ resulting in an 8-fold increase in activity (Baldrian and Gabriel 2002). Similarly, Kang et al. (2024) demonstrated that 10 mM K⁺ improved the activity of \u003cem\u003eHericium erinaceus\u003c/em\u003e laccase, whereas 5 mM Fe\u0026sup2;⁺ exhibited an inhibitory effect. Furthermore, Mg\u0026sup2;⁺ and Cu\u0026sup2;⁺ have been shown to promote the activity of DcLac1 and DcLac2 enzymes purified from carrot (\u003cem\u003eDaucus carota\u003c/em\u003e L.)(Ma et al. 2015). Notably, Mg\u0026sup2;⁺ and K⁺ may maintain or enhance laccase activity by preserving the charge balance and the three-dimensional conformation of the protein structure. Conversely, Fe\u0026sup2;⁺ and Fe\u0026sup3;⁺ function as competitive inhibitors with similar modes of action; they can bind to the T1 site of laccase, thereby inhibiting enzyme activity by blocking substrate access to the T1 site or hindering electron transfer to the T1 active site (Umar et al, 2022).\u003c/p\u003e \u003cp\u003eCollectively, our study positions \u003cem\u003eCsLAC17\u003c/em\u003e as a key node linking cell wall fortification and redox homeostasis in the plant defense network. For practical application, enhancing tea plant disease resistance relies on a combined approach: integrating traditional breeding with modern tools like Molecular Marker-Assisted Selection (MAS) and CRISPR/Cas9 gene editing for targeted cultivar improvement.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eIn this study, we cloned \u003cem\u003eCsLAC17\u003c/em\u003e from \u003cem\u003eCamellia sinensis\u003c/em\u003e and demonstrated, through complementary loss- and gain-of-function analyses, that \u003cem\u003eCsLAC17\u003c/em\u003e positively regulates antifungal resistance by coordinating cell-wall reinforcement and oxidative stress control. We further established a codon-optimized \u003cem\u003ePichia pastoris\u003c/em\u003e expression system to produce active CsLAC17 and characterize its regulation by metal ions. Notably, Cu\u0026sup2;⁺ acted as a key activator, enabling the enzyme preparation to exhibit antifungal activity. This highlights a Cu-responsive laccase module with potential applications in resistance engineering and laccase-based biocontrol development. Collectively, these findings provide a promising target for breeding disease-resistant tea cultivars and developing eco-friendly control measures.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data presented in this research are available in the article and supplementary materials, further inquiries can be directed to the corresponding author.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (Grant numbers [32160077]) and by the National Guiding Foundation for Local Science and Technology Development of China (Grant numbers [2023\u0026ndash;009]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYufeng Hu:\u003c/strong\u003e Writing-original draft, Conceptualization, Methodology, Investigation, Formal analysis, Data curation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYichen Zhao:\u0026nbsp;\u003c/strong\u003eWriting-review \u0026amp; editing, Writing-original draft, Conceptualization, Methodology, Project administration, Funding acquisition.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArregui L, Ayala M, G\u0026oacute;mez-Gil X, Guti\u0026eacute;rrez-Soto G, Hern\u0026aacute;ndez-Luna CE, Herrera de Los Santos M, Levin L, Rojo-Dom\u0026iacute;nguez A, Romero-Mart\u0026iacute;nez D, Saparrat MCN, Trujillo-Rold\u0026aacute;n MA, Valdez-Cruz NA (2019) Laccases: structure, function, and potential application in water bioremediation. Microb Cell Fact 18:200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12934-019-1248-0\u003c/span\u003e\u003cspan address=\"10.1186/s12934-019-1248-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldrian P (2006) Fungal laccases - occurrence and properties. FEMS Microbiol Rev 30:215\u0026ndash;242. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-4976.2005.00010.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-4976.2005.00010.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldrian P, Gabriel J (2002) Copper and cadmium increase laccase activity in \u003cem\u003ePleurotus ostreatus\u003c/em\u003e. FEMS Microbiol Lett 206:69\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6968.2002.tb10988.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6968.2002.tb10988.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerthet S, Demont-Caulet N, Pollet B, Bidzinski P, C\u0026eacute;zard L, Le Bris P, Borrega N, Herv\u0026eacute; J, Blondet E, Balzergue S, Lapierre C, Jouanin L (2011) Disruption of \u003cem\u003eLACCASE4\u003c/em\u003e and \u003cem\u003e17\u003c/em\u003e results in tissue-specific alterations to lignification of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e stems. Plant Cell 23:1124\u0026ndash;1137. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.110.082792\u003c/span\u003e\u003cspan address=\"10.1105/tpc.110.082792\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertrand G (1896) Sur la presence simultanee de la laccase et de la tyrosinase dans le suc de quelques champignons. CR Hebd Seances Acad Sci 123:463\u0026ndash;465\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhardwaj P, Kaur N, Selvaraj M, Ghramh HA, Al-Shehri BM, Singh G, Arya SK, Bhatt K, Ghotekar S, Mani R, Chang SW, Ravindran B, Awasthi MK (2022) Laccase-assisted degradation of emerging recalcitrant compounds-a review. Bioresour Technol 364:128031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biortech.2022.128031\u003c/span\u003e\u003cspan address=\"10.1016/j.biortech.2022.128031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu Rev Plant Biol 54:519\u0026ndash;546. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.arplant.54.031902.134938\u003c/span\u003e\u003cspan address=\"10.1146/annurev.arplant.54.031902.134938\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorah A, Hazarika SN, Thakur D (2022) Potentiality of actinobacteria to combat against biotic and abiotic stresses in tea [\u003cem\u003eCamellia sinensis\u003c/em\u003e (L) O. Kuntze]. J Appl Microbiol 133:2314\u0026ndash;2330. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jam.15734\u003c/span\u003e\u003cspan address=\"10.1111/jam.15734\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Sui Y, Wisniewski M (2025) Current and future perspectives on tea production. Ind Crops Prod 235:121663. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.indcrop.2025.121663\u003c/span\u003e\u003cspan address=\"10.1016/j.indcrop.2025.121663\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang K, Xia Z, Li H, Jiang X, Qin D, Wang Q, Wang Q, Pan C, Li B, Wu H (2021) Genome-wide association analysis identified molecular markers associated with important tea flavor-related metabolites. Hortic Res 8:42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41438-021-00477-3\u003c/span\u003e\u003cspan address=\"10.1038/s41438-021-00477-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G (2010) Laccases: a never - ending story. Cell Mol Life Sci 67:369\u0026ndash;385. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00018-009-0169-1\u003c/span\u003e\u003cspan address=\"10.1007/s00018-009-0169-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGui J, Shen J, Li L (2011) Functional characterization of evolutionarily divergent 4-coumarate:coenzyme a ligases in rice. Plant Physiol 157:574\u0026ndash;586. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.111.178301\u003c/span\u003e\u003cspan address=\"10.1104/pp.111.178301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Q, Min L, Yang X, Jin S, Zhang L, Li Y, Ma Y, Qi X, Li D, Liu H, Lindsey K, Zhu L, Zhang X (2018) Laccase GhLac1 Modulates Broad-Spectrum Biotic Stress Tolerance via Manipulating Phenylpropanoid Pathway and Jasmonic Acid Synthesis. Plant Physiol 176:1808\u0026ndash;1823. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.17.01628\u003c/span\u003e\u003cspan address=\"10.1104/pp.17.01628\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang J, La TV, Kim MJ, Bae JH, Sung BH, Kim S, Sohn JH (2024) Secretory Production of the \u003cem\u003eHericium erinaceus\u003c/em\u003e Laccase from \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. J Microbiol Biotechnol 34:930\u0026ndash;939. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4014/jmb.2312.12043\u003c/span\u003e\u003cspan address=\"10.4014/jmb.2312.12043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaur G, Sidhu GK, Singh A, Dhar-Ray S, Lenka SK, Reddy PM (2025) Overexpression of \u003cem\u003eOsCCR1\u003c/em\u003e, \u003cem\u003eOsCOMT5\u003c/em\u003e, \u003cem\u003eOsCAD2\u003c/em\u003e and \u003cem\u003eOsCCoAOMT1\u003c/em\u003e Genes Enhances Lignin Accumulation and Confers Tolerance Against \u003cem\u003eRhizoctonia solani\u003c/em\u003e in Rice (\u003cem\u003eOryza sativa\u003c/em\u003e). Mol Biotechnol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12033-025-01436-2\u003c/span\u003e\u003cspan address=\"10.1007/s12033-025-01436-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhatami SH, Vakili O, Movahedpour A, Ghesmati Z, Ghasemi H, Taheri-Anganeh M (2022) Laccase: Various types and applications. Biotechnol Appl Biochem 69:2658\u0026ndash;2672. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/bab.2313\u003c/span\u003e\u003cspan address=\"10.1002/bab.2313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Zhang H, Zhou Q, Tao Y, Wang S, Wang P, Wang A, Wei C, Liu S (2024) The Laccase Family Gene \u003cem\u003eCsLAC37\u003c/em\u003e Participates in Resistance to \u003cem\u003eColletotrichum gloeosporioides\u003c/em\u003e Infection in Tea Plants. Plants 13:884. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants13060884\u003c/span\u003e\u003cspan address=\"10.3390/plants13060884\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Li Y, Yao X, Lu L (2022) Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of \u003cem\u003eCsTCS1\u003c/em\u003e. Int J Mol Sci 24:392. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms24010392\u003c/span\u003e\u003cspan address=\"10.3390/ijms24010392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Liu X, Zhang Y, Muhammad A, Han W, Li D, Cheng X, Cai Y (2020a) Cloning and functional characterization of two cinnamate 4-hydroxylase genes from \u003cem\u003ePyrus bretschneideri\u003c/em\u003e. Plant Physiol Biochem 156:135\u0026ndash;145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plaphy.2020.07.035\u003c/span\u003e\u003cspan address=\"10.1016/j.plaphy.2020.07.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Yang K, Wang S, Lou Y, Zhu C, Gao Z (2020b) Genome-wide analysis of laccase genes in moso bamboo highlights \u003cem\u003ePeLAC10\u003c/em\u003e involved in lignin biosynthesis and in response to abiotic stresses. Plant Cell Rep 39:751\u0026ndash;763. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-020-02528-w\u003c/span\u003e\u003cspan address=\"10.1007/s00299-020-02528-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, Wu J, Lin L, Li P, Li S, Wang Y, Li J, Sun Q, Liang J, Wang Y (2021a) Overexpression of \u003cem\u003eCinnamoyl-CoA Reductase 2\u003c/em\u003e in \u003cem\u003eBrassica napus\u003c/em\u003e Increases Resistance to \u003cem\u003eSclerotinia sclerotiorum\u003c/em\u003e by Affecting Lignin Biosynthesis. Front Plant Sci 12:732733. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2021.732733\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2021.732733\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Qu J, Zhang L, Liu X, Yang G, Pei Y (2021b) Cloning of cucumber LCD and DES gene and their response to abiotic stress. Sci Hortic 278:109802. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scienta.2020.109802\u003c/span\u003e\u003cspan address=\"10.1016/j.scienta.2020.109802\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu L, Chen H, Wang X, Zhao Y, Yao X, Xiong B, Deng Y, Zhao D (2021) Genome-level diversification of eight ancient tea populations in the Guizhou and Yunnan regions identifies candidate genes for core agronomic traits. Hortic Res 8:190. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41438-021-00617-9\u003c/span\u003e\u003cspan address=\"10.1038/s41438-021-00617-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa J, Xu ZS, Wang F, Xiong AS (2015) Isolation, Purification and Characterization of Two Laccases from Carrot (\u003cem\u003eDaucus carota\u003c/em\u003e L.) and Their Response to Abiotic and Metal Ions Stresses. Protein J 34:444\u0026ndash;452. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10930-015-9639-5\u003c/span\u003e\u003cspan address=\"10.1007/s10930-015-9639-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayer AM, Staples RC (2002) Laccase: new functions for an old enzyme. Phytochemistry 60:551\u0026ndash;565. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0031-9422(02)00171-1\u003c/span\u003e\u003cspan address=\"10.1016/s0031-9422(02)00171-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMhamdi A, Van Breusegem F (2018) Reactive oxygen species in plant development. Development 145:dev164376. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.164376\u003c/span\u003e\u003cspan address=\"10.1242/dev.164376\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukhopadhyay M, Mondal TK, Chand PK (2016) Biotechnological advances in tea (\u003cem\u003eCamellia sinensis\u003c/em\u003e [L.] O. Kuntze): a review. Plant Cell Rep 35:255\u0026ndash;287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-015-1884-8\u003c/span\u003e\u003cspan address=\"10.1007/s00299-015-1884-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNisha SN, Prabu G, Mandal AKA (2018) Biochemical and molecular studies on the resistance mechanisms in tea [\u003cem\u003eCamellia sinensis\u003c/em\u003e (L.) O. Kuntze] against blister blight disease. Physiol Mol Biol Plants 24:867\u0026ndash;880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12298-018-0565-9\u003c/span\u003e\u003cspan address=\"10.1007/s12298-018-0565-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu Z, Li G, Hu H, Lv J, Zheng Q, Liu J, Wan D (2021) A gene that underwent adaptive evolution, \u003cem\u003eLAC2\u003c/em\u003e (LACCASE), in \u003cem\u003ePopulus euphratica\u003c/em\u003e improves drought tolerance by improving water transport capacity. Hortic Res 8:88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41438-021-00518-x\u003c/span\u003e\u003cspan address=\"10.1038/s41438-021-00518-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan SY, Nie Q, Tai HC, Song XL, Tong YF, Zhang LJ, Wu XW, Lin ZH, Zhang YY, Ye DY, Zhang Y, Wang XY, Zhu PL, Chu ZS, Yu ZL, Liang C (2022) Tea and tea drinking: China\u0026rsquo;s outstanding contributions to the mankind. Chin Med 17:27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13020-022-00571-1\u003c/span\u003e\u003cspan address=\"10.1186/s13020-022-00571-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey AK, Sinniah GD, Babu A, Tanti A (2021) How the Global Tea Industry Copes With Fungal Diseases-Challenges and Opportunities. Plant Dis 105:1868\u0026ndash;1879. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-09-20-1945-FE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-09-20-1945-FE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePei Y, Liu M, Chen H, Li Q, Yu X, Zhang L (2018) Optimization for conditions of high-efficient electroporation transformation of \u003cem\u003eRhodosporidium toruloides\u003c/em\u003e. J Guangdong Ocean Univ 38:48\u0026ndash;54\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRong W, Luo M, Shan T, Wei X, Du L, Xu H, Zhang Z (2016) A Wheat Cinnamyl Alcohol Dehydrogenase TaCAD12 Contributes to Host Resistance to the Sharp Eyespot Disease. Front Plant Sci 7:1723. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.01723\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01723\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamynathan R, Shanmugam K, Nagarajan C, Murugasamy H, Ilango RVJ, Shanmugam A, Venkidasamy B, Thiruvengadam M (2021) The effect of abiotic and biotic stresses on the production of bioactive compounds in tea (\u003cem\u003eCamellia sinensis\u003c/em\u003e (L.) O. Kuntze). Plant Gene 27:100316. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plgene.2021.100316\u003c/span\u003e\u003cspan address=\"10.1016/j.plgene.2021.100316\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheich C, Sievert V, B\u0026uuml;ssow K (2003) An automated method for high-throughput protein purification applied to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnol 3:12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1472-6750-3-12\u003c/span\u003e\u003cspan address=\"10.1186/1472-6750-3-12\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShe G, Yu S, Li Z, Peng A, Li P, Li Y, Chang M, Liu L, Chen Q, Shi C, Sun J, Zhao J, Wan X (2022) Characterization of \u003cem\u003eCsTSI\u003c/em\u003e in the Biosynthesis of Theanine in Tea Plants (\u003cem\u003eCamellia sinensis\u003c/em\u003e). J Agric Food Chem 70:826\u0026ndash;836. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jafc.1c04816\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.1c04816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoni N, Hegde N, Dhariwal A, Kushalappa AC (2020) Role of laccase gene in wheat NILs differing at QTL-Fhb1 for resistance against Fusarium head blight. Plant Sci 298:110574. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plantsci.2020.110574\u003c/span\u003e\u003cspan address=\"10.1016/j.plantsci.2020.110574\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun M (2020) Study on the preparation and purification of antioxidant peptides from whey protein and its in vitro antioxidant activities. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.27345/d.cnki.gsnyu.2019.000365\u003c/span\u003e\u003cspan address=\"10.27345/d.cnki.gsnyu.2019.000365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Sichuan Agricultural University\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y, Lu L, Sheng Z, Zhao D, Tao J (2023) An R2R3-MYB network modulates stem strength by regulating lignin biosynthesis and secondary cell wall thickening in herbaceous peony. Plant J 113:1237\u0026ndash;1258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/tpj.16107\u003c/span\u003e\u003cspan address=\"10.1111/tpj.16107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyagi S, Shah A, Karthik K, Rathinam M, Rai V, Chaudhary N, Sreevathsa R (2022) Reactive oxygen species in plants: an invincible fulcrum for biotic stress mitigation. Appl Microbiol Biotechnol 106:5945\u0026ndash;5955. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00253-022-12138-z\u003c/span\u003e\u003cspan address=\"10.1007/s00253-022-12138-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUmar A, Ahmed S (2022) Optimization, purification and characterization of laccase from \u003cem\u003eGanoderma leucocontextum\u003c/em\u003e along with its phylogenetic relationship. Sci Rep 12:2416. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-06111-z\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-06111-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanholme R, Demedts B, Morreel K, Ralph J, Boerjan W (2010) Lignin biosynthesis and structure. Plant Physiol 153:895\u0026ndash;905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.110.155119\u003c/span\u003e\u003cspan address=\"10.1104/pp.110.155119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei C, Yang H, Wang S, Zhao J, Liu C, Gao L, Xia E, Lu Y, Tai Y, She G, Sun J, Cao H, Tong W, Gao Q, Li Y, Deng W, Jiang X, Wang W, Chen Q, Zhang S, Li H, Wu J, Wang P, Li P, Shi C, Zheng F, Jian J, Huang B, Shan D, Shi M, Fang C, Yue Y, Li F, Li D, Wei S, Han B, Jiang C, Yin Y, Xia T, Zhang Z, Bennetzen JL, Zhao S, Wan X (2018) Draft genome sequence of \u003cem\u003eCamellia sinensis\u003c/em\u003e var. \u003cem\u003esinensis\u003c/em\u003e provides insights into the evolution of the tea genome and tea quality. Proc Natl Acad Sci USA 115:E4151\u0026ndash;E4158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1719622115\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1719622115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia EH, Zhang HB, Sheng J, Li K, Zhang QJ, Kim C, Zhang Y, Liu Y, Zhu T, Li W, Huang H, Tong Y, Nan H, Shi C, Shi C, Jiang JJ, Mao SY, Jiao JY, Zhang D, Zhao Y, Zhao YJ, Zhang LP, Liu YL, Liu BY, Yu Y, Shao SF, Ni DJ, Eichler EE, Gao LZ (2017) The Tea Tree Genome Provides Insights into Tea Flavor and Independent Evolution of Caffeine Biosynthesis. Mol Plant 10:866\u0026ndash;877. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molp.2017.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.molp.2017.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Q, Yang Y, Hu K, Chen J, Djomo SN, Yang X, Knudsen MT (2021) Economic, environmental, and emergy analysis of China's green tea production. Sustain Prod Consum 28:269\u0026ndash;280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.spc.2021.04.019\u003c/span\u003e\u003cspan address=\"10.1016/j.spc.2021.04.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Zhang Y, Liang M, Kong W, Liu J (2022) The Citrus Laccase Gene \u003cem\u003eCsLAC18\u003c/em\u003e Contributes to Cold Tolerance. Int J Mol Sci 23:14509. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms232314509\u003c/span\u003e\u003cspan address=\"10.3390/ijms232314509\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamada K, Sonoda R, Ishikawa K (2016) Population Genetic Structure of QoI-Resistant \u003cem\u003ePestalotiopsis longiseta\u003c/em\u003e Isolates Causing Tea Gray Blight. Plant Dis 100:1686\u0026ndash;1691. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PDIS-09-15-1114-RE\u003c/span\u003e\u003cspan address=\"10.1094/PDIS-09-15-1114-RE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Jia X, Gao T, Gong S, Xia L, Zhang P, Qi Y, Liu S, Yu Y, Wang W (2024) The \u003cem\u003eCsmiR397a\u003c/em\u003e-\u003cem\u003eCsLAC17\u003c/em\u003e module regulates lignin biosynthesis to balance the tenderness and gray blight resistance in young tea shoots. Hortic Res 11:uhae085. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hr/uhae085\u003c/span\u003e\u003cspan address=\"10.1093/hr/uhae085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Q, He Y, Kabahuma M, Chaya T, Kelly A, Borrego E, Bian Y, El Kasmi F, Yang L, Teixeira P, Kolkman J, Nelson R, Kolomiets M, Dangl JL, Wisser R, Caplan J, Li X, Lauter N, Balint-Kurti P (2017) A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens. Nat Genet 49:1364\u0026ndash;1372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.3919\u003c/span\u003e\u003cspan address=\"10.1038/ng.3919\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshida H (1883) Chemistry of Lacquer (Urushi). Part I. J Chem Soc 43:472\u0026ndash;486. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/ct8834300472\u003c/span\u003e\u003cspan address=\"10.1039/ct8834300472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Y, Xing Y, Liu F, Zhang X, Li X, Zhang J, Sun X (2021) The Laccase Gene Family Mediate Multi-Perspective Trade-Offs during Tea Plant (\u003cem\u003eCamellia sinensis\u003c/em\u003e) Development and Defense Processes. Int J Mol Sci 22:12554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms222212554\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212554\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang SN, Shi LJ, Liao ZY, Wang Z, Wang SF (2021) High expression in \u003cem\u003epichia pastoris\u003c/em\u003e and modification of codon-optimization egg white lysozyme. J Zhejiang Univ (Sci Ed) 47:476\u0026ndash;483\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Wu L, Wang X, Chen B, Zhao J, Cui J, Li Z, Yang J, Wu L, Wu J, Zhang G, Ma Z (2019) The cotton laccase gene \u003cem\u003eGhLAC15\u003c/em\u003e enhances Verticillium wilt resistance via an increase in defence-induced lignification and lignin components in the cell walls of plants. Mol Plant Pathol 20:309\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mpp.12755\u003c/span\u003e\u003cspan address=\"10.1111/mpp.12755\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Q, Dixon RA (2011) Transcriptional networks for lignin biosynthesis: more complex than we thought? Trends Plant Sci 16:227\u0026ndash;233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2010.12.005\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2010.12.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Q, Nakashima J, Chen F, Yin Y, Fu C, Yun J, Shao H, Wang X, Wang ZY, Dixon RA (2013) Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 25:3976\u0026ndash;3987. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.113.117770\u003c/span\u003e\u003cspan address=\"10.1105/tpc.113.117770\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Liu Y, Dong X, Liu JJ, Zhao DG (2022) Identification of a novel laccase gene \u003cem\u003eEuLAC1\u003c/em\u003e and its potential resistance against \u003cem\u003eBotrytis cinerea\u003c/em\u003e. Transgenic Res 31:215\u0026ndash;225. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11248-022-00297-8\u003c/span\u003e\u003cspan address=\"10.1007/s11248-022-00297-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Camellia sinensis, laccase, Heterologous expression, Pichia pastoris, VIGS","lastPublishedDoi":"10.21203/rs.3.rs-9122877/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9122877/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTea (\u003cem\u003eCamellia sinensis\u003c/em\u003e (L.) O. Kuntze) is a globally significant beverage crop, yet its production is frequently compromised by various fungal diseases, therefore, enhancing its natural disease resistance is of great importance. Laccases (LACs) are key enzymes in plant defense responses. Here, we identified and functionally characterized a tea laccase gene, \u003cem\u003eCsLAC17\u003c/em\u003e, which has a full length of 1758 bp and encodes 585 amino acids. Silencing \u003cem\u003eCsLAC17\u003c/em\u003e in tea via virus-induced gene silencing (VIGS) significantly compromised resistance to anthracnose, accompanied by elevated MDA content. Its overexpression in tobacco increased lignin content and boosted resistance to \u003cem\u003eBotrytis cinerea\u003c/em\u003e. Furthermore, the purified CsLAC17 protein, heterologously expressed in yeast, directly inhibited the growth of \u003cem\u003eB. cinerea\u003c/em\u003e in vitro. These results indicate that \u003cem\u003eCsLAC17\u003c/em\u003e enhances plant systemic resistance by regulating lignin biosynthesis, and that its encoded protein also possesses direct antifungal activity. This finding not only provides new insights into tea disease resistance mechanisms but also offers a dual target for breeding disease-resistant cultivars and developing novel green fungicides.\u003c/p\u003e","manuscriptTitle":"A dual-functional laccase gene CsLAC17 from tea plant: Insights from VIGS and heterologous expression into lignin-mediated resistance and direct antifungal activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-25 11:29:04","doi":"10.21203/rs.3.rs-9122877/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-16T14:53:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"319926488404612514684180683157804655022","date":"2026-05-06T00:48:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"136096451039539764816102367624928226380","date":"2026-04-29T04:17:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-14T03:42:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"242358574394715810576842195888125714521","date":"2026-04-13T11:51:55+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-23T14:21:46+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-18T02:48:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-18T02:48:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell, Tissue and Organ Culture (PCTOC)","date":"2026-03-14T13:20:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-tissue-and-organ-culture-pctoc","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcto","sideBox":"Learn more about [Plant Cell, Tissue and Organ Culture (PCTOC)](https://www.springer.com/journal/11240)","snPcode":"11240","submissionUrl":"https://submission.nature.com/new-submission/11240/3","title":"Plant Cell, Tissue and Organ Culture (PCTOC)","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5f59f168-ac58-4761-9b0b-462a47bca4e3","owner":[],"postedDate":"March 25th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-16T14:53:55+00:00","index":20,"fulltext":""},{"type":"reviewerAgreed","content":"319926488404612514684180683157804655022","date":"2026-05-06T00:48:44+00:00","index":19,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-25T11:29:04+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-25 11:29:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9122877","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9122877","identity":"rs-9122877","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0