Exosomes derived from endothelial progenitor cells enhance osteogenesis of mesenchymal stem cells by activating the MAPK dependent pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Exosomes derived from endothelial progenitor cells enhance osteogenesis of mesenchymal stem cells by activating the MAPK dependent pathway Yanming Liang, Jiajun Xiao, Jiayu Yu, Ting Sun, Ming Liu, xiaoning he This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5388213/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Recent studies have shown that endothelial progenitor cells (EPCs) could enhance osteogenesis of mesenchymal stem cells (MSCs) through multiple paracrine signals. However, the role of EPCs-derived exosomes (EPCs-exos) in osteogenesis has been rarely reported, and little is known regarding their underlying mechanisms. This study attempted to investigate the underlying mechanism by which EPCs-exos promotes osteogenesis of MSCs. EPCs-exos was isolated by supercentrifugation and characterized by western blot, transmission electron microscopy (TEM) and nano particle analysis (NTA). Internalization of EPCs-exos was observed via a laser confocal microscope. The effects of EPCs-exos on the regulation of MSCs biological properties were investigated in vivo and in vitro . The expression of osteogenesis markers and calcium nodule formation was quantified by qRT-PCR, western blotting, alkaline phosphatase (ALP) staining and Alizarin Red staining. Rat critical-sized calvarial bone defects model was used to assess the efficacy of EPCs-exos on bone regeneration. Real-time PCR array and western blotting were performed to explore possible signaling pathways involved in osteogenesis. Results showed that EPCs-exos could be internalized by MSCs, which exhibited greater ALP activity and increased calcium mineral deposition and improved osteogenic markers expression. EPCs-exos combined with MSCs could improve bone regeneration in vivo . These data suggest that EPCs-exos influence the biological function and promote MSCs osteogenic differentiation in vivo and in vitro. Mitogen-activated protein kinase (MAPK) signaling pathway was involved in this process. Activation of the p38MAPK pathway may be the key to enhancing MSCs osteogenic differentiation. Biological sciences/Stem cells/Regeneration Biological sciences/Cell biology/Cell signalling/Growth signalling Exosomes Endothelial progenitor cells Messenchemcal stem cells osteogenesis MAP kinase signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Bone defects can be caused by various clinical diseases such as trauma, tumor, infections, etc. The effective reconstruction of bone defects, especially the critical-sized defects, is a challenging problem in orthopedic surgery. Autologous bone grafting are the most widely used treatments for bone defect repair, but its availability and its effectiveness is limited by complications such as trauma, infection, and impaired regenerative processes due to osteoporosis[1, 2]. Therefore there is an urgent need to develop new and effective alternatives for bone regeneration. Stem cell-based therapies, which apply a stem cell self-sufficient biological environment and heterogeneity to restore and improve tissue function, have been extensively investigated [3, 4]. Stem cell-based therapies provide an alternative solution for the repair and regeneration of bone defects. Mesenchymal stem cells (MSCs) are isolated from different sources, and differentiated into several lineages under suitable induction conditions [5, 6]. MSCs induce direct effects through cellular signaling via physical contacts, and secrete cytokines for paracrine and autocrine functions, to generate trophic support in bone regeneration [7, 8]. Endothelial progenitor cells (EPCs) have the capacity to differentiate into mature endothelial cells, the role of EPCs in vasculogenesis has been studied extensively in vivo and in vitro [9]. The occurrence of EPCs with MSCs has profound effects on cell proliferation and differentiation [10, 11]. Previous studies showed that co-implantation of EPCs and MSCs improves bone formation significantly [12-14], the positive effects of EPCs on bone regeneration are not only facilitated the vasculogenesis but also by stimulating the osteogenesis via paracrine mechanisms [15, 16]. But the relationship between EPCs and MSCs in osteogenesis is not fully elucidated, an understanding of the cellular and molecular interactions of EPCs and MSCs will enhance the successful development of bone regeneration. Exosomes, the naturally secreted nanocarriers from cells, are 50-120 nm nanoparticles originating from multivesicular bodies [17]. Growing evidence suggest that exosomes play key roles in intercellular communication by transferring proteins and genetic information to target cells [18]. It has been reported that exosomes exhibit similar functional properties to the cells from which they are derived [19, 20]. Accumulating evidence has revealed that EPCs-derived exosomes (EPCs-exos) have therapeutic potential in various disease models, such as cardiovascular diseases and diabetic skin wounds [21, 22]. Therefore, EPCs-exos may also play a critical role in cellular crosstalk between EPCs and MSCs and promote MSCs induced bone regeneration. Therefore, we propose to use EPCs-exos and MSCs combination to assess the osteogenesis ability of EPCs-exos induced MSCs, and study their osteogenic interaction to identify gene expression changes and investigate how EPCs-exos influence osteogenic differentiation of MSCs, and to investigate the involvement of mitogen-activated protein kinase (MAPKs) pathways in the osteogenic differentiation. Results Isolation and phenotype identification of MSCs and EPCs Cells were analyzed and identified by flow cytometry analysis for surface markers at passage four. As shown in Figure 1A, MSCs expressed cell-surface protein profiles, positive for FITC labeled CD44, CD90 and negative for CD31, CD34, while EPCs were positive for CD34, CD133 and negative for CD11b, CD31 (Figure 1B). Indicating that the high purity of the extracted MSCs and EPCs. Isolation and identification of EPCs-derived exosomes The extracted exosomes were characterized using TEM, NanoSight and western blotting. TEM images showed that the isolated exosomes were small closed vesicles which exhibited a round shaped morphology. The diameter of exosomes was approximately 80 nm (Figure 2A), which was consistent with the reported size of exosomes[23]. NTA results suggest that the size distribution of EPCs-exos displayed approximately 50-150nm (Figure 2B). The expression of protein CD9, CD63 and Calnexin were detected in these vesicles, but not the protein Calnexin (Figure 2C). These results indicated that the extraction of the exosomes was successful. Endocytosis of EPCs-derived exosomes in MSCs To confirm that EPCs-exos can be internalized by MSCs, EPCs-exos were labeled with PKH67 and observed via laser confocal microscope. Results showed that when add into MSCs for 24 hours, EPCs-exos gathered inside the MSCs, and fluorescence was observed in perinuclear regions (Figure 2D-F), suggesting that EPCs-exos were endocytosed into the MSCs. EPCs-derived exosomes promote osteoclastic differentiation of MSCs in vitro To explore the functional roles EPC-exos in osteogenesis, MSCs were cultured in osteogenic medium containing 100 μl exosomes (1 × 10 12 particles/ml) or in equal volume of PBS. Data indicated that EPC-exos significantly enhance MSCs differentiation. ALP staining showed that incubation of MSCs with EPC-exos resulted significant increasing ALP activity (Figure 3A), qRT-PCR was performed to quantitative osteogenic gene expression, including Col1, OPN, BSP and Runx2, to investigate the effects of EPC-exos on MSCs differentiation. Results showed that EPC-exos increased Col1 mRNA expression of MSCs significantly by 58.76% (P < 0.05), OPN, BSP and Runx2 mRNA levels also increased significantly by 34.21%, 28.86% and 43.45% respectively in comparison with control group(Figure 3B). EPCs-derived exosomes promote osteoclastic differentiation of MSCs in vivo To investigate the therapeutic potential of EPCs-exos on bone repair, the rat critical-sized calvarial bone defect model was established and the MSCs/EPCs-exos combined with scaffolds were implanted into the defect areas. After 8 weeks, animals were euthanized with CO 2 and the craniums were harvested for micro CT to qualitatively evaluate the newly formed bone within the defects. Three-dimensional reconstruction and sagittal images view of micro-CT images showed the newly regenerated bone in MSCs group, while a larger amount of de novo bone formation with complete closure in the calvarial defect sites in MSCs/EPCs-exos group (Figure 3C, D). This was confirmed by a quantitative analysis of the BV/TV (Figure 3E), which showed an increased new bone formation in the exosomes functionalized group as compared to the control. Furthermore, the local BMDs showed the same tendency as that obtained for the BV/TV levels, BMD in MSCs/EPCs-exos group was significantly higher than that in the other groups (Figure 3F). Moreover, histological evidence demonstrated that exosomes treatment increased the newly formed bone tissues within the defect areas, as determined by the percentage of new bone area (Figure 3G). Indicate that MSCs/EPCs-exos combination exhibited robust osteogenic activity and could improve bone regeneration in the defect areas. Differentially expressed genes in MSCs stimulated by exosomes To determine the effector genes that respond to EPC-exos stimulation, microarray analyses were performed to identify the differentially-regulated genes in MSCs incubated with exosomes or PBS. Results showed that there was a significant differential expression of 1321 candidate genes between the two groups (p < 0.05). Volcano plot revealed that out of 1321 differentially expressed genes, 456 were up regulated (red) and 865 genes were down regulated (green) (Figure 4A). KEGG enrichment analyses of differentially expressed genes demonstrated that that multiple biological pathways were prominently enriched (Enrichment Score >2.0, p < 0.05). Signaling pathways, including MAPK, ECM-receptor interaction, focal adhesion, PI3K-Akt, TGF-β and TNF signaling pathway were regulated by EPCs-exos (Figure 4B). Among these pathways, MAPK was appeared to be the most enriched one. Heat map displaying hierarchical clustering of differentially expressed genes related to MAPK signaling pathway (Figure 4C). These results provided basic data for our further investigation. Involvement of MAPK signaling pathway in the EPCs-derived exosomes induced osteogenic responses The activation of the MAPK pathway in MSCs following EPCs-exos stimulation was verified by Western blotting. The protein and their phosphorylated protein levels of p38, ERK1/2 and JNK were assessed. Compared to the PBS control, incubation with EPCs-exos resulted in a significant increase in p38 MAPK phosphorylation in MSCs, while ERK1/2 and JNK phosphorylation levels were not significantly altered (Figure 5A, E), indicating that the p38 MAPK signaling in MSCs was activated by the EPCs-exos. However, the upregulation of p-p38 MAPK in MSCs by the exosomes was significantly impaired after the MSCs were cultured with a p38 inhibitor (SB203580, 10 μM) (Figure 5B, F). Next we examined the effects of p38 MAPK on the osteogenic differentiation of MSCs. As shown in Figure 5B, after incubation of MSCs with EPCs-exos, the levels of these osteogenesis-related proteins including Col1, Runx2, and OPN were further increased. However, their upregulation by EPCs-exos was markedly suppressed by the p38 inhibitor SB203580 (Figure 5B, F). Also, we evaluated the ALP activity and calcium mineral deposition in EPCs-exos induced MSCs. As shown in results, the exosomes treated MSCs showed significantly higher expression of ALP than control group, whereas these effects were blocked by p38 inhibitor (Figure 5C, G). The calcium nodule formations were also reduced dramatically in EPCs-exos induced MSCs when treated with SB203580, which was consistent with the data from osteogenesis-related protein expression (Figure 5D, H). Taken together, our results indicated that the stimulatory effects of EPCs-exos on the osteogenic differentiation of MSCs mainly resulted from the activation of the p38 MAPK signaling pathway. Discussion Stem cell-based therapy is a promising strategy in bone regeneration. Among cells with therapeutic potential, MSCs have gained much interest[24]. MSCs are regarded as suitable cell sources for bone tissue engineering owing to their ability of multipotential differentiation. [25, 26]. The ability of MSCs to differentiate into multiple lineages is controlled by various inhibitors and stimulators, which have been studied by in vivo or in vitro [27, 28]. Enhanced MSCs osteogenic differentiation can be achieved by various methods, such as electrical stimulation, chemical supplements, or using assisting cells [29, 30]. EPCs are believed to promote bone regeneration by stimulating neovascularization and osteogenesis. EPCs contribute to the formation of new blood vessels and indirectly contribute to the formation of new bone during bone repair[31]. In previous studies, researchers found that EPCs enhance osteogenesis by stimulating proliferation of surrounding cells via a paracrine effect [32]. Our research also proved that when co-cultured with EPCs, MSCs exhibited accelerated bone regeneration [33], suggest there were cellular interactions take place between MSCs and EPCs in osteogenesis [34, 35]. Cellar interactions are complex and incomprehensible processes, studies are required to characterize these processes in bone regeneration. Previous studies indicate that EPCs enhance osteogenesis via paracrine mechanisms [33], while exosomes are important paracrine factors [36]. So we speculate that exosomes might mediate osteogenesis process of MSCs. Exosomes, ranging in size from 50–120 nm, are micro vesicles that are secreted by cells to facilitate inter cellular communication. Exosomes deliver various content including DNAs, RNAs and proteins and provide a novel way to stimulate bone regeneration[23]. In this study we extracted exosomes from EPCs and characterized exosomes using TEM, NanoSight and western blotting. Our data demonstrated that the isolated EPCs-exos exhibited a round shaped morphology with expression of protein CD9 and CD63. The diameter of exosomes was approximately 90 nm and the size distribution of EPCs-exos displayed approximately 50-150nm. These results indicated that the extraction of the exosomes was successful. It has been proposed that exosomes serve as a carrier to transfer lipids, nucleic acids, proteins, and signaling molecules to target cells and mediate genes and proteins to modulating the bioactivity of receptor cells [ 42 ]. Endocytosis of exosomes can facilitate the absorption of proteins, lipids and nucleic acids, thereby affecting target cells [37]. So the exosomes internalization by target cells is the prerequisite for playing such a role. In the present study, MSCs was cultured with PKH67-labeled exosomes and observed with laser confoncal microscope. The labeled exosomes can be seen in perinuclear regions of MSCs, indicating exosomes were endocytosed into the MSCs To explore the functional roles EPC-exos in osteogenesis, MSCs were cultured in osteogenic medium containing exosomes or PBS in vitro . Data indicated that EPC-exos enhance MSC differentiation, ALP activity was significantly increased. qRT-PCR showed that osteogenic gene expression, including Col1, Runx2, OPN and BSP, increased significantly in comparison with control group. Rat critical-sized calvarial bone defect model was established and MSCs were implanted into the defect areas combined with EPCs-exos. After 8 weeks, micro CT showed that a large amount of de novo bone formation was observed in the defect sites in EPCs-exos /MSCs group, with complete closure of bony defects. The BMD in EPCs-exos /MSCs group was significantly higher than that in the other groups. Results were confirmed by a quantitative analysis of the BV/TV and histological evidence. Similar with previous studies, Qin et al found that EPCs-exos significantly promote MSCs proliferation, differentiation and the expression of osteogenic genes [38]. EPCs-exos transplantation could significantly accelerate bone regeneration in rats [39]. Suggests that EPCs-exos was sufficient to promote MSCs osteogenic differentiation in vitro and improve ossification in the defect region in vivo. Osteogenic differentiation processes involves transcription factors and signaling pathways, which transmit molecular information to allow cells react to external stimulation [40]. To determine the candidate signaling pathways potentially involved in EPC-exos stimulation, microarray analyses were performed to identify the differentially-regulated genes in MSCs cultured with exosomes. Result revealed that out of 1321 differentially expressed genes, 456 were up regulated in MSCs and 865 genes were down regulated. KEGG enrichment analyses of targeted genes indicated that the effects of EPCs-exos on the regulation of MSCs biological properties are most associated with MAPK signaling pathway, ECM-receptor interaction, focal adhesion, PI3K-Akt signaling pathway, TGF-β and TNF signaling pathway and so on. Among these pathways, MAPK signaling pathway was primarily affected by EPCs-exos. This results was consistent with previous studies, which reported that MSCs-derived exosomes promoted the proliferation of osteoblast via MAPK pathway [41], and provided basic data for our further investigation. Mitogen-activated protein kinases (MAPK) signaling occurs in many cells, and plays important roles in controlling cell proliferation, and are involved in multiple cellular pathways and functions [42-44]. MAPK functions are mediated via the phosphorylation of several substrates, including phospholipases, transcription factors and cytoskeletal proteins [45]. Studies have demonstrated that gene expression and function of osteoblasts are related to p38 MAPK, which was activated by stress and cytokines [46]. It was reported that p38MAPK signaling pathway is involved in osteoblast proliferation and differentiation [47, 48]. MSCs endocytosed exosomes via the caveolar will trigger the activation of p38MAPK pathway by phosphorylating mechanism [49]. Our experiments also provide similar results, incubation with EPCs-exos resulted in a significant increase in p38 MAPK phosphorylation in MSCs, while ERK1/2 and JNK phosphorylation levels were not significantly altered. To further investigate whether EPCs-exos promotes the osteogenic differentiation of MSCs via p38MAPK signaling, EPCs-exos and specific p38MAPK inhibitor, SB203580, was used to confirm the hypothesis. Results showed that EPCs-exos increased p38 phosphorylation levels and significantly increased Col I, OPN and Runx2 protein production. EPCs-exos were also enhanced MSCs mineralization and ALP activity. While p38 inhibitor decreased p38 phosphorylation levels and reduced Col I, OPN and Runx2 protein production significantly, and suppressed ALP levels and calcium nodule formation. Previous researches revealed that p38MAPK participates in ALP regulation during osteoblast differentiation, and is necessary for BSP and OPN expression, via p38MAPK activation [50, 51]. p38MAPK promotes MSCs osteogenic differentiation via regulating Runx2/Osx [52], while lack of p38α results a defective osteoblast differentiation in pre-osteoblasts, as evidenced by reduced expressions of Col 1, ALP, and OCN [53]. So based on our results and these studies, we speculate EPCs-exos enhance MSCs osteogenic differentiation via the p38MAPK signaling pathway. All these results suggested that important interactions occur between EPCs-exos and MSCs via p38MAPK signaling pathway. The findings of this present study may promote the understanding of osteogenic differentiation mechanisms, which may lead to the development of bone regeneration. But this study only explores the role of EPCs-exos in inducing osteogenic differentiation of MSCs. Further studies are required to characterize the mechanism by which exosomes control MSCs differentiation and the exosomal miRNAs and proteins that contribute towards this process, to better understand the molecular mechanisms that mediate MSCs differentiation and to elucidate the roles of EPCs-exos in the processes. Conclusion The results of this research support the concept that EPCs-exos can enhance MSCs osteogenic differentiation in vitro and in vivo. EPCs-exos have profound effects on differentiation of MSCs and significantly promoted MSCs osteogenic gene expression and protein synthesis. ALP activity and calcium nodule formation were increased significantly. Activation of the p38MAPK signaling pathway may be the key to enhancing MSCs osteogenic differentiation. Further insights into the exosome-mediated paracrine induction will be invaluable for understanding cell dynamics and ultimately leading to more rational tissue engineering strategies. Material and methods Ethics approvals and consent to participate The project entitled “EPCs derived exosomes promotes critical-sized bone defect regeneration of rats” was approved by the China Medical University Animal Care and Use Committee in Sep. 2021 (CMU2021284). All procedures were conducted in full compliance with the ARRIVE guidelines. Specific-Pathogen Free (SPF) SD rats were purchased from Beijing Hfk Bioscience (China). We have ensured all methods were carried out in accordance with relevant guidelines and regulations. Isolation of MSCs and EPCs The study was approved by the China Medical University Animal Care and Use Committee. 4-6 weeks old Sprague-Dawley (SD) rats were euthanized by CO 2 . Rat femurs and tibias were dissected and bone marrow cells were collected in sterile PBS. MSCs were separated by density gradient centrifugation with Histopaque-1083 (1.077g/ml, Sigma-Aldrich, USA) at 400g for 20 min and cultured in a flask at a density of 1×10 6 cells/ml at 37°C and 5% CO 2 . The cells will be passaged using TrypLE express (Invitrogen, USA) when the confluency reached 70-80%. EPC preparation and culture were performed as previously described [54]. Briefly, bone marrow mononuclear cells were harvested and washed twice in PBS, and suspended in EPC media (EGM-2 media supplemented with growth factor bullet kit (Lonza, Germany), at a density of 1x10 6 cells/ml. Non-adherent cells were removed after 24 h incubation at 37°C and 5% CO 2 . Cells were passaged when they reached 80–90 % confluency. Phenotype Identification of MSCs and EPCs Usually, cells at passage 4 exhibited a typical MSCs/EPCs like morphology and were used for cell surface marker identification by flow cytometry analysis. Briefly, 1× 106 cells were fixed with 4 % paraformaldehyde for 15 min, blocked with 3 % BSA in PBS for 30 min, and incubated with primary antibodies. MSCs were stained with FITC-conjugated rat anti-CD44, FITC-conjugated rat anti-CD90, FITC-conjugated rat anti-CD31 and FITC-conjugated rat anti-CD34 antibodies at a concentration of 2 mg/ml at 4°C. EPCs were stained with rat anti-CD31, rat anti-CD34, FITC-conjugated rat anti-CD11b and FITC-conjugated rat anti-CD133, Mouse IgG was served as negative controls. Cells were examined by flow cytometry with 10,000 events recorded for each condition. The results were analyzed by Flowjo software 10.0. Isolation and identification of EPCs-Exos When EPCs were 80–90 % confluent, the culture medium was replaced by the serum-free MSC medium cultured for an additional 48 h. exosomes were isolated from EPCs supernatant. The supernatant was moved to new tubes for centrifugation at 300g for 10 min and 2000g 20min at 4 °C to remove dead cells and cellular debris. The supernatant was then centrifuged at 16500g for 30 min at 4 °C and filtered by using a 0.22-μm filter. Afterwards, the supernatant was moved to new tubes for ultracentrifugation at 100000g for 70 min at 4 °C to pellet the exosomes. The precipitate was resuspended in 10 ml PBS and ultracentrifugation was performed again. All procedures were performed at 4 °C. The obtained pellets was resuspended with PBS and stored at − 80 °C for further experiments. Exosomes were identified by nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM) and western blotting. Internalization of exosomes Endocytosis of exosomes in MSCs was confirmed by laser confocal microscope. Exosomes derived from EPCs were labeled with PKH67 (Sigma-Aldrich, Germany). Then, MSCs was cultured with PKH67-labeled exosomes for 24 h followed by 4% paraformaldehyde fixation for 15 min. After washed by PBS for three times, the nuclei were stained by Hoechest at room temperature for 30 min. Finally, MSCs were observed via a laser confocal microscope (Olympus, Japan). Animals and treatments Specific-Pathogen Free (SPF) SD rats were purchased from Beijing Hfk Bioscience (China). The in vivo experimental protocol was were approved by the China Medical University Animal Care and Use Committee(CMU2021284) All procedures were conducted in full compliance with the ARRIVE guidelines. We have ensured all methods were carried out in accordance with relevant guidelines and regulations. Briefly, 21 male SD rats, each weighing approximately 260-280g, were randomly assigned to three groups after sample size calculation. The rats were anesthetized with 5% isoflurane gas inspiration by using facial mask. After the skin was prepped and sterilized, an incision was made with full thickness reflection of the skin and the periosteum, to expose the calvarium, then an 8 mm critical size defects were created with trephone bur under constant PBS irrigation. The rats were randomly divided into three groups: the PBS group, MSCs group, and MSC/EPCs-exos group (100μl, 1 × 10 12 particles/ml). After surgery, each rat was in a separate cage, buprenornhine was used to minimize pain or discomfort and rats were monitored for signs of infection. At the end of the 8-week period, animals were euthanized with CO 2 and the craniums were harvested for micro CT at 20 μm resolution under radiation source of 70 kV and 200 μA. Gene expression profiling and bioinformatics analysis 3 wells of MSC/EPCs-exos were prepared for microarray analysis and MSCs were used as control. Cells were cultured with osteogenic differentiation medium which refreshed every 3 days. 14 days later, total RNA was extracted using TRIzol® Reagent according the manufacturer’s instructions (Invitrogen, USA) and genomic DNA was removed using DNase I (TaKara, Japan). An RNA-seq transcriptome library was prepared following instructions from the TruSeqTM RNA sample preparation Kit (Illumina, USA). Libraries were size selected for cDNA target fragments of 200–300 base pairs (bp) on 2% low range ultra agarose, followed by PCR amplification. After quantification, the paired-end RNA-seq library was sequenced on the Illumina Novaseq 6000 (2 × 150 bp read length). The expression level of each transcript was calculated according to the FPKM method. EdgeR was used for differential expression analysis [55]. KEGG pathway analyses were conducted on KOBAS (http://kobas.cbi.pku.edu.cn/download.php) [56]. Microarray data were analyzed on the Majorbio online platform (www.majorbio.com). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Total RNA was isolated after 14 days incubation. RNA was quantified using the Nanodrop ND-2000 (NanoDrop Technologies, USA). RNA reverse transcription was performed using the SuperScript TM kit (Invitrogen, USA) and synthesized cDNA was used to perform qRT-PCR reactions [57] to analyzing the expression of collagen type 1(Col1), osteopontin(OPN), bone sialoprotein(BSP) and Runt-related transcription factor 2(Runx2)(Table 1). Real time-PCR conditions were; 95°C for 1 min, followed by 95°C for 30 s, then 58°C for 40 s, over 35 cycles [58]. The experiments were performed in triplicate. GAPDH served as housekeeping gene. The Ct-method (2 -ΔΔCT ) was adopted for gene expression calculations. Table 1. Primers sequences for qRT-PCR Gene Forward Primer(5’-3’) Reverse Primer (5’-3’) Col1 GCTCCTCTTAGGGGCCACT ATTGGGGACCCTTAGGCCAT OPN GAGGAGGCAGAGCACAGCAT GCAAAAGCAAATCACTGCAATT BSP CTGTAGCACCATTCCACACT ATGGCCTGTGCTTTCTCGAT Runx2 CCCGTGGCCTTCAAGGT CGTTACCCGCCATGACAGTA GAPDH TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG Western blotting Exosomes or proteins extracted from cells were mixed with loading buffer and heated at 95°C for 10 min, then subjected to 10% SDS-PAGE and transferred to PVDF membranes (Millipore, USA). After blocking with a blocking buffer for 60 min, the membranes were incubated with the following primary antibodies at 4°C overnight: CD9, CD63, Calnexin, Col1, OPN, RUNX2, JNK, phosphorylated-JNK, p38, phosphorylated-p38, ERK1/2 and phosphorylated-ERK1/2(Abcam, USA) at a dilution range of 1:500-1:1000. Then the membranes were washed with TBST, incubated with horseradish peroxide-conjugated secondary antibodies for 60 min at room temperature, and exposed to chemiluminescence reagents (Millipore, USA) for visualization. blots were quantified using Image J software, measurements were performed in triplicate. ALP activity assay 100 μl exosomes was added into osteogenic medium, MSCs were harvested at 1, 3, and 5 days after osteogenic induction. ALP activity was determined using an ALP assay kit (Sigma, USA) according to manufacturer’s instructions. BCA protein assay kit (Beyotime, China) was used to calculate total protein content for ALP activity normalization,measurements were performed in triplicate. Calcium mineral deposition Calcium deposits were determined by the Osteogenesis Quantization Kit (Sigma-Aldrich, USA). Briefly, Cells were washed with PBS 3 times. Then cells were fixed with 10% formaldehyde and incubating at room temperature for 15 min. Then cells were washed with distilled water for 3 times and stained with 1x Alizarin Red at room temperature for 20 min. After acid extraction, extracted solution was measured at 405 nm. A serial dilution of ARS standards was prepared for quantitative analysis according manufacturer’s instructions, measurements were performed in triplicate. MAPK signaling inhibition SB203580 (Sigma, USA), a highly selective inhibitor of MAPK was dissolved in DMSO at a stock concentration of 100 mM according to the manufacturer’s protocol. To confirm the involvement of MAPK signaling in the exosomes mediated effects on MSCs, cells were pre-treated with 10 μM of SB203580 or an equal volume of DMSO for 1 h. Subsequently, 100 μl of exosomes (1 × 10 12 particles/ml) or an equal volume of PBS was added to MSCs and cells were cultured for 24 h. then western blotting, ALP activity assay, and calcium deposition assay were performed as described above. Statistical analyses Statistical analysis was performed using SPSS-17.0 software. All data are expressed as the mean ±SD. Statistical analyses were performed with one-way analysis of variance or Student’s t-test. The probability level at which differences were considered statistically significant was P < 0.05. Abbreviations EPCs: Endothelial progenitor cells; MSCs: mesenchymal stem cells; exo: exosomes; ALP: alkaline phosphatase; MAPK: The mitogen-activated protein kinase; PBS: phosphate buffered saline; OPN: osteopontin; BSP: bone sialoprotein; Runx2: Runt-related transcription factor 2; Declarations Ethics approval and consent to participate The project entitled “EPCs derived exosomes promotes critical-sized bone defect regeneration of rats” adhered to the ARRIVE guidelines and was approved by the China Medical University Animal Care and Use Committee in Sep. 2021 (CMU2021284). And we have ensured adherence to the ARRIVE guidelines in reporting our animal experiments. Consent for publication Not applicable. Availability of data and materials The sequence data that support the findings of this study are available to download from https://www.jianguoyun.com/p/DWp-21wQp6uJDRjEw-AFIAA. Competing interests The authors have declared that no competing interests exist. Artificial Intelligence The authors declare that they have not used Artificial Intelligence in this study. Funding The work was supported by Foundation of Liaoning Province Education Administration (LJKZ0772). Authors' contributions Conceived and designed the experiments: XH ML YL JY. Performed the experiments: YL JY JX TS. Analyzed the data: XH ML YL JX. Wrote the manuscript and generated the figures: YL XH ML. All authors approved it for publication. Acknowledgment We thank Dr. Huiling Gao, Northeastern University College of Life and Health Sciences, for assistance with cell culture. We thank Dr. Xiaochong Guo, Department of laboratory animal science, China Medical University, for the assistance with the micro-CT. References Migliorini, F., et al., Autologous Bone Grafting in Trauma and Orthopaedic Surgery: An Evidence-Based Narrative Review. J Clin Med, 2021. 10 (19). Hohmann, E., Editorial Commentary: Go Autologous or Go Home: Open-Wedge High Tibial Osteotomies Do Not Benefit From Synthetic Bone Grafting. Arthroscopy, 2018. 34 (9): p. 2631-2632. Marolt Presen, D., et al., Mesenchymal Stromal Cell-Based Bone Regeneration Therapies: From Cell Transplantation and Tissue Engineering to Therapeutic Secretomes and Extracellular Vesicles. Front Bioeng Biotechnol, 2019. 7 : p. 352. Moreno Sancho, F., et al., Cell-Based Therapies for Alveolar Bone and Periodontal Regeneration: Concise Review. Stem Cells Transl Med, 2019. 8 (12): p. 1286-1295. Polymeri, A., W.V. Giannobile, and D. Kaigler, Bone Marrow Stromal Stem Cells in Tissue Engineering and Regenerative Medicine. Horm Metab Res, 2016. 48 (11): p. 700-713. Mendez-Ferrer, S., et al., Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature, 2010. 466 (7308): p. 829-34. Gnecchi, M., et al., Paracrine Mechanisms of Mesenchymal Stem Cells in Tissue Repair. Methods Mol Biol, 2016. 1416 : p. 123-46. Samsonraj, R.M., et al., Concise Review: Multifaceted Characterization of Human Mesenchymal Stem Cells for Use in Regenerative Medicine. Stem Cells Transl Med, 2017. 6 (12): p. 2173-2185. Wang, X., et al., EPCs enhance angiogenesis in renal regeneration. Oncotarget, 2016. 7 (29): p. 44941-44949. Kaigler, D., et al., Endothelial cell modulation of bone marrow stromal cell osteogenic potential. FASEB J, 2005. 19 (6): p. 665-7. Pang, H., et al., Co-culture with endothelial progenitor cells promotes survival, migration, and differentiation of osteoclast precursors. Biochem Biophys Res Commun, 2013. 430 (2): p. 729-34. Yu, J., et al., Interaction between BMSCs and EPCs promotes IUA angiogenesis via modulating PI3K/Akt/Cox2 axis. Am J Transl Res, 2018. 10 (12): p. 4280-4289. Peng, J., et al., Bone Marrow Mesenchymal Stem Cells and Endothelial Progenitor Cells Co-Culture Enhances Large Segment Bone Defect Repair. J Biomed Nanotechnol, 2019. 15 (4): p. 742-755. Seebach, C., et al., Cell-based therapy by implanted human bone marrow-derived mononuclear cells improved bone healing of large bone defects in rats. Tissue Eng Part A, 2015. 21 (9-10): p. 1565-78. Zigdon-Giladi, H., et al., Co-transplantation of endothelial progenitor cells and mesenchymal stem cells promote neovascularization and bone regeneration. Clin Implant Dent Relat Res, 2015. 17 (2): p. 353-9. Bouland, C., et al., Cross-Talk Between Mesenchymal Stromal Cells (MSCs) and Endothelial Progenitor Cells (EPCs) in Bone Regeneration. Front Cell Dev Biol, 2021. 9 : p. 674084. Bell, B.M., et al., Designer exosomes as next-generation cancer immunotherapy. Nanomedicine, 2016. 12 (1): p. 163-9. Huber, J., et al., Exosomes: A Tool for Bone Tissue Engineering. Tissue Eng Part B Rev, 2022. 28 (1): p. 101-113. Burger, D., et al., Human endothelial colony-forming cells protect against acute kidney injury: role of exosomes. Am J Pathol, 2015. 185 (8): p. 2309-23. Doeppner, T.R., et al., Extracellular Vesicles Improve Post-Stroke Neuroregeneration and Prevent Postischemic Immunosuppression. Stem Cells Transl Med, 2015. 4 (10): p. 1131-43. Xu, J., et al., miRNA-221-3p in Endothelial Progenitor Cell-Derived Exosomes Accelerates Skin Wound Healing in Diabetic Mice. Diabetes Metab Syndr Obes, 2020. 13 : p. 1259-1270. Zeng, C.Y., et al., Cardioprotective Roles of Endothelial Progenitor Cell-Derived Exosomes. Front Cardiovasc Med, 2021. 8 : p. 717536. Vig, S. and M.H. Fernandes, Bone Cell Exosomes and Emerging Strategies in Bone Engineering. Biomedicines, 2022. 10 (4). Le Blanc, K. and L.C. Davies, MSCs-cells with many sides. Cytotherapy, 2018. 20 (3): p. 273-278. Rastegar, F., et al., Mesenchymal stem cells: Molecular characteristics and clinical applications. World J Stem Cells, 2010. 2 (4): p. 67-80. Fazeli, Z., et al., Mesenchymal Stem Cells (MSCs) Therapy for Recovery of Fertility: a Systematic Review. Stem Cell Rev Rep, 2018. 14 (1): p. 1-12. Xu, J., et al., Simvastatin enhances bone marrow stromal cell differentiation into endothelial cells via notch signaling pathway. Am J Physiol Cell Physiol, 2009. 296 (3): p. C535-43. Deng, W., et al., IL6 Receptor Facilitates Adipogenesis Differentiation of Human Mesenchymal Stem Cells through Activating P38 Pathway. Int J Stem Cells, 2019. Cai, R., et al., Matrices secreted during simultaneous osteogenesis and adipogenesis of mesenchymal stem cells affect stem cells differentiation. Acta Biomater, 2016. 35 : p. 185-93. Unger, R.E., E. Dohle, and C.J. Kirkpatrick, Improving vascularization of engineered bone through the generation of pro-angiogenic effects in co-culture systems. Adv Drug Deliv Rev, 2015. 94 : p. 116-25. Bates, B.D., et al., Delayed Endothelial Progenitor Cell Therapy Promotes Bone Defect Repair in a Clinically Relevant Rat Model. Stem Cells Int, 2017. 2017 : p. 7923826. Tamari, T., et al., The Paracrine Role of Endothelial Cells in Bone Formation via CXCR4/SDF-1 Pathway. Cells, 2020. 9 (6). Xu, C., et al., Endothelial progenitor cells promote osteogenic differentiation in co-cultured with mesenchymal stem cells via the MAPK-dependent pathway. Stem Cell Res Ther, 2020. 11 (1): p. 537. Bilko, N.M., et al., Characterization of the interactions between stromal and haematopoietic progenitor cells in expansion cell culture models. Cell Biol Int, 2005. 29 (1): p. 83-6. Jia, Y., et al., Co-cultivation of progenitor cells enhanced osteogenic gene expression and angiogenesis potential in vitro. J Int Med Res, 2021. 49 (4): p. 3000605211004024. Asare-Werehene, M., et al., The exosome-mediated autocrine and paracrine actions of plasma gelsolin in ovarian cancer chemoresistance. Oncogene, 2020. 39 (7): p. 1600-1616. Banizs, A.B., et al., Endocytosis Pathways of Endothelial Cell Derived Exosomes. Mol Pharm, 2018. 15 (12): p. 5585-5590. Qin, Y. and C. Zhang, Endothelial progenitor cellderived extracellular vesiclemeditated celltocell communication regulates the proliferation and osteoblastic differentiation of bone mesenchymal stromal cells. Mol Med Rep, 2017. 16 (5): p. 7018-7024. Jia, Y., et al., Exosomes secreted by endothelial progenitor cells accelerate bone regeneration during distraction osteogenesis by stimulating angiogenesis. Stem Cell Res Ther, 2019. 10 (1): p. 12. Majidinia, M., A. Sadeghpour, and B. Yousefi, The roles of signaling pathways in bone repair and regeneration. J Cell Physiol, 2018. 233 (4): p. 2937-2948. Zhao, P., et al., Exosomes derived from bone marrow mesenchymal stem cells improve osteoporosis through promoting osteoblast proliferation via MAPK pathway. Eur Rev Med Pharmacol Sci, 2018. 22 (12): p. 3962-3970. Lawrence, M.C., et al., The roles of MAPKs in disease. Cell Res, 2008. 18 (4): p. 436-42. Roux, P.P. and J. Blenis, ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev, 2004. 68 (2): p. 320-44. Chang, L. and M. Karin, Mammalian MAP kinase signalling cascades. Nature, 2001. 410 (6824): p. 37-40. Cargnello, M. and P.P. Roux, Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev, 2011. 75 (1): p. 50-83. Pearson, G., et al., Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev, 2001. 22 (2): p. 153-83. Johnson, G.L. and R. Lapadat, Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science, 2002. 298 (5600): p. 1911-2. Cong, Q., et al., p38alpha MAPK regulates proliferation and differentiation of osteoclast progenitors and bone remodeling in an aging-dependent manner. Sci Rep, 2017. 7 : p. 45964. Huang, C.C., et al., Exosomes as biomimetic tools for stem cell differentiation: Applications in dental pulp tissue regeneration. Biomaterials, 2016. 111 : p. 103-115. Liao, Q.C., et al., Genistein stimulates osteoblastic differentiation via p38 MAPK-Cbfa1 pathway in bone marrow culture. Acta Pharmacol Sin, 2007. 28 (10): p. 1597-602. Suzuki, A., et al., Regulation of alkaline phosphatase activity by p38 MAP kinase in response to activation of Gi protein-coupled receptors by epinephrine in osteoblast-like cells. Endocrinology, 1999. 140 (7): p. 3177-82. Wang, Z., et al., Mg(2+) in beta-TCP/Mg-Zn composite enhances the differentiation of human bone marrow stromal cells into osteoblasts through MAPK-regulated Runx2/Osx. J Cell Physiol, 2020. 235 (6): p. 5182-5191. Thouverey, C. and J. Caverzasio, Focus on the p38 MAPK signaling pathway in bone development and maintenance. Bonekey Rep, 2015. 4 : p. 711. He, Y., et al., The co-culture of ASCs and EPCs promotes vascularized bone regeneration in critical-sized bone defects of cranial bone in rats. Stem Cell Res Ther, 2020. 11 (1): p. 338. Robinson, M.D., D.J. McCarthy, and G.K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics, 2010. 26 (1): p. 139-40. Xie, C., et al., KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res, 2011. 39 (Web Server issue): p. W316-22. Yang, S. and Y.P. Li, RGS10-null mutation impairs osteoclast differentiation resulting from the loss of [Ca2+]i oscillation regulation. Genes Dev, 2007. 21 (14): p. 1803-16. He, X., et al., BMP2 genetically engineered MSCs and EPCs promote vascularized bone regeneration in rat critical-sized calvarial bone defects. PLoS One, 2013. 8 (4): p. e60473. Additional Declarations No competing interests reported. Supplementary Files 5AP38.tif 5Aactin.tif OPN.tif 5AERK.tif 5APERK.tif JNK.tif CD63.tif RUNX2.tif OCN.tif CD9.tif calnexin.tif Bactin.tif 5APP38.tif pJNK.tif 5BP38.tif BPP38.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5388213","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":382722004,"identity":"291746cc-05ad-40e6-8ed0-4bab4987ba84","order_by":0,"name":"Yanming Liang","email":"","orcid":"","institution":"Qingdao Stomatological Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yanming","middleName":"","lastName":"Liang","suffix":""},{"id":382722005,"identity":"d761cc49-a522-4b5b-a351-94c3127537a1","order_by":1,"name":"Jiajun Xiao","email":"","orcid":"","institution":"Fourth Affiliated Hospital of China Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiajun","middleName":"","lastName":"Xiao","suffix":""},{"id":382722008,"identity":"a5e0c32b-9231-40dd-b915-92267d445967","order_by":2,"name":"Jiayu Yu","email":"","orcid":"","institution":"Fourth Affiliated Hospital of China Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiayu","middleName":"","lastName":"Yu","suffix":""},{"id":382722009,"identity":"14d6cd6b-19b5-427b-b5e9-d6f03f5fbe94","order_by":3,"name":"Ting Sun","email":"","orcid":"","institution":"Medical College of Jinzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Sun","suffix":""},{"id":382722011,"identity":"355d2bfd-9f3b-47d8-a802-915a7fbad355","order_by":4,"name":"Ming Liu","email":"","orcid":"","institution":"Fourth Affiliated Hospital of China Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Liu","suffix":""},{"id":382722013,"identity":"17a4468a-4170-4547-b667-58531f749dc4","order_by":5,"name":"xiaoning he","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqElEQVRIiWNgGAWjYFACHgaGDxCWAfFaGGeQrIWZhyQtBrd7Dz62qdmW2MDevE2CoeYOYS2Sc84lG+ccu53YwHOsTILh2DPCWvglcsykcxuAWoAMCcaGw4S1sEnkmP+2BGmRf0OkFpAtzIxgW3iI1CI5I8dYsufYbeM2nrRii4RjRGgxuJFj+OFHzW3ZfvbDG298qCFCCxywgYgEEjSMglEwCkbBKMADAGu7NZg96UEEAAAAAElFTkSuQmCC","orcid":"","institution":"Fourth Affiliated Hospital of China Medical University","correspondingAuthor":true,"prefix":"","firstName":"xiaoning","middleName":"","lastName":"he","suffix":""}],"badges":[],"createdAt":"2024-11-04 12:53:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5388213/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5388213/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":70432921,"identity":"1635a6b9-29df-4f78-be08-a5a200ab7239","added_by":"auto","created_at":"2024-12-03 06:28:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5693633,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotype identification of MSCs and EPCs. (A) Flow cytometry analysis for MSCs. Cells were stained positive for MSCs surface markers CD44 and CD90, and negative for CD31 and CD34. (B) Flow cytometry analysis for EPCs. Cells were positive for EPCs surface markers CD34 and CD133 and negative for CD11b and CD31.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/6afb5a9add7da63454853cd6.png"},{"id":70431433,"identity":"3f46deb0-a445-4b0d-a608-cc2c2f332397","added_by":"auto","created_at":"2024-12-03 06:20:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":10837913,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of EPCs-derived exosomes. (A) Exosomes extracted from EPCs were identified by transmission electron microscopy (TEM). Magnification: 60 000×, scale bar=100 nm. (B) Particle size distribution and concentration measured by NTA, reveals a range of sizes distribution displayed approximately 50-150nm. (C) The marker protein levels of CD9 and CD63 by western blot analysis in EPCs‐derived exosomes, cell lysate was used as control. (D) Representative confocal image of PKH67 fluorescently labeled exosomes (green) endocytosed by MSCs. (E) DAPI nuclear staining (blue). (F) Overlay of PKH67 and DAPI staining.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/afb746a6658b054b90244022.png"},{"id":70432923,"identity":"0894b516-031f-491b-bb45-50c1e00c5513","added_by":"auto","created_at":"2024-12-03 06:28:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":10220484,"visible":true,"origin":"","legend":"\u003cp\u003eEPCs promote the osteogenic differentiation of MSCs. (A) Osteogenic differentiation was determined by ALP staining at day 1, 3 and 5 days. Data represents the mean ± SD, n = 3 samples. (B) Expression of the osteogenic genes Col1, OPN, BSP and Runx2 were measured by qRT-PCR at the day 5 after osteogenic differentiation induced (n=3) *p \u0026lt; 0.05. (C) Three-dimensional reconstruction of micro-CT images showed the differences of newly regenerated bone in blank group, MSCs group and MSCs/EPCs-exos group. (D) Sagittal view of micro-CT images. (E) Quantitative analysis of the bone volume/tissue volume (BV/TV). (F) Bone mineral density (BMD) analysis. (G) Histological analysis of newly regenerated bone in defect area.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/76b2ed13012725ed1a3f925e.png"},{"id":70432919,"identity":"72bc7256-6a5d-4702-8a1f-5ecfe7ead77e","added_by":"auto","created_at":"2024-12-03 06:28:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2197686,"visible":true,"origin":"","legend":"\u003cp\u003eDifferentially expressed genes in exosomes stimulated MSCs. (A) Volcano plot of microarray data. The horizontal bar represents the nominal significant level of 0.01 for Student’s t-tests, the vertical dashed bars denote down-regulation (left) or up-regulation (right) (B) KEGG enrichment analyses of targeted genes indicated that the effects of EPCs-exos on the regulation of MSCs are associated with MAPK, ECM-receptor interaction, focal adhesion, PI3K-Akt, complement and coagulation cascades, TGF-β and TNF signaling pathway and so on. (C) Heat map displaying hierarchical clustering of differentially expressed genes related to MAPK signaling pathway from exosomes induced MSCs. Up-regulated genes are shown in red, whereas down-regulated genes are shown in green.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/d605a584c9cb80bc78151b18.png"},{"id":70431432,"identity":"49d9601a-074d-44bf-a60d-79a8b8539878","added_by":"auto","created_at":"2024-12-03 06:20:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3481764,"visible":true,"origin":"","legend":"\u003cp\u003eInvolvement of p38MAPK signaling in the EPCs-exos induced osteogenic responses from MSCs. (A) EPCs-exos induced the activation of the MAPK signaling pathway of MSCs. p38, p-p38, ERK1/2, p-ERK1/2, JNK and p-JNK expression were examined by western blotting. (B) EPCs-exos induced the activation of the p38MAPK signaling pathway and increased the protein levels of osteogenesis-related molecules, these effects were abolished by the p38MAPK inhibitor (SB203580 10μm). (C)ALP staining showed that exosomes induced MSCs showed much higher ALP activity compared with the control, respectively, these effects were inhibited by SB203580. (D) Calcium nodules formation was determined by alizarin red staining. (E) Scanning densitometry of relative protein levels of p-p38, p38, p-ERK1/2, ERK1/2, p-JNK and JNK by immunoblotting, β-actin was used as the internal control, measurements were performed in triplicate. Data are presented as the mean ± SD.*p \u0026lt; 0.05. (F) Scanning densitometry of relative protein levels of Col1, OPN, Runx2, p-p38, p38, β-actin was used as the internal control. Data are presented as the mean ± SD.*p \u0026lt; 0.05. (G) Relative ALP activity (n=3) *p \u0026lt; 0.05. (H) Relative mineralization levels (n=3) *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/7d3c9c7878ecd6403e6fde98.png"},{"id":73399534,"identity":"8ca1e26c-41cf-4772-a35f-0e5a292f31a9","added_by":"auto","created_at":"2025-01-09 14:17:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":27627835,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/671af089-7197-4b29-9029-88ebf77e7ce3.pdf"},{"id":70431430,"identity":"46071a3d-3960-4c15-b416-0e627d6051aa","added_by":"auto","created_at":"2024-12-03 06:20:05","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":282416,"visible":true,"origin":"","legend":"","description":"","filename":"5AP38.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/63b682da71770a1a00a47867.tif"},{"id":70431435,"identity":"8cc32123-f583-4689-b9d4-4eac4219fda7","added_by":"auto","created_at":"2024-12-03 06:20:05","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":368132,"visible":true,"origin":"","legend":"","description":"","filename":"5Aactin.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/fdca3310cd773b56cdbff761.tif"},{"id":70432920,"identity":"5d1d0552-f405-4a42-852c-038007aa679e","added_by":"auto","created_at":"2024-12-03 06:28:05","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":388212,"visible":true,"origin":"","legend":"","description":"","filename":"OPN.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/949e295c594bb64d2ea176ee.tif"},{"id":70432922,"identity":"4e700cf5-13d3-4a35-b026-05c0b056abc0","added_by":"auto","created_at":"2024-12-03 06:28:06","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":361332,"visible":true,"origin":"","legend":"","description":"","filename":"5AERK.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/513051841f734a786192b09e.tif"},{"id":70432928,"identity":"91376c5b-45c4-4ad4-9254-475a17706e18","added_by":"auto","created_at":"2024-12-03 06:28:14","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":403000,"visible":true,"origin":"","legend":"","description":"","filename":"5APERK.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/f3f9558bccd339e9b3cc92ca.tif"},{"id":70431442,"identity":"e1b7578e-fc6c-4458-b3eb-73c0e984b629","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":572008,"visible":true,"origin":"","legend":"","description":"","filename":"JNK.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/a413c7da350b285824e15bc0.tif"},{"id":70431439,"identity":"656c22eb-90e1-4887-95c0-7a6e07d465c0","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":331376,"visible":true,"origin":"","legend":"","description":"","filename":"CD63.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/26d880237419274ad5021c4a.tif"},{"id":70431441,"identity":"a9e710fb-b665-4b2a-ac66-ec4b7de66b77","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":332136,"visible":true,"origin":"","legend":"","description":"","filename":"RUNX2.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/a866e1e9c38a6972bb20ab63.tif"},{"id":70431447,"identity":"84f59e98-1526-4442-9305-3cdbc0ca4b9e","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":904296,"visible":true,"origin":"","legend":"","description":"","filename":"OCN.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/d782d91e763b150454c0753f.tif"},{"id":70431448,"identity":"26da5ff8-d256-4de9-b7f0-6b3769049473","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":539444,"visible":true,"origin":"","legend":"","description":"","filename":"CD9.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/a1969846e6cde58ec52afb20.tif"},{"id":70432924,"identity":"7c9e540b-f826-4a0b-bc14-559480b669f6","added_by":"auto","created_at":"2024-12-03 06:28:06","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":580672,"visible":true,"origin":"","legend":"","description":"","filename":"calnexin.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/eb88bc3d5213195c3623ea84.tif"},{"id":70431444,"identity":"c5862aa5-8306-4eea-a0e6-9fb4a23d5254","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":568908,"visible":true,"origin":"","legend":"","description":"","filename":"Bactin.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/963a0cb3d96a64d6513d3cdf.tif"},{"id":70432925,"identity":"fbf66912-b57b-41c2-919b-3f584aa13693","added_by":"auto","created_at":"2024-12-03 06:28:06","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":564692,"visible":true,"origin":"","legend":"","description":"","filename":"5APP38.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/ed8a1ec7015f90e4548ae48b.tif"},{"id":70431446,"identity":"58f78af0-f7bd-47e9-8359-81afbfb30d49","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":566900,"visible":true,"origin":"","legend":"","description":"","filename":"pJNK.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/01496b86ce1f90a2978e88c4.tif"},{"id":70431438,"identity":"3773082a-161d-4741-bb47-3b921021ab64","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":568580,"visible":true,"origin":"","legend":"","description":"","filename":"5BP38.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/627e6030f48c23bd45a48d83.tif"},{"id":70431450,"identity":"89b9863a-23b7-4f47-b281-a9644585eae4","added_by":"auto","created_at":"2024-12-03 06:20:06","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":1614512,"visible":true,"origin":"","legend":"","description":"","filename":"BPP38.tif","url":"https://assets-eu.researchsquare.com/files/rs-5388213/v1/b3fb52cb9b0148fd3b16692f.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exosomes derived from endothelial progenitor cells enhance osteogenesis of mesenchymal stem cells by activating the MAPK dependent pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBone defects can be caused by various clinical diseases such as trauma, tumor, infections, etc. The effective reconstruction of bone defects, especially the critical-sized defects, is a challenging problem in orthopedic surgery. Autologous bone grafting are the most widely used treatments for bone defect repair, but its availability and its effectiveness is limited by complications such as trauma, infection, and impaired regenerative processes due to osteoporosis[1, 2]. Therefore there is an urgent need to develop new and effective alternatives for bone regeneration. Stem cell-based therapies, which apply a stem cell self-sufficient biological environment and heterogeneity to restore and improve tissue function, have been extensively investigated [3, 4]. Stem cell-based therapies provide an alternative solution for the repair and regeneration of bone defects.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMesenchymal stem cells (MSCs) are isolated from different sources, and differentiated into several lineages under suitable induction conditions [5, 6]. MSCs induce direct effects through cellular signaling via physical contacts, and secrete cytokines for paracrine and autocrine functions, to generate trophic support in bone regeneration [7, 8].\u003c/p\u003e\n\u003cp\u003eEndothelial progenitor cells (EPCs) have the capacity to differentiate into mature endothelial cells, the role of EPCs in vasculogenesis has been studied extensively \u003cem\u003ein vivo and in vitro\u003c/em\u003e[9]. The occurrence of EPCs with MSCs has profound effects on cell proliferation and differentiation [10, 11]. Previous studies showed that co-implantation of EPCs and MSCs improves bone formation significantly [12-14], the positive effects of EPCs on bone regeneration are not only facilitated the vasculogenesis but also by stimulating the osteogenesis via paracrine mechanisms [15, 16]. But the relationship between EPCs and MSCs in osteogenesis is not fully elucidated, an understanding of the cellular and molecular interactions of EPCs and MSCs will enhance the successful development of bone regeneration.\u003c/p\u003e\n\u003cp\u003eExosomes, the naturally secreted nanocarriers from cells, are 50-120 nm nanoparticles originating from multivesicular bodies [17]. Growing evidence suggest that exosomes play key roles in intercellular communication by transferring proteins and genetic information to target cells [18]. It has been reported that exosomes exhibit similar functional properties to the cells from which they are derived [19, 20]. Accumulating evidence has revealed that EPCs-derived exosomes (EPCs-exos) have therapeutic potential in various disease models, such as cardiovascular diseases and diabetic skin wounds [21, 22]. Therefore, EPCs-exos may also play a critical role in cellular crosstalk between EPCs and MSCs and promote MSCs induced bone regeneration.\u003c/p\u003e\n\u003cp\u003eTherefore, we propose to use EPCs-exos and MSCs combination to assess the osteogenesis ability of EPCs-exos induced MSCs, and study their osteogenic interaction to identify gene expression changes and investigate how EPCs-exos influence osteogenic differentiation of MSCs, and to investigate the involvement of mitogen-activated protein kinase (MAPKs) pathways in the osteogenic differentiation.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIsolation and phenotype identification of MSCs and EPCs \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were analyzed and identified by flow cytometry analysis for surface markers at passage four. As shown in Figure 1A, MSCs expressed cell-surface protein profiles, positive for FITC labeled CD44, CD90 and negative for CD31, CD34, while EPCs were positive for CD34, CD133 and negative for CD11b, CD31 (Figure 1B). Indicating that the high purity of the extracted MSCs and EPCs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and identification of EPCs-derived exosomes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe extracted exosomes were characterized using TEM, NanoSight and western blotting. TEM images showed that the isolated exosomes were small closed vesicles which exhibited a round shaped morphology. The diameter of exosomes was approximately 80\u0026thinsp;nm (Figure 2A), which was consistent with the reported size of exosomes[23]. NTA results suggest that the size distribution of EPCs-exos displayed approximately 50-150nm (Figure 2B). The expression of protein CD9, CD63 and Calnexin were detected in these vesicles, but not the protein Calnexin (Figure 2C). These results indicated that the extraction of the exosomes was successful.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEndocytosis of EPCs-derived exosomes in MSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm that EPCs-exos can be internalized by MSCs, EPCs-exos were labeled with PKH67 and observed via laser confocal microscope. Results showed that when add into MSCs for 24 hours, EPCs-exos gathered inside the MSCs, and fluorescence was observed in perinuclear regions (Figure 2D-F), suggesting that EPCs-exos were endocytosed into the MSCs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEPCs-derived exosomes promote osteoclastic differentiation of MSCs in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the functional roles EPC-exos in osteogenesis, MSCs were cultured in osteogenic medium containing 100 \u0026mu;l exosomes (1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e particles/ml) or in equal volume of PBS. Data indicated that EPC-exos significantly enhance MSCs differentiation. ALP staining showed that incubation of MSCs with EPC-exos resulted significant increasing ALP activity (Figure 3A), qRT-PCR was performed to quantitative osteogenic gene expression, including Col1, OPN, BSP and Runx2, to investigate the effects of EPC-exos on MSCs differentiation. Results showed that EPC-exos increased Col1 mRNA expression of MSCs significantly by 58.76% (P \u0026lt; 0.05), OPN, BSP and Runx2 mRNA levels also increased significantly by 34.21%, 28.86% and 43.45% respectively in comparison with control group(Figure 3B). \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEPCs-derived exosomes promote osteoclastic differentiation of MSCs in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the therapeutic potential of EPCs-exos on bone repair, the rat critical-sized calvarial bone defect model was established and the MSCs/EPCs-exos combined with scaffolds were implanted into the defect areas. After 8 weeks, animals were euthanized with CO\u003csub\u003e2\u003c/sub\u003e and the craniums were harvested for micro CT to qualitatively evaluate the newly formed bone within the defects. Three-dimensional reconstruction and sagittal images view of micro-CT images showed the newly regenerated bone in MSCs group, while a larger amount of de novo bone formation with complete closure in the calvarial defect sites in MSCs/EPCs-exos group (Figure 3C, D). This was confirmed by a quantitative analysis of the BV/TV (Figure 3E), which showed an increased new bone formation in the exosomes functionalized group as compared to the control. Furthermore, the local BMDs showed the same tendency as that obtained for the BV/TV levels, BMD in MSCs/EPCs-exos group was significantly higher than that in the other groups (Figure 3F). Moreover, histological evidence demonstrated that exosomes treatment increased the newly formed bone tissues within the defect areas, as determined by the percentage of new bone area (Figure 3G). Indicate that MSCs/EPCs-exos combination exhibited robust osteogenic activity and could improve bone regeneration in the defect areas.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDifferentially expressed genes in MSCs stimulated by exosomes \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the effector genes that respond to EPC-exos stimulation, microarray analyses were performed to identify the differentially-regulated genes in MSCs incubated with exosomes or PBS. Results showed that there was a significant differential expression of 1321 candidate genes between the two groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Volcano plot revealed that out of 1321 differentially expressed genes, 456 were up regulated (red) and 865 genes were down regulated (green) (Figure 4A). KEGG enrichment analyses of differentially expressed genes demonstrated that that multiple biological pathways were prominently enriched (Enrichment Score \u0026gt;2.0, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Signaling pathways, including MAPK, ECM-receptor interaction, focal adhesion, PI3K-Akt, TGF-\u0026beta; and TNF signaling pathway were regulated by EPCs-exos (Figure 4B). Among these pathways, MAPK was appeared to be the most enriched one. Heat map displaying hierarchical clustering of differentially expressed genes related to MAPK signaling pathway (Figure 4C). These results provided basic data for our further investigation. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInvolvement of MAPK signaling pathway in the EPCs-derived exosomes induced osteogenic responses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe activation of the MAPK pathway in MSCs following EPCs-exos stimulation was verified by Western blotting. The protein and their phosphorylated protein levels of p38, ERK1/2 and JNK were assessed. Compared to the PBS control, incubation with EPCs-exos resulted in a significant increase in p38 MAPK phosphorylation in MSCs, while ERK1/2 and JNK phosphorylation levels were not significantly altered (Figure 5A, E), indicating that the p38 MAPK signaling in MSCs was activated by the EPCs-exos. However, the upregulation of p-p38 MAPK in MSCs by the exosomes was significantly impaired after the MSCs were cultured with a p38 inhibitor (SB203580, 10 \u0026mu;M) (Figure 5B, F).\u003c/p\u003e\n\u003cp\u003eNext we examined the effects of p38 MAPK on the osteogenic differentiation of MSCs. As shown in Figure 5B, after incubation of MSCs with EPCs-exos, the levels of these osteogenesis-related proteins including Col1, Runx2, and OPN were further increased. However, their upregulation by EPCs-exos was markedly suppressed by the p38 inhibitor SB203580 (Figure 5B, F).\u003c/p\u003e\n\u003cp\u003eAlso, we evaluated the ALP activity and calcium mineral deposition in EPCs-exos induced MSCs. As shown in results, the exosomes treated MSCs showed significantly higher expression of ALP than control group, whereas these effects were blocked by p38 inhibitor (Figure 5C, G). The calcium nodule formations were also reduced dramatically in EPCs-exos induced MSCs when treated with SB203580, which was consistent with the data from osteogenesis-related protein expression (Figure 5D, H).\u003c/p\u003e\n\u003cp\u003eTaken together, our results indicated that the stimulatory effects of EPCs-exos on the osteogenic differentiation of MSCs mainly resulted from the activation of the p38 MAPK signaling pathway.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eStem cell-based therapy is a promising strategy in bone regeneration. Among cells with therapeutic potential, MSCs have gained much interest[24]. MSCs are regarded as suitable cell sources for bone tissue engineering owing to their ability of multipotential differentiation. [25, 26]. The ability of MSCs to differentiate into multiple lineages is controlled by various inhibitors and stimulators, which have been studied by in vivo or in vitro [27, 28]. Enhanced MSCs osteogenic differentiation can be achieved by various methods, such as electrical stimulation, chemical supplements, or using assisting cells [29, 30]. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEPCs are believed to promote bone regeneration by stimulating neovascularization and osteogenesis. EPCs contribute to the formation of new blood vessels and indirectly contribute to the formation of new bone during bone repair[31]. In previous studies, researchers found that EPCs enhance osteogenesis by stimulating proliferation of surrounding cells via a paracrine effect [32]. Our research also proved that when co-cultured with EPCs, MSCs exhibited accelerated bone regeneration [33], suggest there were cellular interactions take place between MSCs and EPCs in osteogenesis [34, 35]. Cellar interactions are complex and incomprehensible processes, studies are required to characterize these processes in bone regeneration.\u003c/p\u003e\n\u003cp\u003ePrevious studies indicate that EPCs enhance osteogenesis via paracrine mechanisms [33], while exosomes are important paracrine factors [36]. So we speculate that exosomes might mediate osteogenesis process of MSCs. Exosomes, ranging in size from 50\u0026ndash;120 nm, are micro vesicles that are secreted by cells to facilitate inter cellular communication. Exosomes deliver various content including DNAs, RNAs and proteins and provide a novel way to stimulate bone regeneration[23]. In this study we extracted exosomes from EPCs and characterized exosomes using TEM, NanoSight and western blotting. Our data demonstrated that the isolated EPCs-exos exhibited a round shaped morphology with expression of protein CD9 and CD63. The diameter of exosomes was approximately 90\u0026thinsp;nm and the size distribution of EPCs-exos displayed approximately 50-150nm. These results indicated that the extraction of the exosomes was successful.\u003c/p\u003e\n\u003cp\u003eIt has been proposed that exosomes serve as a carrier to transfer lipids, nucleic acids, proteins, and signaling molecules to target cells and mediate genes and proteins to modulating the bioactivity of receptor cells [\u003ca href=\"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5028974/#CR42\"\u003e42\u003c/a\u003e]. Endocytosis of exosomes can facilitate the absorption of proteins, lipids and nucleic acids, thereby affecting target cells [37]. So the exosomes internalization by target cells is the prerequisite for playing such a role. In the present study, MSCs was cultured with PKH67-labeled exosomes and observed with laser confoncal microscope. The labeled exosomes can be seen in perinuclear regions of MSCs, indicating exosomes were endocytosed into the MSCs\u003c/p\u003e\n\u003cp\u003eTo explore the functional roles EPC-exos in osteogenesis, MSCs were cultured in osteogenic medium containing exosomes or PBS \u003cem\u003ein vitro\u003c/em\u003e. Data indicated that EPC-exos enhance MSC differentiation, ALP activity was significantly increased. qRT-PCR showed that osteogenic gene expression, including Col1, Runx2, OPN and BSP, increased significantly in comparison with control group. Rat critical-sized calvarial bone defect model was established and MSCs were implanted into the defect areas combined with EPCs-exos. After 8 weeks, micro CT showed that a large amount of de novo bone formation was observed in the defect sites in EPCs-exos /MSCs group, with complete closure of bony defects. The BMD in EPCs-exos /MSCs group was significantly higher than that in the other groups. Results were confirmed by a quantitative analysis of the BV/TV and histological evidence. Similar with previous studies, Qin et al found that EPCs-exos significantly promote MSCs proliferation, differentiation and the expression of osteogenic genes [38]. EPCs-exos transplantation could significantly accelerate bone regeneration in rats [39]. Suggests that EPCs-exos was sufficient to promote MSCs osteogenic differentiation in vitro and improve ossification in the defect region in vivo.\u003c/p\u003e\n\u003cp\u003eOsteogenic differentiation processes involves transcription factors and signaling pathways, which transmit molecular information to allow cells react to external stimulation [40]. To determine the candidate signaling pathways potentially involved in EPC-exos stimulation, microarray analyses were performed to identify the differentially-regulated genes in MSCs cultured with exosomes. Result revealed that out of 1321 differentially expressed genes, 456 were up regulated in MSCs and 865 genes were down regulated. KEGG enrichment analyses of targeted genes indicated that the effects of EPCs-exos on the regulation of MSCs biological properties are most associated with MAPK signaling pathway, ECM-receptor interaction, focal adhesion, PI3K-Akt signaling pathway, TGF-\u0026beta; and TNF signaling pathway and so on. Among these pathways, MAPK signaling pathway was primarily affected by EPCs-exos. This results was consistent with previous studies, which reported that MSCs-derived exosomes promoted the proliferation of osteoblast via MAPK pathway [41], and provided basic data for our further investigation. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMitogen-activated protein kinases (MAPK) signaling occurs in many cells, and plays important roles in controlling cell proliferation, and are involved in multiple cellular pathways and functions [42-44]. MAPK functions are mediated via the phosphorylation of several substrates, including phospholipases, transcription factors and cytoskeletal proteins [45]. Studies have demonstrated that gene expression and function of osteoblasts are related to p38 MAPK, which was activated by stress and cytokines [46].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIt was reported that p38MAPK signaling pathway is involved in osteoblast proliferation and differentiation [47, 48]. MSCs endocytosed exosomes via the caveolar will trigger the activation of p38MAPK pathway by phosphorylating mechanism [49]. Our experiments also provide similar results, incubation with EPCs-exos resulted in a significant increase in p38 MAPK phosphorylation in MSCs, while ERK1/2 and JNK phosphorylation levels were not significantly altered. To further investigate whether EPCs-exos promotes the osteogenic differentiation of MSCs via p38MAPK signaling, EPCs-exos and specific p38MAPK inhibitor, SB203580, was used to confirm the hypothesis. Results showed that EPCs-exos increased p38 phosphorylation levels and significantly increased Col I, OPN and Runx2 protein production. EPCs-exos were also enhanced MSCs mineralization and ALP activity. While p38 inhibitor decreased p38 phosphorylation levels and reduced Col I, OPN and Runx2 protein production significantly, and suppressed ALP levels and calcium nodule formation. Previous researches revealed that p38MAPK participates in ALP regulation during osteoblast differentiation, and is necessary for BSP and OPN expression, via p38MAPK activation [50, 51]. p38MAPK promotes MSCs osteogenic differentiation via regulating Runx2/Osx [52], while lack of p38\u0026alpha; results a defective osteoblast differentiation in pre-osteoblasts, as evidenced by reduced expressions of Col 1, ALP, \u0026nbsp;and OCN [53]. So based on our results and these studies, we speculate EPCs-exos enhance MSCs osteogenic differentiation via the p38MAPK signaling pathway.\u003c/p\u003e\n\u003cp\u003eAll these results suggested that important interactions occur between EPCs-exos and MSCs via p38MAPK signaling pathway. The findings of this present study may promote the understanding of osteogenic differentiation mechanisms, which may lead to the development of bone regeneration. But this study only explores the role of EPCs-exos in inducing osteogenic differentiation of MSCs. Further studies are required to characterize the mechanism by which exosomes control MSCs differentiation and the exosomal miRNAs and proteins that contribute towards this process, to better understand the molecular mechanisms that mediate MSCs differentiation and to elucidate the roles of EPCs-exos in the processes.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results of this research support the concept that EPCs-exos can enhance\u0026nbsp;MSCs osteogenic differentiation \u003cem\u003ein vitro and in vivo.\u0026nbsp;\u003c/em\u003eEPCs-exos have profound effects on differentiation of MSCs and significantly promoted MSCs osteogenic gene expression and protein synthesis. ALP activity and calcium nodule formation were increased significantly. Activation of the p38MAPK signaling pathway may be the key to enhancing MSCs osteogenic differentiation. Further insights into the exosome-mediated paracrine induction will be invaluable for understanding cell dynamics and ultimately leading to more rational tissue engineering strategies.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eEthics approvals and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe project entitled \u0026ldquo;EPCs derived exosomes promotes critical-sized bone defect regeneration of rats\u0026rdquo; was approved by the China Medical University Animal Care and Use Committee in Sep. 2021 (CMU2021284). All procedures were conducted in full compliance with the ARRIVE guidelines. Specific-Pathogen Free (SPF) SD rats were purchased from Beijing Hfk Bioscience (China). We have ensured all methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of MSCs and EPCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the China Medical University Animal Care and Use Committee. 4-6 weeks old Sprague-Dawley (SD) rats were euthanized by CO\u003csub\u003e2\u003c/sub\u003e. Rat femurs and tibias were dissected and bone marrow cells were collected in sterile PBS. MSCs were separated by density gradient centrifugation with Histopaque-1083 (1.077g/ml, Sigma-Aldrich, USA) at 400g for 20 min and cultured in a flask at a density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003ecells/ml at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. The cells will be passaged using TrypLE express (Invitrogen, USA) when the confluency reached 70-80%.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEPC preparation and culture were performed as previously described [54]. Briefly, bone marrow mononuclear cells were harvested and washed twice in PBS, and suspended in EPC media (EGM-2 media supplemented with growth factor bullet kit (Lonza, Germany), at a density of 1x10\u003csup\u003e6\u003c/sup\u003e cells/ml. Non-adherent cells were removed after 24 h incubation at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were passaged when they reached 80\u0026ndash;90\u0026nbsp;% confluency.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhenotype Identification of MSCs and EPCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsually, cells at passage 4 exhibited a typical MSCs/EPCs like morphology and were used for cell surface marker identification by flow cytometry analysis. Briefly, 1\u0026times;\u0026thinsp;106 cells were fixed with 4 % paraformaldehyde for 15 min, blocked with 3 % BSA in PBS for 30 min, and incubated with primary antibodies. MSCs were stained with FITC-conjugated rat anti-CD44, FITC-conjugated rat anti-CD90, FITC-conjugated rat anti-CD31 and FITC-conjugated rat anti-CD34 antibodies at a concentration of 2 mg/ml at 4\u0026deg;C. EPCs were stained with rat anti-CD31, rat anti-CD34, FITC-conjugated rat anti-CD11b and FITC-conjugated rat anti-CD133, Mouse IgG was served as negative controls. Cells were examined by flow cytometry with 10,000 events recorded for each condition. The results were analyzed by Flowjo software 10.0. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and identification of EPCs-Exos\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhen EPCs were 80\u0026ndash;90\u0026nbsp;% confluent, the culture medium was replaced by the serum-free MSC medium cultured for an additional 48\u0026nbsp;h. exosomes were isolated from EPCs supernatant. The supernatant was moved to new tubes for centrifugation at 300g for 10\u0026thinsp;min and 2000g 20min at 4\u0026thinsp;\u0026deg;C to remove dead cells and cellular debris. The supernatant was then centrifuged at 16500g for 30\u0026thinsp;min at 4\u0026thinsp;\u0026deg;C and filtered by using a 0.22-\u0026mu;m filter. Afterwards, the supernatant was moved to new tubes for ultracentrifugation at 100000g for 70\u0026thinsp;min at 4\u0026thinsp;\u0026deg;C to pellet the exosomes. The precipitate was resuspended in 10\u0026nbsp;ml PBS and ultracentrifugation was performed again. All procedures were performed at 4\u0026nbsp;\u0026deg;C. The obtained pellets was resuspended with PBS and stored at \u0026minus;\u0026thinsp;80\u0026thinsp;\u0026deg;C for further experiments. Exosomes were identified by nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM) and western blotting.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInternalization of exosomes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEndocytosis\u0026nbsp;of\u0026nbsp;exosomes\u0026nbsp;in MSCs was confirmed by laser confocal microscope. Exosomes derived from EPCs were labeled with PKH67 (Sigma-Aldrich, Germany). Then, MSCs was cultured with PKH67-labeled exosomes for 24\u0026thinsp;h followed by 4% paraformaldehyde fixation for 15\u0026thinsp;min. After washed by PBS for three times, the nuclei were stained by Hoechest at room temperature for 30\u0026thinsp;min. Finally, MSCs were observed via a laser confocal microscope (Olympus, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals and treatments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecific-Pathogen Free (SPF) SD rats were purchased from Beijing Hfk Bioscience (China). The in vivo experimental protocol was were approved by the China Medical University Animal Care and Use Committee(CMU2021284) All procedures were conducted in full compliance with the ARRIVE guidelines. We have ensured all methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003eBriefly, 21 male SD rats, each weighing approximately 260-280g, were randomly assigned to three groups after sample size calculation. The rats were anesthetized with 5% isoflurane gas inspiration by using facial mask. After the skin was prepped and sterilized, an incision was made with full thickness reflection of the skin and the periosteum, to expose the calvarium, then an 8 mm critical size defects were created with trephone bur under constant PBS irrigation. The rats were randomly divided into three groups: the PBS group, MSCs group, and MSC/EPCs-exos group (100\u0026mu;l, 1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e particles/ml). After surgery, each rat was in a separate cage,\u0026nbsp;buprenornhine was used to minimize pain or discomfort and\u0026nbsp;rats\u0026nbsp;were monitored for signs of infection. At the end of the 8-week period, animals were euthanized\u0026nbsp;with CO\u003csub\u003e2\u003c/sub\u003e and the craniums were harvested for micro CT at 20 \u0026mu;m resolution under radiation source of 70 kV and 200 \u0026mu;A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene expression profiling and bioinformatics analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e3 wells of MSC/EPCs-exos were prepared for microarray analysis and MSCs were used as control. Cells were cultured with osteogenic differentiation medium which refreshed every 3\u0026thinsp;days. 14 days later, total RNA was extracted using TRIzol\u0026reg; Reagent according the manufacturer\u0026rsquo;s instructions (Invitrogen, USA) and genomic DNA was removed using DNase I (TaKara, Japan). An RNA-seq transcriptome library was prepared following instructions from the TruSeqTM RNA sample preparation Kit (Illumina, USA). Libraries were size selected for cDNA target fragments of 200\u0026ndash;300 base pairs (bp) on 2% low range ultra agarose, followed by PCR amplification. After quantification, the paired-end RNA-seq library was sequenced on the Illumina Novaseq 6000 (2 \u0026times; 150 bp read length). The expression level of each transcript was calculated according to the FPKM method. EdgeR was used for differential expression analysis [55]. KEGG pathway analyses were conducted on KOBAS (http://kobas.cbi.pku.edu.cn/download.php) [56]. Microarray data were analyzed on the Majorbio online platform (www.majorbio.com).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription-polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated after 14 days incubation. RNA was quantified using the Nanodrop ND-2000 (NanoDrop Technologies, USA). RNA reverse transcription was performed using the SuperScript\u003csup\u003eTM\u0026nbsp;\u003c/sup\u003ekit (Invitrogen, USA) and synthesized cDNA was used to perform qRT-PCR reactions [57] to analyzing the expression of collagen type 1(Col1), osteopontin(OPN), bone sialoprotein(BSP) and Runt-related transcription factor 2(Runx2)(Table 1). Real time-PCR conditions were; 95\u0026deg;C for 1 min, followed by 95\u0026deg;C for 30 s, then 58\u0026deg;C for 40 s, over 35 cycles [58]. The experiments were performed in triplicate. GAPDH served as housekeeping gene. The Ct-method (2\u003csup\u003e-\u0026Delta;\u0026Delta;CT\u003c/sup\u003e) was adopted for gene expression calculations.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. Primers sequences for qRT-PCR\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"584\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eGene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eForward Primer(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eReverse Primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eCol1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eGCTCCTCTTAGGGGCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eATTGGGGACCCTTAGGCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eOPN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eGAGGAGGCAGAGCACAGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eGCAAAAGCAAATCACTGCAATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eBSP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eCTGTAGCACCATTCCACACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eATGGCCTGTGCTTTCTCGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eRunx2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eCCCGTGGCCTTCAAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eCGTTACCCGCCATGACAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 70px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 249px;\"\u003e\n \u003cp\u003eTGTGTCCGTCGTGGATCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 265px;\"\u003e\n \u003cp\u003eTTGCTGTTGAAGTCGCAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExosomes or proteins extracted from cells were mixed with loading buffer and heated at 95\u0026deg;C for 10\u0026nbsp;min, then subjected to 10% SDS-PAGE and transferred to PVDF membranes (Millipore, USA). After blocking with a blocking buffer for 60\u0026nbsp;min, the membranes were incubated with the following primary antibodies at 4\u0026deg;C overnight: CD9, CD63, Calnexin, Col1, OPN, RUNX2, JNK, phosphorylated-JNK, p38, phosphorylated-p38, ERK1/2 and phosphorylated-ERK1/2(Abcam, USA) at a dilution range of 1:500-1:1000. Then the membranes were washed with TBST, incubated with horseradish peroxide-conjugated secondary antibodies for 60 min at room temperature, and exposed to chemiluminescence reagents (Millipore, USA) for visualization. blots were quantified using Image J software, measurements were performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eALP activity assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e100 \u0026mu;l exosomes was added into osteogenic medium, MSCs were harvested at 1, 3, and 5 days after osteogenic induction. ALP activity was determined using an ALP assay kit (Sigma, USA) according to manufacturer\u0026rsquo;s instructions. BCA protein assay kit (Beyotime, China) was used to calculate total protein content for ALP activity normalization,measurements were performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCalcium mineral deposition\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCalcium deposits were determined by the Osteogenesis Quantization Kit (Sigma-Aldrich, USA). Briefly, Cells were washed with PBS 3 times. Then cells were fixed with 10% formaldehyde and incubating at room temperature for 15 min. Then cells were washed with distilled water for 3 times and stained with 1x Alizarin Red at room temperature for 20 min. After acid extraction, extracted solution was measured at 405 nm. A serial dilution of ARS standards was prepared for quantitative analysis according manufacturer\u0026rsquo;s instructions, measurements were performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAPK signaling inhibition\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSB203580 (Sigma, USA), a highly selective inhibitor of MAPK was dissolved in DMSO at a stock concentration of 100\u0026nbsp;mM according to the manufacturer\u0026rsquo;s protocol. To confirm the involvement of MAPK signaling in the exosomes mediated effects on MSCs, cells were pre-treated with 10\u0026nbsp;\u0026mu;M of SB203580 or an equal volume of DMSO for 1\u0026nbsp;h. Subsequently, 100 \u0026mu;l of exosomes (1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e particles/ml) or an equal volume of PBS was added to MSCs and cells were cultured for 24 h. then western blotting, ALP activity assay, and calcium deposition assay were performed as described above.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was performed using SPSS-17.0 software. All data are expressed as the mean \u0026plusmn;SD. Statistical analyses were performed with one-way analysis of variance or Student\u0026rsquo;s t-test. The probability level at which differences were considered statistically significant was P \u0026lt; 0.05. \u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEPCs: Endothelial progenitor cells; MSCs: mesenchymal stem cells; exo: exosomes; ALP: alkaline phosphatase; MAPK: The mitogen-activated protein kinase; PBS: phosphate buffered saline; OPN: osteopontin; BSP: bone sialoprotein; Runx2: \u0026nbsp;Runt-related transcription factor 2;\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe project entitled \u0026ldquo;EPCs derived exosomes promotes critical-sized bone defect regeneration of rats\u0026rdquo; adhered to the ARRIVE guidelines and was approved by the China Medical University Animal Care and Use Committee in Sep. 2021 (CMU2021284). And we have ensured adherence to the ARRIVE guidelines in reporting our animal experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence data that support the findings of this study are available to download from https://www.jianguoyun.com/p/DWp-21wQp6uJDRjEw-AFIAA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe\u0026nbsp;authors\u0026nbsp;have declared that\u0026nbsp;no\u0026nbsp;competing\u0026nbsp;interests\u0026nbsp;exist.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eArtificial Intelligence\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not used Artificial Intelligence in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe work was supported by Foundation of Liaoning Province Education Administration (LJKZ0772). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceived and designed the experiments: XH ML YL JY. Performed the experiments: YL JY JX TS. Analyzed the data: XH ML YL JX. Wrote the manuscript and generated the figures: YL XH ML. All authors approved it for publication. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Huiling Gao, Northeastern University College of Life and Health Sciences, for assistance with cell culture. We thank Dr. Xiaochong Guo, Department of laboratory animal science, China Medical University, for the assistance with the micro-CT. \u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMigliorini, F., et al., \u003cem\u003eAutologous Bone Grafting in Trauma and Orthopaedic Surgery: An Evidence-Based Narrative Review.\u003c/em\u003e J Clin Med, 2021. \u003cstrong\u003e10\u003c/strong\u003e(19).\u003c/li\u003e\n\u003cli\u003eHohmann, E., \u003cem\u003eEditorial Commentary: Go Autologous or Go Home: Open-Wedge High Tibial Osteotomies Do Not Benefit From Synthetic Bone Grafting.\u003c/em\u003e Arthroscopy, 2018. \u003cstrong\u003e34\u003c/strong\u003e(9): p. 2631-2632.\u003c/li\u003e\n\u003cli\u003eMarolt Presen, D., et al., \u003cem\u003eMesenchymal Stromal Cell-Based Bone Regeneration Therapies: From Cell Transplantation and Tissue Engineering to Therapeutic Secretomes and Extracellular Vesicles.\u003c/em\u003e Front Bioeng Biotechnol, 2019. \u003cstrong\u003e7\u003c/strong\u003e: p. 352.\u003c/li\u003e\n\u003cli\u003eMoreno Sancho, F., et al., \u003cem\u003eCell-Based Therapies for Alveolar Bone and Periodontal Regeneration: Concise Review.\u003c/em\u003e Stem Cells Transl Med, 2019. \u003cstrong\u003e8\u003c/strong\u003e(12): p. 1286-1295.\u003c/li\u003e\n\u003cli\u003ePolymeri, A., W.V. Giannobile, and D. Kaigler, \u003cem\u003eBone Marrow Stromal Stem Cells in Tissue Engineering and Regenerative Medicine.\u003c/em\u003e Horm Metab Res, 2016. \u003cstrong\u003e48\u003c/strong\u003e(11): p. 700-713.\u003c/li\u003e\n\u003cli\u003eMendez-Ferrer, S., et al., \u003cem\u003eMesenchymal and haematopoietic stem cells form a unique bone marrow niche.\u003c/em\u003e Nature, 2010. \u003cstrong\u003e466\u003c/strong\u003e(7308): p. 829-34.\u003c/li\u003e\n\u003cli\u003eGnecchi, M., et al., \u003cem\u003eParacrine Mechanisms of Mesenchymal Stem Cells in Tissue Repair.\u003c/em\u003e Methods Mol Biol, 2016. \u003cstrong\u003e1416\u003c/strong\u003e: p. 123-46.\u003c/li\u003e\n\u003cli\u003eSamsonraj, R.M., et al., \u003cem\u003eConcise Review: Multifaceted Characterization of Human Mesenchymal Stem Cells for Use in Regenerative Medicine.\u003c/em\u003e Stem Cells Transl Med, 2017. \u003cstrong\u003e6\u003c/strong\u003e(12): p. 2173-2185.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., \u003cem\u003eEPCs enhance angiogenesis in renal regeneration.\u003c/em\u003e Oncotarget, 2016. \u003cstrong\u003e7\u003c/strong\u003e(29): p. 44941-44949.\u003c/li\u003e\n\u003cli\u003eKaigler, D., et al., \u003cem\u003eEndothelial cell modulation of bone marrow stromal cell osteogenic potential.\u003c/em\u003e FASEB J, 2005. \u003cstrong\u003e19\u003c/strong\u003e(6): p. 665-7.\u003c/li\u003e\n\u003cli\u003ePang, H., et al., \u003cem\u003eCo-culture with endothelial progenitor cells promotes survival, migration, and differentiation of osteoclast precursors.\u003c/em\u003e Biochem Biophys Res Commun, 2013. \u003cstrong\u003e430\u003c/strong\u003e(2): p. 729-34.\u003c/li\u003e\n\u003cli\u003eYu, J., et al., \u003cem\u003eInteraction between BMSCs and EPCs promotes IUA angiogenesis via modulating PI3K/Akt/Cox2 axis.\u003c/em\u003e Am J Transl Res, 2018. \u003cstrong\u003e10\u003c/strong\u003e(12): p. 4280-4289.\u003c/li\u003e\n\u003cli\u003ePeng, J., et al., \u003cem\u003eBone Marrow Mesenchymal Stem Cells and Endothelial Progenitor Cells Co-Culture Enhances Large Segment Bone Defect Repair.\u003c/em\u003e J Biomed Nanotechnol, 2019. \u003cstrong\u003e15\u003c/strong\u003e(4): p. 742-755.\u003c/li\u003e\n\u003cli\u003eSeebach, C., et al., \u003cem\u003eCell-based therapy by implanted human bone marrow-derived mononuclear cells improved bone healing of large bone defects in rats.\u003c/em\u003e Tissue Eng Part A, 2015. \u003cstrong\u003e21\u003c/strong\u003e(9-10): p. 1565-78.\u003c/li\u003e\n\u003cli\u003eZigdon-Giladi, H., et al., \u003cem\u003eCo-transplantation of endothelial progenitor cells and mesenchymal stem cells promote neovascularization and bone regeneration.\u003c/em\u003e Clin Implant Dent Relat Res, 2015. \u003cstrong\u003e17\u003c/strong\u003e(2): p. 353-9.\u003c/li\u003e\n\u003cli\u003eBouland, C., et al., \u003cem\u003eCross-Talk Between Mesenchymal Stromal Cells (MSCs) and Endothelial Progenitor Cells (EPCs) in Bone Regeneration.\u003c/em\u003e Front Cell Dev Biol, 2021. \u003cstrong\u003e9\u003c/strong\u003e: p. 674084.\u003c/li\u003e\n\u003cli\u003eBell, B.M., et al., \u003cem\u003eDesigner exosomes as next-generation cancer immunotherapy.\u003c/em\u003e Nanomedicine, 2016. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 163-9.\u003c/li\u003e\n\u003cli\u003eHuber, J., et al., \u003cem\u003eExosomes: A Tool for Bone Tissue Engineering.\u003c/em\u003e Tissue Eng Part B Rev, 2022. \u003cstrong\u003e28\u003c/strong\u003e(1): p. 101-113.\u003c/li\u003e\n\u003cli\u003eBurger, D., et al., \u003cem\u003eHuman endothelial colony-forming cells protect against acute kidney injury: role of exosomes.\u003c/em\u003e Am J Pathol, 2015. \u003cstrong\u003e185\u003c/strong\u003e(8): p. 2309-23.\u003c/li\u003e\n\u003cli\u003eDoeppner, T.R., et al., \u003cem\u003eExtracellular Vesicles Improve Post-Stroke Neuroregeneration and Prevent Postischemic Immunosuppression.\u003c/em\u003e Stem Cells Transl Med, 2015. \u003cstrong\u003e4\u003c/strong\u003e(10): p. 1131-43.\u003c/li\u003e\n\u003cli\u003eXu, J., et al., \u003cem\u003emiRNA-221-3p in Endothelial Progenitor Cell-Derived Exosomes Accelerates Skin Wound Healing in Diabetic Mice.\u003c/em\u003e Diabetes Metab Syndr Obes, 2020. \u003cstrong\u003e13\u003c/strong\u003e: p. 1259-1270.\u003c/li\u003e\n\u003cli\u003eZeng, C.Y., et al., \u003cem\u003eCardioprotective Roles of Endothelial Progenitor Cell-Derived Exosomes.\u003c/em\u003e Front Cardiovasc Med, 2021. \u003cstrong\u003e8\u003c/strong\u003e: p. 717536.\u003c/li\u003e\n\u003cli\u003eVig, S. and M.H. Fernandes, \u003cem\u003eBone Cell Exosomes and Emerging Strategies in Bone Engineering.\u003c/em\u003e Biomedicines, 2022. \u003cstrong\u003e10\u003c/strong\u003e(4).\u003c/li\u003e\n\u003cli\u003eLe Blanc, K. and L.C. Davies, \u003cem\u003eMSCs-cells with many sides.\u003c/em\u003e Cytotherapy, 2018. \u003cstrong\u003e20\u003c/strong\u003e(3): p. 273-278.\u003c/li\u003e\n\u003cli\u003eRastegar, F., et al., \u003cem\u003eMesenchymal stem cells: Molecular characteristics and clinical applications.\u003c/em\u003e World J Stem Cells, 2010. \u003cstrong\u003e2\u003c/strong\u003e(4): p. 67-80.\u003c/li\u003e\n\u003cli\u003eFazeli, Z., et al., \u003cem\u003eMesenchymal Stem Cells (MSCs) Therapy for Recovery of Fertility: a Systematic Review.\u003c/em\u003e Stem Cell Rev Rep, 2018. \u003cstrong\u003e14\u003c/strong\u003e(1): p. 1-12.\u003c/li\u003e\n\u003cli\u003eXu, J., et al., \u003cem\u003eSimvastatin enhances bone marrow stromal cell differentiation into endothelial cells via notch signaling pathway.\u003c/em\u003e Am J Physiol Cell Physiol, 2009. \u003cstrong\u003e296\u003c/strong\u003e(3): p. C535-43.\u003c/li\u003e\n\u003cli\u003eDeng, W., et al., \u003cem\u003eIL6 Receptor Facilitates Adipogenesis Differentiation of Human Mesenchymal Stem Cells through Activating P38 Pathway.\u003c/em\u003e Int J Stem Cells, 2019.\u003c/li\u003e\n\u003cli\u003eCai, R., et al., \u003cem\u003eMatrices secreted during simultaneous osteogenesis and adipogenesis of mesenchymal stem cells affect stem cells differentiation.\u003c/em\u003e Acta Biomater, 2016. \u003cstrong\u003e35\u003c/strong\u003e: p. 185-93.\u003c/li\u003e\n\u003cli\u003eUnger, R.E., E. Dohle, and C.J. Kirkpatrick, \u003cem\u003eImproving vascularization of engineered bone through the generation of pro-angiogenic effects in co-culture systems.\u003c/em\u003e Adv Drug Deliv Rev, 2015. \u003cstrong\u003e94\u003c/strong\u003e: p. 116-25.\u003c/li\u003e\n\u003cli\u003eBates, B.D., et al., \u003cem\u003eDelayed Endothelial Progenitor Cell Therapy Promotes Bone Defect Repair in a Clinically Relevant Rat Model.\u003c/em\u003e Stem Cells Int, 2017. \u003cstrong\u003e2017\u003c/strong\u003e: p. 7923826.\u003c/li\u003e\n\u003cli\u003eTamari, T., et al., \u003cem\u003eThe Paracrine Role of Endothelial Cells in Bone Formation via CXCR4/SDF-1 Pathway.\u003c/em\u003e Cells, 2020. \u003cstrong\u003e9\u003c/strong\u003e(6).\u003c/li\u003e\n\u003cli\u003eXu, C., et al., \u003cem\u003eEndothelial progenitor cells promote osteogenic differentiation in co-cultured with mesenchymal stem cells via the MAPK-dependent pathway.\u003c/em\u003e Stem Cell Res Ther, 2020. \u003cstrong\u003e11\u003c/strong\u003e(1): p. 537.\u003c/li\u003e\n\u003cli\u003eBilko, N.M., et al., \u003cem\u003eCharacterization of the interactions between stromal and haematopoietic progenitor cells in expansion cell culture models.\u003c/em\u003e Cell Biol Int, 2005. \u003cstrong\u003e29\u003c/strong\u003e(1): p. 83-6.\u003c/li\u003e\n\u003cli\u003eJia, Y., et al., \u003cem\u003eCo-cultivation of progenitor cells enhanced osteogenic gene expression and angiogenesis potential in vitro.\u003c/em\u003e J Int Med Res, 2021. \u003cstrong\u003e49\u003c/strong\u003e(4): p. 3000605211004024.\u003c/li\u003e\n\u003cli\u003eAsare-Werehene, M., et al., \u003cem\u003eThe exosome-mediated autocrine and paracrine actions of plasma gelsolin in ovarian cancer chemoresistance.\u003c/em\u003e Oncogene, 2020. \u003cstrong\u003e39\u003c/strong\u003e(7): p. 1600-1616.\u003c/li\u003e\n\u003cli\u003eBanizs, A.B., et al., \u003cem\u003eEndocytosis Pathways of Endothelial Cell Derived Exosomes.\u003c/em\u003e Mol Pharm, 2018. \u003cstrong\u003e15\u003c/strong\u003e(12): p. 5585-5590.\u003c/li\u003e\n\u003cli\u003eQin, Y. and C. Zhang, \u003cem\u003eEndothelial progenitor cellderived extracellular vesiclemeditated celltocell communication regulates the proliferation and osteoblastic differentiation of bone mesenchymal stromal cells.\u003c/em\u003e Mol Med Rep, 2017. \u003cstrong\u003e16\u003c/strong\u003e(5): p. 7018-7024.\u003c/li\u003e\n\u003cli\u003eJia, Y., et al., \u003cem\u003eExosomes secreted by endothelial progenitor cells accelerate bone regeneration during distraction osteogenesis by stimulating angiogenesis.\u003c/em\u003e Stem Cell Res Ther, 2019. \u003cstrong\u003e10\u003c/strong\u003e(1): p. 12.\u003c/li\u003e\n\u003cli\u003eMajidinia, M., A. Sadeghpour, and B. Yousefi, \u003cem\u003eThe roles of signaling pathways in bone repair and regeneration.\u003c/em\u003e J Cell Physiol, 2018. \u003cstrong\u003e233\u003c/strong\u003e(4): p. 2937-2948.\u003c/li\u003e\n\u003cli\u003eZhao, P., et al., \u003cem\u003eExosomes derived from bone marrow mesenchymal stem cells improve osteoporosis through promoting osteoblast proliferation via MAPK pathway.\u003c/em\u003e Eur Rev Med Pharmacol Sci, 2018. \u003cstrong\u003e22\u003c/strong\u003e(12): p. 3962-3970.\u003c/li\u003e\n\u003cli\u003eLawrence, M.C., et al., \u003cem\u003eThe roles of MAPKs in disease.\u003c/em\u003e Cell Res, 2008. \u003cstrong\u003e18\u003c/strong\u003e(4): p. 436-42.\u003c/li\u003e\n\u003cli\u003eRoux, P.P. and J. Blenis, \u003cem\u003eERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions.\u003c/em\u003e Microbiol Mol Biol Rev, 2004. \u003cstrong\u003e68\u003c/strong\u003e(2): p. 320-44.\u003c/li\u003e\n\u003cli\u003eChang, L. and M. Karin, \u003cem\u003eMammalian MAP kinase signalling cascades.\u003c/em\u003e Nature, 2001. \u003cstrong\u003e410\u003c/strong\u003e(6824): p. 37-40.\u003c/li\u003e\n\u003cli\u003eCargnello, M. and P.P. Roux, \u003cem\u003eActivation and function of the MAPKs and their substrates, the MAPK-activated protein kinases.\u003c/em\u003e Microbiol Mol Biol Rev, 2011. \u003cstrong\u003e75\u003c/strong\u003e(1): p. 50-83.\u003c/li\u003e\n\u003cli\u003ePearson, G., et al., \u003cem\u003eMitogen-activated protein (MAP) kinase pathways: regulation and physiological functions.\u003c/em\u003e Endocr Rev, 2001. \u003cstrong\u003e22\u003c/strong\u003e(2): p. 153-83.\u003c/li\u003e\n\u003cli\u003eJohnson, G.L. and R. Lapadat, \u003cem\u003eMitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases.\u003c/em\u003e Science, 2002. \u003cstrong\u003e298\u003c/strong\u003e(5600): p. 1911-2.\u003c/li\u003e\n\u003cli\u003eCong, Q., et al., \u003cem\u003ep38alpha MAPK regulates proliferation and differentiation of osteoclast progenitors and bone remodeling in an aging-dependent manner.\u003c/em\u003e Sci Rep, 2017. \u003cstrong\u003e7\u003c/strong\u003e: p. 45964.\u003c/li\u003e\n\u003cli\u003eHuang, C.C., et al., \u003cem\u003eExosomes as biomimetic tools for stem cell differentiation: Applications in dental pulp tissue regeneration.\u003c/em\u003e Biomaterials, 2016. \u003cstrong\u003e111\u003c/strong\u003e: p. 103-115.\u003c/li\u003e\n\u003cli\u003eLiao, Q.C., et al., \u003cem\u003eGenistein stimulates osteoblastic differentiation via p38 MAPK-Cbfa1 pathway in bone marrow culture.\u003c/em\u003e Acta Pharmacol Sin, 2007. \u003cstrong\u003e28\u003c/strong\u003e(10): p. 1597-602.\u003c/li\u003e\n\u003cli\u003eSuzuki, A., et al., \u003cem\u003eRegulation of alkaline phosphatase activity by p38 MAP kinase in response to activation of Gi protein-coupled receptors by epinephrine in osteoblast-like cells.\u003c/em\u003e Endocrinology, 1999. \u003cstrong\u003e140\u003c/strong\u003e(7): p. 3177-82.\u003c/li\u003e\n\u003cli\u003eWang, Z., et al., \u003cem\u003eMg(2+) in beta-TCP/Mg-Zn composite enhances the differentiation of human bone marrow stromal cells into osteoblasts through MAPK-regulated Runx2/Osx.\u003c/em\u003e J Cell Physiol, 2020. \u003cstrong\u003e235\u003c/strong\u003e(6): p. 5182-5191.\u003c/li\u003e\n\u003cli\u003eThouverey, C. and J. Caverzasio, \u003cem\u003eFocus on the p38 MAPK signaling pathway in bone development and maintenance.\u003c/em\u003e Bonekey Rep, 2015. \u003cstrong\u003e4\u003c/strong\u003e: p. 711.\u003c/li\u003e\n\u003cli\u003eHe, Y., et al., \u003cem\u003eThe co-culture of ASCs and EPCs promotes vascularized bone regeneration in critical-sized bone defects of cranial bone in rats.\u003c/em\u003e Stem Cell Res Ther, 2020. \u003cstrong\u003e11\u003c/strong\u003e(1): p. 338.\u003c/li\u003e\n\u003cli\u003eRobinson, M.D., D.J. McCarthy, and G.K. Smyth, \u003cem\u003eedgeR: a Bioconductor package for differential expression analysis of digital gene expression data.\u003c/em\u003e Bioinformatics, 2010. \u003cstrong\u003e26\u003c/strong\u003e(1): p. 139-40.\u003c/li\u003e\n\u003cli\u003eXie, C., et al., \u003cem\u003eKOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases.\u003c/em\u003e Nucleic Acids Res, 2011. \u003cstrong\u003e39\u003c/strong\u003e(Web Server issue): p. W316-22.\u003c/li\u003e\n\u003cli\u003eYang, S. and Y.P. Li, \u003cem\u003eRGS10-null mutation impairs osteoclast differentiation resulting from the loss of [Ca2+]i oscillation regulation.\u003c/em\u003e Genes Dev, 2007. \u003cstrong\u003e21\u003c/strong\u003e(14): p. 1803-16.\u003c/li\u003e\n\u003cli\u003eHe, X., et al., \u003cem\u003eBMP2 genetically engineered MSCs and EPCs promote vascularized bone regeneration in rat critical-sized calvarial bone defects.\u003c/em\u003e PLoS One, 2013. \u003cstrong\u003e8\u003c/strong\u003e(4): p. e60473.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Exosomes, Endothelial progenitor cells, Messenchemcal stem cells, osteogenesis, MAP kinase signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-5388213/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5388213/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRecent studies have shown that endothelial progenitor cells (EPCs) could enhance osteogenesis of mesenchymal stem cells (MSCs) through multiple paracrine signals. However, the role of EPCs-derived exosomes (EPCs-exos) in osteogenesis has been rarely reported, and little is known regarding their underlying mechanisms. This study attempted to investigate the underlying mechanism by which EPCs-exos promotes osteogenesis of MSCs. EPCs-exos was isolated by supercentrifugation and characterized by western blot, transmission electron microscopy (TEM) and nano particle analysis (NTA). Internalization of EPCs-exos was observed via a laser confocal microscope. The effects of EPCs-exos on the regulation of MSCs biological properties were investigated \u003cem\u003ein vivo and in vitro\u003c/em\u003e. The expression of osteogenesis markers and calcium nodule formation was quantified by qRT-PCR, western blotting, alkaline phosphatase (ALP) staining and Alizarin Red staining. Rat critical-sized calvarial bone defects model was used to assess the efficacy of EPCs-exos on bone regeneration. Real-time PCR array and western blotting were performed to explore possible signaling pathways involved in osteogenesis. Results showed that EPCs-exos could be internalized by MSCs, which exhibited greater ALP activity and increased calcium mineral deposition and improved osteogenic markers expression. EPCs-exos combined with MSCs could improve bone regeneration \u003cem\u003ein vivo\u003c/em\u003e. These data suggest that EPCs-exos influence the biological function and promote MSCs osteogenic differentiation \u003cem\u003ein vivo and in vitro.\u003c/em\u003e Mitogen-activated protein kinase (MAPK) signaling pathway was involved in this process. Activation of the p38MAPK pathway may be the key to enhancing MSCs osteogenic differentiation.\u003c/p\u003e","manuscriptTitle":"Exosomes derived from endothelial progenitor cells enhance osteogenesis of mesenchymal stem cells by activating the MAPK dependent pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-03 06:20:00","doi":"10.21203/rs.3.rs-5388213/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5f6a8c89-dde1-43d0-ad18-36b427b6460a","owner":[],"postedDate":"December 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":40760975,"name":"Biological sciences/Stem cells/Regeneration"},{"id":40760976,"name":"Biological sciences/Cell biology/Cell signalling/Growth signalling"}],"tags":[],"updatedAt":"2025-01-09T14:09:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-03 06:20:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5388213","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5388213","identity":"rs-5388213","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.