Repeated identification of two novel Poleroviruses in the virome of French grain cereals

preprint OA: closed CC-BY-4.0
Full text 63,443 characters · extracted from preprint-html · click to expand
Repeated identification of two novel Poleroviruses in the virome of French grain cereals | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Repeated identification of two novel Poleroviruses in the virome of French grain cereals L. Svanella-Dumas, A. Marais, C. Faure, B. Bergey, R. Comte², and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9300754/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Two novel poleroviruses were repeatedly identified by metagenomics in French cereals over the 2018-2023 period. One showed ~98.5% nucleotide (nt) identity with plant-associated polerovirus 3 (PaPV3) identified by metagenomics in Slovenia, while the second represents a novel species for which the name barley virus H (BVH) is proposed. Both viruses show a typical polerovirus genome organization but do not have ORF6 or ORF7. In French cereals samples, the most prevalent polerovirus was barley virus G (6.4%) followed by BVH (2.3%), cereal yellow dwarf virus RPV (CYDV-RPV, 1.8%) and PaPV3 (0.9%) suggesting the novel poleroviruses to be as prevalent as CYDV. Wheat Barley high-throughput sequencing virome Polerovirus RNASeq dsRNA Figures Figure 1 Figure 2 Full Text Small grain cereal crops such as wheat or barley are affected by a broad range of viral diseases. Among those, the yellow dwarf disease (YDD) caused by the barley yellow dwarf/cereal yellow dwarf viruses (B/CYDV) complex is certainly the most significant worldwide [1,2]. Initially considered as a single entity named barley yellow dwarf virus in the Luteoviridae family, this complex is now understood to comprise several viruses belonging to the Luteovirus genus (family Tombusviridae ) and the Polerovirus genus (family Solemoviridae ) [1]. Although not all of them have been identified in grain cereal crops, the ICTV currently recognizes respectively 6 and 12 Poaceae -infecting Luteovirus and Polerovirus species, of which several have been identified recently in high-throughput sequencing (HTS) metagenomic analyses [3,4]. Some other viruses identified in this way have yet to be formally recognized by ICTV, such as BYDV-OYV [5] or plant-associated polerovirus 3 [6]. All these viruses share a similar biology, being phloem-limited in their host plants and persistently transmitted by their aphid vectors [1,2]. Those that infect cereal crops and cause YDD can often have a very significant impact on yield [1,2,7]. Until recently, the most effective control strategy against these viruses relied on neonicotinoid insecticides seed treatments [2], whose high efficacy contributed to a relative decline in research attention over the past 25 years [2]. The withdrawal of neonicotinoids in the European Union in 2018 has since brought YDD back into focus. In parallel, ongoing climate change may further increase disease pressure by favoring aphid vector populations in temperate regions. Together, these factors have renewed interest in YDD-associated viruses and highlight the need to reassess their identity, prevalence, and impact after years of relative neglect. As part of a large-scale effort to characterize the virome of small grain cereal crops and weedy Poaceae species in France, we have analyzed by HTS the virome of more than 200 single plants sampled between 2018 and 2023 during the spring period in various regions of France. Most of the plants were selected because they showed YDD symptoms but some of them were also asymptomatic. Total RNAs purified from these plants were analyzed by RNAseq by Illumina sequencing (Illumina Novaseq6000, 2*150nt paired reads). Following quality trimming with default parameters, reads were mapped at high stringency (>90% identity for >90% read length) against reference viral genomes and, in parallel, de novo assembled. Resulting contigs were annotated by BlastX analysis against GenBank. All analyses were performed using CLC Genomics Workbench 21.0 (Qiagen). Besides the identification of the poleroviruses CYDV-RPV, CYDV-RPS and barley virus G (BVG) and that of other cereal infecting viruses (see below), two novel poleroviruses were identified, alone or in mixed infection, in the reads from several plants collected between 2018 and 2023 (Table 1, Supplementary Figure 1). In all cases, large contigs or scaffolds with small internal gaps and representing near-complete genomes of the two viruses (>5.6 kilobases) could be assembled, representing 0.01-0.1% of total reads and with 72x-727x average coverages (Table 1). In parallel, the same two viruses were also identified in the virome of pools of 50 volunteer cereal plants or weedy Poaceae collected in September 2022-2024 in different regions of France or in pools of 50 winter wheat plants collected in spring 2022 and 2023. All of these pools were analyzed by HTS of randomly amplified purified double-stranded RNAs (dsRNAs) [8]. Out of a total of 197 pools analyzed, three (1.5%) yielded reads of one or the other of the two novel poleroviruses. In two cases near-complete genome contigs could be assembled, representing 0.08-0.93% of reads for average coverages of 16.6-118.5x, while in the third case the very limited representation of the polerovirus precluded genome assembly (Table 1). BlastN sequence comparisons showed that one of the poleroviruses thus detected shows extremely high identity levels (98.3-98.5% nt identity) with a virus previously identified in Slovenia from a mixed plant species pool and for which the name plant-associated polerovirus 3 (PaPV3) has been proposed [6]. The corresponding contigs were thus considered as representing isolates of PaPV3 and no specific efforts were made to verify or extend their 5’ and 3’ ends. These contigs have been deposited in GenBank under accession numbers PX661619-20. Presence of PaPV3 in the analyzed plants was confirmed by RT-PCR using a pair of specific primers (New-polero-2-F 5' TATTAAGCCTAGTCCGCCTC 3', New Polero-2-R 5' GGGCCTTTAGTTACTCGTGA 3'; annealing temperature 56°C, amplicon 408 nt). For the other virus, the closest homolog identified in GenBank by BlastN is Guiyang Paspalum paspaloides solemo-like virus 1 (GPpSlV1, OM514387), a virus identified by meta-transcriptomics in weeds growing in rice fields in China [9]. There is however some uncertainty about the host species from which GPpSlV1 was identified since the publication only mentions a Guiyang Paspalum distichum solemo-like virus 1 while the GenBank entry is for a Guiyang Paspalum paspaloides solemo-like virus 1 [9]. The assembled French genomes have been deposited in GenBank (PX661621-26), with the exception of the contig for the AF158 pool for which reads remapping showed evidence for significant viral population heterogeneity. These genomes show pairwise nucleotide identities in the 97.4-98.9% range but only in the 84.7-85.2% range with the GenBank GPpSlV1 sequence, suggesting the French isolates might represent a distinct species. Efforts were therefore made to confirm virus presence by RT-PCR in the analyzed plants and to verify genome ends by 5’ and 3’ RACE experiments. Presence of the virus was confirmed using a specific primer pair (Npolero-Trou26-1-F 5' tcaagtccgccttcagatgg 3', Npolero-Trou26-1-R 5' ACCGCATGTTGGATCACGAG 3'; annealing temperature 56°C, amplicon 302 nt) but despite repeated efforts the longest contig obtained (isolate JNO22-31, Table 1) could not be extended further by RACE. The genome contig obtained for isolate JNO22-31 is 5,790 nt long. Sequence comparisons with the genomes of sugarcane yellow leaf virus (ScYLV), Miscanthus yellow fleck virus (MYFV) and wheat leaf yellowing-associated virus (WLYaV) suggest that it may be missing as few as 11 5’ terminal nucleotides (result not shown). With currently 152 nucleotides for the 3’ non-coding region (NCR), it is likely that only a few 3’-terminal nucleotides are missing. The genome has a typical polerovirus genomic organization with six major open reading frames (ORFs) arranged along the genome and encoding proteins containing the expected conserved motifs (Figure 1). An ORF3a, lacking an ATG start codon as in most other poleroviruses [10], was also identified at positions 3430-3561 of the genome. There is no evidence for the presence of an ORF6 or of an ORF7, a situation similar to that observed for GPpSlV1 [9]. Sequence comparisons using the various genome proteins showed that with the exception of the RNA-dependent RNA polymerase (P2, 3.9% aa divergence) and the CP readthrough domain (RT, 7.1%), protein identity level between the JNO22-31 isolate and GPpSlV1 fall below the 10% species cut-off value used by the ICTV for the Polerovirus genus. In the other proteins, the following divergence values were obtained: 13.8% (CP), 19% (P4), 22.7% (P1) and 28% (P0). No other polerovirus in GenBank gave higher identity levels than GPpSlV1 in its various proteins. Considering the ICTV species discrimination criterion of divergence of 10% in any of the viral proteins, the French isolates thus unambiguously represent a novel polerovirus species. Given that barley was by far the host plant in which it was identified (Table 1), the name barley virus H (BVH) is proposed for this novel virus. Remarkably, while very high divergence levels were observed between BVH and PaPV3 in the 5’ half of their genome (aa divergence levels of respectively 80.6%, 76.4% and 32.7% for the P0, P1 and P2 proteins), much closer affinities were observed when considering the 3’ genome half (respectively 16.3%, 14.4% and 9% for P4, CP and RT), which suggests a recombination event might somehow link these two viruses. Maximum likelihood trees were reconstructed using Muscle multiple alignments of the RdRP (P2) and CP of a range of Poaceae -infecting poleroviruses (Figures 2A-B). In the RdRP tree, PaPV3 appears remote from any other species while BVH and GPpSlV1 form a cluster with ScYLV, MYFV and WLYaV (Figure 2A). By comparison, in the CP tree the affinities of BVH and GPpSlV1 with ScYLV, MYFV and WLYaV are again observed but PaPV3 now clusters very tightly with BVH, again supporting the notion that a recombination event links these two viruses (Figure 2B). In our single plant virome analyses, BVH and PaPV3 showed overall prevalence levels of 2.3% (5/218) and 0.9% (2/218), respectively. They were only identified in barley samples, eventhough barley represents only 36% of the analyzed samples, which suggests preferential association with this host. Comparable prevalence levels are obtained when considering cereals and Poaceae pools. PaPV3 was detected in a single barley pool (0.5%, 1/197) while BVH was detected from pools of a wild Panicum sp. and of wheat, giving an overall prevalence of 1%. Comparatively, single plant virome analyses showed prevalences of respectively 6.4%, 1.8% and 0.45% for BVG, CYDV-RPV and CYDV-RPS, suggesting that BVH and PaPV3 may currently circulate at a level comparable to the RPS and RPV cereal yellow dwarf viruses which are generally considered as the most significant poleroviruses in crops or in less managed Poaceae populations in Europe [2,11]. Remarkably, BVG appears to be the most prevalent polerovirus, but at a level much lower than the prevalence in excess of 50% observed for BYDV-PAS and BYDV-PAV in the analyzed plants. Taken together, the results reported here document the significant presence in French barley crops of PaPV3 and BVH. They also provide a first information about the diversity of these two viruses. The two French isolates of PaPV3 show 98.4% nucleotide identity and are 98.3-98.5% identical to the reference isolate from Slovenia. For BVH, the seven near complete genomic sequences we obtained, which span the 2018-2023 period and were sampled in multiple parts of France (Supplementary Figure 1), show pairwise nucleotide identities of 97.4-98.9%. Unfortunately, since BVH and PaPV3 have been identified through metagenomic approaches, little can be said about their potential pathogenicity, as in all cases the plants in which they were identified were also infected by other pathogenic viruses like BYDV-PAS or -PAV, BVG, CYDV-RPS or -RPV or wheat dwarf virus (results not shown). While preventing us from reaching conclusions on BVH and PaPV3 pathogenicity, these co-infections provide some tentative ideas about their transmission. Indeed, the rates of co-infection by the different poleroviruses are much higher than would be expected by chance, being 50-fold higher than expected for co-infection of BVH and PaPV3 and 13 to 20-fold higher than expected for co-infection of BVG and BVH or PaPV3. This observation suggests that these three viruses might have been co-transmitted and may therefore share the same aphid vector(s) [12]. In this respect, the recent demonstration that BVG is very efficiently transmitted by the corn-leaf aphid ( Rhopalosiphum maidis ) and, less efficiently, by the bird cherry-oat aphid ( R. padi ) [13] suggests these two species are prime candidates vector species for BVH and PaPV3. Our recent identification of a PaPV3 isolate in a maize plant collected in southwestern France in 2025 (GenBank PX692073) could go along with the hypothesis of transmission by R. maidis . Declarations Acknowledgements The help of DEEP IMPACT project partners and of Arvalis Institut du Végétal staff for the collection of samples is gratefully acknowledged. We thank the INRAE GeT-PlaGe Platform (GenoToul, INRAE, Toulouse, France) for Illumina sequencing. Funding : This work was funded by the ViroCAP project funded through the CASDAR RT scheme by the French Ministry of Agriculture, and by the ANR-20-PCPA-0004 DEEP IMPACT. Compliance with ethical standards : This manuscript presents original work that does not involve studies with humans or animals. Conflict of interest : The authors declare that they have no conflict of interest. References Miller WA, Lozier Z (2022) Yellow dwarf viruses of cereals: taxonomy and molecular mechanisms. Annu Rev Phytopathol 60:121-141. https://doi.org/10.1146/annurev-phyto-121421-125135 Mc Namara L, Gauthier K, Walsh L et al (2020) Management of yellow dwarf disease in Europe in a post-neonicotinoid agriculture. Pest Manag Sci 76:2276-2285. https://doi.org/10.1002/ps.5835 Zhao F, Lim S, Yoo RH et al (2016) The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea. Arch Virol 161:2047-2050. https://doi.org/10.1007/s00705-016-2881-0 Zhang P, Liu Y, Liu W et al (2017) Identification, characterization and full-length sequence analysis of a novel Polerovirus associated with wheat leaf yellowing disease. Front Microbiol 8:1689. https://doi.org/10.3389/fmicb.2017.01689 Sõmera M, Massart S, Tamisier L et al (2021) A survey using high-throughput sequencing suggests that the diversity of cereal and barley yellow dwarf viruses is underestimated. Front Microbiol 12:673218. https://doi.org/10.3389/fmicb.2021.673218 Rivarez MPS, Pecman A, Bačnik K et al (2023) In-depth study of tomato and weed viromes reveals undiscovered plant virus diversity in an agroecosystem. Microbiome 11(1):60. https://doi.org/10.1186/s40168-023-01500-6 Nancarrow N, Aftab M, Hollaway G, Rodoni B, Trębicki P (2021) Yield losses caused by barley yellow dwarf virus-PAV infection in wheat and barley: a three-year field study in south-eastern Australia. Microorganisms 9:645. https://doi.org/10.3390/microorganisms9030645 Marais A, Faure C, Bergey B, Candresse T (2018) Viral double-stranded RNAs (dsRNAs) from plants: alternative nucleic acid substrates for high-throughput sequencing. Meth Mol Biol 1746:45–53. https://doi.org/10.1007/978-1-4939-7683-6 Chao S, Wang H, Zhang S et al (2022) Novel RNA viruses discovered in weeds in rice fields. Viruses 14(11):2489. https://doi.org/10.3390/v14112489 Smirnova E, Firth AE, Miller WA, Scheidecker D, Brault V, Reinbold C, Rakotondrafara AM, Chung BY, Ziegler-Graff V (2015) Discovery of a small non-AUG-initiated ORF in poleroviruses and luteoviruses that is required for long-distance movement. PLoS Pathog 11:e1004868. https://doi.org/10.1371/journal.ppat.1004868 Maclot F, Debue V, Malmstrom CM, Filloux D, Roumagnac P, Eck M, Tamisier L, Blouin AG, Candresse T, Massart S (2023) Long-term anthropogenic management and associated loss of plant diversity deeply impact virome richness and composition of Poaceae communities. Microbiol Spectr 11:e0485022. https://doi.org/10.1128/spectrum.04850-22 Gray S, Gildow FE (2003) Luteovirus -aphid interactions. Annu Rev Phytopathol 41:539-566. https://doi.org/10.1146/annurev.phyto.41.012203.105815 Erickson A, Jiang J, Kuo YW et al (2023) Construction and use of an infectious cDNA clone to identify aphid vectors and susceptible monocot hosts of the polerovirus barley virus G. Virology 579:178-185. https://doi.org/10.1016/j.virol.2023.01.011 Table Table 1. Information on the samples and the contigs identified for two novel poleroviruses, barley virus H (BVH) and plant-associated polerovirus 3 (PaPV3). Virus Sample code Type of sample Species Sampling Year Department of France Contig length Mapped reads Average coverage Total reads % reads in contig GenBank BVH JNO18-58 Single plant Winter barley 2018 Tarn 5,681 10,168 213.7x 17,289,894 0.06% PX661624 BVH JNO18-326 Single plant Winter barley 2018 Cher 5,642 3,371 72.0x 20,103,894 0.02% PX661625 BVH JNO19-142 Single plant Winter barley 2019 Tarn 5,771 7,005 150.2x 20,481,396 0.03% PX661623 BVH JNO22-31 Single plant Winter barley 2022 Yvelines 5,790 28,148 727.6x 29,171,682 0.10% PX661621 BVH JNO23-33 Single plant Winter barley 2023 Drome 5,789 1,981 51.2x 28,264,726 0.01% PX661622 BVH RSV22-014 Pool Panicum sp. 2022 Tarn 5,588 6,099 118.5x 657,382 0.93% PX661626 BVH AF158 Pool Winter wheat 2024 Doubs 5,614 855 16.6x 1,132,784 0.08% na PaPV3 JNO18-326 Single plant Winter barley 2018 Tarn 5,747 5,119 109.1x 20,103,894 0.03% PX661620 PaPV3 JNO22-31 Single plant Winter barley 2022 Yvelines 5,871 15,931 406.2x 29,171,682 0.05% PX661619 PaPV3 RSV23-026 Pool Volunteer barley 2023 Loir-et-Cher na 159 3.1x 1,302,658 0.01% na Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 28 Apr, 2026 Reviews received at journal 27 Apr, 2026 Reviews received at journal 19 Apr, 2026 Reviewers agreed at journal 08 Apr, 2026 Reviewers agreed at journal 07 Apr, 2026 Reviewers invited by journal 06 Apr, 2026 Editor assigned by journal 03 Apr, 2026 Submission checks completed at journal 03 Apr, 2026 First submitted to journal 02 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9300754","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":620007954,"identity":"1861bb5f-34b0-4962-933a-8c147d5dcf1c","order_by":0,"name":"L. Svanella-Dumas","email":"","orcid":"","institution":"Univ. Bordeaux, INRAE, UMR 1332 Biologie du Fruit et Pathologie","correspondingAuthor":false,"prefix":"","firstName":"L.","middleName":"","lastName":"Svanella-Dumas","suffix":""},{"id":620007955,"identity":"45a95337-418b-4e9f-b7b6-e0c3fd6da27d","order_by":1,"name":"A. Marais","email":"","orcid":"","institution":"Univ. Bordeaux, INRAE, UMR 1332 Biologie du Fruit et Pathologie","correspondingAuthor":false,"prefix":"","firstName":"A.","middleName":"","lastName":"Marais","suffix":""},{"id":620007956,"identity":"7279aa85-eb72-4bb3-bca9-afc718c7a5cf","order_by":2,"name":"C. Faure","email":"","orcid":"","institution":"Univ. Bordeaux, INRAE, UMR 1332 Biologie du Fruit et Pathologie","correspondingAuthor":false,"prefix":"","firstName":"C.","middleName":"","lastName":"Faure","suffix":""},{"id":620007957,"identity":"3eb62dc2-bc5c-497e-a6fb-c6f38ebd9adf","order_by":3,"name":"B. Bergey","email":"","orcid":"","institution":"Univ. Bordeaux, INRAE, UMR 1332 Biologie du Fruit et Pathologie","correspondingAuthor":false,"prefix":"","firstName":"B.","middleName":"","lastName":"Bergey","suffix":""},{"id":620007958,"identity":"63f3e58a-62a8-4feb-99b8-b362b89f33a4","order_by":4,"name":"R. Comte²","email":"","orcid":"","institution":"Arvalis - Institut du Végétal","correspondingAuthor":false,"prefix":"","firstName":"R.","middleName":"","lastName":"Comte²","suffix":""},{"id":620007959,"identity":"cc1d2600-41a5-45d6-a0d9-88978a80e84f","order_by":5,"name":"T. Candresse","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCklEQVRIiWNgGAWjYDACCcYGBBtMsjdCRNgbMFWDAA+mFp6DEBGeA7i0INsIIRMY8Gqxl25ufFy55zADf/vZg7crKurs+SUftz2uqLFh4JHGrodH5mCz4ZlnhxkkzuQlW545czhx5uzEdsMzx9IYePgScDgssU2y4cBhBgOGHDPJxrYDCQa3QSJshxnseXD5JbH9J1gL/xugln919vY3DwK1/PvPwINbSxsjWIsEyJYGZsYNEoxtIOtwa7mR2Ax0WDqPxI03xpYNxw4nzjgDdFhjXzIPLi3sM9Iffmw4YC3H359jeLOhBhhi7cefSTZ8s5PDpQUKmjGl8WtgYKgjID8KRsEoGAUjGgAAvDlaYG+x+bYAAAAASUVORK5CYII=","orcid":"","institution":"Univ. Bordeaux, INRAE, UMR 1332 Biologie du Fruit et Pathologie","correspondingAuthor":true,"prefix":"","firstName":"T.","middleName":"","lastName":"Candresse","suffix":""}],"badges":[],"createdAt":"2026-04-02 09:08:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9300754/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9300754/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106591294,"identity":"f3d1348e-4ce5-4da6-ab41-55f857362473","added_by":"auto","created_at":"2026-04-10 08:42:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":52774,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenome organization of barley virus H\u003c/strong\u003e. Open reading frames are indicated by boxes with the names of the various viral proteins indicated (CP: coat protein, RT: readthrough domain). ORF3a, which has no ATG codon, is not figured. Conserved motifs identified in various proteins are highlighted with different grey shadings: Peptidase S9 motif (Pfam 02122) in P1, RDRP4 motif (Pfam 02123) in P2, Luteo coat motif (Pfam 00894) in CP and PLRV ORF5 motif (Pfam 01690) in RT. Positions on the genome of the various ORFs are indicated in reference to the genome of isolate JNO22-31.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9300754/v1/3c8a82ccf25d3cd9e4a11b64.png"},{"id":106591295,"identity":"480c9d97-1001-4703-8450-736e19c054e7","added_by":"auto","created_at":"2026-04-10 08:42:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":130454,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum likelihood phylogenetic trees based on the alignment obtained by Muscle of the RdRP (P2 protein, \u003cstrong\u003e2A\u003c/strong\u003e) and coat protein (CP, \u003cstrong\u003e2B\u003c/strong\u003e) sequence of various poleroviruses. The trees were reconstructed using the best distance model as determined using Mega 7.0 (WAG+G+I). Random bootstrapping (1,000 replicates) was used to evaluate branch strength and only bootstrap values less than 70% were removed. Accession numbers of reference sequences in GenBank are given, followed by the virus name. The viruses characterized in this study are shown by a black diamond (barley virus H, BVH) or a black square (plant-associated polerovirus 3, PaPV3). The scale bars represent 20% aa divergence.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9300754/v1/4796a935de104d38652eedaa.png"},{"id":106591334,"identity":"5a310158-261b-44a3-90aa-53fa11f4db34","added_by":"auto","created_at":"2026-04-10 08:42:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":566877,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9300754/v1/6066c6e9-7015-4211-9e8f-5ade5a166114.pdf"},{"id":106591291,"identity":"18bc68aa-e13d-4558-87ce-8e4e576fbc2c","added_by":"auto","created_at":"2026-04-10 08:42:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":202020,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-9300754/v1/b00ea961508ffdb86a337030.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Repeated identification of two novel Poleroviruses in the virome of French grain cereals","fulltext":[{"header":"Full Text","content":"\u003cp\u003eSmall grain cereal crops such as wheat or barley are affected by a broad range of viral diseases. Among those, the yellow dwarf disease (YDD) caused by the barley yellow dwarf/cereal yellow dwarf viruses (B/CYDV) complex is certainly the most significant worldwide [1,2]. Initially considered as a single entity named barley yellow dwarf virus in the \u003cem\u003eLuteoviridae\u003c/em\u003e family, this complex is now understood to comprise several viruses belonging to the \u003cem\u003eLuteovirus\u003c/em\u003e genus (family \u003cem\u003eTombusviridae\u003c/em\u003e) and the \u003cem\u003ePolerovirus\u003c/em\u003e genus (family \u003cem\u003eSolemoviridae\u003c/em\u003e) [1]. Although not all of them have been identified in grain cereal crops, the ICTV currently recognizes respectively 6 and 12 \u003cem\u003ePoaceae\u003c/em\u003e-infecting \u003cem\u003eLuteovirus\u003c/em\u003e and \u003cem\u003ePolerovirus\u003c/em\u003e species, of which several have been identified recently in high-throughput sequencing (HTS) metagenomic analyses [3,4]. Some other viruses identified in this way have yet to be formally recognized by ICTV, such as BYDV-OYV [5] or plant-associated polerovirus 3 [6]. All these viruses share a similar biology, being phloem-limited in their host plants and persistently transmitted by their aphid vectors [1,2]. Those that infect cereal crops and cause YDD can often have a very significant impact on yield [1,2,7]. Until recently, the most effective control strategy against these viruses relied on neonicotinoid insecticides seed treatments [2], whose high efficacy contributed to a relative decline in research attention over the past 25 years [2]. The withdrawal of neonicotinoids in the European Union in 2018 has since brought YDD back into focus. In parallel, ongoing climate change may further increase disease pressure by favoring aphid vector populations in temperate regions. Together, these factors have renewed interest in YDD-associated viruses and highlight the need to reassess their identity, prevalence, and impact after years of relative neglect.\u003c/p\u003e\n\u003cp\u003eAs part of a large-scale effort to characterize the virome of small grain cereal crops and weedy \u003cem\u003ePoaceae\u003c/em\u003e species in France, we have analyzed by HTS the virome of more than 200 single plants sampled between 2018 and 2023 during the spring period in various regions of France. Most of the plants were selected because they showed YDD symptoms but some of them were also asymptomatic. Total RNAs purified from these plants were analyzed by RNAseq by Illumina sequencing (Illumina Novaseq6000, 2*150nt paired reads). Following quality trimming with default parameters, reads were mapped at high stringency (\u0026gt;90% identity for \u0026gt;90% read length) against reference viral genomes and, in parallel, \u003cem\u003ede novo\u003c/em\u003e assembled. Resulting contigs were annotated by BlastX analysis against GenBank. All analyses were performed using CLC Genomics Workbench 21.0 (Qiagen). Besides the identification of the poleroviruses CYDV-RPV, CYDV-RPS and barley virus G (BVG) and that of other cereal infecting viruses (see below), two novel poleroviruses were identified, alone or in mixed infection, in the reads from several plants collected between 2018 and 2023 (Table 1, Supplementary Figure 1). In all cases, large contigs or scaffolds with small internal gaps and representing near-complete genomes of the two viruses (\u0026gt;5.6 kilobases) could be assembled, representing 0.01-0.1% of total reads and with 72x-727x average coverages (Table 1). In parallel, the same two viruses were also identified in the virome of pools of 50 volunteer cereal plants or weedy \u003cem\u003ePoaceae\u003c/em\u003e collected in September 2022-2024 in different regions of France or in pools of 50 winter wheat plants collected in spring 2022 and 2023. All of these pools were analyzed by HTS of randomly amplified purified double-stranded RNAs (dsRNAs) [8]. Out of a total of 197 pools analyzed, three (1.5%) yielded reads of one or the other of the two novel poleroviruses. In two cases near-complete genome contigs could be assembled, representing 0.08-0.93% of reads for average coverages of 16.6-118.5x, while in the third case the very limited representation of the polerovirus precluded genome assembly (Table 1). BlastN sequence comparisons showed that one of the poleroviruses thus detected shows extremely high identity levels (98.3-98.5% nt identity) with a virus previously identified in Slovenia from a mixed plant species pool and for which the name plant-associated polerovirus 3 (PaPV3) has been proposed [6]. The corresponding contigs were thus considered as representing isolates of PaPV3 and no specific efforts were made to verify or extend their 5’ and 3’ ends. These contigs have been deposited in GenBank under accession numbers PX661619-20. Presence of PaPV3 in the analyzed plants was confirmed by RT-PCR using a pair of specific primers (New-polero-2-F 5' TATTAAGCCTAGTCCGCCTC 3', New Polero-2-R 5' GGGCCTTTAGTTACTCGTGA 3'; annealing temperature 56°C, amplicon 408 nt). For the other virus, the closest homolog identified in GenBank by BlastN is Guiyang Paspalum paspaloides solemo-like virus 1 (GPpSlV1, OM514387), a virus identified by meta-transcriptomics in weeds growing in rice fields in China [9]. There is however some uncertainty about the host species from which GPpSlV1 was identified since the publication only mentions a Guiyang Paspalum distichum solemo-like virus 1 while the GenBank entry is for a Guiyang Paspalum paspaloides solemo-like virus 1 [9]. The assembled French genomes have been deposited in GenBank (PX661621-26), with the exception of the contig for the AF158 pool for which reads remapping showed evidence for significant viral population heterogeneity. These genomes show pairwise nucleotide identities in the 97.4-98.9% range but only in the 84.7-85.2% range with the GenBank GPpSlV1 sequence, suggesting the French isolates might represent a distinct species. Efforts were therefore made to confirm virus presence by RT-PCR in the analyzed plants and to verify genome ends by 5’ and 3’ RACE experiments. Presence of the virus was confirmed using a specific primer pair (Npolero-Trou26-1-F 5' tcaagtccgccttcagatgg 3', Npolero-Trou26-1-R 5' ACCGCATGTTGGATCACGAG 3'; annealing temperature 56°C, amplicon 302 nt) but despite repeated efforts the longest contig obtained (isolate JNO22-31, Table 1) could not be extended further by RACE.\u003c/p\u003e\n\u003cp\u003eThe genome contig obtained for isolate JNO22-31 is 5,790 nt long. Sequence comparisons with the genomes of sugarcane yellow leaf virus (ScYLV), Miscanthus yellow fleck virus (MYFV) and wheat leaf yellowing-associated virus (WLYaV) suggest that it may be missing as few as 11 5’ terminal nucleotides (result not shown). With currently 152 nucleotides for the 3’ non-coding region (NCR), it is likely that only a few 3’-terminal nucleotides are missing. The genome has a typical polerovirus genomic organization with six major open reading frames (ORFs) arranged along the genome and encoding proteins containing the expected conserved motifs (Figure 1). An ORF3a, lacking an ATG start codon as in most other poleroviruses [10], was also identified at positions 3430-3561 of the genome. There is no evidence for the presence of an ORF6 or of an ORF7, a situation similar to that observed for GPpSlV1 [9]. Sequence comparisons using the various genome proteins showed that with the exception of the RNA-dependent RNA polymerase (P2, 3.9% aa divergence) and the CP readthrough domain (RT, 7.1%), protein identity level between the JNO22-31 isolate and GPpSlV1 fall below the 10% species cut-off value used by the ICTV for the \u003cem\u003ePolerovirus\u003c/em\u003e genus. In the other proteins, the following divergence values were obtained: 13.8% (CP), 19% (P4), 22.7% (P1) and 28% (P0). No other polerovirus in GenBank gave higher identity levels than GPpSlV1 in its various proteins. Considering the ICTV species discrimination criterion of divergence of 10% in any of the viral proteins, the French isolates thus unambiguously represent a novel polerovirus species. Given that barley was by far the host plant in which it was identified (Table 1), the name barley virus H (BVH) is proposed for this novel virus.\u003c/p\u003e\n\u003cp\u003eRemarkably, while very high divergence levels were observed between BVH and PaPV3 in the 5’ half of their genome (aa divergence levels of respectively 80.6%, 76.4% and 32.7% for the P0, P1 and P2 proteins), much closer affinities were observed when considering the 3’ genome half (respectively 16.3%, 14.4% and 9% for P4, CP and RT), which suggests a recombination event might somehow link these two viruses.\u003c/p\u003e\n\u003cp\u003eMaximum likelihood trees were reconstructed using Muscle multiple alignments of the RdRP (P2) and CP of a range of \u003cem\u003ePoaceae\u003c/em\u003e-infecting poleroviruses (Figures 2A-B). In the RdRP tree, PaPV3 appears remote from any other species while BVH and GPpSlV1 form a cluster with ScYLV, MYFV and WLYaV (Figure 2A). By comparison, in the CP tree the affinities of BVH and GPpSlV1 with ScYLV, MYFV and WLYaV are again observed but PaPV3 now clusters very tightly with BVH, again supporting the notion that a recombination event links these two viruses (Figure 2B).\u003c/p\u003e\n\u003cp\u003eIn our single plant virome analyses, BVH and PaPV3 showed overall prevalence levels of 2.3% (5/218) and 0.9% (2/218), respectively. They were only identified in barley samples, eventhough barley represents only 36% of the analyzed samples, which suggests preferential association with this host. Comparable prevalence levels are obtained when considering cereals and \u003cem\u003ePoaceae\u003c/em\u003e pools. PaPV3 was detected in a single barley pool (0.5%, 1/197) while BVH was detected from pools of a wild \u003cem\u003ePanicum\u003c/em\u003e sp. and of wheat, giving an overall prevalence of 1%. Comparatively, single plant virome analyses showed prevalences of respectively 6.4%, 1.8% and 0.45% for BVG, CYDV-RPV and CYDV-RPS, suggesting that BVH and PaPV3 may currently circulate at a level comparable to the RPS and RPV cereal yellow dwarf viruses which are generally considered as the most significant poleroviruses in crops or in less managed \u003cem\u003ePoaceae\u003c/em\u003e populations in Europe [2,11]. Remarkably, BVG appears to be the most prevalent polerovirus, but at a level much lower than the prevalence in excess of 50% observed for BYDV-PAS and BYDV-PAV in the analyzed plants.\u003c/p\u003e\n\u003cp\u003eTaken together, the results reported here document the significant presence in French barley crops of PaPV3 and BVH. They also provide a first information about the diversity of these two viruses. The two French isolates of PaPV3 show 98.4% nucleotide identity and are 98.3-98.5% identical to the reference isolate from Slovenia. For BVH, the seven near complete genomic sequences we obtained, which span the 2018-2023 period and were sampled in multiple parts of France (Supplementary Figure 1), show pairwise nucleotide identities of 97.4-98.9%. Unfortunately, since BVH and PaPV3 have been identified through metagenomic approaches, little can be said about their potential pathogenicity, as in all cases the plants in which they were identified were also infected by other pathogenic viruses like BYDV-PAS or -PAV, BVG, CYDV-RPS or -RPV or wheat dwarf virus (results not shown). While preventing us from reaching conclusions on BVH and PaPV3 pathogenicity, these co-infections provide some tentative ideas about their transmission. Indeed, the rates of co-infection by the different poleroviruses are much higher than would be expected by chance, being 50-fold higher than expected for co-infection of BVH and PaPV3 and 13 to 20-fold higher than expected for co-infection of BVG and BVH or PaPV3. This observation suggests that these three viruses might have been co-transmitted and may therefore share the same aphid vector(s) [12]. In this respect, the recent demonstration that BVG is very efficiently transmitted by the corn-leaf aphid (\u003cem\u003eRhopalosiphum maidis\u003c/em\u003e) and, less efficiently, by the bird cherry-oat aphid (\u003cem\u003eR. padi\u003c/em\u003e) [13] suggests these two species are prime candidates vector species for BVH and PaPV3. Our recent identification of a PaPV3 isolate in a maize plant collected in southwestern France in 2025 (GenBank PX692073) could go along with the hypothesis of transmission by \u003cem\u003eR. maidis\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe help of DEEP IMPACT project partners and of Arvalis Institut du Végétal staff for the collection of samples is gratefully acknowledged.\u0026nbsp;We thank the INRAE GeT-PlaGe Platform (GenoToul, INRAE, Toulouse, France) for Illumina sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e: This work was funded by the ViroCAP project funded through the CASDAR RT scheme by the French Ministry of Agriculture, and by the ANR-20-PCPA-0004 DEEP IMPACT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e: This manuscript presents original work that does not involve studies with humans or animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e: The authors declare that they have no conflict of interest.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eMiller WA, Lozier Z (2022) Yellow dwarf viruses of cereals: taxonomy and molecular mechanisms. Annu Rev Phytopathol 60:121-141. https://doi.org/10.1146/annurev-phyto-121421-125135\u003c/li\u003e\n \u003cli\u003eMc Namara L, Gauthier K, Walsh L et al (2020) Management of yellow dwarf disease in Europe in a post-neonicotinoid agriculture. Pest Manag Sci 76:2276-2285. https://doi.org/10.1002/ps.5835\u003c/li\u003e\n \u003cli\u003eZhao F, Lim S, Yoo RH et al (2016) The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea. Arch Virol 161:2047-2050. https://doi.org/10.1007/s00705-016-2881-0\u003c/li\u003e\n \u003cli\u003eZhang P, Liu Y, Liu W et al (2017) Identification, characterization and full-length sequence analysis of a novel \u003cem\u003ePolerovirus\u003c/em\u003e associated with wheat leaf yellowing disease. Front Microbiol 8:1689. https://doi.org/10.3389/fmicb.2017.01689\u003c/li\u003e\n \u003cli\u003eS\u0026otilde;mera M, Massart S, Tamisier L et al (2021) A survey using high-throughput sequencing suggests that the diversity of cereal and barley yellow dwarf viruses is underestimated. Front Microbiol 12:673218. https://doi.org/10.3389/fmicb.2021.673218\u003c/li\u003e\n \u003cli\u003eRivarez MPS, Pecman A, Bačnik K et al (2023) In-depth study of tomato and weed viromes reveals undiscovered plant virus diversity in an agroecosystem. Microbiome 11(1):60. https://doi.org/10.1186/s40168-023-01500-6\u003c/li\u003e\n \u003cli\u003eNancarrow N, Aftab M, Hollaway G, Rodoni B, Trębicki P (2021) Yield losses caused by barley yellow dwarf virus-PAV infection in wheat and barley: a three-year field study in south-eastern Australia. Microorganisms 9:645. https://doi.org/10.3390/microorganisms9030645\u003c/li\u003e\n \u003cli\u003eMarais A, Faure C, Bergey B, Candresse T (2018) Viral double-stranded RNAs (dsRNAs) from plants: alternative nucleic acid substrates for high-throughput sequencing. Meth Mol Biol 1746:45\u0026ndash;53. https://doi.org/10.1007/978-1-4939-7683-6\u003c/li\u003e\n \u003cli\u003eChao S, Wang H, Zhang S et al (2022) Novel RNA viruses discovered in weeds in rice fields. Viruses 14(11):2489. https://doi.org/10.3390/v14112489\u003c/li\u003e\n \u003cli\u003eSmirnova E, Firth AE, Miller WA, Scheidecker D, Brault V, Reinbold C, Rakotondrafara AM, Chung BY, Ziegler-Graff V (2015) Discovery of a small non-AUG-initiated ORF in poleroviruses and luteoviruses that is required for long-distance movement. PLoS Pathog 11:e1004868. https://doi.org/10.1371/journal.ppat.1004868\u003c/li\u003e\n \u003cli\u003eMaclot F, Debue V, Malmstrom CM, Filloux D, Roumagnac P, Eck M, Tamisier L, Blouin AG, Candresse T, Massart S (2023) Long-term anthropogenic management and associated loss of plant diversity deeply impact virome richness and composition of \u003cem\u003ePoaceae\u003c/em\u003e communities. Microbiol Spectr 11:e0485022. https://doi.org/10.1128/spectrum.04850-22\u003c/li\u003e\n \u003cli\u003eGray S, Gildow FE (2003) \u003cem\u003eLuteovirus\u003c/em\u003e-aphid interactions. Annu Rev Phytopathol 41:539-566. https://doi.org/10.1146/annurev.phyto.41.012203.105815\u003c/li\u003e\n \u003cli\u003eErickson A, Jiang J, Kuo YW et al (2023) Construction and use of an infectious cDNA clone to identify aphid vectors and susceptible monocot hosts of the polerovirus barley virus G. Virology 579:178-185. https://doi.org/10.1016/j.virol.2023.01.011\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Information on the samples and the contigs identified for two novel poleroviruses, barley virus H (BVH) and plant-associated polerovirus 3 (PaPV3).\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"964\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eVirus\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSample code\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eType of sample\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSampling Year\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDepartment of France\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eContig length\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMapped reads\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage coverage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal reads\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e% reads in contig\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenBank\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO18-58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eTarn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,681\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e10,168\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e213.7x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e17,289,894\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.06%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661624\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO18-326\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eCher\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,642\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e3,371\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e72.0x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e20,103,894\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.02%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661625\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO19-142\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eTarn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,771\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e7,005\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e150.2x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e20,481,396\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.03%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661623\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO22-31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eYvelines\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,790\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e28,148\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e727.6x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e29,171,682\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.10%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661621\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO23-33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eDrome\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,789\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e1,981\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e51.2x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e28,264,726\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.01%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661622\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eRSV22-014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003ePool\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003ePanicum sp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eTarn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,588\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e6,099\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e118.5x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e657,382\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.93%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661626\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBVH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAF158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003ePool\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter wheat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eDoubs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,614\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e855\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e16.6x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e1,132,784\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.08%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ena\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePaPV3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO18-326\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eTarn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,747\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e5,119\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e109.1x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e20,103,894\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.03%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661620\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePaPV3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eJNO22-31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eSingle plant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eWinter barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eYvelines\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5,871\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e15,931\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e406.2x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e29,171,682\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.05%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ePX661619\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePaPV3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eRSV23-026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003ePool\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eVolunteer barley\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e2023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 95px;\"\u003e\n \u003cp\u003eLoir-et-Cher\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 66px;\"\u003e\n \u003cp\u003ena\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e159\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e3.1x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 85px;\"\u003e\n \u003cp\u003e1,302,658\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.01%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003ena\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Wheat, Barley, high-throughput sequencing, virome, Polerovirus, RNASeq, dsRNA","lastPublishedDoi":"10.21203/rs.3.rs-9300754/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9300754/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTwo novel poleroviruses were repeatedly identified by metagenomics in French cereals over the 2018-2023 period. One showed ~98.5% nucleotide (nt) identity with plant-associated polerovirus 3 (PaPV3) identified by metagenomics in Slovenia, while the second represents a novel species for which the name barley virus H (BVH) is proposed. Both viruses show a typical polerovirus genome organization but do not have ORF6 or ORF7. In French cereals samples, the most prevalent polerovirus was barley virus G (6.4%) followed by BVH (2.3%), cereal yellow dwarf virus RPV (CYDV-RPV, 1.8%) and PaPV3 (0.9%) suggesting the novel poleroviruses to be as prevalent as CYDV.\u003c/p\u003e","manuscriptTitle":"Repeated identification of two novel Poleroviruses in the virome of French grain cereals","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-10 08:41:26","doi":"10.21203/rs.3.rs-9300754/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-28T12:48:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-27T19:12:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-19T13:01:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"189512801841523566062064587822353050298","date":"2026-04-08T11:17:16+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"156870786946998534450942180076858829176","date":"2026-04-07T22:55:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-06T10:47:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-03T10:06:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-03T10:05:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Archives of Virology","date":"2026-04-02T08:52:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"b54089e4-3eef-4a6e-9264-4fa4cbe3c995","owner":[],"postedDate":"April 10th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-05T20:38:32+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-10 08:41:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9300754","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9300754","identity":"rs-9300754","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0