Matrine Exerts Antifungal and Antibiofilm Effects on Candida albicans via the Oxidative Stress-MAPK-Metabolism Axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Matrine Exerts Antifungal and Antibiofilm Effects on Candida albicans via the Oxidative Stress-MAPK-Metabolism Axis Xiaomin Liu, Huanqin Li, Yun Lin, Yali Bai, Qin Tang, Zhiping Yin, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9667972/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aim of the study Matrine is a major alkaloid component of the traditional Chinese medicinal plant Sophora flavescens . Although it has been reported to inhibit fungal growth in vitro, its underlying mechanisms of action and potential molecular targets in Candida albicans remain largely unclear. This study aimed to elucidate the antifungal mechanisms of matrine against C. albicans using flow cytometry, transcriptomics, and untargeted metabolomics, thereby providing a theoretical basis for further mechanistic and translational research. Materials and methods The ΔOD values were measured with a microplate reader, and the half-maximal inhibitory concentrations (IC 50 ) values were calculated by nonlinear regression. The inhibitory effects of matrine were evaluated through time-kill assays, Annexin V-FITC/PI staining, DCFH-DA staining for reactive oxygen species (ROS), cell-cycle analysis, transmission electron microscopy (TEM), and fluorescence-activated cell sorting (FACS). RNA-seq and untargeted metabolomics were employed to explore the underlying antifungal mechanisms, and key pathways and differentially expressed genes were further validated by quantitative real-time PCR (qRT-PCR). Results Nonlinear fitting showed IC 50 values of 57.79-535.60 μg/mL (P = 0.0407), indicating a significant concentration-dependent inhibition. Annexin V-FITC/PI assays showed significant differences in apoptosis between the control and matrine-treated groups at concentrations of 128, 256, and 512 μg/mL (all P < 0.05). TEM demonstrated dose-dependent ultrastructural injuries, including cytoplasmic separation, compromised cell-wall architecture, and severe cell-wall disruption and dissolution at concentrations of 512 and 1,024 μg/mL. RNA-seq identified 2,894 differentially expressed genes, including 1,145 upregulated and 1,749 downregulated genes. The upregulation of genes encoding oxidative-stress-related enzymes ( GPX3 , SOD1 , and CTT1 ) and the unfolded protein response-related transcription factor HAC1 , coupled with marked alterations in lipid metabolites, strongly suggested that matrine induced profound oxidative stress. Mechanistically, matrine-induced endomembrane injury and lipotoxicity were linked to the dysregulation of genes involved in cell-wall and membrane biosynthesis, including CHT1 and FKS2 . Conclusion This study demonstrates that matrine exerts potent antifungal effects against C. albicans through an oxidative stress-MAPK-metabolism axis. The proposed mechanism involves the accumulation of ROS, disruption of lipid and redox homeostasis, inhibition of chitin synthase-related cell-wall remodeling ( CHT1 ), and modulation of β-1,3-glucan synthase activity ( FKS2 ). These cascading effects lead to impaired cell-wall integrity, disrupted polarized growth, and suppressed hyphal development, providing a mechanistic basis for further development of matrine as a candidate antifungal agent for candidiasis. Traditional Chinese medicine Sophora flavescens matrine Candida albicans oxidative stress MAPK metabolomics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Candida spp. are important opportunistic fungal pathogens in humans that commonly colonize moist mucosal and cutaneous sites, including the skin, oral cavity, intestine, and vaginal mucosa. Under normal physiological conditions, this colonization is generally asymptomatic. However, when host immunity is impaired (e.g., in patients with malignancy or receiving immunosuppressive therapy) or when the microbiota balance is disrupted, Candida can proliferate and invade mucosal tissues. This can result in oral candidiasis, vulvovaginal candidiasis, superficial skin infections, and, in severe cases, invasive systemic disease [ 1 ] . C. albicans is among the most common fungal pathogens associated with vaginitis, and its increasing incidence has become an important concern for women's health. Clinical management of Candida infections predominantly relies on a limited repertoire of antifungal classes, such as azoles, polyenes, and echinocandins. However, the clinical use of these agents is limited by their restricted variety, associated toxicities, and the rapid emergence of drug-resistant strains. Therefore, identifying antifungal compounds from natural products has emerged as an important research direction. Traditional Chinese medicine (TCM), with its multi-component and multi-target characteristics and long history of clinical use, offers promising new strategies for antifungal therapy and for mitigating the development of resistance. The dried root of Sophora flavescens Aiton (Ku Shen) is a traditional Chinese medicinal material recorded in the Chinese Pharmacopoeia [ 2 ] . It is traditionally described as bitter and cold and is used to clear heat and dry dampness. Classical indications include dysentery, jaundice, eczema, pruritus, scabies, and external treatment of gynecological infections [ 3 – 4 ] . Modern pharmacological studies have shown that S. flavescens contains a variety of bioactive constituents, mainly alkaloids and flavonoids [ 5 ] . Matrine (C15H24N2O; molecular weight, 248.37) is one of the major alkaloids in S. flavescens [ 6 ] . Since its isolation and structural characterization, matrine has exhibited a broad spectrum of pharmacological activities, including antitumor, antipyretic, antiviral, and anti-atherosclerotic effects [ 7 – 10 ] . Furthermore, previous studies have also suggested that matrine has broad-spectrum antifungal activity, inhibiting several clinically relevant fungi, including dermatophytes and C. albicans [ 11 ] . In addition, inhibitory effects against plant pathogenic fungi, such as poplar brown spot fungus and dragon bamboo mildew, have been reported, with IC50 values of 123 µg/mL and 272 µg/mL, respectively [ 12 ] . Although existing studies support the in vitro antifungal potential of matrine, its activity against key pathogenic fungi, particularly C. albicans , and its deeper mechanisms of action remain insufficiently characterized. Systematic evaluation of the cellular targets and molecular pathways affected by matrine is of theoretical and practical significance for developing this natural product into a potential antifungal agent. Therefore, this study systematically investigated the effects of matrine on C. albicans using Annexin V-FITC/PI staining, DCFH-DA ROS detection, cell-cycle assays, flow cytometry, RNA-seq transcriptomics, and untargeted metabolomics, aiming to clarify its antifungal mechanism. Materials and Methods Clinical strains and reagents Clinical non-drug-resistant C.albicans strains were obtained from the Clinical Microbiology Laboratory of the First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine. The following reagents and media were used: YPD broth (Mindray); PDA agar and SDA agar (OXOID); 2% glucose; PBS (pH 7.0 ± 0.5; Biosharp); dimethyl sulfoxide (Solarbio); Annexin V-FITC apoptosis detection kit (Thermo Fisher Scientific); DCFH-DA fluorescent probe (2',7'-dichlorodihydrofluorescein diacetate; Thermo Fisher); PI staining solution (Source Leaf); PCR primers (Sangon Biotech, Shanghai, China); RNA fluorescence detection kit (Equalbit RNA BR Assay Kit, Vazyme); HP All-in-One qRT Master Mix II (Kunming Yungen Biology); and 2× Universal Blue SYBR Green qPCR Master Mix (Servicebio). Matrine reference standard (HPLC purity 98%; lot no. 110805–202010) was purchased from the National Institutes for Food and Drug Control of China and dissolved in PBS (pH 7.0 ± 0.5) before use. Instruments The main instruments included a microplate reader (Thermo Multiskan FC), flow cytometer (BD FACSCalibur), DNBSEQ sequencing platform, S1000 thermal cycler, qPCR instrument (Bio-Rad CFX Connect, XLFZ006), electrophoresis apparatus (Bio-Rad, BEP-600), and Q Exactive HF mass spectrometer (Thermo Fisher Scientific, USA). Determination of IC / IC and time-kill kinetics The samples were assigned to three groups with three biological replicates per group: NC, YPD broth (2% glucose) plus drug solution; PC, YPD broth plus diluted fungal suspension; and treatment group, 100 µL of diluted matrine solution plus 100 µL of working fungal suspension. The final fungal concentration was 2 × 10^3 CFU/mL [ 13 ] . All samples were incubated in a CO 2 incubator at 35°C for 20 h. Absorbance at 600 nm was measured using a microplate reader, and fungal growth inhibition was calculated to determine IC50 and IC90 values. For time-kill assays, 100 µL aliquots of drug-treated suspension were collected at 0, 2, 4, 6, 8, 10, 12, and 24 h, inoculated onto SDA plates, and incubated at 37°C for 24 h. Fungal colonies were counted, and time-kill curves were generated using GraphPad Prism 8.0 with time on the x-axis and log10 (CFU/mL) on the y-axis. Transmission electron microscopy observation Fungal suspensions were treated with matrine at final concentrations of 0, 512, and 1,024 µg/mL for 20 h. After treatment, cells were digested with low-concentration trypsin, transferred into 1.5-mL EP tubes, fixed in pre-cooled 4.0% fixative for 20 h, embedded in resin, sectioned into 50-nm ultrathin slices, double-stained with uranyl acetate and lead citrate, and observed by Transmission electron microscopy (TEM). Flow cytometry C. albicans cells were cultured in YPD medium and treated with the indicated concentrations of matrine for 20 h. Cells were then collected, stained with Annexin V-FITC/PI, incubated for 10–15 min, and analyzed using a BD FACSCalibur flow cytometer. DCFH-DA staining assay Single-cell suspensions were prepared at 1 × 10^6 cells/mL and stained according to the ROS detection kit protocol using the fluorescent probe DCFH-DA. DCF fluorescence in each sample was quantified with FlowJo to evaluate intracellular ROS levels. RNA-seq transcriptomic analysis Total RNA was extracted from 12 samples (control and treatment groups) and quantified using the Equalbit RNA BR Assay Kit (Vazyme). RNA-seq libraries were analyzed on the DNBSEQ platform. Raw sequencing data were subjected to quality control, and clean reads were aligned and annotated using the Candida Genome Database (CGD). Untargeted metabolomic analysis Metabolites were extracted from two groups and analyzed using an LC-MS platform. Metabolites were annotated using the BMDB (BGI Metabolome Database), mzCloud, and ChemSpider databases. After MS data processing, a data matrix containing metabolite peak areas and identification information was generated. Skyline was used for quantitative analysis, and the Mfuzz R package was used for clustering analysis of metabolite expression profiles across groups. Bioinformatic analysis Weighted gene co-expression network analysis (WGCNA) and pathway enrichment analysis (KEGG + Mummichog algorithm) were performed using R version 4.2.2. Integrated statistical analysis of metabolomics and transcriptomics, including random forest analysis, was performed using R with support from BGI Tech Solution Co. qRT-PCR Total RNA was extracted from each sample and reverse-transcribed using HP All-in-One qRT Master Mix II (RT203-Ver.1). The 20-µL reaction mixture contained 4× All-in-One qRT Master Mix (5 µL), total RNA (2 µg), and RNase-free H2O to 20 µL. After brief centrifugation, reverse transcription was performed in a conventional PCR instrument under the following conditions: 50°C for 10 min, 85°C for 5 s, and 4°C hold. qPCR was performed using 2× Universal Blue SYBR Green qPCR Master Mix. The reaction mixture contained cDNA (3 µL), 2× Universal Blue SYBR Green qPCR Master Mix (5 µL), forward primer (10 µM, 1 µL), and reverse primer (10 µM, 1 µL). qRT-PCR was conducted on the CFX96 Real-Time PCR Detection System under the following conditions: initial denaturation at 95°C for 10 min; denaturation at 95°C for 15 s; annealing at 60°C for 30 s; and extension at 72°C for 30 s. Amplification and melting curves were collected. Gene expression was validated by qRT-PCR for targets associated with oxidative stress, the MAPK pathway, peroxisomal membrane components, deoxyribonucleotide biosynthesis, cell cycle regulation, fatty acid metabolism, and secondary metabolite biosynthesis. 18S rRNA , ACT1 , and PMA1 were used as internal reference genes. Primer sequences are listed below: Table 1 Primer list Gene / Direction Sequence (5' to 3') Gene / Direction Sequence (5' to 3') SOD1 F TGGTTGTACTTCTGCTGGTCC CTT1 F AGAGTTGGTCAACACGGTCC R CCAATGACACCACAAGCAGG R CACCATAAGCACCGGAACCT HAC1 F TGGCTAGACTGATTGCTGCT CLN1 F TGGGGTTACCGGAACCATTG R TGACGTCTACACCACCATCT R AGTGGGGATGAAGAGGACGA FAA21 F TTGGCATTGGTTCCTCGTGT CDC28 F AGGTGTACCTAGTACCGCCA R AGCGATTGGTGCACTACCAG R AGCCCCTAGTCCAACTCCTT PEX11 F TGGTTACTTGGTTTAATTGCTGG CHT1 F GACAGACTGGACTGGTGTGG R CAGCTAAACCAACATCACCTTCA R GCCCATACCCTGATGAGTCG GLR1 F TTCTACCTGCAGCAATGGCA CYP5 F GCCATCTAAGACCTCGCCAA R TTCCTCCTTCAGTCCCTGGT R CGTCGAGGAGGATGGCAAAT GPX3 F ACCCACTTCACCAGGCTTTT ACT1 F TAGGTTTGGAAGCTGCTGGT R GTGGCAAGTTTGTGTGGGTT R ACGTTCAGCAATACCTGGGA PKC1 F TTGAACCACCGTATTCCGCA 18S - rRNA F GATCCATTGGAGGGCAAGTCT R GAGTATGCCTCGACTCAGCC R CAGACAAATCGCTCCACCAAC FKS2 F AGGCCGATAATGCAAACCCA PMA1 F TGTTTTCTTGGCCCCAGGTT R ACTTGCTAGCAGTCGCCAAT R GGCCAAAGTGGCAACATCAG Statistical analysis and Bioinformatics analysis Statistical analysis was performed using GraphPad Prism 9. Using WGCNA weighted gene co-expression network analysis of pathway enrichment (KEGG + Mummichog algorithm) statistical analysis: R language 4.2.2. Statistical Analysis of Metabolomics and Transcriptomics: Implementation of Random Forest Analysis Using R Language. Provided by BGI Tech Solution Co. Results Drug Control Matrine (Standards), HPLC 98% (lot: 110805–202010), purchased from China Institute of Food and Drug Identification. Dissolve in PBS, pH 7.0 ± 0.5. Determination of IC 50 /IC 90 and time-kill kinetics The NC group showed no microbial growth, whereas the PC group showed fungal growth, confirming assay validity (Table 2 ). Based on ΔOD values, IC 50 values were distributed between 64 and 512 µg/mL and IC 90 values between 128 and 2,048 µg/mL. Nonlinear regression analysis yielded IC 50 values of 57.79–535.60 µg/mL (Table 2 , Table 3 ). These results indicate that matrine inhibited C. albicans growth in vitro in different culture media, with inhibition increasing as the drug concentration increased. Differences from the control group were statistically significant (P = 0.0001 and P = 0.0006; P < 0.05) (Fig. 2 ,Fig. 3 ). Table 2 In vitro inhibition of C. albicans by matrine in different culture media Sample Concentration (µg/mL) 2,048 µg/mL 1,024 µg/mL NC Positive control F46 0.066 0.057 0.075 0.121 T67 0.061 0.065 0.065 0.109 F34 0.077 0.069 0.078 0.142 T50 0.074 0.070 0.075 0.146 Table 3 IC 50 and IC 90 values calculated by nonlinear fitting IC 50 (µg/mL) F64 T67 F34 T50 >64 >256 512 > 128 Nonlinear-fit IC 50 (µg/mL) / log(inhibitor) vs. response -- variable slope (four parameters) 57.79 401.70 535.60 — IC 90 (µg/mL) 128 1024 1024 512 Table 3 Average colony counts (CFU/mL) at different matrine concentrations and time points Concentration (µg/mL) 0h 2h 4h 6h 8h 10h 12h 24h 512 58 24.2 24.4 28.3 13.0 20.7 3.5 0.5 256 58 23.6 24.2 79.8 31.7 28.5 70.0 621.6 128 81 21.2 16.6 39.7 157.9 716.7 533.3 > 1000(≈ 3.0×10^ 4 ) 64 56 18.9 11.5 16.4 149.2 266.7 1100.0 > 1000(≈ 7.5×10^ 4 ) PC 65.6 12.4 7.0 74.2 348.0 1333.3 1566.7 > 1000(≈ 1.7×10^ 5 ) NC 0 0 0 0 0 0 0 0 Transmission electron microscopy observation of C. albicans ultrastructure after matrine treatment The NC group exhibited intact cell walls, cell membranes, and overall cellular morphology, with no obvious swelling or damage. In the 1,024 µg/mL group, most cells showed membrane separation, incomplete cell-wall structures, and occasional cell damage. Structural damage in the 512 µg/mL group was less severe than that in the 1,024 µg/mL group, and more cells retained relatively complete morphology(Fig. 4 ). Overall, matrine caused concentration-dependent destruction of C. albicans cellular structures. Flow cytometric evaluation of the antifungal effects of matrine C. albicans infected cells were cultured in YPD medium and treated with the indicated concentrations of matrine for 20 h. Cells were then collected, stained with Annexin V-FITC/PI, incubated for 10–15 min, and analyzed using a BD FACSCalibur flow cytometer. Flow analysis showed that the proportion of viable cells (Q4) decreased gradually with increasing matrine concentration, whereas necrotic/apoptotic cells (Q2 and Q3) increased. Compared with the control group, the treatment groups (128, 256, and 512 µg/mL) showed significant differences (P < 0.0002, P = 0.0001, and P = 0.0001, respectively; all P < 0.05; Fig. 5 ). DCFH-DA staining assay for reactive oxygen species accumulation in C. albicans Flow cytometric analysis showed that the proportion of ROS-positive cells increased in the 2,048 µg/mL group. Because ROS accumulation can promote apoptosis, these results suggest that matrine affects C. albicans cellular processes and apoptosis partly through ROS generation (Table 4 and Fig. 6 ). At 512 µg/mL, the number of C. albicans cells decreased and most cells showed yeast-like morphology. By contrast, the negative control group displayed branched hyphal forms, indicating that matrine suppressed hyphal growth and may exert antibiofilm activity. Hyphal formation is closely associated with pathogenicity and tissue invasion by C. albicans (Fig. 7 ). Table 4 DCFH-DA fluorescence analysis of intracellular ROS Group NC 1,024 µg/mL 2,048 µg/mL Value of DCF+ 4.07% 4.34% 11.0% 4.38% 4.07% 11.2% 4.29% 4.40% 11.3% 4.53% 2.98% 16.5% 4.00% 2.73% 15.8% 3.78% 3.02% 15.4% 1.97% 5.17% 9.32% 2.31% 5.06% 9.83% 2.25% 5.20% 9.15% Mean ± SD 3.51 ± 1.03% 4.11 ± 0.98% 12.17 ± 2.92% (Experimental groups A-C: 1,024, 512, and 256 µg/mL; D, NC). RNA-seq transcriptomic analysis In the C.albicans RNA-seq dataset, 12,231 genes were identified with > 80% alignment coverage. Group differences were assessed using a t-test based on 2^-ΔCT data; fold change was calculated from the ratio of 2^-ΔCT values between groups. Genes with |log 2 FC| ≥ 1 and P < 0.05 were defined as significantly differentially expressed. A total of 2,894 DEGs were identified, including 1,145 upregulated and 1,749 downregulated genes (Fig. 7 A). GO enrichment analysis revealed that DEGs between the matrine-treated and NC groups were mainly associated with plasma membrane components, membrane-associated structures, extracellular regions, extracellular vesicles, the cell surface, the mitochondrial respiratory chain, and the fungal cell wall. In the biological process category, DEGs were enriched in arginine biosynthesis, cellular iron ion homeostasis, iron ion transport, carbohydrate transport, copper ion import, inositol biosynthesis, dicarboxylic acid transport, siderophore transport, glutathione membrane transport, and asparagine catabolism. In the molecular function category, DEGs were enriched in carbohydrate binding, ferric-chelate reductase activity, argininosuccinate synthase activity, inositol-3-phosphate synthase activity, dicarboxylic acid transmembrane transporter activity, 4-α-hydroxytetrahydrobiopterin dehydratase activity, and asparaginase activity (Fig. 7 B, 7 C). These transcriptomic findings were consistent with the TEM observations, both indicating that matrine affects the membrane and cell-wall structures of C. albicans . KEGG enrichment analysis was performed using KOBAS, and the 20 most significantly enriched pathways are shown in Fig. 7 D. DEGs between the treatment and NC groups were mapped to 115 signaling pathways, of which 21 were significant (P < 0.05). The enriched pathways included ribosome biogenesis, sulfur metabolism, alanine/aspartate/glutamate metabolism, glutathione metabolism, arginine biosynthesis, tyrosine metabolism, pyruvate metabolism, and peroxisome-related pathways. Untargeted metabolomic analysis Statistical method Differential metabolites between groups were screened using univariate and multivariate analyses. PCA and PLS-DA were first performed to evaluate overall group separation, and OPLS-DA was then used to calculate variable importance in projection (VIP) values. Differential metabolites were defined as those meeting the following criteria: VIP ≥ 1 in the OPLS-DA model, fold change ≥ 1.2 or ≤ 0.83, and q-value < 0.05. Classification plots, volcano plots, and other visualizations were generated (Fig. 8 A). PCA was used to assess the distribution and separation trends between groups, including inter-group and intra-group variation (Fig. 8 A). Analysis A total of 16,472 compounds were identified, of which 3,640 could be classified (Fig. 7 B). These compounds mainly included terpenoids, flavonoids, coumarins and derivatives, alkaloids and derivatives, lipids, benzene and derivatives, amino acids, peptides and analogues, organic acids, carbohydrates, and other metabolites. Among them, 491 metabolites were significantly altered, including 242 upregulated and 249 downregulated metabolites (Fig. 7 B). The differential metabolites were mainly enriched in amino acid metabolism, xenobiotic biodegradation, carbohydrate and nucleotide metabolism, lipid metabolism, secondary metabolite biosynthesis, and cofactor/vitamin metabolism. Amino acid metabolism was one of the most active metabolic pathways in the current samples (Fig. 8 C). Lipid metabolism is central to C. albicans cell-membrane homeostasis(Table 5 ). Lipid classes such as ergosterol (a classical antifungal drug target), sphingolipids, glycerolipids, and phospholipids are essential for membrane fluidity, lipid homeostasis/lipotoxicity [ 14 ] , signal transduction, energy metabolism, growth and reproduction, pathogenicity, and drug resistance [ 15 , 16 ] .(Fig. 8 D). The accumulation of lipid metabolic products suggests that matrine affects cell-membrane and cell-wall stability, a conclusion supported by the TEM observations. Figure 8 . Untargeted metabolomic analysis(A: Permutation test plot of the PLS-DA model for group comparison (treated vs. negative control)(Blue dots represent results from 1,000 random permutations; the red line represents the regression line of permuted data; the red solid circle indicates the original model. R2Y = 0.98; Q2 intercept = -0.08; P < 0.001); B: Volcano plot of differential metabolite analysis(A, volcano plot; B, number of metabolites; C, metabolic pathway classification); C: Overall metabolite classification; D: Heat map of read counts) Table 5 Metabolic pathway enrichment analysis KEGG pathway Number of metabolites P value Rich factor Biosynthesis of secondary metabolites 35 7.13E-05 0.0155 Biosynthesis of amino acids 11 6.20E-09 0.0859 ABC transporters 9 1.62E-06 0.0652 D-Amino acid metabolism 7 1.26E-06 0.1014 Arginine and proline metabolism 7 1.26E-06 0.1014 Real-time fluorescence PCR validation based on Bio-Rad CFX 96 To assess consistency between omics findings and gene expression, differential genes were validated by qRT-PCR, and 2^-ΔΔCT values across samples were visualized using clustered heat maps. Data were standardized using Z-scores to represent relative expression levels. Validation focused on pathways related to oxidative stress response and protection, peroxisomes and peroxisomal membrane components, MAPK signaling, steroid biosynthesis, cell-cycle regulation, deoxyribonucleotide biosynthesis, fungal ribosome biosynthesis, metabolism, antioxidant/reductive reactions, fatty acid, carbohydrate, and energy metabolism, and amino acid biosynthesis. The expression levels of HAC1, SOD1, GPX3, and CTT1 were elevated, indicating oxidative stress in Candida cells after matrine treatment and supporting the ROS assay results. Matrine also inhibited the expression/activity of CHT1 chitin synthase and FKS2 β-1,3-D-glucan synthase, and decreased CLN1 expression, consistent with cell-cycle arrest in the G0/G1 and G2/M phases (Fig. 8 ). Discussion S. flavescens is a traditional Chinese medicine used for conditions such as dysentery, hematochezia, jaundice, urinary retention, leukorrhea, genital swelling and itching, eczema, sores, pruritus, boils, tinea, leprosy, and external treatment of trichomonas vaginitis. Matrine, one of its main active compounds, is also present in several traditional Chinese medicine formulations and may contribute important synergistic effects. However, its antifungal mechanism has not been fully clarified. In this study, nonlinear regression indicated that the IC 50 of matrine against C. albicans was 57.79–535.60 µg/mL and the IC 90 was 128-1,024 µg/mL. These values differed from the previously reported IC 50 of 3.125 µg/mL [ 11 ] , which may be related to differences in strains, media, assay conditions, or calculation methods. The effects of matrine on C. albicans viability were evaluated using Annexin V-FITC/PI staining and BD flow cytometry. FlowJo analysis showed significant differences compared with the control group (P < 0.0001, P = 0.0001, and P = 0.0002), supporting the antifungal activity of matrine. TEM observations showed that matrine-treated cells exhibited membrane separation, incomplete cell-wall structures, and occasional cell-wall rupture and dissolution. The extent of structural damage increased with increasing matrine concentration. Pathogenic fungi such as C. albicans can undergo apoptosis-like cell death in response to adverse stimuli [ 17 , 18 ] . Necrosis and apoptosis represent important forms of cell death, characterized by cell swelling, loss of plasma membrane integrity, leakage of cellular contents, disruption of ion gradients, or genetically regulated programmed cell death. Our results are consistent with these processes. DCFH-DA staining showed that intracellular ROS levels in C. albicans increased with matrine concentration. Statistical analysis showed that the ROS-positive proportion in the 2,048 µg/mL group increased approximately fourfold compared with the untreated group (P < 0.0001). Increased ROS production was accompanied by reduced fungal growth and suppressed hyphal formation. ROS, as a second messenger, plays an important role in apoptosis and necrosis [ 19 ] . Under physiological conditions, ROS participates in energy metabolism and cell proliferation; however, excessive ROS accumulation disrupts the oxidative-antioxidative balance, damages macromolecules such as DNA and proteins, and promotes programmed cell death [ 20 ] . High ROS levels may also impair mitochondria and reduce mitochondrial membrane potential, an early indicator of apoptosis [ 21 ] . Similar findings have been reported for TTS-12, a compound extracted from Tribulus terrestris , which induces C. albicans apoptosis by increasing intracellular ROS levels [ 22 ] . Excessive ROS can attack membrane lipids and generate lipid radicals. These highly reactive lipid peroxidation products may amplify damage through peroxisomal metabolic pathways, fatty acid oxidation, and acetyl-CoA transferase-associated metabolism. Therefore, matrine may broadly impair the cytoplasmic membrane system, plasma membrane components, extracellular region, extracellular vesicles, cell surface, and fungal cell-wall biosynthesis. Such chain reactions can damage the plasma membrane and may ultimately lead to cell death [ 23 ] . Transcriptomic, metabolomic, and qRT-PCR analyses confirmed increased expression of HAC1, SOD1, and GPX3, supporting the occurrence of oxidative stress in Candida cells after matrine treatment. This result is consistent with the ROS assay. HAC1 is a transcription factor associated with endoplasmic reticulum stress, whereas GPX3 encodes a glutathione peroxidase that helps reduce H 2 O 2 to H 2 O and O 2 through the glutathione (GSH) system and contributes to antioxidant defense. SOD1 encodes superoxide dismutase, a key enzyme involved in scavenging superoxide anions. CTT1 encodes peroxisomal catalase, which helps prevent intracellular lipid peroxidation, limits organic peroxide formation, and protects cells from oxidative lipid damage. The upregulation of HAC1, SOD1, GPX3, and CTT1 after matrine treatment suggests activation of an oxidative-stress defense response and indicates that ROS-mediated injury may be an important contributor to the antifungal activity of matrine. FAA21, an acyl-CoA synthetase, participates in lipid synthesis and fatty acid oxidation. In lipid metabolism, FAA21 regulates acyl-CoA pool partitioning by activating medium- and long-chain fatty acids, promoting peroxisomal oxidative energy production, and reducing intracellular free fatty acid accumulation to maintain membrane lipid homeostasis and energy balance. During oxidative stress, FAA21 may enhance antioxidant capacity by decreasing lipotoxic ROS generation, supporting NADPH-dependent GSH recycling, and stabilizing membrane lipid fluidity. Conversely, loss of FAA21 function can cause fatty acid accumulation, mitochondrial dysfunction, ROS bursts, membrane damage, and cell death. In C. albicans , FAA21 activity is related to growth, biofilm formation, adhesion/invasion, virulence, and susceptibility to antifungal agents [ 24 ] . Glutathione reductase GLR1 is mainly localized in mitochondria and reduces oxidized glutathione (GSSG) to reduced glutathione (GSH) in an NADPH-dependent manner, thereby maintaining glutathione homeostasis. PEX11 encodes a peroxisomal membrane protein involved in peroxisome division, fusion, and abundance regulation; it also participates in fatty acid oxidation and antioxidant defense, contributing to ROS clearance and redox balance. The decreased expression of GLR1 and PEX11 suggests impairment of the antioxidant defense system [ 25 ] . Under matrine treatment, increased ROS production, reduced ROS-scavenging capacity, and disrupted redox homeostasis may cause extensive endomembrane and cell-wall damage, potentially activating the yeast MAPK cascade. The MAPK signaling pathway participates in Candida cell-wall damage repair, osmotic stress homeostasis, nutrient-stress responses, expression of cell-wall-related genes, maintenance of cell-wall integrity, actin cytoskeleton organization, targeted vesicle secretion to growth sites, β-glucan synthesis, spore formation, pseudohyphal growth, and cell-cycle regulation. This pathway is therefore important for signal transduction and apoptosis-related responses in C. albicans . In the canonical cascade, multiple receptors activate BCK1 through phosphorylation; BCK1 then activates Mkk1/2, which further phosphorylates MPK1. Activated MPK1 enters the nucleus to regulate transcription factors such as RLM1, thereby controlling DNA transcription and influencing cell-wall integrity and remodeling, including processes related to FKS2-encoded β-glucan synthesis. FKS2 encodes a catalytic subunit involved in the biosynthesis of major cell-wall glucans, including β-1,3-glucan and β-1,6-glucan, which account for approximately 50%-60% of the cell wall [ 26 , 27 ] . These components are essential for maintaining cell integrity and for cell-wall remodeling, bud-tip polarized growth, and cytoplasmic development during budding. The Candida cell wall is a layered structure that accounts for 20%-30% of the dry cell weight and supports cell shape, osmotic pressure, material exchange, nutrition, proliferation, and budding reproduction. The outer layer mainly consists of highly glycosylated mannoproteins, whereas the inner layer contains glucan polymers, chitin, and small amounts of transmembrane proteins. Glucan and chitin account for most of the inner wall mass, and β-1,3-glucan chains with β-1,6-linked branches constitute a major part of this structure [ 28 , 29 ] . Chitin is a major component of cell-wall-anchored proteins and is also associated with the cytoplasmic membrane system. Previous studies suggest that chitin contributes to vesicle secretion, budding growth, and membrane development in Candida [ 30 ] , whereas chitin deficiency can cause septum formation defects and even growth arrest [ 31 ] . Reduced synthesis of chitin and β-1,3-D-glucan may alter fungal osmotic pressure and lead to cell-wall rupture or cell death. In this study, the activity/expression of chitin synthases CHT1 and CHS2 was significantly inhibited. TEM results showed that 20 h of matrine treatment caused varying degrees of cell-wall rupture and structural deficiency, indicating that matrine impaired the structure and function of the fungal cell wall, disrupted cell-wall integrity, or inhibited cell-wall synthesis. These observations were supported by RNA-seq and qRT-PCR results. Through this pathway, PKC1, β-1,3-glucan synthase (HGT12/GS), BNI1 and SKN7 transcription factors, the GTP-Rho-binding vesicle subunit SEC3, FKS2, and chitin synthases CHT1 and CHS2 jointly participate in glucan/chitin synthesis and cell-wall repair (Fig. 16). These genes are important markers of cell-wall biogenesis [ 32 , 33 , 34 ] . In summary, this study demonstrates that matrine exerts antifungal effects against C. albicans through the oxidative stress-MAPK-metabolism axis. The proposed mechanism involves inhibition of chitin synthase-related processes (CHT1), impairment of cell-wall/membrane development and hyphal growth, and disruption of cell-wall repair through modulation of FKS2-associated β-1,3-glucan synthesis. These findings provide a mechanistic basis for further investigation of matrine as a potential therapeutic strategy for candidiasis. Declarations Author Contribution 1.The following financial interests/personal relationships considered as potential competing interests① This study was supported by the Funding of Applied Basic Research Foundation of Yunnan Province (CN) (NO.202501AT070487)② This study was supported by the Joint Fund of Yunnan University of Traditional Chinese Medicine and the First Affiliated Hospital (NO.XYLH202009)③ This study was supported by the Applied Basic Research Foundation of Yunnan Province (NO.XYLH202301AZO70001-144)④ This study was Suppored by the Joint Found of Yunnan University of Traditional Chinese Medicine and the First Affiliated Hospital (NO.XYLH202215)⑤ The drugs, or supplies was provided by China Food and Drug Inspection Institute (Beijing). ⑥ Equipment for drug validation was supported by the Experimental Research Center of Yunnan Provincial Hospital of Traditional Chinese Medicine⑦ This study statistical analysis was provided by Wuhan China University. ⑧ Huang Churong reports a relationship with Yunnan College of Business Management that includes: non-financial support. 2.CRediT authorship contribution statement Liu Xiaomin: Writing – original draft, review & editing, Methodology, Data curation, Conceptualization. Huang Churong: Writing – original draft, Writing – review, Data curation.Li Huanqing: Methodology, Data curation. Bai Yali: Methodology、Data curation. Tang Qin: Writing – review, Conceptualization, Supervision. Lin Yun: Methodology, Conceptualization, Supervision. Yin Zhiping: Supervision References Donnelly JP, Chen SC, the Mycoses Study Group Education and Research Consortium [J]. Revision and Update of the Consensus Definitions of Invasive Fungal Disease From the European Organization for Research and Treatment of Cancer and. Clin Infect Dis. 2020;71(6):1367–76. 10.1093/cid/ciz1008. . PMID: 31802125; PMCID: PMC7486838. Zeng Yuan'er. China Pharmacopoeia 2010 (Part I) Concise Manual of Chemical Composition Analysis [M]. Sun Yat-sen University; 2010. Wang Jiaokui Z. Ruixian. Research on the Shen Nong Ben Cao Jing [M]. Beijing: Science and Technology; 2001. Tao Hongjing. Collected Annotations on the Classic of Materia Medica [J]. Qunlian Publishing House; 1955. Xi Y, Guanghuan S, Linlin C, et al. Synthesis and Activity of Berberine Derivatives: A Review of Recent Advances [J]. Synthesis Chem. 2024;32(4):381–92. JUANES M, SARAGI R T, ENRíQUEZ L, et al. Molecular rotation spectrum of tetracyclic quinolizidines: observation of trans-matrine and the elusive cisn-matrine [J]. J Org Chem. 2021;86(2):1861–7. Zhang Zhongwei L, Jieying H, Liang, et al. Study on the Effects and Mechanisms of Berberine on the Proliferation, Apoptosis, and Migration of Lung Cancer Cells A549 [J]. J Youjiang Minzu Med Coll. 2024;46(01):13–7. Chen Linjin X, Yingyu C. The cell cycle regulation mechanism of oxalicine regulating the CDK4/cyclinD1 pathway to induce apoptosis in prostate cancer PC-3 cells [J]. China J Gerontol. 2024;44(02):490–3. Jianjun J. Qiu Wenkui. The pro-apoptotic mechanism of oxalicine via mitochondrial autophagy mediated by COX-2/PINK1/Parkin signaling pathway in MG63 osteosarcoma cells [J]. China Pharm. 2024;35(01):44–50. Li X, Lu Y, Wen P, Yuan Y, Xiao Z, Shi H, Feng E. Matrine restrains the development of colorectal cancer through regulating the AGRN/Wnt/β-catenin pathway [J]. Environ Toxicol. 2023;38(4):809–19. 10.1002/tox.23730. . Epub 2023 Jan 9. PMID: 36620879. Hua GS, Tao F, Yuanyuan L et al. Study on the In Vitro Antifungal Activity of Theobromine [J]. New Traditional Chinese Medicine and Clinical Pharmacology, 2011,22(4):382–385. Yang Xueyun Z, Boguang JY. The Antibacterial Activity and Synergistic Effects of Sophorine and Oxidized Sophorine [J]. J Nanjing Forestry Univ (Natural Sci Edition), 2008, (02):79–82. Bertout S, Dunyach, Drakulovski P, et al. Comparison of the Sensititre YeastOne dilution method with the Clinical Laboratory Standards Institute (CLSI) M27-A3 microbroth dilution reference method for determining MIC of eight antifungal agents on 102 yeast strains [J]. Pathol Biol (Paris). 2011;59(1):48–51. 10.1016/j.patbio.2010.07.020 . Davis J. Glycerolipid homeostasis in Candida albicans, its role in virulence, and the potential for lipotoxicity as an anti-biofilm therapeutic [D]. Kent Acad Repos. 2025;4. 10.13140/RG.2.2.14272.18352 . Anonymous. Kinase mediated regulation of lipid metabolism and the crosstalk with drug tolerance mechanisms in Candida albicans [J]. J Med Sci Sports Pharm. 2020;245–52. 10.3844/jmssp.2020.245.252 . Garbe E, Gerwien F, Driesch D, Müller T, Böttcher B, Gräler M, Vylkova S. Systematic Metabolic Profiling Identifies De Novo Sphingolipid Synthesis as Hypha Associated and Essential for Candida albicans Filamentation [J]. mBio. 2022;13(6):e02255–22. 10.1128/mbio.02255-22 . Madeo F, Herker E, Wissing S, Jungwirth H, Eisenberg T, Fröhlich KU. Apoptosis in yeast [J]. Curr Opin Microbiol. 2004;7(6):655–60. Yang, Yi, Ning Yumei. Modern Research Progress on the Apoptosis Mechanism of Candida albicans [J]. Western J Traditional Chin Med. 2012;25(1):4. Rinnerthaler M, Büttner S, Laun P, et al. Yno1p/Aim14p, a NADPH-oxidase ortholog,controls extramitochondrial reactive oxygen species generation, apoptosis, and actin cable formation in yeast [J]. Proc Natl Acad Sci USA. 2019;109(22):8658–63. Litemburg-Apers DC, Willems PH, Koopman WJ, et al. Interactions between mitochondrial reactive oxygen species and cellular glucose metabolism [J]. Arch Toxicol. 2015;89:1209–26. Brooks MM, Neelam S, Fudala R, et al. Lenticular mitoprotection. Part A: Monitoring mitochondrial depolarization with JC-1 and artifactual fluorescence by the glycogen synthase kinase-3 β inhibitor [J]. Mol Vis. 2019;19:1406–12. Huang Shan Y, Ying. Jiang Yuan Ying. Effects of Natural Compound TTS-12 on Apoptosis of Candida albicans Cells [J]. Armed Police Med J. 2011;22(1):27–33. Rinnerthaler M, Büttner S, Laun P, et al. Yno1p/Aim14p, a NADPH-oxidase ortholog,controls extramitochondrial reactive oxygen species generation, apoptosis, and actin cable formation in yeast 24. [J]. Proc Natl Acad Sci USA. 2019;109(22):8658–63. Kamiryo T, Mishina M, Tashiro SI, Numa S. Candida lipolytica mutants defective in an acyl-coenzyme A synthetase: isolation and fatty acid metabolism [J]. Proc Natl Acad Sci USA. 1977;74(11):4947–50. García-Leiro A, Cerdán ME, González-Siso MI. A functional analysis of Kluyveromyces lactis glutathione reductase [J]. Yeast. 2010;27(7):431 – 41. 10.1002/yea.1760 . PMID: 20148387. Gow NA, Hube B. Candida albicans cell wall glycobiology and virulence [J]. Nat Rev Microbiol. 2012;10(2):112–22. Li Min C, Yun S. Isolation, purification, and analysis of alkali-soluble β-glucan from the cell wall of Candida albicans [J]. Chin J Dermatology. 2000;33(5):311–3. Mayor S, Riezman H. Sorting GPI-anchored proteins [J]. Nat Rev Mol Cell Biol. 2004;5(2):110–20. 10.1038/nrm1309 . Levin DE. 2005. Cell Wall Integrity Signaling in Saccharomyces cerevisiae [J]. Microbiol Mol Biol Rev 69. Selvaggini S. Independent regulation of chitin synthase and chitinase activity in Candida albicans and Saccharomyces cerevisiae[J]. Microbiology. 2004;150(4):921–8. 10.1099/mic.0.26661-0 . WINTER MUNROCA, BUCHAN K, HENRY A, BECKER K, BROWN JM, BULAWA CE AJP. Chs1 of Candida albicans is an essential chitin synthase required for synthesis of the septum and for cell integrity[J]. Mol Microbiol. 2004;39(5):1414–26. Van Drogen F, Dard N, Pelet S, Lee SS, Mishra R, Srejić N, Peter M. Crosstalk and spatiotemporal regulation between stress-induced MAP kinase pathways and pheromone signaling in budding yeast [J]. Cell Cycle. 2020;19(14):1707–15. Fonzi WA. The protein secretory pathway of Candida albicans [J]. Mycoses. 2009;52(4):291–303. 10.1111/j.1439-0507.2008.01673 . xIF: 3.1 Q2. Epub 2009 Jan 21. PMID: 19207839. Bishop A, Lane R, Beniston R, Chapa-y-Lazo B, Smythe C, Sudbery P. Hyphal growth in Candida albicans requires the phosphorylation of Sec2 by the Cdc28-Ccn1/Hgc1 kinase [J]. EMBO J. 2010;29(17):2930–42. 10.1038/emboj.2010.158. . Epub 2010 Jul 16. PMID: 20639857; PMCID: PMC2944046. Additional Declarations No competing interests reported. Supplementary Files declarationStatement.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9667972","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":638081284,"identity":"cade8ab4-9879-47fd-9006-7b37b72efb2e","order_by":0,"name":"Xiaomin Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIie3PoQvCQBTH8R0Ht3LD+v6MJ4MlwX/lYGBaWLzmQDjLcFX/i1nMJ4IrZx9YXFlenEmHybZbE7xvfh94P89zuX6wZVU0TScX68LeGENDMCtyyKxJnTAI1IWU2laQ/KYBDKVhFZdeL0/jhPo7galkLDJtSnJzHyeMaxRgOI/qBClRFoSDQB0ogHBvSwCSeRYoRARbgvwaUzBieK5Nz1Zb0N9Uz06+xGwbHx+9tCBfDaMm3X/IVOFyuVx/0hvQfT+FzEAWNwAAAABJRU5ErkJggg==","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Xiaomin","middleName":"","lastName":"Liu","suffix":""},{"id":638081285,"identity":"b29ceee5-ed64-4ec7-97dd-e03dc5b9ba32","order_by":1,"name":"Huanqin Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Huanqin","middleName":"","lastName":"Li","suffix":""},{"id":638081286,"identity":"219d94c7-2ded-49f8-9afe-83aab4227b83","order_by":2,"name":"Yun Lin","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Lin","suffix":""},{"id":638081287,"identity":"ca311e65-504f-4ec5-8467-fada19b8aee5","order_by":3,"name":"Yali Bai","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yali","middleName":"","lastName":"Bai","suffix":""},{"id":638081289,"identity":"d7b49edf-ce1a-4d37-9b09-4bcb31407703","order_by":4,"name":"Qin Tang","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Tang","suffix":""},{"id":638081290,"identity":"c306ba37-ff93-4c68-ad2e-272bd3766a6f","order_by":5,"name":"Zhiping Yin","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhiping","middleName":"","lastName":"Yin","suffix":""},{"id":638081291,"identity":"736efcea-3dea-4e7f-9a43-8dc588a3691a","order_by":6,"name":"Churong Huang","email":"","orcid":"","institution":"The First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Churong","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2026-05-10 06:38:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9667972/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9667972/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109072470,"identity":"75a58225-b3d1-4529-b9af-390253658aca","added_by":"auto","created_at":"2026-05-12 10:42:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":87919,"visible":true,"origin":"","legend":"\u003cp\u003eContent Analysis of Matrine, HPLC-FLD\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/d16c563758e628d3505b5709.png"},{"id":109072282,"identity":"b7539a05-ff9e-404b-8427-d7473af60559","added_by":"auto","created_at":"2026-05-12 10:41:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":420884,"visible":true,"origin":"","legend":"\u003cp\u003eIn vitro inhibition of C. albicans by matrine in different culture media\u003c/p\u003e\n\u003cp\u003e(A, YPD with 2% glucose in PBS, pH 7.0 ± 0.5; B, PDA with 2% glucose in PBS, pH 7.0 ± 0.5).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/20d56a29f4e15b52b4e5fe5e.png"},{"id":109072473,"identity":"379c9e92-d3c1-466d-ab7c-b1640bca8092","added_by":"auto","created_at":"2026-05-12 10:42:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1695836,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth dynamics of C. albicans under matrine treatment\u003c/p\u003e\n\u003cp\u003e(A, matrine treatment for 12 h: 512, 256 (1/10), 128 (1/100), and 64 (1/100) μg/mL; B, matrine treatment for 24 h: 512, 256 (1/10), 128 (1/100), and 64 (1/100) μg/mL; C, matrine treatment for 24 h: 2,048, 1,024, 512, and 256 μg/mL).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/64255e840754aa6b10983244.png"},{"id":109072295,"identity":"7258fbb6-2113-46eb-a774-fa0785a8e2a9","added_by":"auto","created_at":"2026-05-12 10:41:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":567439,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of matrine on the ultrastructure of C. albicans: (1) 20,000×; (2) 30,000×\u003c/p\u003e\n\u003cp\u003e(A, 1,024 μg/mL; B, 512 μg/mL; C, NC).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/a4c1203919aab9ac9b351823.png"},{"id":109072468,"identity":"3fc2f51d-ea12-49be-be03-2a5caadadfd1","added_by":"auto","created_at":"2026-05-12 10:42:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":294393,"visible":true,"origin":"","legend":"\u003cp\u003eAnnexin V-FITC/PI staining analysis\u003c/p\u003e\n\u003cp\u003e(A, 512 μg/mL; B, 256 μg/mL; C, 128 μg/mL; D, NC).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/f4102f029379f5d40a8fd6ba.png"},{"id":109072280,"identity":"eba19af8-9ee6-427f-a81e-7ad7cf68bbe9","added_by":"auto","created_at":"2026-05-12 10:41:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":82516,"visible":true,"origin":"","legend":"\u003cp\u003eFACSCalibur flow cytometric analysis\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/70c35c3913a025b4f44b0062.png"},{"id":109072496,"identity":"bfbd417d-d643-4029-9c22-bfc9a1418866","added_by":"auto","created_at":"2026-05-12 10:42:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":642296,"visible":true,"origin":"","legend":"\u003cp\u003eROS assay showing intracellular reactive oxygen species in C. albicans\u003c/p\u003e\n\u003cp\u003e(Experimental groups A-C: 1,024, 512, and 256 μg/mL; D, NC).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/aa75c13a53aa7cbf409666a5.png"},{"id":109072277,"identity":"63b3e293-b346-416a-bfc0-b8517dc990a3","added_by":"auto","created_at":"2026-05-12 10:41:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":53883,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 7. RNA-Seq transcriptome analysis of C. albicans infected cells (A: differential gene enrichment analysis; B: GO annotation classification; C: GO cellular component enrichment; D: KEGG pathway enrichment analysis and Classification)\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/1b69a25b591fef3f6115ebf1.png"},{"id":109072467,"identity":"c368c4e3-07b2-4e73-8e6d-33048ad924eb","added_by":"auto","created_at":"2026-05-12 10:42:41","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":216927,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 8. Untargeted metabolomic analysis(A: Permutation test plot of the PLS-DA model for group comparison (treated vs. negative control)(Blue dots represent results from 1,000 random permutations; the red line represents the regression line of permuted data; the red solid circle indicates the original model. R2Y = 0.98; Q2 intercept = -0.08; P \u0026lt; 0.001); B: Volcano plot of differential metabolite analysis(A, volcano plot; B, number of metabolites; C, metabolic pathway classification); C: Overall metabolite classification; D: Heat map of read counts)\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/36e5a3f9ab7d2d4683ad9b0f.png"},{"id":109072283,"identity":"a3cc7dad-5280-4b6f-82af-a838836c8782","added_by":"auto","created_at":"2026-05-12 10:41:39","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":98158,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 9. Differential expression\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/c78e0af4b696ade80e4d7923.png"},{"id":109072439,"identity":"ec4262d1-41a7-4766-8c86-33c0cbfd4b0b","added_by":"auto","created_at":"2026-05-12 10:42:30","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":341569,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 9. Proposed mechanism of matrine against \u003cem\u003eC. albicans.\u003c/em\u003e(Under the action of the drug sophoridine, the production of ROS (reactive oxygen species) in fungal cells increases, the clearance ability weakens, and the ability to maintain redox balance declines, resulting in extensive damage to the inner membrane and cell wall, which may trigger the MAPK (yeast) cascade reaction. The MAPK cascade reaction is sensed by multiple receptors and is inhibited by phosphorylation, thereby inhibiting the phosphorylation activation of Mkk1/2 mitogen-activated protein kinase and the phosphorylation activation of Slt2 (MPK1). Eventually, the expression levels of GTP-Rho-related genes decrease. The inhibition of FKS2 and Chitinase genes CHT1 and CHS2 leads to the occurrence of fungal cell wall repair and Polarized growth disorders). \u003cem\u003eThe map adapted from the 'Activation of Protein Kinase A [PKA]' template; created with BioRender.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/6d5f1b4a20cca61e49f85895.png"},{"id":109290299,"identity":"b0a45097-4233-4d59-af21-f18e5d8b8cd9","added_by":"auto","created_at":"2026-05-15 06:55:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4686248,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/6e86b0c7-7be8-4194-a3b7-cf5762de75c3.pdf"},{"id":109072293,"identity":"286b478e-9fd5-4135-84f7-d00ae0c5268c","added_by":"auto","created_at":"2026-05-12 10:41:43","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16572,"visible":true,"origin":"","legend":"","description":"","filename":"declarationStatement.docx","url":"https://assets-eu.researchsquare.com/files/rs-9667972/v1/11ad40e14375bf3e2439ee0b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Matrine Exerts Antifungal and Antibiofilm Effects on Candida albicans via the Oxidative Stress-MAPK-Metabolism Axis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCandida spp. are important opportunistic fungal pathogens in humans that commonly colonize moist mucosal and cutaneous sites, including the skin, oral cavity, intestine, and vaginal mucosa. Under normal physiological conditions, this colonization is generally asymptomatic. However, when host immunity is impaired (e.g., in patients with malignancy or receiving immunosuppressive therapy) or when the microbiota balance is disrupted, \u003cem\u003eCandida\u003c/em\u003e can proliferate and invade mucosal tissues. This can result in oral candidiasis, vulvovaginal candidiasis, superficial skin infections, and, in severe cases, invasive systemic disease\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eC. albicans\u003c/em\u003e is among the most common fungal pathogens associated with vaginitis, and its increasing incidence has become an important concern for women's health.\u003c/p\u003e \u003cp\u003eClinical management of \u003cem\u003eCandida\u003c/em\u003e infections predominantly relies on a limited repertoire of antifungal classes, such as azoles, polyenes, and echinocandins. However, the clinical use of these agents is limited by their restricted variety, associated toxicities, and the rapid emergence of drug-resistant strains. Therefore, identifying antifungal compounds from natural products has emerged as an important research direction. Traditional Chinese medicine (TCM), with its multi-component and multi-target characteristics and long history of clinical use, offers promising new strategies for antifungal therapy and for mitigating the development of resistance.\u003c/p\u003e \u003cp\u003eThe dried root of \u003cem\u003eSophora flavescens\u003c/em\u003e Aiton (Ku Shen) is a traditional Chinese medicinal material recorded in the Chinese Pharmacopoeia\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. It is traditionally described as bitter and cold and is used to clear heat and dry dampness. Classical indications include dysentery, jaundice, eczema, pruritus, scabies, and external treatment of gynecological infections\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Modern pharmacological studies have shown that \u003cem\u003eS. flavescens\u003c/em\u003e contains a variety of bioactive constituents, mainly alkaloids and flavonoids\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMatrine (C15H24N2O; molecular weight, 248.37) is one of the major alkaloids in \u003cem\u003eS. flavescens\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Since its isolation and structural characterization, matrine has exhibited a broad spectrum of pharmacological activities, including antitumor, antipyretic, antiviral, and anti-atherosclerotic effects\u003csup\u003e[\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Furthermore, previous studies have also suggested that matrine has broad-spectrum antifungal activity, inhibiting several clinically relevant fungi, including dermatophytes and \u003cem\u003eC. albicans\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. In addition, inhibitory effects against plant pathogenic fungi, such as poplar brown spot fungus and dragon bamboo mildew, have been reported, with IC50 values of 123 \u0026micro;g/mL and 272 \u0026micro;g/mL, respectively\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlthough existing studies support the in vitro antifungal potential of matrine, its activity against key pathogenic fungi, particularly \u003cem\u003eC. albicans\u003c/em\u003e, and its deeper mechanisms of action remain insufficiently characterized. Systematic evaluation of the cellular targets and molecular pathways affected by matrine is of theoretical and practical significance for developing this natural product into a potential antifungal agent. Therefore, this study systematically investigated the effects of matrine on \u003cem\u003eC. albicans\u003c/em\u003e using Annexin V-FITC/PI staining, DCFH-DA ROS detection, cell-cycle assays, flow cytometry, RNA-seq transcriptomics, and untargeted metabolomics, aiming to clarify its antifungal mechanism.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eClinical strains and reagents\u003c/h2\u003e \u003cp\u003eClinical non-drug-resistant \u003cem\u003eC.albicans\u003c/em\u003e strains were obtained from the Clinical Microbiology Laboratory of the First Affiliated Hospital of Yunnan University of Traditional Chinese Medicine. The following reagents and media were used: YPD broth (Mindray); PDA agar and SDA agar (OXOID); 2% glucose; PBS (pH 7.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5; Biosharp); dimethyl sulfoxide (Solarbio); Annexin V-FITC apoptosis detection kit (Thermo Fisher Scientific); DCFH-DA fluorescent probe (2',7'-dichlorodihydrofluorescein diacetate; Thermo Fisher); PI staining solution (Source Leaf); PCR primers (Sangon Biotech, Shanghai, China); RNA fluorescence detection kit (Equalbit RNA BR Assay Kit, Vazyme); HP All-in-One qRT Master Mix II (Kunming Yungen Biology); and 2\u0026times; Universal Blue SYBR Green qPCR Master Mix (Servicebio). Matrine reference standard (HPLC purity 98%; lot no. 110805\u0026ndash;202010) was purchased from the National Institutes for Food and Drug Control of China and dissolved in PBS (pH 7.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5) before use.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInstruments\u003c/h3\u003e\n\u003cp\u003eThe main instruments included a microplate reader (Thermo Multiskan FC), flow cytometer (BD FACSCalibur), DNBSEQ sequencing platform, S1000 thermal cycler, qPCR instrument (Bio-Rad CFX Connect, XLFZ006), electrophoresis apparatus (Bio-Rad, BEP-600), and Q Exactive HF mass spectrometer (Thermo Fisher Scientific, USA).\u003c/p\u003e\n\u003ch3\u003eDetermination of IC / IC and time-kill kinetics\u003c/h3\u003e\n\u003cp\u003eThe samples were assigned to three groups with three biological replicates per group: NC, YPD broth (2% glucose) plus drug solution; PC, YPD broth plus diluted fungal suspension; and treatment group, 100 \u0026micro;L of diluted matrine solution plus 100 \u0026micro;L of working fungal suspension. The final fungal concentration was 2 \u0026times; 10^3 CFU/mL\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. All samples were incubated in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 35\u0026deg;C for 20 h. Absorbance at 600 nm was measured using a microplate reader, and fungal growth inhibition was calculated to determine IC50 and IC90 values.\u003c/p\u003e \u003cp\u003eFor time-kill assays, 100 \u0026micro;L aliquots of drug-treated suspension were collected at 0, 2, 4, 6, 8, 10, 12, and 24 h, inoculated onto SDA plates, and incubated at 37\u0026deg;C for 24 h. Fungal colonies were counted, and time-kill curves were generated using GraphPad Prism 8.0 with time on the x-axis and log10 (CFU/mL) on the y-axis.\u003c/p\u003e\n\u003ch3\u003eTransmission electron microscopy observation\u003c/h3\u003e\n\u003cp\u003eFungal suspensions were treated with matrine at final concentrations of 0, 512, and 1,024 \u0026micro;g/mL for 20 h. After treatment, cells were digested with low-concentration trypsin, transferred into 1.5-mL EP tubes, fixed in pre-cooled 4.0% fixative for 20 h, embedded in resin, sectioned into 50-nm ultrathin slices, double-stained with uranyl acetate and lead citrate, and observed by Transmission electron microscopy (TEM).\u003c/p\u003e\n\u003ch3\u003eFlow cytometry\u003c/h3\u003e\n\u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eC.\u003cem\u003ealbicans\u003c/em\u003e cells were cultured in YPD medium and treated with the indicated concentrations of matrine for 20 h. Cells were then collected, stained with Annexin V-FITC/PI, incubated for 10\u0026ndash;15 min, and analyzed using a BD FACSCalibur flow cytometer.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDCFH-DA staining assay\u003c/h2\u003e \u003cp\u003eSingle-cell suspensions were prepared at 1 \u0026times; 10^6 cells/mL and stained according to the ROS detection kit protocol using the fluorescent probe DCFH-DA. DCF fluorescence in each sample was quantified with FlowJo to evaluate intracellular ROS levels.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRNA-seq transcriptomic analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from 12 samples (control and treatment groups) and quantified using the Equalbit RNA BR Assay Kit (Vazyme). RNA-seq libraries were analyzed on the DNBSEQ platform. Raw sequencing data were subjected to quality control, and clean reads were aligned and annotated using the Candida Genome Database (CGD).\u003c/p\u003e\n\u003ch3\u003eUntargeted metabolomic analysis\u003c/h3\u003e\n\u003cp\u003eMetabolites were extracted from two groups and analyzed using an LC-MS platform. Metabolites were annotated using the BMDB (BGI Metabolome Database), mzCloud, and ChemSpider databases. After MS data processing, a data matrix containing metabolite peak areas and identification information was generated. Skyline was used for quantitative analysis, and the Mfuzz R package was used for clustering analysis of metabolite expression profiles across groups.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis\u003c/h2\u003e \u003cp\u003eWeighted gene co-expression network analysis (WGCNA) and pathway enrichment analysis (KEGG\u0026thinsp;+\u0026thinsp;Mummichog algorithm) were performed using R version 4.2.2. Integrated statistical analysis of metabolomics and transcriptomics, including random forest analysis, was performed using R with support from BGI Tech Solution Co.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eqRT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from each sample and reverse-transcribed using HP All-in-One qRT Master Mix II (RT203-Ver.1). The 20-\u0026micro;L reaction mixture contained 4\u0026times; All-in-One qRT Master Mix (5 \u0026micro;L), total RNA (2 \u0026micro;g), and RNase-free H2O to 20 \u0026micro;L. After brief centrifugation, reverse transcription was performed in a conventional PCR instrument under the following conditions: 50\u0026deg;C for 10 min, 85\u0026deg;C for 5 s, and 4\u0026deg;C hold.\u003c/p\u003e \u003cp\u003eqPCR was performed using 2\u0026times; Universal Blue SYBR Green qPCR Master Mix. The reaction mixture contained cDNA (3 \u0026micro;L), 2\u0026times; Universal Blue SYBR Green qPCR Master Mix (5 \u0026micro;L), forward primer (10 \u0026micro;M, 1 \u0026micro;L), and reverse primer (10 \u0026micro;M, 1 \u0026micro;L). qRT-PCR was conducted on the CFX96 Real-Time PCR Detection System under the following conditions: initial denaturation at 95\u0026deg;C for 10 min; denaturation at 95\u0026deg;C for 15 s; annealing at 60\u0026deg;C for 30 s; and extension at 72\u0026deg;C for 30 s. Amplification and melting curves were collected.\u003c/p\u003e \u003cp\u003eGene expression was validated by qRT-PCR for targets associated with oxidative stress, the MAPK pathway, peroxisomal membrane components, deoxyribonucleotide biosynthesis, cell cycle regulation, fatty acid metabolism, and secondary metabolite biosynthesis. \u003cem\u003e18S rRNA\u003c/em\u003e, \u003cem\u003eACT1\u003c/em\u003e, and \u003cem\u003ePMA1\u003c/em\u003e were used as internal reference genes. Primer sequences are listed below:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer list\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGene / Direction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eGene / Direction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSequence (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTGTACTTCTGCTGGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCTT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAGAGTTGGTCAACACGGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATGACACCACAAGCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCACCATAAGCACCGGAACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHAC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCTAGACTGATTGCTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCLN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTGGGGTTACCGGAACCATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACGTCTACACCACCATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAGTGGGGATGAAGAGGACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFAA21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGCATTGGTTCCTCGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCDC28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAGGTGTACCTAGTACCGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGATTGGTGCACTACCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAGCCCCTAGTCCAACTCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePEX11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTACTTGGTTTAATTGCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCHT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGACAGACTGGACTGGTGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCTAAACCAACATCACCTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGCCCATACCCTGATGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGLR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTACCTGCAGCAATGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCYP5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGCCATCTAAGACCTCGCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCTCCTTCAGTCCCTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCGTCGAGGAGGATGGCAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGPX3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCACTTCACCAGGCTTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eACT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTAGGTTTGGAAGCTGCTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGCAAGTTTGTGTGGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eACGTTCAGCAATACCTGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePKC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGAACCACCGTATTCCGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e18S - rRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGATCCATTGGAGGGCAAGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTATGCCTCGACTCAGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCAGACAAATCGCTCCACCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFKS2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCCGATAATGCAAACCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePMA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTGTTTTCTTGGCCCCAGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTGCTAGCAGTCGCCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGGCCAAAGTGGCAACATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis and Bioinformatics analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad Prism 9. Using WGCNA weighted gene co-expression network analysis of pathway enrichment (KEGG\u0026thinsp;+\u0026thinsp;Mummichog algorithm) statistical analysis: R language 4.2.2. Statistical Analysis of Metabolomics and Transcriptomics: Implementation of Random Forest Analysis Using R Language. Provided by BGI Tech Solution Co.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eDrug Control\u003c/h2\u003e\n \u003cp\u003eMatrine (Standards), HPLC 98% (lot: 110805\u0026ndash;202010), purchased from China Institute of Food and Drug Identification. Dissolve in PBS, pH 7.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eDetermination of IC\u003csub\u003e50\u003c/sub\u003e /IC\u003csub\u003e90\u003c/sub\u003e and time-kill kinetics\u003c/h2\u003e\n \u003cp\u003eThe NC group showed no microbial growth, whereas the PC group showed fungal growth, confirming assay validity (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Based on \u0026Delta;OD values, IC\u003csub\u003e50\u003c/sub\u003e values were distributed between 64 and 512 \u0026micro;g/mL and IC\u003csub\u003e90\u003c/sub\u003e values between 128 and 2,048 \u0026micro;g/mL. Nonlinear regression analysis yielded IC\u003csub\u003e50\u003c/sub\u003e values of 57.79\u0026ndash;535.60 \u0026micro;g/mL (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Table \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These results indicate that matrine inhibited \u003cem\u003eC. albicans\u003c/em\u003e growth in vitro in different culture media, with inhibition increasing as the drug concentration increased. Differences from the control group were statistically significant (P\u0026thinsp;=\u0026thinsp;0.0001 and P\u0026thinsp;=\u0026thinsp;0.0006; P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003e,Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u0026nbsp;\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eIn vitro inhibition of \u003cem\u003eC. albicans\u003c/em\u003e by matrine in different culture media\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eSample\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e\n \u003cp\u003eConcentration (\u0026micro;g/mL)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e2,048 \u0026micro;g/mL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1,024 \u0026micro;g/mL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003eNC\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003ePositive control\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eF46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e0.066\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e0.057\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\n \u003cp\u003e0.121\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eT67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e0.061\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e0.065\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.065\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\n \u003cp\u003e0.109\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eF34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e0.077\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e0.069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.078\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\n \u003cp\u003e0.142\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eT50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e0.074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e0.070\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\n \u003cp\u003e0.146\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\u0026nbsp;\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eIC\u003csub\u003e50\u003c/sub\u003e and IC\u003csub\u003e90\u003c/sub\u003e values calculated by nonlinear fitting\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eIC\u003csub\u003e50\u003c/sub\u003e (\u0026micro;g/mL)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eF64\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003eT67\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003eF34\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003eT50\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e\u0026gt;64\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e\u0026gt;256\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e512\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e\u0026gt;\u0026thinsp;128\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eNonlinear-fit IC\u003csub\u003e50\u003c/sub\u003e (\u0026micro;g/mL) / log(inhibitor) vs. response -- variable slope (four parameters)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e57.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e401.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e535.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eIC\u003csub\u003e90\u003c/sub\u003e (\u0026micro;g/mL)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e1024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e512\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAverage colony counts (CFU/mL) at different matrine concentrations and time points\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eConcentration (\u0026micro;g/mL)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e0h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e2h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e4h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e6h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e8h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e10h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e12h\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e24h\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e512\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e24.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e24.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e28.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e13.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e20.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e3.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e256\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e23.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e24.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e79.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e31.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e28.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e70.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e621.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e21.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e16.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e39.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e157.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e716.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e533.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e\u0026gt;\u0026thinsp;1000(\u0026asymp;\u0026thinsp;3.0\u0026times;10^\u003csup\u003e4\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e18.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e11.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e16.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e149.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e266.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e1100.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e\u0026gt;\u0026thinsp;1000(\u0026asymp;\u0026thinsp;7.5\u0026times;10^\u003csup\u003e4\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003ePC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e12.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e7.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e74.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e348.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e1333.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e1566.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e\u0026gt;\u0026thinsp;1000(\u0026asymp;\u0026thinsp;1.7\u0026times;10^\u003csup\u003e5\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eNC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c7\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c8\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c9\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eTransmission electron microscopy observation of \u003cem\u003eC. albicans\u003c/em\u003e ultrastructure after matrine treatment\u003c/h2\u003e\n \u003cp\u003eThe NC group exhibited intact cell walls, cell membranes, and overall cellular morphology, with no obvious swelling or damage. In the 1,024 \u0026micro;g/mL group, most cells showed membrane separation, incomplete cell-wall structures, and occasional cell damage. Structural damage in the 512 \u0026micro;g/mL group was less severe than that in the 1,024 \u0026micro;g/mL group, and more cells retained relatively complete morphology(Fig. \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Overall, matrine caused concentration-dependent destruction of \u003cem\u003eC. albicans\u003c/em\u003e cellular structures.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow cytometric evaluation of the antifungal effects of matrine\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eC. albicans\u003c/em\u003e infected cells were cultured in YPD medium and treated with the indicated concentrations of matrine for 20 h. Cells were then collected, stained with Annexin V-FITC/PI, incubated for 10\u0026ndash;15 min, and analyzed using a BD FACSCalibur flow cytometer. Flow analysis showed that the proportion of viable cells (Q4) decreased gradually with increasing matrine concentration, whereas necrotic/apoptotic cells (Q2 and Q3) increased. Compared with the control group, the treatment groups (128, 256, and 512 \u0026micro;g/mL) showed significant differences (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0002, P\u0026thinsp;=\u0026thinsp;0.0001, and P\u0026thinsp;=\u0026thinsp;0.0001, respectively; all P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig. \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eDCFH-DA staining assay for reactive oxygen species accumulation in \u003cem\u003eC. albicans\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eFlow cytometric analysis showed that the proportion of ROS-positive cells increased in the 2,048 \u0026micro;g/mL group. Because ROS accumulation can promote apoptosis, these results suggest that matrine affects \u003cem\u003eC. albicans\u003c/em\u003e cellular processes and apoptosis partly through ROS generation (Table \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig. \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e6\u003c/span\u003e). At 512 \u0026micro;g/mL, the number of \u003cem\u003eC. albicans\u003c/em\u003e cells decreased and most cells showed yeast-like morphology. By contrast, the negative control group displayed branched hyphal forms, indicating that matrine suppressed hyphal growth and may exert antibiofilm activity. Hyphal formation is closely associated with pathogenicity and tissue invasion by \u003cem\u003eC. albicans\u003c/em\u003e (Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDCFH-DA fluorescence analysis of intracellular ROS\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eGroup\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eNC\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1,024 \u0026micro;g/mL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e2,048 \u0026micro;g/mL\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\" morerows=\"8\" rowspan=\"9\"\u003e\n \u003cp\u003eValue of DCF+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e4.07%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e4.34%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e11.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e4.38%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e4.07%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e11.2%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e4.29%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e4.40%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e11.3%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e4.53%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e2.98%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e16.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e4.00%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e2.73%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e15.8%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e3.78%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e3.02%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e15.4%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e1.97%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e5.17%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e9.32%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e2.31%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e5.06%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e9.83%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e2.25%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e5.20%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e9.15%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e3.51\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\n \u003cp\u003e4.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e12.17\u0026thinsp;\u0026plusmn;\u0026thinsp;2.92%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e(Experimental groups A-C: 1,024, 512, and 256 \u0026micro;g/mL; D, NC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eRNA-seq transcriptomic analysis\u003c/h2\u003e\n \u003cp\u003eIn the C.albicans RNA-seq dataset, 12,231 genes were identified with \u0026gt;\u0026thinsp;80% alignment coverage. Group differences were assessed using a t-test based on 2^-\u0026Delta;CT data; fold change was calculated from the ratio of 2^-\u0026Delta;CT values between groups. Genes with |log\u003csub\u003e2\u003c/sub\u003eFC| \u0026ge; 1 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were defined as significantly differentially expressed. A total of 2,894 DEGs were identified, including 1,145 upregulated and 1,749 downregulated genes (Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eA).\u003c/p\u003e\n \u003cp\u003eGO enrichment analysis revealed that DEGs between the matrine-treated and NC groups were mainly associated with plasma membrane components, membrane-associated structures, extracellular regions, extracellular vesicles, the cell surface, the mitochondrial respiratory chain, and the fungal cell wall. In the biological process category, DEGs were enriched in arginine biosynthesis, cellular iron ion homeostasis, iron ion transport, carbohydrate transport, copper ion import, inositol biosynthesis, dicarboxylic acid transport, siderophore transport, glutathione membrane transport, and asparagine catabolism. In the molecular function category, DEGs were enriched in carbohydrate binding, ferric-chelate reductase activity, argininosuccinate synthase activity, inositol-3-phosphate synthase activity, dicarboxylic acid transmembrane transporter activity, 4-\u0026alpha;-hydroxytetrahydrobiopterin dehydratase activity, and asparaginase activity (Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eB,\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e\n \u003cp\u003eThese transcriptomic findings were consistent with the TEM observations, both indicating that matrine affects the membrane and cell-wall structures of \u003cem\u003eC. albicans\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eKEGG enrichment analysis was performed using KOBAS, and the 20 most significantly enriched pathways are shown in Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eD. DEGs between the treatment and NC groups were mapped to 115 signaling pathways, of which 21 were significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The enriched pathways included ribosome biogenesis, sulfur metabolism, alanine/aspartate/glutamate metabolism, glutathione metabolism, arginine biosynthesis, tyrosine metabolism, pyruvate metabolism, and peroxisome-related pathways.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eUntargeted metabolomic analysis\u003c/h2\u003e\n \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\n \u003ch2\u003eStatistical method\u003c/h2\u003e\n \u003cp\u003eDifferential metabolites between groups were screened using univariate and multivariate analyses. PCA and PLS-DA were first performed to evaluate overall group separation, and OPLS-DA was then used to calculate variable importance in projection (VIP) values. Differential metabolites were defined as those meeting the following criteria: VIP\u0026thinsp;\u0026ge;\u0026thinsp;1 in the OPLS-DA model, fold change\u0026thinsp;\u0026ge;\u0026thinsp;1.2 or \u0026le;\u0026thinsp;0.83, and q-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Classification plots, volcano plots, and other visualizations were generated (Fig. \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). PCA was used to assess the distribution and separation trends between groups, including inter-group and intra-group variation (Fig. \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n \u003ch2\u003eAnalysis\u003c/h2\u003e\n \u003cp\u003eA total of 16,472 compounds were identified, of which 3,640 could be classified (Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). These compounds mainly included terpenoids, flavonoids, coumarins and derivatives, alkaloids and derivatives, lipids, benzene and derivatives, amino acids, peptides and analogues, organic acids, carbohydrates, and other metabolites. Among them, 491 metabolites were significantly altered, including 242 upregulated and 249 downregulated metabolites (Fig. \u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e\n \u003cp\u003eThe differential metabolites were mainly enriched in amino acid metabolism, xenobiotic biodegradation, carbohydrate and nucleotide metabolism, lipid metabolism, secondary metabolite biosynthesis, and cofactor/vitamin metabolism. Amino acid metabolism was one of the most active metabolic pathways in the current samples (Fig. \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e\n \u003cp\u003eLipid metabolism is central to \u003cem\u003eC. albicans\u003c/em\u003e cell-membrane homeostasis(Table \u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Lipid classes such as ergosterol (a classical antifungal drug target), sphingolipids, glycerolipids, and phospholipids are essential for membrane fluidity, lipid homeostasis/lipotoxicity \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e, signal transduction, energy metabolism, growth and reproduction, pathogenicity, and drug resistance \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.(Fig. \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). The accumulation of lipid metabolic products suggests that matrine affects cell-membrane and cell-wall stability, a conclusion supported by the TEM observations.\u003c/p\u003e\n \u003cp\u003eFigure \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003e. Untargeted metabolomic analysis(A: Permutation test plot of the PLS-DA model for group comparison (treated vs. negative control)(Blue dots represent results from 1,000 random permutations; the red line represents the regression line of permuted data; the red solid circle indicates the original model. R2Y\u0026thinsp;=\u0026thinsp;0.98; Q2 intercept = -0.08; P\u0026thinsp;\u0026lt;\u0026thinsp;0.001); B: Volcano plot of differential metabolite analysis(A, volcano plot; B, number of metabolites; C, metabolic pathway classification); C: Overall metabolite classification; D: Heat map of read counts)\u0026nbsp;\u003c/p\u003e\n \u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eMetabolic pathway enrichment analysis\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eKEGG pathway\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eNumber of metabolites\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003eRich factor\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eBiosynthesis of secondary metabolites\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e7.13E-05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.0155\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eBiosynthesis of amino acids\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e6.20E-09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.0859\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eABC transporters\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1.62E-06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.0652\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eD-Amino acid metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1.26E-06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.1014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003eArginine and proline metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1.26E-06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\n \u003cp\u003e0.1014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n \u003ch2\u003eReal-time fluorescence PCR validation based on Bio-Rad CFX 96\u003c/h2\u003e\n \u003cp\u003eTo assess consistency between omics findings and gene expression, differential genes were validated by qRT-PCR, and 2^-\u0026Delta;\u0026Delta;CT values across samples were visualized using clustered heat maps. Data were standardized using Z-scores to represent relative expression levels. Validation focused on pathways related to oxidative stress response and protection, peroxisomes and peroxisomal membrane components, MAPK signaling, steroid biosynthesis, cell-cycle regulation, deoxyribonucleotide biosynthesis, fungal ribosome biosynthesis, metabolism, antioxidant/reductive reactions, fatty acid, carbohydrate, and energy metabolism, and amino acid biosynthesis. The expression levels of HAC1, SOD1, GPX3, and CTT1 were elevated, indicating oxidative stress in Candida cells after matrine treatment and supporting the ROS assay results. Matrine also inhibited the expression/activity of CHT1 chitin synthase and FKS2 \u0026beta;-1,3-D-glucan synthase, and decreased CLN1 expression, consistent with cell-cycle arrest in the G0/G1 and G2/M phases (Fig. \u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eS. flavescens\u003c/em\u003e is a traditional Chinese medicine used for conditions such as dysentery, hematochezia, jaundice, urinary retention, leukorrhea, genital swelling and itching, eczema, sores, pruritus, boils, tinea, leprosy, and external treatment of trichomonas vaginitis. Matrine, one of its main active compounds, is also present in several traditional Chinese medicine formulations and may contribute important synergistic effects. However, its antifungal mechanism has not been fully clarified. In this study, nonlinear regression indicated that the IC\u003csub\u003e50\u003c/sub\u003e of matrine against \u003cem\u003eC. albicans\u003c/em\u003e was 57.79\u0026ndash;535.60 \u0026micro;g/mL and the IC\u003csub\u003e90\u003c/sub\u003e was 128-1,024 \u0026micro;g/mL. These values differed from the previously reported IC\u003csub\u003e50\u003c/sub\u003e of 3.125 \u0026micro;g/mL \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e, which may be related to differences in strains, media, assay conditions, or calculation methods.\u003c/p\u003e \u003cp\u003eThe effects of matrine on \u003cem\u003eC. albicans\u003c/em\u003e viability were evaluated using Annexin V-FITC/PI staining and BD flow cytometry. FlowJo analysis showed significant differences compared with the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, P\u0026thinsp;=\u0026thinsp;0.0001, and P\u0026thinsp;=\u0026thinsp;0.0002), supporting the antifungal activity of matrine.\u003c/p\u003e \u003cp\u003eTEM observations showed that matrine-treated cells exhibited membrane separation, incomplete cell-wall structures, and occasional cell-wall rupture and dissolution. The extent of structural damage increased with increasing matrine concentration. Pathogenic fungi such as \u003cem\u003eC. albicans\u003c/em\u003e can undergo apoptosis-like cell death in response to adverse stimuli \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Necrosis and apoptosis represent important forms of cell death, characterized by cell swelling, loss of plasma membrane integrity, leakage of cellular contents, disruption of ion gradients, or genetically regulated programmed cell death. Our results are consistent with these processes.\u003c/p\u003e \u003cp\u003eDCFH-DA staining showed that intracellular ROS levels in \u003cem\u003eC. albicans\u003c/em\u003e increased with matrine concentration. Statistical analysis showed that the ROS-positive proportion in the 2,048 \u0026micro;g/mL group increased approximately fourfold compared with the untreated group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Increased ROS production was accompanied by reduced fungal growth and suppressed hyphal formation. ROS, as a second messenger, plays an important role in apoptosis and necrosis \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Under physiological conditions, ROS participates in energy metabolism and cell proliferation; however, excessive ROS accumulation disrupts the oxidative-antioxidative balance, damages macromolecules such as DNA and proteins, and promotes programmed cell death \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. High ROS levels may also impair mitochondria and reduce mitochondrial membrane potential, an early indicator of apoptosis \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Similar findings have been reported for TTS-12, a compound extracted from \u003cem\u003eTribulus terrestris\u003c/em\u003e, which induces \u003cem\u003eC. albicans\u003c/em\u003e apoptosis by increasing intracellular ROS levels \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExcessive ROS can attack membrane lipids and generate lipid radicals. These highly reactive lipid peroxidation products may amplify damage through peroxisomal metabolic pathways, fatty acid oxidation, and acetyl-CoA transferase-associated metabolism. Therefore, matrine may broadly impair the cytoplasmic membrane system, plasma membrane components, extracellular region, extracellular vesicles, cell surface, and fungal cell-wall biosynthesis. Such chain reactions can damage the plasma membrane and may ultimately lead to cell death \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTranscriptomic, metabolomic, and qRT-PCR analyses confirmed increased expression of HAC1, SOD1, and GPX3, supporting the occurrence of oxidative stress in Candida cells after matrine treatment. This result is consistent with the ROS assay. HAC1 is a transcription factor associated with endoplasmic reticulum stress, whereas GPX3 encodes a glutathione peroxidase that helps reduce H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e to H\u003csub\u003e2\u003c/sub\u003eO and O\u003csub\u003e2\u003c/sub\u003e through the glutathione (GSH) system and contributes to antioxidant defense.\u003c/p\u003e \u003cp\u003eSOD1 encodes superoxide dismutase, a key enzyme involved in scavenging superoxide anions. CTT1 encodes peroxisomal catalase, which helps prevent intracellular lipid peroxidation, limits organic peroxide formation, and protects cells from oxidative lipid damage. The upregulation of HAC1, SOD1, GPX3, and CTT1 after matrine treatment suggests activation of an oxidative-stress defense response and indicates that ROS-mediated injury may be an important contributor to the antifungal activity of matrine.\u003c/p\u003e \u003cp\u003eFAA21, an acyl-CoA synthetase, participates in lipid synthesis and fatty acid oxidation. In lipid metabolism, FAA21 regulates acyl-CoA pool partitioning by activating medium- and long-chain fatty acids, promoting peroxisomal oxidative energy production, and reducing intracellular free fatty acid accumulation to maintain membrane lipid homeostasis and energy balance. During oxidative stress, FAA21 may enhance antioxidant capacity by decreasing lipotoxic ROS generation, supporting NADPH-dependent GSH recycling, and stabilizing membrane lipid fluidity. Conversely, loss of FAA21 function can cause fatty acid accumulation, mitochondrial dysfunction, ROS bursts, membrane damage, and cell death. In \u003cem\u003eC. albicans\u003c/em\u003e, FAA21 activity is related to growth, biofilm formation, adhesion/invasion, virulence, and susceptibility to antifungal agents \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGlutathione reductase GLR1 is mainly localized in mitochondria and reduces oxidized glutathione (GSSG) to reduced glutathione (GSH) in an NADPH-dependent manner, thereby maintaining glutathione homeostasis. PEX11 encodes a peroxisomal membrane protein involved in peroxisome division, fusion, and abundance regulation; it also participates in fatty acid oxidation and antioxidant defense, contributing to ROS clearance and redox balance. The decreased expression of GLR1 and PEX11 suggests impairment of the antioxidant defense system \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eUnder matrine treatment, increased ROS production, reduced ROS-scavenging capacity, and disrupted redox homeostasis may cause extensive endomembrane and cell-wall damage, potentially activating the yeast MAPK cascade. The MAPK signaling pathway participates in Candida cell-wall damage repair, osmotic stress homeostasis, nutrient-stress responses, expression of cell-wall-related genes, maintenance of cell-wall integrity, actin cytoskeleton organization, targeted vesicle secretion to growth sites, β-glucan synthesis, spore formation, pseudohyphal growth, and cell-cycle regulation. This pathway is therefore important for signal transduction and apoptosis-related responses in \u003cem\u003eC. albicans\u003c/em\u003e. In the canonical cascade, multiple receptors activate BCK1 through phosphorylation; BCK1 then activates Mkk1/2, which further phosphorylates MPK1. Activated MPK1 enters the nucleus to regulate transcription factors such as RLM1, thereby controlling DNA transcription and influencing cell-wall integrity and remodeling, including processes related to FKS2-encoded β-glucan synthesis.\u003c/p\u003e \u003cp\u003eFKS2 encodes a catalytic subunit involved in the biosynthesis of major cell-wall glucans, including β-1,3-glucan and β-1,6-glucan, which account for approximately 50%-60% of the cell wall \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. These components are essential for maintaining cell integrity and for cell-wall remodeling, bud-tip polarized growth, and cytoplasmic development during budding. The Candida cell wall is a layered structure that accounts for 20%-30% of the dry cell weight and supports cell shape, osmotic pressure, material exchange, nutrition, proliferation, and budding reproduction. The outer layer mainly consists of highly glycosylated mannoproteins, whereas the inner layer contains glucan polymers, chitin, and small amounts of transmembrane proteins. Glucan and chitin account for most of the inner wall mass, and β-1,3-glucan chains with β-1,6-linked branches constitute a major part of this structure \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eChitin is a major component of cell-wall-anchored proteins and is also associated with the cytoplasmic membrane system. Previous studies suggest that chitin contributes to vesicle secretion, budding growth, and membrane development in Candida \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e, whereas chitin deficiency can cause septum formation defects and even growth arrest \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Reduced synthesis of chitin and β-1,3-D-glucan may alter fungal osmotic pressure and lead to cell-wall rupture or cell death. In this study, the activity/expression of chitin synthases CHT1 and CHS2 was significantly inhibited.\u003c/p\u003e \u003cp\u003eTEM results showed that 20 h of matrine treatment caused varying degrees of cell-wall rupture and structural deficiency, indicating that matrine impaired the structure and function of the fungal cell wall, disrupted cell-wall integrity, or inhibited cell-wall synthesis. These observations were supported by RNA-seq and qRT-PCR results.\u003c/p\u003e \u003cp\u003eThrough this pathway, PKC1, β-1,3-glucan synthase (HGT12/GS), BNI1 and SKN7 transcription factors, the GTP-Rho-binding vesicle subunit SEC3, FKS2, and chitin synthases CHT1 and CHS2 jointly participate in glucan/chitin synthesis and cell-wall repair (Fig.\u0026nbsp;16). These genes are important markers of cell-wall biogenesis \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn summary, this study demonstrates that matrine exerts antifungal effects against \u003cem\u003eC. albicans\u003c/em\u003e through the oxidative stress-MAPK-metabolism axis. The proposed mechanism involves inhibition of chitin synthase-related processes (CHT1), impairment of cell-wall/membrane development and hyphal growth, and disruption of cell-wall repair through modulation of FKS2-associated β-1,3-glucan synthesis. These findings provide a mechanistic basis for further investigation of matrine as a potential therapeutic strategy for candidiasis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003e1.The following financial interests/personal relationships considered as potential competing interests① This study was supported by the Funding of Applied Basic Research Foundation of Yunnan Province (CN) (NO.202501AT070487)② This study was supported by the Joint Fund of Yunnan University of Traditional Chinese Medicine and the First Affiliated Hospital (NO.XYLH202009)③ This study was supported by the Applied Basic Research Foundation of Yunnan Province (NO.XYLH202301AZO70001-144)④ This study was Suppored by the Joint Found of Yunnan University of Traditional Chinese Medicine and the First Affiliated Hospital (NO.XYLH202215)⑤ The drugs, or supplies was provided by China Food and Drug Inspection Institute (Beijing). ⑥ Equipment for drug validation was supported by the Experimental Research Center of Yunnan Provincial Hospital of Traditional Chinese Medicine⑦ This study statistical analysis was provided by Wuhan China University. ⑧ Huang Churong reports a relationship with Yunnan College of Business Management that includes: non-financial support. 2.CRediT authorship contribution statement Liu Xiaomin: Writing \u0026ndash; original draft, review \u0026amp; editing, Methodology, Data curation, Conceptualization. Huang Churong: Writing \u0026ndash; original draft, Writing \u0026ndash; review, Data curation.Li Huanqing: Methodology, Data curation. Bai Yali: Methodology、Data curation. Tang Qin: Writing \u0026ndash; review, Conceptualization, Supervision. Lin Yun: Methodology, Conceptualization, Supervision. Yin Zhiping: Supervision\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDonnelly JP, Chen SC, the Mycoses Study Group Education and Research Consortium [J]. Revision and Update of the Consensus Definitions of Invasive Fungal Disease From the European Organization for Research and Treatment of Cancer and. Clin Infect Dis. 2020;71(6):1367\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cid/ciz1008.\u003c/span\u003e\u003cspan address=\"10.1093/cid/ciz1008.\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e . PMID: 31802125; PMCID: PMC7486838.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Yuan'er. China Pharmacopoeia 2010 (Part I) Concise Manual of Chemical Composition Analysis [M]. Sun Yat-sen University; 2010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Jiaokui Z. Ruixian. Research on the Shen Nong Ben Cao Jing [M]. Beijing: Science and Technology; 2001.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao Hongjing. Collected Annotations on the Classic of Materia Medica [J]. Qunlian Publishing House; 1955.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXi Y, Guanghuan S, Linlin C, et al. Synthesis and Activity of Berberine Derivatives: A Review of Recent Advances [J]. Synthesis Chem. 2024;32(4):381\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJUANES M, SARAGI R T, ENR\u0026iacute;QUEZ L, et al. Molecular rotation spectrum of tetracyclic quinolizidines: observation of trans-matrine and the elusive cisn-matrine [J]. J Org Chem. 2021;86(2):1861\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Zhongwei L, Jieying H, Liang, et al. Study on the Effects and Mechanisms of Berberine on the Proliferation, Apoptosis, and Migration of Lung Cancer Cells A549 [J]. J Youjiang Minzu Med Coll. 2024;46(01):13\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Linjin X, Yingyu C. The cell cycle regulation mechanism of oxalicine regulating the CDK4/cyclinD1 pathway to induce apoptosis in prostate cancer PC-3 cells [J]. China J Gerontol. 2024;44(02):490\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJianjun J. Qiu Wenkui. The pro-apoptotic mechanism of oxalicine via mitochondrial autophagy mediated by COX-2/PINK1/Parkin signaling pathway in MG63 osteosarcoma cells [J]. China Pharm. 2024;35(01):44\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Lu Y, Wen P, Yuan Y, Xiao Z, Shi H, Feng E. Matrine restrains the development of colorectal cancer through regulating the AGRN/Wnt/β-catenin pathway [J]. Environ Toxicol. 2023;38(4):809\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/tox.23730.\u003c/span\u003e\u003cspan address=\"10.1002/tox.23730.\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e . Epub 2023 Jan 9. PMID: 36620879.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHua GS, Tao F, Yuanyuan L et al. Study on the In Vitro Antifungal Activity of Theobromine [J]. New Traditional Chinese Medicine and Clinical Pharmacology, 2011,22(4):382\u0026ndash;385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Xueyun Z, Boguang JY. The Antibacterial Activity and Synergistic Effects of Sophorine and Oxidized Sophorine [J]. J Nanjing Forestry Univ (Natural Sci Edition), 2008, (02):79\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertout S, Dunyach, Drakulovski P, et al. Comparison of the Sensititre YeastOne dilution method with the Clinical Laboratory Standards Institute (CLSI) M27-A3 microbroth dilution reference method for determining MIC of eight antifungal agents on 102 yeast strains [J]. Pathol Biol (Paris). 2011;59(1):48\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.patbio.2010.07.020\u003c/span\u003e\u003cspan address=\"10.1016/j.patbio.2010.07.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis J. Glycerolipid homeostasis in Candida albicans, its role in virulence, and the potential for lipotoxicity as an anti-biofilm therapeutic [D]. Kent Acad Repos. 2025;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13140/RG.2.2.14272.18352\u003c/span\u003e\u003cspan address=\"10.13140/RG.2.2.14272.18352\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnonymous. Kinase mediated regulation of lipid metabolism and the crosstalk with drug tolerance mechanisms in Candida albicans [J]. J Med Sci Sports Pharm. 2020;245\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3844/jmssp.2020.245.252\u003c/span\u003e\u003cspan address=\"10.3844/jmssp.2020.245.252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarbe E, Gerwien F, Driesch D, M\u0026uuml;ller T, B\u0026ouml;ttcher B, Gr\u0026auml;ler M, Vylkova S. Systematic Metabolic Profiling Identifies De Novo Sphingolipid Synthesis as Hypha Associated and Essential for Candida albicans Filamentation [J]. mBio. 2022;13(6):e02255\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mbio.02255-22\u003c/span\u003e\u003cspan address=\"10.1128/mbio.02255-22\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadeo F, Herker E, Wissing S, Jungwirth H, Eisenberg T, Fr\u0026ouml;hlich KU. Apoptosis in yeast [J]. Curr Opin Microbiol. 2004;7(6):655\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, Yi, Ning Yumei. Modern Research Progress on the Apoptosis Mechanism of Candida albicans [J]. Western J Traditional Chin Med. 2012;25(1):4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRinnerthaler M, B\u0026uuml;ttner S, Laun P, et al. Yno1p/Aim14p, a NADPH-oxidase ortholog,controls extramitochondrial reactive oxygen species generation, apoptosis, and actin cable formation in yeast [J]. Proc Natl Acad Sci USA. 2019;109(22):8658\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLitemburg-Apers DC, Willems PH, Koopman WJ, et al. Interactions between mitochondrial reactive oxygen species and cellular glucose metabolism [J]. Arch Toxicol. 2015;89:1209\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrooks MM, Neelam S, Fudala R, et al. Lenticular mitoprotection. Part A: Monitoring mitochondrial depolarization with JC-1 and artifactual fluorescence by the glycogen synthase kinase-3 β inhibitor [J]. Mol Vis. 2019;19:1406\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Shan Y, Ying. Jiang Yuan Ying. Effects of Natural Compound TTS-12 on Apoptosis of Candida albicans Cells [J]. Armed Police Med J. 2011;22(1):27\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRinnerthaler M, B\u0026uuml;ttner S, Laun P, et al. Yno1p/Aim14p, a NADPH-oxidase ortholog,controls extramitochondrial reactive oxygen species generation, apoptosis, and actin cable formation in yeast 24. [J]. Proc Natl Acad Sci USA. 2019;109(22):8658\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamiryo T, Mishina M, Tashiro SI, Numa S. Candida lipolytica mutants defective in an acyl-coenzyme A synthetase: isolation and fatty acid metabolism [J]. Proc Natl Acad Sci USA. 1977;74(11):4947\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Leiro A, Cerd\u0026aacute;n ME, Gonz\u0026aacute;lez-Siso MI. A functional analysis of Kluyveromyces lactis glutathione reductase [J]. Yeast. 2010;27(7):431\u0026thinsp;\u0026ndash;\u0026thinsp;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/yea.1760\u003c/span\u003e\u003cspan address=\"10.1002/yea.1760\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 20148387.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGow NA, Hube B. Candida albicans cell wall glycobiology and virulence [J]. Nat Rev Microbiol. 2012;10(2):112\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Min C, Yun S. Isolation, purification, and analysis of alkali-soluble β-glucan from the cell wall of Candida albicans [J]. Chin J Dermatology. 2000;33(5):311\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayor S, Riezman H. Sorting GPI-anchored proteins [J]. Nat Rev Mol Cell Biol. 2004;5(2):110\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrm1309\u003c/span\u003e\u003cspan address=\"10.1038/nrm1309\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevin DE. 2005. Cell Wall Integrity Signaling in Saccharomyces cerevisiae [J]. Microbiol Mol Biol Rev 69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaggini S. Independent regulation of chitin synthase and chitinase activity in Candida albicans and Saccharomyces cerevisiae[J]. Microbiology. 2004;150(4):921\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/mic.0.26661-0\u003c/span\u003e\u003cspan address=\"10.1099/mic.0.26661-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWINTER MUNROCA, BUCHAN K, HENRY A, BECKER K, BROWN JM, BULAWA CE AJP. Chs1 of Candida albicans is an essential chitin synthase required for synthesis of the septum and for cell integrity[J]. Mol Microbiol. 2004;39(5):1414\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Drogen F, Dard N, Pelet S, Lee SS, Mishra R, Srejić N, Peter M. Crosstalk and spatiotemporal regulation between stress-induced MAP kinase pathways and pheromone signaling in budding yeast [J]. Cell Cycle. 2020;19(14):1707\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFonzi WA. The protein secretory pathway of Candida albicans [J]. Mycoses. 2009;52(4):291\u0026ndash;303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1439-0507.2008.01673\u003c/span\u003e\u003cspan address=\"10.1111/j.1439-0507.2008.01673\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. xIF: 3.1 Q2. Epub 2009 Jan 21. PMID: 19207839.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBishop A, Lane R, Beniston R, Chapa-y-Lazo B, Smythe C, Sudbery P. Hyphal growth in Candida albicans requires the phosphorylation of Sec2 by the Cdc28-Ccn1/Hgc1 kinase [J]. EMBO J. 2010;29(17):2930\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/emboj.2010.158.\u003c/span\u003e\u003cspan address=\"10.1038/emboj.2010.158.\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e . Epub 2010 Jul 16. PMID: 20639857; PMCID: PMC2944046.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Traditional Chinese medicine, Sophora flavescens, matrine, Candida albicans, oxidative stress, MAPK, metabolomics","lastPublishedDoi":"10.21203/rs.3.rs-9667972/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9667972/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eAim of the study\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMatrine is a major alkaloid component of the traditional Chinese medicinal plant \u003cem\u003eSophora flavescens\u003c/em\u003e. Although it has been reported to inhibit fungal growth in vitro, its underlying mechanisms of action and potential molecular targets in \u003cem\u003eCandida albicans\u003c/em\u003e remain largely unclear. This study aimed to elucidate the antifungal mechanisms of matrine against \u003cem\u003eC. albicans\u003c/em\u003e using flow cytometry, transcriptomics, and untargeted metabolomics, thereby providing a theoretical basis for further mechanistic and translational research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ΔOD values were measured with a microplate reader, and the half-maximal inhibitory concentrations (IC\u003csub\u003e50\u003c/sub\u003e) values were calculated by nonlinear regression. The inhibitory effects of matrine were evaluated through time-kill assays, Annexin V-FITC/PI staining, DCFH-DA staining for reactive oxygen species (ROS), cell-cycle analysis, transmission electron microscopy (TEM), and fluorescence-activated cell sorting (FACS). RNA-seq and untargeted metabolomics were employed to explore the underlying antifungal mechanisms, and key pathways and differentially expressed genes were further validated by quantitative real-time PCR (qRT-PCR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNonlinear fitting showed IC\u003csub\u003e50 \u003c/sub\u003evalues of 57.79-535.60 μg/mL (P = 0.0407), indicating a significant concentration-dependent inhibition. Annexin V-FITC/PI assays showed significant differences in apoptosis between the control and matrine-treated groups at concentrations of 128, 256, and 512 μg/mL (all P \u0026lt; 0.05). TEM demonstrated dose-dependent ultrastructural injuries, including cytoplasmic separation, compromised cell-wall architecture, and severe cell-wall disruption and dissolution at concentrations of 512 and 1,024 μg/mL. RNA-seq identified 2,894 differentially expressed genes, including 1,145 upregulated and 1,749 downregulated genes. The upregulation of genes encoding oxidative-stress-related enzymes (\u003cem\u003eGPX3\u003c/em\u003e, \u003cem\u003eSOD1\u003c/em\u003e, and \u003cem\u003eCTT1\u003c/em\u003e) and the unfolded protein response-related transcription factor \u003cem\u003eHAC1\u003c/em\u003e, coupled with marked alterations in lipid metabolites, strongly suggested that matrine induced profound oxidative stress. Mechanistically, matrine-induced endomembrane injury and lipotoxicity were linked to the dysregulation of genes involved in cell-wall and membrane biosynthesis, including \u003cem\u003eCHT1\u003c/em\u003e and \u003cem\u003eFKS2\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study demonstrates that matrine exerts potent antifungal effects against \u003cem\u003eC. albicans\u003c/em\u003e through an oxidative stress-MAPK-metabolism axis. The proposed mechanism involves the accumulation of ROS, disruption of lipid and redox homeostasis, inhibition of chitin synthase-related cell-wall remodeling (\u003cem\u003eCHT1\u003c/em\u003e), and modulation of β-1,3-glucan synthase activity (\u003cem\u003eFKS2\u003c/em\u003e). These cascading effects lead to impaired cell-wall integrity, disrupted polarized growth, and suppressed hyphal development, providing a mechanistic basis for further development of matrine as a candidate antifungal agent for candidiasis.\u003c/p\u003e","manuscriptTitle":"Matrine Exerts Antifungal and Antibiofilm Effects on Candida albicans via the Oxidative Stress-MAPK-Metabolism Axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-12 10:16:58","doi":"10.21203/rs.3.rs-9667972/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8828dcc4-fa7b-4fb3-a3dc-0d9c34193a92","owner":[],"postedDate":"May 12th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Rejected","date":"2026-05-15T06:37:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-11T08:53:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Chinese Medicine","date":"2026-05-10T06:26:03+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-15T06:55:38+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-12 10:16:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9667972","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9667972","identity":"rs-9667972","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.