Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 64,751 characters · extracted from preprint-html · click to expand
Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development | medRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-P4HH5NV'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development View ORCID Profile Adrian Romero , Alejandra Davilavaladez , Alexandria T. M. Blackburn , Amisheila Kinua , Yogesh Srivastava , D. Gareth Evans , Elizabeth K. Bancroft , Rosalind A. Eeles , Mark E. Corkins , View ORCID Profile Rachel K. Miller doi: https://doi.org/10.1101/2025.08.29.25333303 Adrian Romero 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Adrian Romero Alejandra Davilavaladez 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA 2 The University of Texas MD Anderson Cancer Center UTHealth Houston Graduate School of Biomedical Sciences, Program in Genetics and Epigenetics , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alexandria T. M. Blackburn 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA 2 The University of Texas MD Anderson Cancer Center UTHealth Houston Graduate School of Biomedical Sciences, Program in Genetics and Epigenetics , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Amisheila Kinua 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA 3 Program in Biochemistry and Cell Biology, Rice University , Houston, Texas 77251, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yogesh Srivastava 4 Department of Genetics, University of Texas MD Anderson Cancer Center , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site D. Gareth Evans 6 Genomic Medicine, Manchester Academic Health Sciences Centre, Division of Evolution, Infection and Genomic Science, University of Manchester, Manchester University Hospitals NHS Foundation Trust , Manchester, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Elizabeth K. Bancroft 7 The Oncogenetics Research Team, The Royal Marsden NHS Foundation Trust , London, UK 8 The Oncogenetics Research Team, The Institute of Cancer Research , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rosalind A. Eeles 8 The Oncogenetics Research Team, The Institute of Cancer Research , London, UK 7 The Oncogenetics Research Team, The Royal Marsden NHS Foundation Trust , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mark E. Corkins 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rachel K. Miller 1 Department of Pediatrics, Pediatric Research Center, UTHealth McGovern Medical School , Houston, TX 77030, USA 2 The University of Texas MD Anderson Cancer Center UTHealth Houston Graduate School of Biomedical Sciences, Program in Genetics and Epigenetics , Houston, TX 77030, USA 4 Department of Genetics, University of Texas MD Anderson Cancer Center , Houston, TX 77030, USA 5 The University of Texas MD Anderson Cancer Center UTHealth Houston Graduate School of Biomedical Sciences, Program in Molecular and Translational Biology , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Rachel K. Miller For correspondence: Rachel.K.Miller{at}uth.tmc.edu Abstract Full Text Info/History Metrics Supplementary material Data/Code Preview PDF Abstract Li-Fraumeni Syndrome (LFS) is a rare autosomal dominant disorder that increases the risk of various types of cancer. It is primarily caused by inherited mutations in the TP53 gene. While the tumor suppressor function of p53 is well established, its role in embryonic development, particularly in the formation of the kidney and urinary tract, remains poorly understood. Moreover, its contribution to human congenital anomalies has not been clearly defined. Here, we report that pathogenic TP53 variants can lead to congenital anomalies of the kidney and urinary tract (CAKUT), as well as genital defects (GD), in individuals with LFS. Among 28 unrelated TP53 mutation carriers, 28% (8/28) exhibited CAKUT and/or GD, with a higher frequency observed in individuals carrying structurally disruptive or dominant-negative mutations. We focused on two clinically observed variants: R242W, which destabilizes protein structure, and R282W, a dominant-negative hotspot mutation. AlphaFold modeling showed that both variants cluster within the DNA-binding domain and are predicted to disrupt tetramer formation. In Xenopus laevis, tp53 is expressed in developing nephric structures, consistent with findings from mouse models of nephrogenesis. Expression of either mutant TP53 mRNA in Xenopus embryos disrupted kidney morphogenesis in vivo , supporting a developmental loss-of-function effect. These findings indicate that pathogenic TP53 variants contribute to renal and urogenital defects in LFS. They reveal a previously unrecognized developmental role for p53 and expand the phenotypic spectrum associated with this cancer predisposition syndrome. Introduction The tumor suppressor gene TP53 , encoding the p53 protein, is widely recognized as the “guardian of the genome” for its critical role in maintaining genomic stability ( Lane, 1992 , Marei et al., 2021 ). As a transcription factor, p53 induces genes involved in DNA repair, cell cycle arrest, and apoptosis in response to cellular stress ( Kuerbitz et al., 1992 , Smith et al., 1994 , Miyashita and Reed, 1995 , el-Deiry et al., 1993 ). Because p53 functions as a tetramer, many TP53 mutations can exhibit dominant-negative effects, often leading to early-onset cancer predisposition syndromes called Li-Fraumeni syndrome (LFS) ( Monti et al., 2011 , Friedman et al., 1993 , Gaglia et al., 2013 ). Beyond its well-known tumor-suppressive role, p53 also plays essential, yet often overlooked, functions in embryonic development and organogenesis ( Saifudeen et al., 2009 ). Although p53-null mice are viable, they develop tumors early in life ( Donehower et al., 1992 ), and certain genetic backgrounds reveal developmental defects, including neural tube closure abnormalities and craniofacial malformations ( Armstrong et al., 1995 , Rinon et al., 2011 ). Additionally, a subset of p53-deficient mice displays growth retardation or subtle developmental anomalies involving the palate, eyes, teeth, lungs, or kidneys ( Kaufman et al., 1997 , Saifudeen et al., 2009 , Baatout et al., 2002 ). Notably, renal hypoplasia and duplex ureters have been observed in p53-deficient mice, implicating p53 in nephrogenesis ( Saifudeen et al., 2002 , Saifudeen et al., 2009 ). Conditional deletion of Trp53 in nephron progenitor cells results in the loss of cap mesenchyme, a key population required for nephron formation ( Li et al., 2015 ). Complementary studies in Xenopus laevis show that dominant-negative p53 overexpression leads to pronephric loss, further supporting p53’s conserved role in kidney development ( Wallingford et al., 1997 ). Mice expressing a stabilized, transcriptionally inactive Trp53 variant show embryonic lethality and multiple congenital malformations, including craniofacial, ocular, and cardiac anomalies ( Van Nostrand et al., 2014 ). On the other hand, overexpression of overactive p53 also causes tissue-specific developmental defects. These phenotypes are likely due to inappropriate activation of p53-mediated apoptosis or proliferation arrest during critical stages of organogenesis ( Bowen and Attardi, 2019 ). While p53 has been implicated in kidney development in animal models, its contribution to congenital anomalies of the kidney and urinary tract (CAKUT) in humans has not been directly demonstrated. In this study, we investigated the potential developmental role of TP53 variants identified in LFS patients presenting with CAKUT and/or GD abnormalities. We used Xenopus laevis , a well-established model for studying pronephric kidney development, due to its accessible embryos, rapid kidney organogenesis, and structural and molecular similarity to the mammalian nephron ( Blackburn and Miller, 2019 , Zhou and Vize, 2004 , Corkins et al., 2023 ). Using unilateral microinjection approaches, we examined the effects of two patient-derived TP53 variants on kidney development. Our findings demonstrate that both variants disrupt pronephric morphogenesis in Xenopus and are associated with CAKUT in human patients, providing evidence that p53 is essential for kidney development. Materials and methods Study participants and data analysis Human TP53 mutation carriers as part of the SIGNIFY study ( Saya et al., 2017 ) were scanned with Diffusion-Weighted (DW) whole body MRI from November 2012 through July 201. Individuals carrying known low-penetrance TP53 mutations (as determined by a clinical geneticist) or variants of uncertain significance were excluded, as were those with a malignancy diagnosed within the previous five years, except for non-melanoma skin cancer or cervical carcinoma in situ (CIS). For this paper, an additional sub-study involving 44 patients was conducted to examine renal morphology and function, with data collected on renal function, body mass index (BMI), and blood pressure. However, only 28 patients were included in the substudy assessing blood pressure and glomerular filtration rate (GFR). This component was added later to the protocol. Participants who lived locally were recalled for these follow-up measurements; for others, participation was not feasible due to logistical constraints. Consequently, inclusion in this substudy was determined solely by the feasibility of returning for additional evaluation, without any selection or prioritization based on clinical characteristics. The research was approved by the Health Research Authority NRES Committee London—Brent (12/LO/0781). TP53 Testing and Sequencing The entire TP53 coding region (exons 2–11) was analyzed by direct sequencing, with a reported sensitivity of >98%. Negative results do not exclude somatic or germline mosaicism. Deletions and duplications were assessed using Multiplex Ligation-dependent Probe Amplification (MLPA, MRC-Holland kit P056). Single exon deletions/duplications were confirmed by sequencing and/or dosage-sensitive WAWE analysis. Mutation nomenclature follows Human Genome Variation Society (HGVS) guidelines, with numbering based on the A of the ATG start codon (reference sequence: GenBank NM_000546 ). Sequencing was performed using the Illumina TruSight Cancer Panel, analyzed via GAMA and SIGMA bioinformatic pipelines. The full coding sequence and intron-exon boundaries were screened for small variants. Pathogenic and rare variants were confirmed by bidirectional Sanger sequencing. MRIs MRI examinations were performed at The Royal Marsden NHS Foundation Trust or Central Manchester University Hospitals NHS Foundation Trust using a 1.5 T MRI machine (Siemens, Erlangen, Germany) from vertex to feet using conventional MR imaging sequences (T1-weighted, with or without fat suppressed T2-weighted/STIR sequences), as well as diffusion weighted images. Slices were 0.8 cm thick and scans were not contrast enhanced. Scans were read independently by two radiologists with at least 5 years’ experience, who were blinded to the mutation status of the study participants. Ten percent of scans, selected randomly, were cross-read at both centres for quality assurance. Data sheets were completed for each participant to collate clinical data, including blood pressure, BMI and renal function. Xenopus laevis embryos and microinjections Xenopus eggs were obtained using standard procedures, incubated in 0.3x MMR, and fertilized in vitro ( Sive et al., 2012 ). Blastula cleavage stages and dorsal-ventral polarity were identified using established methods ( Nieuwkoop and Faber, 1994 ). Microinjections were specifically targeted to the V2 blastomere at the eight-cell stage, as this lineage significantly contributes to pronephros development ( Nieuwkoop and Faber, 1994 , DeLay et al., 2016 , Moody and Kline, 1990 ). For the overexpression of wild-type human TP53 (p53 WT) and its mutants ( TP53 R248W or TP53 R282W ), a mixture containing 50 pg of TP53 mRNA and 300 pg of membrane-RFP mRNA ( Davidson et al., 2006 ) was injected as a lineage tracer to confirm the targeted blastomere. As a control, 50 pg of β-galactosidase mRNA was co-injected with the tracer. Details on experimental design and statistical analysis are provided in Supplementary Information (Table S1). All procedures were approved by the UTHealth Center for Laboratory Animal Medicine Animal Welfare Committee (IACUC protocol #: AWC-22-0082). Whole-mount in situ hybridization A digoxigenin-11-UTP-labeled antisense RNA probe for tp53 was synthesized by in vitro transcription using T7 RNA polymerase. The DNA template was generated through PCR amplification from plasmid 415-AP, obtained from the European Xenopus Resource Centre (EXRC) (XB-CLONE-12440929) ( Wallingford et al., 1997 ). This clone contains the Xenopus laevis coding sequence for tp53 . The primers used to generate the template are forward CTAGCTAATACGACTCACTATAGGGCTCTGGGGTCTCGAGGGTGA and reverse CCCACCGTCACTTCATGTGC. The embryos were staged, fixed, and stained according to standard procedures ( Nieuwkoop and Faber, 1994 , Sive et al., 2012 ) using an anti-digoxigenin antibody (1:3000, Sigma 11093274910, St. Louis, MO, USA) and BM Purple (Sigma 11442074001). Hybridization Chain Reaction (HCR) For in situ Hybridization Chain Reaction (HCR) on whole Xenopus laevis embryos, staging and fixation were performed according to standard protocols ( Nieuwkoop and Faber, 1994 , Sive et al., 2012 ), followed by a modified in situ HCR protocol based on ( Choi et al., 2018 , Schock et al., 2024 ). Hybridization probes for lhx1 and atp1a1 were designed and synthesized by Molecular Instruments Inc. ( https://www.molecularinstruments.com/ ), which also provided the probe hybridization buffer, probe wash buffer, amplification buffers, and DNA HCR amplifier hairpin sets. The HCR probe for tp53 was designed using a probe maker tool developed by Ryan Null ( Kuehn et al., 2022 ) and executed via Anaconda Navigator (2023-07-1) and JupyterLab (3.0.10). Five embryos were collected in Wheaton vials (4 mL) and fixed in 4% formaldehyde in 1× MEMFA (MOPS, EGTA, MgSO 4 ) for 60 min at room temperature (RT) on a rotator. After fixation, embryos were washed three times (5 min each) with PBST, followed by three washes (5 min each) with 100% methanol, and permeabilized overnight at − 20°C in 100% methanol. The next day, embryos were rehydrated through sequential 5-min washes in 75% methanol/25% PBST, 50% methanol/50% PBST, and 25% methanol/75% PBST, followed by two washes in 100% PBST (5 min each). Embryos were then washed twice in 0.1 M triethanolamine (5 min each). Acetylation was performed by sequential 5-min incubations in 0.1 M triethanolamine containing 0.25% acetic anhydride, followed by 0.5% acetic anhydride. After two additional PBST washes (5 min each), embryos were refixed in MEMFA for 20 min at RT on a rotator and then washed five times in PBST (5 min each). Embryos were incubated in preheated (37°C) wash buffer (500 μL) for 5 min, then transferred to hybridization buffer (500 μL) at 37°C for 30 min. The buffer was replaced with probe solution (8 nM probe diluted in hybridization buffer), and embryos were incubated overnight (12–16 hrs) at 37°C. After hybridization, embryos were washed four times (15 min each) in probe wash buffer at 37°C. For amplification, embryos were incubated in 500 μL of amplification buffer for 30 min at RT, then transferred to an amplification solution containing fluorescently tagged hairpin pairs (h1 and h2). Hairpins were preheated to 95°C, incubated for 30 min at RT in the dark, diluted in amplification buffer (final concentration: 48 nM), and added to the embryos for overnight incubation (12–16 hrs) at RT in the dark. The following day, embryos were sequentially washed in 5× SSCT (two 5-min washes, one 30-min wash), followed by a 30-min wash in 5× SSCT containing DAPI. After three PBST washes (5 min each) in the dark and three PBS washes (5 min each) in the dark. Embryos were preserved in PBS for immediate imaging or in methanol for long-term storage and imaging. Western blot Ten Xenopus embryos were collected at various stages to prepare protein lysates as previously described ( Kim et al., 2002 ). One embryo equivalent of lysate was loaded per well on a 10% SDS-PAGE gel. Proteins were transferred to 0.45 μm nitrocellulose membranes and blocked for 1 hour at room temperature in KPL block (SeraCare) at 4°C. Membranes were incubated overnight at 4°C with primary antibodies: mouse anti-p53 (1:1000, Abcam ab16465), mouse anti-Flag (1:1000, Sigma M2), or rabbit anti-GAPDH (1:1000, Santa Cruz). After washing with TBS-T, membranes were incubated for 1 hour at room temperature with goat anti-rabbit or goat anti-mouse IgG horseradish peroxidase-conjugated secondary antibody (1:3000; Bio-Rad). Following further washing with TBS-T, blots were imaged using the Bio-Rad ChemiDoc XRS+ system and SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific). Imaging Embryos used for in situ hybridization were imaged on a Zeiss AxioZoom V16 with a 1x objective, Zeiss 512 color camera (Zeiss, Oberkochen, Germany), and extended depth of focus processing. Embryos used for HCR were scored and photographed using a Zeiss LSM800 confocal microscope (Zeiss, Oberkochen, Germany). HCR-stained embryos were dehydrated in 100% methanol and cleared in BABB/Murray’s 1:2 (volume of benzyl alcohol to benzyl benzoate) solution for 10 min. Embryos were mounted on cover glasses and imaged using an LSM800 inverted confocal microscope. Image processing, including maximum intensity projection of z-stacks and contrast adjustments, was performed using Imaris software. AlphaFold analysis The DNA sequence used for modeling the p53 tetramer binding site was adopted from ( McLure and Lee, 1998 ). AlphaFold 3 was used for structural modeling of the p53-DNA complex (for clear visualization of binding, DNA extended from both ends by adding 7 A-T nucleotides), which enabled precise prediction of the interactions between the DNA-binding domain and the p53 tetrameric interface. The AMBER ff14SB force field for proteins and AMBER Bsc0 force field for nucleic acids were used to energy minimize for the final models. R248Q and R282W mutations were introduced by in silico site-directed mutagenesis using the swapaa command in order to examine the structural impact of mutations linked to cancer. With a step size of 0.02 Å, a two-stage procedure including 1,000 steps of the steepest descent method and 500 steps of the conjugate gradient algorithm was used to minimize energy. UCSF ChimeraX was used for distance measurements and molecular visualization. The stability of the tetrameric interface, residue interactions with DNA, and possible steric conflicts brought on by mutations were all evaluated structurally. The sequences used for AlphaFold analysis were downloaded from the NIH GenBank repository: NM_000546 _6 Homo sapiens tumor protein p53 (TP53), transcript variant 1, mRNA. Results CAKUT/GD has been identified in patients with TP53 variants, most of which are loss-of-function mutations located in the DNA-binding domain (DBD) of p53 A total of 88 participants were recruited from 37 families ( Table 1 ), including 44 carriers of pathogenic TP53 variants and 44 matched healthy population controls. Among the carriers, 18 participants had a prior cancer diagnosis, and 6 of these individuals had experienced multiple primary tumors. During the study period, 6 carriers were diagnosed with a malignancy, 4 of which were detected directly through whole-body MRI screening. No cancers were identified in the control group. View this table: View inline View popup Download powerpoint Table 1: Characteristics of the cases and controls with previous malignant tumours MRI data revealed that a cohort of Li-Fraumeni patients from 19 to 58 years of age exhibited a higher prevalence of CAKUT relative to the control group. CAKUT manifested itself in kidney hypoplasia, complete agenesis of the kidneys and reproductive tract, renal cysts, benign kidney tumors, ovarian cysts, and reduced glomerular filtration rates ( Table 1 ). 57 % (16/28) of the patients exhibited either structural urogenital anomalies and/or abnormal glomerular filtration rates (GFRs) below 90 mL/min/1.73 m 4 (normal range: 90–120 mL/min/1.73 m 4 ) ( Table 2 ). Of the 57% of patients with p53 variants who exhibit genitourinary (GU) abnormalities, eight present with structural defects observable by MRI. Several patients have notable anomalies such as simple renal cysts, renal angiomyolipoma, a large adenoma, and complex cysts. These findings highlight a spectrum of kidney defects, ranging from mild to clinically significant, supporting a critical role for p53 in GU development. Additionally, eight patients without obvious structural anomalies exhibit a glomerular filtration rate (GFR) below 90, suggesting impaired kidney function despite a normal anatomy ( Table 2 ). View this table: View inline View popup Download powerpoint Table 2. Demographics and molecular data of patients with TP53 SNVs and small indels (<10bp) View this table: View inline View popup Download powerpoint Table 3. Available information on Genitourinary (GU) phenotype and GFR < 90 of LFS patients reported in this study. We categorized the variants identified in this cohort based on their genetic mutation type. Six variants contain nonsense mutations leading to premature stop codons and are predicted to result in protein truncation ( Lindeboom et al., 2016 ). Six variants are associated with splicing defects, and one involves a deletion spanning exon 11 within the regulatory domain ( Fig. 1 ). Fifteen are missense variants, all occurring within the DNA-binding domain (DBD; residues 94–292). Many variants associated with kidney phenotypes are located within the DNA-binding domain (DBD). Interestingly, the variants linked to cancer-related phenotypes (IDs 7, 10, 11, 19, and 21) also affect this domain. All these mutations impact the DBD, suggesting that they likely disrupt the structural stability of p53. Download figure Open in new tab Fig. 1: Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) Associated with TP53 Variants in Li-Fraumeni Syndrome. The schematic illustrates the domain structure of the p53 protein, highlighting patient-specific TP53 variants. Patient variants are labeled by patient numbers as listed in Table 1 . Variants are color-coded as follows: red indicates CAKUT-associated variants; orange marks variants found in patients with low glomerular filtration rate (GFR); orange with a red outline highlights CAKUT-associated variants also associated with low GFR; and blue denotes variants not linked to CAKUT or impaired kidney function. Different shapes indicate the type of variant: a square represents deletion, circles denote missense variants, stars indicate nonsense variants, and triangles mark splice variants. These shapes are positioned according to the affected amino acid sequence. Numbers above the p53 model correspond to amino acid positions, while numbers below indicate exon numbers. Dotted lines represent splice sites. Patients with Li-Fraumeni syndrome exhibit mutations across various p53 domains, including the Trans-Activation Domain (TAD), Proline-Rich Domain (PRD), DNA-Binding Domain (DBD), Nuclear Localization Signal (NLS), Tetramerization Domain (TD), and Regulatory Domain (RD), but not the nuclear export signal (NES). Notably, p53 mutations associated with urogenital anomalies detected by MRI are localized within the DBD. Of the patients with kidney abnormalities, we selected two distinct human TP53 variants (identified in patient IDs 21 and 24) for functional modeling in Xenopus laevis . These mutations, TP53 R248W and TP53 R282W , result in missense mutations in the p53 DNA-binding domain and are suspected to exert a dominant-negative effect. Previous studies have indicated that overexpression of a dominant-negative form of TP53 in Xenopus results in the loss of kidney tubules ( Wallingford et al., 1997 ). The TP53 R248W mutation has been previously characterized, and structural studies of the human p53 core domain revealed that this mutation disrupts DNA binding by eliminating key contacts with the DNA minor groove ( Cho et al., 1994 ). In our studies, the individual carrying this mutation presented with a large kidney cyst measuring 6.8 cm in diameter. The second mutation, TP53 R282W , is novel to this study. Based on its location in the DNA-binding domain and the patient’s clinical features, we hypothesize that it also functions through a similar dominant-negative mechanism. The patient with this mutation exhibited a complex kidney cyst measuring 3.4 cm in diameter, along with additional kidney lesions. We used AlphaFold to predict structural changes in those variants. p53 functions as a tetramer to bind DNA, and mutant p53 can interact with wild-type p53, inhibiting its function or disrupting DNA binding. The Arginine (Arg =R)-Tryptophan (Trp=W) mutation significantly alters the physicochemical properties of the residue, impacting protein stability and function ( Fig. 2A ). In the structural prediction, the interaction between guanine/cytosine nucleotides and arginine, hydrophilic and positively charged, is crucial for p53-DNA binding and stabilizes the complex, particularly in the minor groove ( Fig. 2B ). In contrast, tryptophan is a large, non-polar amino acid that lacks the necessary positive charge, leading to steric hindrance and localized destabilization of the protein. Consequently, the Arg-to-Trp mutation reduces p53’s DNA-binding affinity and disrupts structural integrity ( Fig. 2B ). Consistent with previous studies, we show that the TP53 R248W variant directly affects residues involved in DNA interaction, impairing p53’s ability to bind target gene promoters without significantly altering its overall structure ( Roszkowska et al., 2022 ). On the other hand, the variant residue R282 stabilizes the p53 DNA-binding domain by interacting with neighboring residues such as F134, L130, S127, and Q286 ( Fig. 2C ). Although it does not directly contact DNA, these interactions are critical for maintaining the protein’s structural integrity. The TP53 R282W mutation introduces a bulky tryptophan side chain, causing steric clashes that disrupt this stabilizing network, potentially destabilizing the β-sheet and α-helix interface ( Fig. 2C ). Download figure Open in new tab Fig. 2. Structural modeling of the p53–DNA complex and effects of p53 R248W and R282W variants. (A) The tetrameric full-length wild-type p53 bound to DNA (center, top). Left: Close-up of residue R248 forming hydrogen bonds with DNA bases (2.9 Å and 4.3 Å). Right: Residue R282 supports structural stability through interactions with neighboring residues (F134, L130, S127, and Q286) but does not directly contact DNA. (B) The tetrameric p53 containing the R248W and R282W mutations bound to DNA (center, bottom). Left: The R248W mutation disrupts hydrogen bonding, increasing distances (6.6–8.1 Å) and likely reducing DNA-binding affinity; the R248 site in the minor groove shows loss of contact. Right: The R282W mutation introduces steric clashes that disrupt the stabilizing network of interactions, potentially destabilizing the β-sheet/α-helix interface of the DNA-binding domain. tp53 is expressed during Xenopus development and in the early and late stages of kidney formation To model human patient data, we used Xenopus laevis embryos as a model. To determine if the X. laevis tp53 gene is homologous to the human, we analyzed the sequence similarity between human and Xenopus laevis (Supplementary Information S2). We find that the DNA-binding domain (DBD) is heavily conserved, with 67.34% of the amino acids being identical (Percent Identity Matrix in CLUSTAL O(1.2.4)). As described before, this domain is particularly relevant, as it harbors approximately 80% of TP53 mutations ( Fig. 1 ) ( Bouaoun et al., 2016 , Levine, 2019 ). To assess endogenous tp53 expression in the Xenopus kidney, in situ hybridization utilizing DIG-labeled probes, alkaline phosphatase, and NBT/BCIP was performed at four developmental stages (NF 18, 25, 30, and 40) (Supplementary Information S1A). At stage 18, strong p53 expression was detected in neuronal structures, including the neural plate, and was widely distributed around the intermediate mesoderm. By stages 25 and 40, tp53 transcripts were present in the brain, neural tube, head, eyes, and somites (Supplementary Information S1A). During pronephros specification in the early neurula stage (stage 18), tp53 transcripts were weakly detected but showed a notable reduction by stage 25. However, transcript levels increased again at stage 30, suggesting a potential role in the early epithelialization and differentiation of the pronephros. By stage 40, when the kidney is fully functional and completely epithelialized, tp53 transcripts were clearly detected in the Xenopus kidney (Supplementary Information S1A). To better visualize tp53 transcript distribution during kidney development, we employed Hybridization Chain Reaction (HCR) in whole-mount Xenopus embryos. This technique uses nucleotide probes that hybridize to target mRNA. The pair of probes contains two initiator sequences that trigger a chain reaction with hairpin molecules (h1 and h2) tagged with fluorescent markers, allowing simultaneous detection of multiple transcripts ( Choi et al., 2018 ). tp53 transcripts are shown in pink, with lhx1 and atp1a1 probes used as markers for nephron progenitors and epithelial kidney tubules, respectively ( Fig. 3 ). Across all stages (18–40, Fig. 3a–f ), tp53 transcripts were highly expressed in neuronal structures, including brain precursors, head, and facial structures. From stages 18–25, tp53 expression was also detected in the neural crest and neural tube but showed no clear expression in nephron progenitors ( Fig. 3a’’–c’’ ). However, at stages 18 and 22 ( Fig. 3a’’ and b’’ ), tp53 exhibited a localized pattern around nephron progenitors, suggesting an early role in surrounding cells, possibly in an undifferentiated stage. By stage 25, tp53 transcripts were no longer detected in the developing kidney or showed only a weak or highly specific signal in kidney progenitors ( Fig. 3c’’ ). At stage 30, tp53 expression gradually increased, marking a distinct structure around the pronephros ( Fig. 3d and d’’ ). This increase continued, peaking at stage 35, coinciding with tubulogenesis and epithelialization ( Fig. 3e ). At this stage, tp53 mRNA levels were markedly elevated in and around the pronephros, with the highest intensity observed in regions surrounding kidney tubules, as marked by atp1a1 ( Fig. 3e and e’’ ). Atp1a1 is a transporter whose transcript is specifically expressed in epithelial cells of the functional nephron ( Fig. 3e ’). By stage 40, tp53 expression was evident inside and around the pronephros ( Fig. 3f ), with a magnified view suggesting partial colocalization of tp53 transcripts with kidney markers, reinforcing its potential role in nephron maturation ( Fig. 3f and f’’ ). tp53 transcript expression is shown throughout the stage 40 tadpole ( Fig. 3g ). To confirm probe specificity, we performed a negative control by omitting amplifier H2. As expected, using only H1 did not produce any signal, confirming that in situ HCR detection of tp53 mRNA is specific ( Fig. 3h ). Download figure Open in new tab Fig. 3. Hybridization Chain Reaction (HCR) whole mount analysis of tp53 expression during kidney development in X. laevis . To examine the spatial–temporal expression of tp53 mRNA in the kidney, HCR was performed using probes designed against X. laevis to target both L and S tp53 homologous sequences. Pronephric kidney development occurs between stages 12.5 and 40, with nephron progenitor compaction already visible in the neurula stage (stage 18), as indicated by lhx1 expression (yellow, a-f and a’’-d’’). At stages 18 and 22, p53 transcripts (pink) are detected around, but not within, nephron progenitors (a-b and a’’-b’’). By stage 30, p53 expression increases in specific cells inside and around the differentiating pronephros (d and d’’). However, tp53 expression is most prominent at stages 35 and 40, coinciding with epithelialization, as marked by atp1a1 expression (a-f and a’’-f’’). At stage 40, tp53 is highly expressed both inside and around the differentiated pronephric kidney, with areas of colocalization between tp53 and atp1a1 transcripts appearing as white and gray signals (f). A magnified view of the epithelial tubules reveals clear tp53 expression within kidney tubules (f’ and f’’). Panel a-e show kidneys at stages 18-35 (same 150 µm scale bar). Global tp53 transcript expression in a stage 40 X. laevis embryo. Abundant tp53 expression is observed in tissues including the facial region, brain, otic vesicle, branchial arches, and kidney. The control, where the harpin H2 was omitted, shows no tp53 expression, confirming specificity. Each panel (a-e) includes a magnified view of the kidney region (yellow, a’-e’) and tp53 expression to the right (pink a’’-e’’). Scale bars: 50 µm (a’-f’ and a’’-f’’) and 100 µm (stage 40, f). Western blot analysis on whole embryo lysates confirmed p53 protein expression throughout the stages of kidney development, showing a marked increase after stage 30 (tailbud) and peaking at stages 35 and 40 (Supplementary Information S1B). The p53 Western blot consistently displays two bands. The lower band runs at the size seen for other organisms, but it is unclear whether the upper band is a modified protein or nonspecific binding (Supplementary Information S1B). Missense TP53 variants R248W and R248W from Li-Fraumeni patients lead to abnormal kidney development in Xenopus Site-directed mutagenesis was used to introduce mutations, and mRNA for TP53 R248W , TP53 R282W , and wild-type human TP53 was synthesized. All constructs contained two FLAG epitopes. Western blot analysis with TP53- and FLAG-specific antibodies confirmed the successful expression of the proteins derived from wild-type TP53, TP53 R248W , and TP53 R282W transcripts in Xenopus embryos ( Fig. 4F ). Notably, TP53 R282W exhibited lower expression levels than wild-type TP53 and TP53 R248W ( Fig. 4 ), likely due to reduced protein stability resulting from impaired conformational integrity. To evaluate the functional impact of these mutations, we injected wild-type TP53, TP53 R248W , or TP53 R282W mRNA into the V2 blastomere of 8-cell Xenopus embryos to target a single kidney. A subphenotypic dose of wild-type TP53 was established to prevent aberrant kidney development, as high p53 levels have been previously shown to induce defects ( Hoever et al., 1994 ). Injection of 300 pg of TP53 R248W or TP53 R282W mRNA significantly reduced kidney tubule formation ( Fig. 4C and D ), whereas wild-type TP53 had no such effect ( Fig. 4B ), indicating a dominant negative effect of the patient variants on nephric tubule formation. Download figure Open in new tab Fig. 4: Mutant Human TP53 Impairs Kidney Development in Xenopus Embryos. (A–D) Xenopus embryos were unilaterally injected at the 8-cell stage with 300 pg of β -galactosidase ( β -gal) , wild-type human TP53, TP53 R248W , or TP53 R282W mRNA. At stage 40, tadpoles were stained with kidney-specific antibodies: 3G8 (proximal tubules) and 4A6 (distal and connecting tubules). Panels without apostrophes (A–D) depict the injected side, whereas corresponding panels with apostrophes (A’–D’) show the uninjected side. Overexpression of mutant p53 (C–D) disrupted kidney development, whereas wild-type p53 (B) had no effect. β-gal (A) served as a negative control. Scale bars represent 100 μm. (E) Quantification reveals a significant reduction in kidney tubule formation in embryos injected with TP53 R248W or TP53 R282W mRNA compared to those injected with wild-type p53. Kidney phenotypes were assessed at Nieuwkoop and Faber stage 40 ( Nieuwkoop and Faber, 1994 ). A normal kidney exhibits three proximal branches connected to a central trunk (showed with numbers in A), leading to the convoluted early distal region and strong immunostaining in the late distal region. A weak phenotype is characterized by the loss of one proximal branch, reduced early distal looping, and/or partial loss of late distal immunostaining. A moderate phenotype involves the loss of two proximal branches, moderate reduction in early distal looping, and potential late distal immunostaining loss. A severe phenotype is defined by the complete absence of proximal tubules, along with severe or total loss of early distal looping and late distal structures. Phenotypes examples for this nomenclature were published by ( Blackburn et al., 2019 ). Statistical significance was assessed using a two-tailed t -test, with weak (yellow bar), moderate (orange bar), and severe (red bar) kidney phenotypes. Double asterisks (**) denote p < 0.007, and triple asterisks (***) denote p < 0.0006. Error bars represent the standard error. (F) Single-cell Xenopus embryos were injected with 1 ng of wild-type, R248W, or R282W human TP53 mRNA alongside a membrane RFP tracer. Western blot analysis confirmed successful translation of wild-type and mutant TP53 mRNA in Xenopus embryos. Notably, the R282W mutant exhibited lower expression levels compared to wild-type TP53 and the R248W mutant, suggesting reduced protein stability. β-gal was used as a negative control. The R248W (C742T) and R282W (C844T) point mutations were introduced via site-directed mutagenesis using a wild-type human pcDNA3-FLAG-p53 vector. GAPDH served as a loading control, and molecular weight markers are indicated on the left side of the blot. Discussion Our findings contribute to a growing body of evidence implicating TP53 mutations, particularly those with dominant-negative properties, in congenital anomalies of the kidney and urinary tract (CAKUT) within the context of Li-Fraumeni syndrome (LFS). Although p53 is classically characterized as a tumor suppressor, accumulating data now indicate its broader involvement in embryonic development, including roles in nephrogenesis and organ patterning ( Li et al., 2015 , Saifudeen et al., 2009 ). This study uncovers overlooked developmental roles of p53 mutations and expands the phenotypic spectrum of Li-Fraumeni syndrome to include urogenital anomalies. The identification of CAKUT, including kidney hypoplasia, renal agenesis, and/or reduced glomerular filtration rates in approximately one-third of LFS patients, suggests a non-random association between p53 dysfunction and renal developmental defects. The prevalence of impaired renal function (GFR <90) in nearly half of the cohort further supports a physiologically relevant role for p53 in renal morphogenesis. Importantly, our functional experiments in Xenopus laevis confirmed that the overexpression of two human TP53 variants, identified in LFS patients, causes the developmental disruptions in nephrogenesis similar to those observed with p53 loss ( Saifudeen et al., 2002 , Saifudeen et al., 2009 ), implicating both loss-of-function and/or dominant-negative mechanisms. Notably, specific hotspot mutations R248W and R282W are strongly associated with kidney phenotypes in the patient cohort of this study. These mutations occur in the highly conserved DNA-binding domain of p53 and have distinct structural and functional consequences. R248W, a DNA-interaction mutation, has previously been shown to aberrantly activate oncogenic pathways, including STAT3 signaling ( Klemke et al., 2021 , Schulz-Heddergott et al., 2018 ). Its correlation with kidney phenotypes in both human patients and Xenopus laevis model suggests that this variant may interfere with p53’s transcriptional regulation of developmental genes. Similarly, R282W destabilizes the DBD by perturbing the loop-sheet-helix motif, potentially leading to protein misfolding and compromised DNA-binding ( Joerger et al., 2006 ). These mechanistic insights suggest that certain p53 mutations may selectively disrupt developmental pathways independently of their tumor-suppressive roles, though further studies are needed to clarify this. The evolutionary conservation of p53 across vertebrates and non-vertebrates underscores its critical role beyond cancer biology ( Brandt et al., 2009 , Armstrong et al., 1995 ). The observation that Xenopus (a non-amniote) develops kidney abnormalities upon expression of human TP53 mutants underscores the conserved, evolutionary critical role of p53 in organogenesis. Our results highlight further consideration of the wider developmental consequences of p53 dysfunction. While p53 activity is tightly regulated to prevent inappropriate apoptosis or senescence during embryogenesis ( Molchadsky et al., 2010 ), our data suggest that aberrant p53 signaling can disrupt organ development. This is particularly relevant in LFS, where germline TP53 mutations may predispose individuals not only to malignancy but also to developmental abnormalities, including CAKUT. In conclusion, this study provides novel evidence that p53 plays a vital role in renal development and that specific TP53 variants associated with LFS can contribute to CAKUT. These findings open new avenues for exploring p53’s developmental functions and underscore the importance of considering non-oncogenic phenotypes in patients with germline TP53 mutations. Future studies should focus on identifying downstream p53 targets involved in nephrogenesis and delineating the molecular pathways disrupted by specific p53 variants during embryonic development. Data Availability All data produced in the present work are contained in the manuscript. Disclosure of Interests Professor Rosalind Eeles has the following conflicts of interest to declare: Honoraria from GU-ASCO, Janssen, University of Chicago, Dana Farber Cancer Institute USA as a speaker. Educational honorarium from Bayer and Ipsen, member of external expert committee to Astra Zeneca UK and Member of Active Surveillance Movember Committee. She is a member of the SAB of Our Future Health. She undertakes private practice as a sole trader at The Royal Marsden NHS Foundation Trust and 90 Sloane Street SW1X 9PQ and 280 Kings Road SW3 4NX, London, UK. Acknowledgements We sincerely thank the patients and their families for their participation in this study. The SIGNIFY study was funded by The Annabel Evens Memorial Fund and supported by the National Institute for Health and Care Research (NIHR) to the Biomedical Research Centre at The Royal Marsden NHS Foundation Trust and Institute of Cancer Research. We are grateful to the faculty and staff of the Royal Marsden NHS Foundation Trust, London, UK and Central Manchester University Hospitals NHS Foundation Trust, Manchester, UK for their contributions. We acknowledge the SIGNIFY Study Steering Committee: Prof Anwar Padhani, Paul Strickland Scanner Centre, Mount Vernon Cancer Centre; Prof Leslie Walker, University of Hull; Dr Gillian Mitchell, Familial Cancer Centre, Peter MacCallum Cancer Centre and Sir Peter MacCallum Department of Oncology, University of Melbourne; Dr Gek Kwan-Lim, The Institute of Cancer Research and The Royal Marsden NHS Foundation Trust; Susan Eastbrook, patient representative; Dr Peter Simmonds, Cancer Sciences Academic Unit and University of Southampton Clinical Trials Unit, Faculty of Medicine, University of Southampton and University Hospital Southampton Foundation Trust; Dr Frank Saran, The Royal Marsden NHS Foundation Trust. We also appreciate the helpful input from members of the laboratories of Drs. Rachel K. Miller and Rosalind A. Eeles. We thank the instructors and teaching assistants of the Cold Spring Harbor Laboratory’s Cell & Developmental Biology of Xenopus : Gene Discovery & Disease Course for advanced research training, particularly Drs. Lance A. Davidson and Chenbei Chang, who directed the course in 2022-2024. Particular thanks to Dr. Carole LaBonne and Andrew Montequin for their assistance with the HCR protocol. This work was supported by the NIDDK (R01DK115655 to R.K.M.), and Xenopus studies were funded by K01DK092320 and R03DK118771 (to R.K.M.), as well as startup funds from the Department of Pediatrics, Pediatric Research Center, McGovern Medical School. We thank members of the Miller and McCrea labs, and Dr. M. Kloc, for their valuable suggestions. Special thanks to Dr. T.H. Gomez for animal care. Confocal imaging was supported by the UTHealth Office of the Executive Vice President and Chief Academic Officer and the Department of Pediatrics Microscopy Core through the Zeiss LSM800 confocal microscope. References ↵ Armstrong , J. F. , Kaufman , M. H. , Harrison , D. J. & Clarke , A. R. 1995 . High-frequency developmental abnormalities in p53-deficient mice . Curr Biol , 5 , 931 – 6 . OpenUrl CrossRef PubMed Web of Science ↵ Baatout , S. , Jacquet , P. , Michaux , A. , Buset , J. , Vankerkom , J. , Derradji , H. , Yan , J. , Von Suchodoletz , H. , De Saint-Georges , L. , Desaintes , C. & Mergeay , M. 2002 . Developmental abnormalities induced by X-irradiation in p53 deficient mice . In Vivo , 16 , 215 – 21 . OpenUrl PubMed ↵ Blackburn , A. T. M. , Bekheirnia , N. , Uma , V. C. , Corkins , M. E. , Xu , Y. , Rosenfeld , J. A. , Bainbridge , M. N. , Yang , Y. , Liu , P. , Madan-Khetarpal , S. , Delgado , M. R. , Hudgins , L. , Krantz , I. , Rodriguez-BURITICA , D. , Wheeler , P. G. , Al-Gazali , L. , Mohamed Saeed Mohamed Al Shamsi , A. , Gomez-Ospina , N. , Chao , H. T. , Mirzaa , G. M. , Scheuerle , A. E. , Kukolich , M. K. , Scaglia , F. , Eng , C. , Willsey , H. R. , Braun , M. C. , Lamb , D. J. , Miller , R. K. & Bekheirnia , M. R. 2019 . DYRK1A-related intellectual disability: a syndrome associated with congenital anomalies of the kidney and urinary tract . Genet Med , 21 , 2755 – 2764 . OpenUrl CrossRef PubMed ↵ Blackburn , A. T. M. & Miller , R. K. 2019 . Modeling congenital kidney diseases in Xenopus laevis . Dis Model Mech , 12 . ↵ Bouaoun , L. , Sonkin , D. , Ardin , M. , Hollstein , M. , Byrnes , G. , Zavadil , J. & Olivier , M. 2016 . TP53 Variations in Human Cancers: New Lessons from the IARC TP53 Database and Genomics Data . Hum Mutat , 37 , 865 – 76 . OpenUrl CrossRef PubMed ↵ Bowen , M. E. & Attardi , L. D. 2019 . The role of p53 in developmental syndromes . J Mol Cell Biol , 11 , 200 – 211 . OpenUrl CrossRef PubMed ↵ Brandt , T. , Petrovich , M. , Joerger , A. C. & Veprintsev , D. B. 2009 . Conservation of DNA-binding specificity and oligomerisation properties within the p53 family . BMC Genomics , 10 , 628 . OpenUrl CrossRef PubMed ↵ Cho , Y. , Gorina , S. , Jeffrey , P. D. & Pavletich , N. P. 1994 . Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations . Science , 265 , 346 – 55 . OpenUrl Abstract / FREE Full Text ↵ Choi , H. M. T. , Schwarzkopf , M. , Fornace , M. E. , Acharya , A. , Artavanis , G. , Stegmaier , J. , Cunha , A. & Pierce , N. A. 2018 . Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust . Development , 145 . ↵ Corkins , M. E. , Achieng , M. , Delay , B. D. , Krneta-Stankic , V. , Cain , M. P. , Walker , B. L. , Chen , J. , Lindstrom , N. O. & Miller , R. K. 2023 . A comparative study of cellular diversity between the Xenopus pronephric and mouse metanephric nephron . Kidney Int , 103 , 77 – 86 . OpenUrl CrossRef PubMed ↵ Davidson , L. A. , Marsden , M. , Keller , R. & Desimone , D. W. 2006 . Integrin alpha5beta1 and fibronectin regulate polarized cell protrusions required for Xenopus convergence and extension . Curr Biol , 16 , 833 – 44 . OpenUrl CrossRef PubMed ↵ Delay , B. D. , Krneta-STANKIC , V. & Miller , R. K. 2016 . Technique to Target Microinjection to the Developing Xenopus Kidney . J Vis Exp . ↵ Donehower , L. A. , Harvey , M. , Slagle , B. L. , Mcarthur , M. J. , Montgomery , C. A. , Jr. , Butel , J. S. & Bradley , A. 1992 . Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours . Nature , 356 , 215 – 21 . OpenUrl CrossRef PubMed Web of Science ↵ El-DEIRY , W. S. , Tokino , T. , Velculescu , V. E. , Levy , D. B. , Parsons , R. , Trent , J. M. , Lin , D. , Mercer , W. E. , Kinzler , K. W. & Vogelstein , B. 1993 . WAF1, a potential mediator of p53 tumor suppression . Cell , 75 , 817 – 25 . OpenUrl CrossRef PubMed Web of Science ↵ Friedman , P. N. , Chen , X. , Bargonetti , J. & Prives , C. 1993 . The p53 protein is an unusually shaped tetramer that binds directly to DNA . Proc Natl Acad Sci U S A , 90 , 3319 – 23 . OpenUrl Abstract / FREE Full Text ↵ Gaglia , G. , Guan , Y. , Shah , J. V. & Lahav , G. 2013 . Activation and control of p53 tetramerization in individual living cells . Proc Natl Acad Sci U S A , 110 , 15497 – 501 . OpenUrl Abstract / FREE Full Text ↵ Hoever , M. , Clement , J. H. , Wedlich , D. , Montenarh , M. & KnÖCHEL , W. 1994 . Overexpression of wild-type p53 interferes with normal development in Xenopus laevis embryos . Oncogene , 9 , 109 – 20 . OpenUrl PubMed Web of Science ↵ Joerger , A. C. , Ang , H. C. & Fersht , A. R. 2006 . Structural basis for understanding oncogenic p53 mutations and designing rescue drugs . Proc Natl Acad Sci U S A , 103 , 15056 – 61 . OpenUrl Abstract / FREE Full Text ↵ Kaufman , M. H. , Kaufman , D. B. , Brune , R. M. , Stark , M. , Armstrong , J. F. & Clarke , A. R. 1997 . Analysis of fused maxillary incisor dentition in p53-deficient exencephalic mice . J Anat , 191 ( Pt 1 ), 57 – 64 . OpenUrl CrossRef PubMed ↵ Kim , S. W. , Fang , X. , Ji , H. , Paulson , A. F. , Daniel , J. M. , Ciesiolka , M. , Van Roy , F. & Mccrea , P. D. 2002 . Isolation and characterization of XKaiso, a transcriptional repressor that associates with the catenin Xp120(ctn) in Xenopus laevis . J Biol Chem , 277 , 8202 – 8 . OpenUrl Abstract / FREE Full Text ↵ Klemke , L. , Fehlau , C. F. , Winkler , N. , Toboll , F. , Singh , S. K. , Moll , U. M. & Schulz-Heddergott , R. 2021 . The Gain-of-Function p53 R248W Mutant Promotes Migration by STAT3 Deregulation in Human Pancreatic Cancer Cells . Front Oncol , 11 , 642603 . OpenUrl CrossRef PubMed ↵ Kuehn , E. , Clausen , D. S. , Null , R. W. , Metzger , B. M. , Willis , A. D. & Ozpolat , B. D. 2022 . Segment number threshold determines juvenile onset of germline cluster expansion in Platynereis dumerilii . J Exp Zool B Mol Dev Evol , 338 , 225 – 240 . OpenUrl PubMed ↵ Kuerbitz , S. J. , Plunkett , B. S. , Walsh , W. V. & Kastan , M. B. 1992 . Wild-type p53 is a cell cycle checkpoint determinant following irradiation . Proc Natl Acad Sci U S A , 89 , 7491 – 5 . OpenUrl Abstract / FREE Full Text ↵ Lane , D. P. 1992 . Cancer. p53, guardian of the genome . Nature , 358 , 15 – 6 . OpenUrl CrossRef PubMed Web of Science ↵ Levine , A. J. 2019 . Targeting Therapies for the p53 Protein in Cancer Treatments . Annual Review of Cancer Biology , 3 , 21 – 34 . OpenUrl ↵ Li , Y. , Liu , J. , Li , W. , Brown , A. , Baddoo , M. , Li , M. , Carroll , T. , Oxburgh , L. , Feng , Y. & Saifudeen , Z. 2015 . p53 Enables metabolic fitness and self-renewal of nephron progenitor cells . Development , 142 , 1228 – 41 . OpenUrl Abstract / FREE Full Text ↵ Lindeboom , R. G. , Supek , F. & Lehner , B. 2016 . The rules and impact of nonsense-mediated mRNA decay in human cancers . Nat Genet , 48 , 1112 – 8 . OpenUrl CrossRef PubMed ↵ Marei , H. E. , Althani , A. , Afifi , N. , Hasan , A. , Caceci , T. , Pozzoli , G. , Morrione , A. , Giordano , A. & Cenciarelli , C. 2021 . p53 signaling in cancer progression and therapy . Cancer Cell Int , 21 , 703 . OpenUrl CrossRef PubMed ↵ Mclure , K. G. & Lee , P. W. 1998 . How p53 binds DNA as a tetramer . EMBO J , 17 , 3342 – 50 . OpenUrl Abstract / FREE Full Text ↵ Miyashita , T. & Reed , J. C. 1995 . Tumor suppressor p53 is a direct transcriptional activator of the human bax gene . Cell , 80 , 293 – 9 . OpenUrl CrossRef PubMed Web of Science ↵ Molchadsky , A. , Rivlin , N. , Brosh , R. , Rotter , V. & Sarig , R. 2010 . p53 is balancing development, differentiation and de-differentiation to assure cancer prevention . Carcinogenesis , 31 , 1501 – 8 . OpenUrl CrossRef PubMed Web of Science ↵ Monti , P. , Perfumo , C. , Bisio , A. , Ciribilli , Y. , Menichini , P. , Russo , D. , Umbach , D. M. , Resnick , M. A. , Inga , A. & Fronza , G. 2011 . Dominant-negative features of mutant TP53 in germline carriers have limited impact on cancer outcomes . Mol Cancer Res , 9 , 271 – 9 . OpenUrl Abstract / FREE Full Text ↵ Moody , S. A. & Kline , M. J. 1990 . Segregation of fate during cleavage of frog (Xenopus laevis) blastomeres . Anat Embryol (Berl) , 182 , 347 – 62 . OpenUrl CrossRef PubMed ↵ Nieuwkoop , P. D. & Faber , J. 1994 . Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis . ↵ Rinon , A. , Molchadsky , A. , Nathan , E. , Yovel , G. , Rotter , V. , Sarig , R. & Tzahor , E. 2011 . p53 coordinates cranial neural crest cell growth and epithelial-mesenchymal transition/delamination processes . Development , 138 , 1827 – 38 . OpenUrl Abstract / FREE Full Text ↵ Roszkowska , K. A. , Piecuch , A. , Sady , M. , Gajewski , Z. & Flis , S. 2022 . Gain of Function (GOF) Mutant p53 in Cancer-Current Therapeutic Approaches . Int J Mol Sci , 23 . ↵ Saifudeen , Z. , Dipp , S. & El-Dahr , S. S. 2002 . A role for p53 in terminal epithelial cell differentiation . J Clin Invest , 109 , 1021 – 30 . OpenUrl CrossRef PubMed Web of Science ↵ Saifudeen , Z. , Dipp , S. , Stefkova , J. , Yao , X. , Lookabaugh , S. & El-DAHR , S. S. 2009 . p53 regulates metanephric development . J Am Soc Nephrol , 20 , 2328 – 37 . OpenUrl Abstract / FREE Full Text ↵ Saya , S. , Killick , E. , Thomas , S. , Taylor , N. , Bancroft , E. K. , Rothwell , J. , Benafif , S. , Dias , A. , Mikropoulos , C. , Pope , J. , Chamberlain , A. , Gunapala , R. , Committee , S. S. S. , Izatt , L. , Side , L. , Walker , L. , Tomkins , S. , Cook , J. , Barwell , J. , Wiles , V. , Limb , L. , Eccles , D. , Leach , M. O. , Shanley , S. , Gilbert , F. J. , Hanson , H. , Gallagher , D. , Rajashanker , B. , Whitehouse , R. W. , Koh , D. M. , Sohaib , S. A. , Evans , D. G. & Eeles , R. A. 2017 . Baseline results from the UK SIGNIFY study: a whole-body MRI screening study in TP53 mutation carriers and matched controls . Fam Cancer , 16 , 433 – 440 . OpenUrl CrossRef PubMed ↵ Schock , E. N. , York , J. R. , Li , A. P. , Tu , A. Y. & Labonne , C. 2024 . SoxB1 transcription factors are essential for initiating and maintaining neural plate border gene expression . Development , 151 . ↵ Schulz-Heddergott , R. , Stark , N. , Edmunds , S. J. , Li , J. , Conradi , L. C. , Bohnenberger , H. , Ceteci , F. , Greten , F. R. , Dobbelstein , M. & Moll , U. M. 2018 . Therapeutic Ablation of Gain-of-Function Mutant p53 in Colorectal Cancer Inhibits Stat3-Mediated Tumor Growth and Invasion . Cancer Cell , 34 , 298 – 314 e7 . OpenUrl CrossRef PubMed ↵ Sive , H. L. , Grainger , R. M. & Harland , R. M. 2012 . Isolation of DNA from red blood cells in Xenopus . Cold Spring Harb Protoc , 2012 , 129 – 32 . OpenUrl PubMed ↵ Smith , M. L. , Chen , I. T. , Zhan , Q. , Bae , I. , Chen , C. Y. , Gilmer , T. M. , Kastan , M. B. , O’connor , P. M. & Fornace , A. J. , Jr . . 1994 . Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen . Science , 266 , 1376 – 80 . OpenUrl Abstract / FREE Full Text ↵ Van Nostrand , J. L. , Brady , C. A. , Jung , H. , Fuentes , D. R. , Kozak , M. M. , Johnson , T. M. , Lin , C. Y. , Lin , C. J. , Swiderski , D. L. , Vogel , H. , Bernstein , J. A. , Attie-Bitach , T. , Chang , C. P. , Wysocka , J. , Martin , D. M. & Attardi , L. D. 2014 . Inappropriate p53 activation during development induces features of CHARGE syndrome . Nature , 514 , 228 – 32 . OpenUrl CrossRef PubMed ↵ Wallingford , J. B. , Seufert , D. W. , Virta , V. C. & Vize , P. D. 1997 . p53 activity is essential for normal development in Xenopus . Curr Biol , 7 , 747 – 57 . OpenUrl CrossRef PubMed Web of Science ↵ Zhou , X. & Vize , P. D. 2004 . Proximo-distal specialization of epithelial transport processes within the Xenopus pronephric kidney tubules . Dev Biol , 271 , 322 – 38 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted September 03, 2025. Download PDF Supplementary Material Data/Code Email Thank you for your interest in spreading the word about medRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development Message Subject (Your Name) has forwarded a page to you from medRxiv Message Body (Your Name) thought you would like to see this page from the medRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development Adrian Romero , Alejandra Davilavaladez , Alexandria T. M. Blackburn , Amisheila Kinua , Yogesh Srivastava , D. Gareth Evans , Elizabeth K. Bancroft , Rosalind A. Eeles , Mark E. Corkins , Rachel K. Miller medRxiv 2025.08.29.25333303; doi: https://doi.org/10.1101/2025.08.29.25333303 Share This Article: Copy Citation Tools Li-Fraumeni Syndrome-Associated p53 Variants Disrupt Kidney and Urinary Tract Development Adrian Romero , Alejandra Davilavaladez , Alexandria T. M. Blackburn , Amisheila Kinua , Yogesh Srivastava , D. Gareth Evans , Elizabeth K. Bancroft , Rosalind A. Eeles , Mark E. Corkins , Rachel K. Miller medRxiv 2025.08.29.25333303; doi: https://doi.org/10.1101/2025.08.29.25333303 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Nephrology Subject Areas All Articles Addiction Medicine (568) Allergy and Immunology (863) Anesthesia (299) Cardiovascular Medicine (4425) Dentistry and Oral Medicine (443) Dermatology (382) Emergency Medicine (607) Endocrinology (including Diabetes Mellitus and Metabolic Disease) (1507) Epidemiology (15221) Forensic Medicine (30) Gastroenterology (1123) Genetic and Genomic Medicine (6588) Geriatric Medicine (667) Health Economics (997) Health Informatics (4524) Health Policy (1368) Health Systems and Quality Improvement (1612) Hematology (540) HIV/AIDS (1264) Infectious Diseases (except HIV/AIDS) (15910) Intensive Care and Critical Care Medicine (1103) Medical Education (623) Medical Ethics (145) Nephrology (667) Neurology (6588) Nursing (346) Nutrition (998) Obstetrics and Gynecology (1143) Occupational and Environmental Health (956) Oncology (3331) Ophthalmology (970) Orthopedics (369) Otolaryngology (420) Pain Medicine (435) Palliative Medicine (129) Pathology (663) Pediatrics (1690) Pharmacology and Therapeutics (691) Primary Care Research (710) Psychiatry and Clinical Psychology (5440) Public and Global Health (9220) Radiology and Imaging (2195) Rehabilitation Medicine and Physical Therapy (1369) Respiratory Medicine (1196) Rheumatology (593) Sexual and Reproductive Health (710) Sports Medicine (529) Surgery (710) Toxicology (99) Transplantation (289) Urology (265) (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ffd956fcb88593a',t:'MTc3OTQ3MTM5Mw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-19T06:35:33.578913+00:00